# RGD-PIPELINE: ftp-file-extracts # MODULE: strains build Mar 13, 2024 # GENERATED-ON: 2024/11/30 # PURPOSE: information about active rat strains extracted from RGD database # CONTACT: rgd.data@mcw.edu # FORMAT: tab delimited text # NOTES: multiple values in a single column are separated by ';' # as of Oct 15, 2021, new columns were added: CITATION_ID, MRATBN_7.2_CHR, MRATBN_7.2_START_POS, MRATBN_7.2_STOP_POS, MRATBN_7.2_METHOD # as of Feb 08, 2024, column ORIGIN was renamed to ORIGINATION, and new column DESCRIPTION was added RGD_ID STRAIN_SYMBOL FULL_NAME ORIGINATION SOURCE STRAIN_TYPE LAST_KNOWN_STATUS RESEARCH_USE ALLELES ALLELE_RGD_IDS RGSC_3.4_CHR RGSC_3.4_START_POS RGSC_3.4_STOP_POS RGSC_3.4_METHOD RNOR_5.0_CHR RNOR_5.0_START_POS RNOR_5.0_STOP_POS RNOR_5.0_METHOD RNOR_6.0_CHR RNOR_6.0_START_POS RNOR_6.0_STOP_POS RNOR_6.0_METHOD MRATBN_7.2_CHR MRATBN_7.2_START_POS MRATBN_7.2_STOP_POS MRATBN_7.2_METHOD CITATION_ID DESCRIPTION 10000 ACI/N A X C 9935, Irish Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery spontaneous tumors; chronic renal disease; congenital malformations Tnfrsf1a 621237 RRID:RRRC_00142 Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR) 10001 AVN/Orl Ctr de Selection et d'Elev d'Anim de Lab, Orleans, France. inbred Unknown RRID:RGD_10001 10002 BBDP/Rhw inbred Unknown RRID:RGD_10002 S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. 10003 BBDR/Rhw R. H. William Laboratory, University of Washington, Seattle, Washington inbred Unknown RRID:RGD_10003 S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 +/- 53 days of age after the first and 67 +/- 10 days of age after the 9th cycle. 10004 BC/CpbU Central Laboratory Animal Institute of Utrecht University, The Netherlands. inbred Unknown RRID:RGD_10004 Obtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands. 10005 BDIX/Han inbred Unknown RRID:RGD_10005 unknown 10006 BDVII/Cub Charles University, Department of Biology, Prague, inbred Unknown RRID:RGD_10006 Druckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype. 10008 BN/SsNHsd Harlan inbred Unknown RRID:RGD_10008 Obtained by HSD from nucleus colony at NIH 10009 BP/Cub Charles University, Department of Biology, Prague, inbred Unknown RRID:RGD_10009 10010 BUF/Pit Buffalo inbred Unknown RRID:RGD_10010 10011 COP/OlaHsd Harlan inbred Unknown RRID:RGD_10011 These are derived from the original colony which was developed by Dr. W.F. Dunning. 10012 DA/PitN inbred Extinct RRID:RRRC_00154 Unknown 10013 DON/Melb inbred Unknown RRID:RGD_10013 10014 F344/Pit inbred Unknown RRID:RGD_10014 10015 FHH/Eur Erasmus University-Rotterdam inbred Unknown RRID:RGD_10015 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. 10016 GH/Omr Genetically Hypertensive University of Otago Wellcome Med. Res. Inst, New Zealand. inbred Unknown RRID:RGD_10016 This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. 10017 GK/KyoSwe Goto Kakizaki Department of Molecular Medicine, Karolinska Hospital, Stockholm, Sweden inbred Unknown RRID:RGD_10017 Developed from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975). 10018 IS/Kyo ishibashi rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis RRID:RGD_10018 Ishibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978. 10019 LE/Mol Long Evans M & B A/S, Denmark. inbred Unknown RRID:RGD_10019 10020 LEW/Pit Lewis inbred Unknown RRID:RGD_10020 10021 LH/Mav Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_10021 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 10022 LN/Mav Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_10022 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 10023 LOU/CHan Louvain inbred Unknown RRID:RGD_10023 unknown 10024 M520/N NIH Animal Genetic Resource Rat Resource and Research Center inbred Cryopreserved Embryo RRID:RRRC_00168 To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. 10025 MHS/Gib Milan Hypertensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_10025 Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure 10026 MNR/N Maudsely non-reactive NIH Animal Genetic Resource inbred Extinct RRID:RRRC_00174 To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci. 10027 MNRA/N NIH Animal Genetic Resource inbred Unknown RRID:RGD_10027 To Harrington in 1965 at F25 (Harrington 1981). 10028 MNS/Gib Milan Normotensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_10028 Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. 10029 MR/Pit inbred Unknown RRID:RGD_10029 As for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). 10030 NEDH/K Central Institute for Diabetes, Karlsburg, Germany. inbred Unknown RRID:RGD_10030 Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. 10031 NP9 inbred Unknown RRID:RGD_10031 From Wistar 10032 ODU/N Osaka Dental University NIH Animal Genetic Resource inbred Extinct RRID:RRRC_00176 From outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982). 10033 OKA/Wsl Professor Herve Bazin, Universite de Louvain, France inbred Unknown RRID:RGD_10033 10034 OM/Ztm Osborne-Mendel inbred Unknown RRID:RGD_10034 unknown 10035 P5C inbred Unknown RRID:RGD_10035 10036 PVG/Pit inbred Unknown RRID:RGD_10036 10037 SD/Rij Harlan Rijswijk inbred Unknown RRID:RGD_10037 From Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984). 10038 SHR/OlaHsd Spontaneously Hypertensive Rat Harlan Sprague Dawley, Inc. inbred Unknown RRID:RGD_10038 10039 SHRSP/Riv Spontaneously Hypertensive Rat, Stroke Prone inbred Unknown RRID:RGD_10039 10040 SR/Jr Salt Resistant Dr. John P. Rapp, Medical College of Ohio, USA Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00056 Originated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). 10041 SS/Jr Salt Sensitive Dr. John P. Rapp, Medical College of Ohio, USA Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Hmox1 2806 RRID:RRRC_00055 Strain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982) 10042 WAG/RijKyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_10042 Rij > Kyo (1979, F?, GF) 10043 WF/Pit Wistar Furth inbred Unknown RRID:RGD_10043 10044 WIST/Nhg Wistar Gesellschaft f. Strahlen & Umweltforschung, Munich, Germany. inbred Unknown Ugt1a1|Abcd2 3935|69244 RRID:RGD_10044 From outbred Wistar stock in 1967. 10045 WN/N Inbred Wistar; W/N NIH Animal Genetic Resource inbred Unknown RRID:RGD_10045 Heston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15. 10046 WKY/OlaHsd Harlan Sprague Dawley, Inc. inbred Unknown RRID:RGD_10046 10047 WTC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) RRID:RGD_10047 WTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. A missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene (Ohno et al. 2015). 60984 GH inbred Unknown RRID:RGD_60984 University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). 60985 BN BN Charles River Laboratories Charles River Laboratories inbred Unknown Cd36|Tnfrsf1a 2301|621237 RRID:RGD_60985 Billingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b). 60986 BUF/N NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_60986 Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. 60987 MHS/N Milan Hypertensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Extinct Add1|Add2 2041|2042 RRID:RRRC_00169 Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994). 60988 LOU/M inbred Unknown RRID:RGD_60988 Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible. Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978). 60989 BP inbred Unknown RRID:RGD_60989 Strain selected for resistance to Walker 256 tumour. 60990 LH/MavRrrc Lyon Hypertensive Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-02-13) RRID:RRRC_00057 Lyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed, unrestrained, conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 60991 LE Long Evans inbred Unknown RRID:RGD_60991 Dr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984). 60992 MNS Milan normotensive strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_60992 Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974). 60993 FHH Fawn Hooded Hypertensive University of Colorado Health Science Center, Denver, Colorado inbred Unknown RRID:RGD_60993 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. 60994 F344 Fischer NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_60994 Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. 60995 DRY Sankyo Co., Ltd., Tokyo, Japan inbred Unknown RRID:RGD_60995 Recombinant inbred strain used as normotensive control in studies of hypertension. 60996 DON Donryu rat inbred Unknown RRID:RGD_60996 R. Sato 1950 by inbreeding Japanese albino rats. 60997 DA DA inbred Unknown Ednrb|Tnfrsf1a 2536|621237 RRID:RGD_60997 Developed from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case. 60998 COP inbred Unknown RRID:RGD_60998 This Copenhagen (COP) rat was an inbred strain from Curtiss 1921 at Columbia University Institute for Cancer Research. 60999 LEW Lewis Harlan Sprague Dawley Inc. Indianapolis, United States inbred Unknown Fgf2|Tnfrsf1a 2609|621237 RRID:RGD_60999 Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992) 61000 SHR Spontaneously Hypertensive Rat inbred Unknown Agtr1b|Cd36|Ephx2 2071|2301|620732 RRID:RGD_61000 Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648). 61001 NEDH inbred Unknown RRID:RGD_61001 Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. 61002 BDIX inbred Unknown RRID:RGD_61002 Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 61003 BC inbred Unknown RRID:RGD_61003 Hagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973. 61004 WIST/Zihk inbred Unknown RRID:RGD_61004 From Wistar outbred stock in 1978. 61005 OM/N Osborne-Mendel NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_61005 Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). 61006 PVG PVG inbred Unknown RRID:RGD_61006 Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994). 61007 WF Wistar Furth inbred Unknown RRID:RGD_61007 J Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995). 61008 WAG Wistar Albino Glaxo inbred Unknown RRID:RGD_61008 AL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984). 61009 AVN inbred Unknown RRID:RGD_61009 Unknown. Keil University from O Stark, Charles University, Prague. 61010 SHRSP Spontaneously Hypertensive Rat, Stroke Prone Iffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-Buch inbred Unknown RRID:RGD_61010 The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994). 61011 BB/N BioBreeding rat inbred Extinct RRID:RRRC_00144 Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990). 61013 E3 inbred Unknown RRID:RGD_61013 Kroning, Gottingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968. 61014 OLETF Otsuka Long-Evans Tokushima fatty Otsuka Research Institute, Tokushima, Japan inbred Unknown RRID:RGD_61014 Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence' 61015 LN/MavRrrc lyon normotensive Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00058 (taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 61096 SHR/NCruk Spontaneously Hypertensive Rat Charles River Laboratories UK Charles River Laboratories UK inbred Unknown RRID:RGD_61096 NIH derived strain maintained at the Charles River, United Kingdom. 61097 WKY/NCruk Charles River Laboratories UK Charles River Laboratories UK inbred Unknown RRID:RGD_61097 NIH derived strain maintained at the Charles River, United Kingdom. 61098 BXH/Ipcv Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_61098 These recombinant inbred strains are derived from the (BN-Lx/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic 61099 HXB/Ipcv Institute of Physiology, Czech Academy of Sciences, Charles University, Prague recombinant_inbred Unknown RRID:RGD_61099 Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published. 61100 SHR/Ola Czech Academy of Sciences, Prague, Czech Republic inbred Unknown RRID:RGD_61100 Strain originated from an inbred SHR strain from Harlan UK Ltd. 61103 WKY Medical College of Ohio, Toledo, Ohio inbred Unknown Cd36|Nos3 2301|3186 RRID:RGD_61103 This strain was maintained at Medical College of Ohio, Toledo, Ohio 61104 LEW/NCrl Charles River Laboratories USA Charles River Laboratories USA inbred Unknown RRID:RGD_61104 Substrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34. 61105 WKY/NHsd Envigo EnvigoD8Mit5-D8Mgh6)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 8 32203394 64762616 1 - by flanking markers 8 33603024 65467051 1 - by flanking markers 8 33558660 65717592 1 - by flanking markers 8 30848154 61290444 1 - by flanking markers RRID:RGD_61106 A segment of chr. 8 is transferred from the normotensive BN-Lx/Cub rat to the SHR/Ola. 61107 BB/OK BioBreeding rat Central Institute for Diabetes, Karlsburg, Germany National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Diabetes Obesity; Immunology Asns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk5 2162|2280|2332|2481|2794|3082|3726|3807|69430|70514 RRID:RGD_61107 This colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada. 61109 F344/NHsd F344/NHsd Envigo, Envigo aged Envigo, Envigo aged inbred Unknown RRID:RGD_61109 Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. 61110 SHR/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_61110 Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes. 61111 DA/Slc dark agouti National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_61111 These were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983. 61112 13M Laboratory of Human Behavior and Metabolism, Rockefeller University inbred Unknown RRID:RGD_61112 This is a Leprfa/Leprfa substrain derived from the Zucker rat. 61113 BN-Lx mutant Unknown RRID:RGD_61113 These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. 61114 DA/Bkl Bantin and Kingman, Fremont, California inbred Unknown RRID:RGD_61114 Commercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls. 61115 BN/SsN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_61115 To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony. 61116 SHRSP/A3 Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, Japan inbred Unknown RRID:RGD_61116 Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness. 61117 BN-Lx/Cub Brown Norway with polydactyly-luxate Charles University, Department of Biology, Prague inbred Unknown RRID:RGD_61117 These were derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. 61118 BUF/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer; Urology Bsis 2221 RRID:RGD_61118 Strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. 61119 WKY/NCrlCrlj Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo (as of 2023-05-30) RRID:RGD_61119 Originated from outbred Wistar of Kyoto University. To NIH from Kyoto University in 1971 and sib mating has started. To Charles River Laboratories, Inc from NIH in 1974 at F11, and to Charles River Japan, Inc. in 1981 at F25. (May 27, 2010). Used as control strain for the SHR strain. 61498 BN/NHsdMcwi PhysGen RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryorecovery RRID:RGD_61498 Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115). The genome of this BN strain is used as the rat reference assembly. 61499 SS/JrHsdMcwi PhysGen RGD HRDP, contact HRDP inbred Live Animals; Cryorecovery RRID:RGD_61499 Inbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115). 61517 FHL/Eur Fawn Hooded Low blood pressure Erasmus University-Rotterdam inbred Unknown RRID:RGD_61517 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damage 67934 WOKA inbred Unknown RRID:RGD_67934 Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. 67935 WOKW Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown RRID:RGD_67935 Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designated WOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. 67936 WR inbred Unknown RRID:RGD_67936 Sykora, Rosice (Stark et al 1968b). No further infromation. 67937 WST inbred Unknown RRID:RGD_67937 Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986). 67938 Y59 inbred Unknown RRID:RGD_67938 Strain developed in Zagreb, Jugoslavia. 67939 YA/N inbred Extinct RRID:RRRC_00191 No further information. 67940 YO inbred Unknown RRID:RGD_67940 Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992) 67941 Z61 inbred Unknown RRID:RGD_67941 Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours. 67942 ZI inbred Unknown RRID:RGD_67942 A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989). 67943 SHE/N-cp inbred Unknown RRID:RGD_67943 Reference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94. 67945 IS inbred Unknown RRID:RGD_67945 from a cross between a wild male and a Wistar female, with sib mating since 1968. 67948 JC inbred Unknown RRID:RGD_67948 LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984). 67957 APR inbred Unknown RRID:RGD_67957 Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). 67958 AS Albino Surgery National Institute for Medical Research, Mill Hill, UK inbred Unknown RRID:RGD_67958 University of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973). 67959 AS2 inbred Unknown RRID:RGD_67959 Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968). 67960 AUG inbred Unknown RRID:RGD_67960 Derived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England. 67962 AN inbred Unknown RRID:RGD_67962 Outbred Wistar Imamichi strain. 67965 AXC recombinant_inbred Unknown RRID:RGD_67965 A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976. 67966 B inbred Unknown RRID:RGD_67966 Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85. 67967 B/1N inbred Extinct RRID:RGD_67967 No further information. 67971 BBZ inbred Unknown RRID:RGD_67971 Strain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3 67974 BDE inbred Unknown RRID:RGD_67974 Zentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring. 67975 BDI inbred Unknown RRID:RGD_67975 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67976 BDII inbred Unknown RRID:RGD_67976 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67977 BDIII inbred Unknown RRID:RGD_67977 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67978 BDIV inbred Unknown RRID:RGD_67978 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67981 BDV inbred Unknown RRID:RGD_67981 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67983 BDVI inbred Unknown RRID:RGD_67983 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67984 BDVII inbred Unknown RRID:RGD_67984 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976) 67986 BDVIII inbred Unknown RRID:RGD_67986 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67987 BDX inbred Unknown Lypd3 69053 RRID:RGD_67987 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67988 BEG inbred Unknown RRID:RGD_67988 from a cross between SC and TE. 67989 BH inbred Unknown RRID:RGD_67989 D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973. 67990 BI inbred Unknown RRID:RGD_67990 Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992) 67991 BIL/1 NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_67991 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. 67993 BIL/2 NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_67993 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. 68000 BIRMB inbred Unknown RRID:RGD_68000 same as BIRMA. 68001 BLK/N inbred Extinct Asip 2003 RRID:RGD_68001 This strain has an agouti mutation 68007 BROFO inbred Unknown RRID:RGD_68007 Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions. 68008 BS inbred Unknown RRID:RGD_68008 University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966). 68011 C inbred Unknown RRID:RGD_68011 No further information. 68012 CAP inbred Unknown RRID:RGD_68012 Polish Academy of Sciences, Krakow (Stark et al 1968a). 68013 CAR/N Hunt-Hoppert caries resistant; CA/R NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_68013 Hunt 1937, developed for resistance to dental caries (Hunt et al 1955). 68014 CAS inbred Unknown RRID:RGD_68014 Hunt 1937, developed for high incidence of dental caries. 68015 CBH inbred Unknown RRID:RGD_68015 Woodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded). 68018 CPB-WE inbred Unknown RRID:RGD_68018 Wistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands. 68019 CRDH Cohen Rosenthal Diabetic Hypertensive Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_68019 As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995). 68020 CWS inbred Unknown RRID:RGD_68020 R Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open. 68022 DB inbred Unknown RRID:RGD_68022 No further information. 68023 DEBR Dundee experimental bald rat inbred Unknown RRID:RGD_68023 The DEBR rats have been bred at the University of Dundee since March 1984. The original crosses involved the inbred stock BDIX rats showing lesion and Wistar rat. The descendants of this cross resulted from full sib-matings.Two strains of DEBR rats are geing developed: the black-hooded and brown-hooded strains. 68026 DSS/1N inbred Extinct RRID:RRRC_00155 Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N). 68027 DSS/2N inbred Extinct RRID:RRRC_00156 Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). 68028 DSS/3N inbred Extinct RRID:RRRC_00157 Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). 68029 DXE-1 recombinant_inbred Unknown RRID:RGD_68029 Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover) 68031 ET Taisho Pharmaceutical Co. Ltd inbred Unknown RRID:RGD_68031 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). 68032 EXBH inbred Unknown RRID:RGD_68032 Hannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990) 68034 F6R inbred Unknown RRID:RGD_68034 Mutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985). 68035 FCH inbred Unknown RRID:RGD_68035 Fice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol. 68036 FH inbred Unknown Rab38ru 1600311 RRID:RGD_68036 Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see strains FHH and FHL), which may have different characteristics. 68038 FHL inbred Unknown RRID:RGD_68038 see FHH. 68040 FNL inbred Unknown RRID:RGD_68040 Fice Normolipidemic strain. Developed as a control strain for FCH (see FCH). 68041 G inbred Unknown RRID:RGD_68041 Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977) 68042 GEPR inbred Unknown RRID:RGD_68042 Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a). 68044 GHA inbred Unknown RRID:RGD_68044 The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973). 68046 HCS inbred Unknown RRID:RGD_68046 Harvard to Liverpool, UK in 1960. 68047 HMT inbred Unknown RRID:RGD_68047 Outbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor". 68048 HS inbred Unknown RRID:RGD_68048 Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus. 68049 HXB-1-43/Ipcv Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlands recombinant_inbred Unknown RRID:RGD_68049 Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs. 68050 IIM inbred Unknown RRID:RGD_68050 Set of nine strains bred as parallel strains from a single outbred colony maintained by B. Houssay in 1948. All strains were selected for large body weight and high fertility. One strain designated Beta IIM (RGD:40924649) derived from line 'b' became obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). Alpha IIM (RGD:40924650) was used as a control strain in study. 68051 INR/N inbred Extinct RRID:RRRC_00160 Harrington 1962 from a stock selected by CS Hall for low open field defaecation. 68052 IR inbred Unknown RRID:RGD_68052 Harrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981). 68057 K inbred Unknown RRID:RGD_68057 Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973). 68058 KGH/PitN inbred Extinct RRID:RRRC_00162 Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974). 68059 KIRBY-B inbred Unknown RRID:RGD_68059 From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980). 68060 KX inbred Unknown RRID:RGD_68060 developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977) 68061 KYN/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68061 Makino, Hokkaido University 1960 from stock the carrying the 68062 LA/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68062 from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982). 68063 LA/N-cp NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_68063 The corpulent (LA/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. The obese homozygous (cp/cp) littermates developspontaneous insulin resistance, obesity, impaired glucose tolerance, hypertriglyceridemia and atherosclerosis. 68065 LEA inbred Unknown RRID:RGD_68065 Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993) 68066 LEC inbred Unknown RRID:RGD_68066 In 1975, at the Center for Experimental Plants and Animals, Hokkaido University, Long Evans Cinnamon was derived originally from a closed colony of Long-Evans rats obtained from Kobe University in 1975. 68067 LEJ/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68067 Hok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication). 68068 LEM inbred Unknown Ckb 2357 RRID:RGD_68068 Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980). 68069 LEO inbred Unknown RRID:RGD_68069 from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980). 68070 LEP inbred Unknown RRID:RGD_68070 Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984) 68071 LER/N inbred Extinct RRID:RRRC_00164 Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology. 68072 LET inbred Unknown RRID:RGD_68072 from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1 68073 LETL inbred Unknown RRID:RGD_68073 A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan 68074 LETO inbred Unknown RRID:RGD_68074 THe LETO was obtained by mating of Long-Evan rats in Otsuka Pharmaceutical Co.The LETO has not shown the diabetic syndrome. 68077 LL/MavRrrc Lyon hypotensive Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00059 Lyon Low-Tensive. See LH 68079 LOU Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France inbred Unknown RRID:RGD_68079 Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). 68082 LUDW inbred Unknown RRID:RGD_68082 Ludwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU. 68083 LXB recombinant_inbred Unknown RRID:RGD_68083 Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover) 68084 M14 inbred Unknown RRID:RGD_68084 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum. 68085 M17 inbred Unknown RRID:RGD_68085 AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum. 68086 M520 inbred Unknown RRID:RGD_68086 Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992). 68087 MAXX inbred Unknown RRID:RGD_68087 From a cross of BNxLEW with subsequent inbreeding. 68088 MF inbred Unknown RRID:RGD_68088 Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). 68091 MLCS Milan low-calpastatin strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy recombinant_inbred Unknown RRID:RGD_68091 From a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity. 68097 MSUBL inbred Unknown RRID:RGD_68097 Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977). 68098 MW Munich Wistar inbred Unknown RRID:RGD_68098 Munich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS. 68099 MWF inbred Unknown RRID:RGD_68099 From outbred Wistar rats selected for large numbers of superficial glomeruli. 68100 NBL inbred Unknown RRID:RGD_68100 Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990). 68103 NER noda epileptic rat inbred Unknown RRID:RGD_68103 From Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has. 68104 NIG-III/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68104 From a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987). 68106 NSD/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68106 NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock. 68107 NZR inbred Unknown RRID:RGD_68107 Subline of AS2 separated at F32. 68109 ODUS inbred Unknown RRID:RGD_68109 As for ODU, but maintained at Osaka Dental University. 68113 OXYR/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_68113 Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain. 68114 OXYS/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_68114 Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats. 68115 P77PMC inbred Unknown RRID:RGD_68115 Wistar rats from Beijing Medical College in 1977. 68116 PA inbred Unknown RRID:RGD_68116 King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction. 68117 PETH/N Royal College of Surgeons, RCS NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_68117 Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS. 68118 PKD PKD Central Institute for Laboratory Animal Breeding, Hanover, Germany inbred Unknown RRID:RGD_68118 Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991. 68119 PSDO/N inbred Extinct RRID:RRRC_00178 Reserved symbol for strain in development now at F6 (NIH 1989). 68121 R inbred Unknown RRID:RGD_68121 Muhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R. 68122 RCS/N inbred Extinct RRID:RRRC_00180 Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline. 68123 RHA/N Roman high avoidance NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68123 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated. 68124 RII/1 inbred Unknown RRID:RGD_68124 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991). 68125 RII/2 inbred Unknown RRID:RGD_68125 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991). 68126 RLA/N inbred Unknown RRID:RGD_68126 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains. 68127 RP/AEurRij inbred Unknown RRID:RGD_68127 Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). 68128 S5B inbred Unknown RRID:RGD_68128 Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating. 68129 SBH Sabra hypertensive Barzilai Medical Center, Ashkelon, Israel inbred Unknown RRID:RGD_68129 Sabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics). 68130 SBN inbred Unknown RRID:RGD_68130 As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984). 68131 SC inbred Unknown RRID:RGD_68131 Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360) 68133 SDJ/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Slc2a2 3705 RRID:RGD_68133 Takeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966. 68134 SDNK inbred Unknown RRID:RGD_68134 Sprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan. 68136 SEL inbred Unknown RRID:RGD_68136 Dunning 1948. Probably extinct. 68137 SHHF inbred Unknown Grk2|Grk3 2062|2063 RRID:RGD_68137 JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile. 68140 SPRD/Hsd Harlan Harlan outbred Unknown RRID:RGD_68140 Originated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony. 68143 TA inbred Unknown RRID:RGD_68143 Outbred Wistar Imamichi. 68144 TE inbred Unknown RRID:RGD_68144 Outbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987). 68145 TF inbred Unknown RRID:RGD_68145 From outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988). 68146 THA inbred Unknown RRID:RGD_68146 Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990). 68147 THE/Utp Tsukuba high-emotional rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_68147 Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE). 68148 TLE/Utp Tsukuba low-emotional rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Behavior RRID:RGD_68148 Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE). 68149 TM Tester Moriyama rat Institute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, Japan inbred Unknown RRID:RGD_68149 Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication). 68150 TMB inbred Unknown RRID:RGD_68150 PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68151 TMD inbred Unknown RRID:RGD_68151 PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68152 TO/Hok Tokyo rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68152 A breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994). 68154 TOM inbred Unknown RRID:RGD_68154 Toma Institute, Japan (Ikadai, personal communication, 1991) 68155 TS inbred Unknown RRID:RGD_68155 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). 68156 TS1 inbred Unknown RRID:RGD_68156 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68157 TS3/N inbred Extinct RRID:RRRC_00185 Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68158 TT inbred Unknown RRID:RGD_68158 outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991). 68160 TU inbred Unknown RRID:RGD_68160 From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991) 68161 TW inbred Unknown RRID:RGD_68161 Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985). 68162 TX inbred Unknown RRID:RGD_68162 From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991) 68163 U inbred Unknown RRID:RGD_68163 Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990). 68164 UChA University of Chile, Casilla, Chile inbred Unknown RRID:RGD_68164 Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. 68165 UChB University of Chile, Casilla, Chile inbred Unknown RRID:RGD_68165 Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. 68166 W/Hok inbred Unknown RRID:RGD_68166 Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977). 68167 W/Nhg inbred Unknown RRID:RGD_68167 Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany. 68168 WA inbred Unknown RRID:RGD_68168 St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983. 68169 WAB inbred Unknown RRID:RGD_68169 Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977). 68171 WBB/1N inbred Extinct RRID:RRRC_00186 No further information 68172 WBB/2N inbred Extinct RRID:RRRC_00187 No further information. 68173 WBN inbred Unknown RRID:RGD_68173 Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived. 68174 WCF inbred Unknown RRID:RGD_68174 R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot. 68175 WDF inbred Unknown RRID:RGD_68175 Ikeda et al (1981) by backcrossing the fatty gene to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus. 68176 WEC inbred Unknown RRID:RGD_68176 Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). 68177 WEK inbred Unknown RRID:RGD_68177 Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). 68178 WELS inbred Unknown RRID:RGD_68178 Outbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984) 68180 WIN inbred Unknown RRID:RGD_68180 WI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986). 68183 WKA inbred Unknown RRID:RGD_68183 King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992) 68184 WKAH/Hok Wistar-King Aptekman Hokkaido National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_68184 King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA. 68185 WKAM inbred Unknown RRID:RGD_68185 King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA. 68186 WKHA/N inbred Extinct RRID:RRRC_00188 From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure. 68187 WKHT/N inbred Extinct RRID:RRRC_00189 From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992). 68188 WKS inbred Unknown RRID:RGD_68188 National Institute of Genetics, Mishima, Japan. 68189 HTX/Hcj Department of Pharmacology, University of Florida, Gainesville. inbred Unknown RRID:RGD_68189 D. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30. 69369 SS Brookhaven National Laboratories, Upton, New York inbred Unknown RRID:RGD_69369 From a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension. 69638 BN/Ka Brown Norway Katholiek (kininogen or kinin deficient) Kitasato University, Kanagawa, Japan. inbred Unknown RRID:RGD_69638 Kitasato University, Kanagawa, Japan. 69643 F344/DuCrlCrlj Charles River Laboratories Japan, National BioResource Project for the Rat in Japan Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Cardio Hypertension RRID:RGD_69643 This strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976. 70410 AA Alko, Alcohol Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown RRID:RGD_70410 Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as drink for 10 days, after which they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. Fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight, so alcohol intake was used as a phenotypic measure. 70411 ANA Alko, Non-Alcohol Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown RRID:RGD_70411 Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure. 70413 WBB inbred Unknown RRID:RGD_70413 70416 ACH inbred Unknown RRID:RGD_70416 Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research. 70417 A28807/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RRRC_00141 Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982). 70418 A35322 inbred Unknown RRID:RGD_70418 Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990. 70419 A7322 inbred Unknown RRID:RGD_70419 Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus. 70420 A990 inbred Unknown RRID:RGD_70420 Curtiss 1921 at Columbia University Institute for Cancer Research. 70421 AAW inbred Unknown RRID:RGD_70421 Atomic Energy Commission, Melbourne (Adams et al 1984). 70422 ABH Nishimura, Hammatsu University School of Medicine, Japan. inbred Unknown RRID:RGD_70422 Yamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan. 70423 ACP inbred Unknown RRID:RGD_70423 Dunning to National Cancer Institute 1967 at F54. 70424 AGA inbred Unknown RRID:RGD_70424 Nakic, Zagreb (Stark et al 1968b). Used for immunological studies. 70425 AGUS inbred Unknown RRID:RGD_70425 Germ-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26. 70426 ALB/N Albany NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_70426 Wolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer. 70427 AM inbred Unknown RRID:RGD_70427 Torres, Rio de Janeiro, from outbred stock. 70428 AMDIL inbred Unknown RRID:RGD_70428 Torres, Rio de Janeiro, from outbred stock 70429 AO inbred Unknown RRID:RGD_70429 From ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995). 70440 BIRMA inbred Unknown RRID:RGD_70440 AM Mandl 1952 from Albino rats purchased from Birmingham market. 70446 LIH/Lac Liverpool Hooded inbred Unknown RRID:RGD_70446 "Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981). 70447 MNR Maudsely non-reactive inbred Unknown RRID:RGD_70447 PL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982). 70448 MNRA inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00692 Substrain of MNR. To Harrington in 1965 at F25 (Harrington 1981). 70449 MR/N Maudsely reactive NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_70449 Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). 70450 NBR inbred Unknown RRID:RGD_70450 Poiley 1966 from heterogeneous stock 70451 OKA inbred Unknown RRID:RGD_70451 From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days. 70452 OM Osborne-Mendel NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center outbred Unknown RRID:RGD_70452 Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). 70453 SR inbred Unknown RRID:RGD_70453 Rapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen. 70454 WKY/N NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-01) RRID:RRRC_00190 National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain. 70455 WKYO/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_70455 Inbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991). 70456 WM inbred Unknown RRID:RGD_70456 Wistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Mishima in 1951. 70457 WMS inbred Unknown RRID:RGD_70457 Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWF 70458 WN inbred Unknown RRID:RGD_70458 Heston in 1942 from Wistar stock of Nettleship, This WN is the parent to WN substrains maintained in other institutions. 70459 ZDF Vancouver diabetic fatty Zucker Animal Model Core Facility, University of California at Davis inbred Unknown RRID:RGD_70459 "Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b). 70508 SD Sprague-Dawley outbred Unknown Aqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f1 2141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|728892 RRID:RGD_70508 This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain, probably Wistar) and subsequently to his white female offspring for 7 generations. All the current colonies are from this original stock. 70509 F344/NRrrc NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Sperm Cdkn2a|Gfap|Tnfrsf1a 2323|2679|621237 RRID:RRRC_00158 Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. 625624 LETsc2Eker/Hin Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo Japan mutant Unknown Tsc2|Tsc2Eker 3908|12791989 10 13848210 13883189 7 10 13778990 13813725 7 10 13962006 13996684 7 10 13621135 13655773 7 RRID:RGD_625624 Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo. 625659 DRH/Seac National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_625659 Established by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3 628372 ACI.FHH-(D1Mit34-D1Rat156)/Eur Animal Research Center of the Erasmus University, Rotterdam, The Netherlands congenic Unknown 1 230963695 253410500 1 - by flanking markers 1 252776360 279213254 1 - by flanking markers 1 245529606 245529710 1 - by flanking markers 1 225126575 225126682 1 - by flanking markers RRID:RGD_628372 The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI. 628486 NER/Kyo Noda epileptic rat, GMS National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_628486 Originated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan. 628525 Ni/Hin Clea Japan Inc. Shiga inbred Unknown RRID:RGD_628525 Found in the Sprague-Dawley (Jci:SD) in Japan. In these the Tsc2 gene is not mutated. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream 628907 SHR.BN-RT1n congenic Unknown RRID:RGD_628907 This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR. 628908 SHR.BN-(D1Mit3-Igf2)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Igf2|Sa|Scnn1b|Scnn1g 2870|3616|3640|3641 1 146971846 202915231 1 - by flanking markers 1 162692213 222733868 1 - by flanking markers 1 156446196 215839081 1 - by flanking markers 1 144267353 197831802 1 - by flanking markers RRID:RGD_628908 Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. 628909 SHR.BN-(D13Arb5-Ren1)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 13 25430110 64281346 1 - by flanking markers 13 14281836 72173144 1 - by flanking markers 13 9016742 67207219 1 - by flanking markers 13 5994668 62022792 1 - by flanking markers RRID:RGD_628909 Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity. 629459 ZUC-LeprfaSteJrpz-/- Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USA mutant Unknown RRID:RGD_629459 Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology. 629462 ZUC-LeprfaSte-/- University of California Davis, Davis, CA mutant Unknown Leprfa 13432153 5 122320075 122503449 7 5 124380327 124556585 7 5 120597857 120597857 8 5 116389200 116389200 8 RRID:RRRC_00839 This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. 629463 ZUC-Lepr+Ste University of California Davis, Davis, CA mutant Unknown Lepr 3001 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_629463 This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype. 629464 ZUC-Leprfa mutant Unknown Leprfa 13432153 5 122320075 122503449 7 5 124380327 124556585 7 5 120597857 120597857 8 5 116389200 116389200 8 RRID:RGD_629464 This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions. 629465 SHR/NCrlCrlj Charles River Japan, National BioResource Project for the Rat in Japan Charles River Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cardio Hypertension RRID:RGD_629465 NIH derived strain maintained at the Charles River, Japan. 629481 SHR.WKY-(D1Wox33-D1Got194) Département de Physiologie et Pharmacologie Clinique, Faculté de Pharmacie, France congenic Unknown 1;2 160754901;198300754 208638156;198300855 1 - by flanking markers;1 - by flanking markers 1;2 174300636;224991853 228298222;224991955 1 - by flanking markers;1 - by flanking markers 1 221363524 221363653 1 - by flanking markers 1 203293397 203293528 1 - by flanking markers RRID:RGD_629481 This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background. 629482 WKY.SHR-(D1Wox19-D1Mit2)/Njs University of Leicester, Leicester, UK congenic Unknown 1 134980526 185691036 1 - by flanking markers 1 204942418 204942572 1 - by flanking markers 1 197963658 197963812 1 - by flanking markers 1 181133855 181134010 1 - by flanking markers RRID:RGD_629482 Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY 629484 LEW-tl Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1|Csf1tl 621063|12910954 RRID:RGD_629484 The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N. 629485 LE/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_629485 The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50. 629486 PVG/OlaHsd Envigo inbred Cryorecovery RRID:RGD_629486 black hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992 629487 SHR.WKY-(D1Wox19-D1Wox34)/Njs University of Leicester, Leicester, UK congenic Unknown 1 168382195 185691036 1 - by flanking markers 1 182435050 204942572 1 - by flanking markers 1 175447029 197963812 1 - by flanking markers 1 164747424 181134010 1 - by flanking markers RRID:RGD_629487 Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR 629488 SI-Tg(Ednrb)Ywa transgenic spotting lethal University of Texas Southwestern Medical Center, Dallas, Texas transgenic Unknown Ednrb|Ednrbsl 2536|10755424 RRID:RGD_629488 A 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals. 629489 Eker-Tg(Tsc2)5Hin Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 RRID:RGD_629489 Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. 629490 DA.F344-Aia1/1 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 20 2790511 32560683 1 - by flanking markers 20 5249981 36993999 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_629490 genomic segments with region of interest from chr 20 were inserted to DA strain 629491 DA.F344-Aia1/2 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 36592628 85014222 1 - by flanking markers 4 37534124 151090861 1 - by flanking markers 4 37685175 86438507 1 - by flanking markers 4 39505275 85379614 1 - by flanking markers RRID:RGD_629491 genomic segments with region of interest from chr 4 were inserted to DA strain 629492 Sl Institute of Animal Reproduction, Omiya, Japan inbred Unknown Ednrb|Ednrbsl 2536|10755424 RRID:RGD_629492 Natural mutation in the progeny of a Wistar-Imamichi female and a wild rat. 629493 DA.F344-Aia1/3 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 54879077 54879214 1 - by flanking markers 4 55118586 55118722 1 - by flanking markers 4 55375865 55376001 1 - by flanking markers 4 56698790 56698927 1 - by flanking markers RRID:RGD_629493 genomic segments with region of interest from chr 4 were inserted to DA strain 629494 DA.F344-Aia1/4 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 10 23444813 104060283 1 - by flanking markers RRID:RGD_629494 genomic segments with region of interest from chr 10 were inserted to DA strain 629495 WKY.SHRSP-(Mt1pa-D1Rat57)/Bbb Freie Universitdt Berlin, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 177313819 185690396 1 - by flanking markers 1 195736433 204941832 1 - by flanking markers 1 188794419 197963072 1 - by flanking markers 1 173421600 181133270 1 - by flanking markers RRID:RGD_629495 Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY 629499 BXS/Ipcv Czechoslovak Academy of Sciences, Prague recombinant_inbred Unknown RRID:RGD_629499 These recombinant inbred strains are obtained by crossing normotensive BN-Lx/Cub with hypertensive SHR/Ola progenitor strains. 629500 LEXF/Stm Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan recombinant_inbred Unknown RRID:RGD_629500 Recombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating. 629501 SD-Tg(Ren2)27 Center for Genome Research, University of Edinburgh, UK transgenic Unknown Agtr1b|Ace 2071|2493 RRID:RGD_629501 This is a hypertensive rat strain in which the mouse Ren2 renin gene along with its 5' and 3' flanking sequences were microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background. 629502 SHR.BN-(Il6-Npy) MRC Clinical Centre, London, UK congenic Unknown Il6|Npy 2901|3197 4 456799 78045187 1 - by flanking markers 4 3095536 144240956 1 - by flanking markers 4 3043231 79565059 1 - by flanking markers 4 5214602 78888495 1 - by flanking markers RRID:RGD_629502 This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes 629503 SHR.BN-(D19Rat57-D19Mit7)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Agt 2069 19 57234802 57235101 1 - by flanking markers 19 59599823 70892142 1 - by flanking markers 19 48798983 60220581 1 - by flanking markers 19 44306955 55283277 1 - by flanking markers RRID:RGD_629503 The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating. 629504 WKY.SHR-(D1Mit3-D1Rat57)/Iwai Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 146971846 177313977 1 - by flanking markers 1 162692213 195736590 1 - by flanking markers 1 156446196 188794576 1 - by flanking markers 1 144267353 173421758 1 - by flanking markers RRID:RGD_629504 Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY 629505 SS.MNS-(D10Mit11-D10M11Mit119)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers RRID:RGD_629505 fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr 629506 LEW-tl.BN-(D2Arb16-D2Wox8) Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1 621063 2 198312439 212776982 1 - by flanking markers 2 225003539 237636701 1 - by flanking markers 2 205572952 219581453 1 - by flanking markers 2 190602746 204499414 1 - by flanking markers RRID:RGD_629506 LEW.tl carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2. 629509 FHH/EurMcwi PhysGen Rat Resource and Research Center, RGD HRDP, contact HRDP inbred Live Animals; Cryorecovery RRID:RRRC_00293 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. 629510 SS.BN-(D12Arb13-D12Rat79)/Mcwi PhysGen congenic Live Animals 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 18 59796478 59796643 1 - by flanking markers RRID:RGD_629510 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629511 SS-Chr 2BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629511 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629512 FHH-Chr 12BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629512 A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed 629513 SS-Chr 4BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629513 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629514 SS-Chr 6BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629514 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629515 SS-Chr 7BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629515 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629516 SS-Chr 8BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629516 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629517 SS-Chr YBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629517 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629518 SS-Chr 9BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629518 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629519 SS.BN-(D13Mgh13-D13Mit4)/Mcwi PhysGen congenic Unknown 13 90551150 90551272 1 - by flanking markers 13 41256240 97381801 1 - by flanking markers 13 36147533 92916783 1 - by flanking markers 13 31241331 86800898 1 - by flanking markers RRID:RGD_629519 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629520 FHH-Chr 1BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629520 A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed 629521 SS-Chr 11BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629521 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629522 SS-Chr 20BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629522 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629523 SS-Chr 13BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_629523 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629524 SS-Chr 16BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629524 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629525 SS-Chr 18BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629525 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629548 SHR.BN-(D1Mit3-Igf2)/1lpcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_629548 SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv. 629578 SS.LEW-(D5Rat130-D5Mco10)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio. congenic Unknown 5 32701659 168174140 1 - by flanking markers 5 36590997 171686754 1 - by flanking markers 5 31926122 168109659 1 - by flanking markers 5 31663789 161481680 1 - by flanking markers RRID:RGD_629578 A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generations 631158 DXE1/Ztm Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631158 DXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. 631160 DXE2/Ztm Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631160 Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats 631161 DXE3/Ztm Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631161 Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. 631163 LE/BluGill University of Illinois at Urbana-Champaign inbred Unknown RRID:RGD_631163 This inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock. 631182 DA/BklArbN NIH, Arthritis and Rheumatism Branch, Bethesda MD inbred Extinct RRID:RRRC_00091 This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding. 631219 SDT/Jcl CLEA Japan, Inc CLEA Japan, Inc inbred Live Animals (as of 2021-04-23) RRID:RGD_631219 Established from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating. 631220 SS.LEW-(D10Mco1-D10Mco31)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10 69986912 84284667 1 - by flanking markers 10 68786307 83220224 1 - by flanking markers 10 69123603 83411656 1 - by flanking markers 10 66743655 80537228 1 - by flanking markers RRID:RGD_631220 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 631275 WKY/Cfd WKY/Cfd Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown RRID:RGD_631275 Substrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA) 631276 WKHA/Cfd WKHA/Cfd Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown RRID:RGD_631276 Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM) 631278 SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Gstm1|Vcam1|S1pr1 2633|2755|3952|61958 2 46542246 210636169 1 - by flanking markers 2 65576721 235592880 1 - by flanking markers 2 46537589 217498710 1 - by flanking markers 2 46123260 202447032 1 - by flanking markers RRID:RGD_631278 Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background. 631279 SHRSP.WKY-(D2Rat13-D2Mit5)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst 2633 2 46542246 66680209 1 - by flanking markers 2 65576721 86560306 1 - by flanking markers 2 46537589 66828236 1 - by flanking markers 2 46123260 66118463 1 - by flanking markers RRID:RGD_631279 Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. 631280 WKY.SHRSP-(D2Mit5-D2Mgh12)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Pklr 3336 2 66680022 181223505 1 - by flanking markers 2 86560119 207874394 1 - by flanking markers 2 66828049 188458034 1 - by flanking markers 2 66118275 174551863 1 - by flanking markers RRID:RGD_631280 Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. 631281 WKY.SHRSP-(Fst-Pklr)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Pklr 2633|3336 2 46542246 181223505 1 - by flanking markers 2 65576721 207874394 1 - by flanking markers 2 46537589 188458034 1 - by flanking markers 2 46123260 174551863 1 - by flanking markers RRID:RGD_631281 Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. 631282 DA.F344-(D10Arb20-D10Arb22)/Arb Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 10 23444813 104060283 1 - by flanking markers RRID:RGD_631282 This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background. 631283 DA.F344-(D10Arb21-D10Arb22)/Arb Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 14721135 14721325 1 - by flanking markers 10 14644150 107484761 1 - by flanking markers 10 14827894 107857673 1 - by flanking markers 10 14487011 104060283 1 - by flanking markers RRID:RGD_631283 This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background. 631285 IER/Ihr Institute of Experimental Animals of Shiga University, Medical Science, Ohtsu, Japan National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Ophthalmology RRID:RGD_631285 A mutant rat strain which is a useful model for human cataract. 631286 WKY/Izm Wistar-Kyoto National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_631286 WKY strain from the Izumo colony 631294 F344.GK-(D1Arb42a-D1Rat90)/Swe Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden congenic Unknown Cyp2c12 2470 1 267110921 267111153 1 - by flanking markers 1 266156838 289137268 1 - by flanking markers 1 258709726 281795785 1 - by flanking markers 1 238699859 259647894 1 - by flanking markers RRID:RGD_631294 This congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 background 631571 SS.LEW-(D1Uia8-D1Mco38)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 110818690 110818887 1 - by flanking markers 1 117836211 117836407 1 - by flanking markers 1 116680361 116680557 1 - by flanking markers 1 110159449 110159650 1 - by flanking markers RRID:RGD_631571 Segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. 631572 SBH/Ygl Sabra hypertension prone Ben Gurion University Barzilai Medical Center, Ashkelon, Israel Available at the Barzilai University Medical Center in Ashkelon, Israel inbred Live Animals (as of 2024-07-15) RRID:RGD_631572 Bred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai University Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed - hence substrain designated with suffix/Ygl. 631573 SBN/Ygl Sabra hypertension resistant Ben Gurion University Barzilai Medical Center, Ashkelon, Israel Available at the Barzilai University Medical Center in Ashkelon, Israel inbred Live Animals (as of 2024-07-15) RRID:RGD_631573 Bred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed - hence substrain designated with suffix/Ygl 631574 Wild/K Department of Laboratory Animal Science, Greifswald, Karlsburg, Germany wild Unknown RRID:RGD_631574 Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany. 631576 LEW/CrlCrlj Charles River, Atsugi, Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Immunology; Osteosis RRID:RGD_631576 Developed by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34. 631577 SHR/Izm National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan inbred Live Animals Cardio Hypertension RRID:RGD_631577 Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). 631578 SHR.BN-(D2Rat171-D2Arb24)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic. congenic Unknown 2 116874922 221284686 1 - by flanking markers 2 135770850 248088631 1 - by flanking markers 2 116075644 228737869 1 - by flanking markers 2;9 112456140;67703258 212696837;67703293 1 - by flanking markers;1 - by flanking markers RRID:RGD_631578 This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background 631579 LEW/OlaHsd Harlan France Harlan France inbred Unknown RRID:RGD_631579 Obtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands. 631581 LEW.1F Zentralinstitut fur versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_631581 Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1f haplotype into the LEW stock 631582 SS.WKY-(Mme-D2Wox18)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 174727552 1 - by flanking markers 2 173193501 201402094 1 - by flanking markers 2 153799203 181987474 1 - by flanking markers 2 147686913 168355276 1 - by flanking markers RRID:RGD_631582 Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr 631583 SS.WKY-(D2Mgh8-D2Mgh9)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_631583 Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr 631585 SS.LEW-(D16Mit2-D16Rat12)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 16 380245 4227730 1 - by flanking markers RRID:RGD_631585 This congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr background 631586 SS.MNS-(D10Mco14-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 45105978 102587587 1 - by flanking markers 10 44914976 101157704 1 - by flanking markers 10 45157430 101482600 1 - by flanking markers 10 43593509 98003205 1 - by flanking markers RRID:RGD_631586 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 631587 SS.MNS-(D10M11Mit119-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown Ace 2493 10 69986912 102587587 1 - by flanking markers 10 68786307 101157704 1 - by flanking markers 10 69123603 101482600 1 - by flanking markers 10 66743655 98003205 1 - by flanking markers RRID:RGD_631587 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 631588 SS.MNS-(D10Mit11-Vamp2)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 101848683 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 10 53793581 53797815 1 - by flanking markers RRID:RGD_631588 Fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr 631589 SHR.WKY-(D1Wox34-D1Rat164)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 168382195 170218440 1 - by flanking markers 1 182435050 184213712 1 - by flanking markers 1 175447029 177235302 1 - by flanking markers 1 164747424 166533203 1 - by flanking markers RRID:RGD_631589 Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR 631590 SHR.WKY-(D1Wox34-Sah)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Acsm3 62086 1 168382195 178081751 1 - by flanking markers 1 182435050 196475596 1 - by flanking markers 1 175447029 189541233 1 - by flanking markers 1 164747424 174159966 1 - by flanking markers RRID:RGD_631590 Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR 631591 WKY.SHR-(D1Rat56-D1M7Mit206)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 172926151 172926455 1 - by flanking markers 1 191393321 191393468 1 - by flanking markers 1 184419946 184420093 1 - by flanking markers 1 169112897 169113045 1 - by flanking markers RRID:RGD_631591 Congenic substrain derived by backcrossing congenic strain WKY.SHR-(DWox19-D1Mit2) to WKY 631592 WKY.SHR-(D1Rat236-D1M7Mit206)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 155183458 155183662 1 - by flanking markers 1 169098399 169098603 1 - by flanking markers 1 162891429 162891633 1 - by flanking markers 1 152234464 152234669 1 - by flanking markers RRID:RGD_631592 Congenic substrain derived by backcrossing congenic strain WKY.SHR-(D1Wox19-D1Mit2) to WKY 631593 LEW/Rj Hopital Purpan, Toulouse Cedex, France inbred Unknown RRID:RGD_631593 Strain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). 631594 BN/Rj Hopital Purpan, Toulouse Cedex, France; Centre D'Elevage R. Janvier, Route des Chenes-Secs Le Genest-St-Isle, France inbred Unknown RRID:RGD_631594 Strain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). 631595 LEW.1AV1.DA-(D10Rat92-D10Rat135)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 108776963 1 - by flanking markers 10 77132487 108145987 1 - by flanking markers 10 77269759 108540162 1 - by flanking markers 10 74585846 104670812 1 - by flanking markers RRID:RGD_631595 LEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain. 631596 LEW.1AV1.DA-(D10Rat92-D10Wox17)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 91168491 1 - by flanking markers 10 77132487 89831596 1 - by flanking markers 10 77269759 90042115 1 - by flanking markers 10 74585846 87055282 1 - by flanking markers RRID:RGD_631596 Congenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2. 631597 LEW.1AV1.DA-(D10Wox17-D10Rat135)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 91168332 108776963 1 - by flanking markers 10 89831438 108145987 1 - by flanking markers 10 90041957 108540162 1 - by flanking markers 10 87055121 104670812 1 - by flanking markers RRID:RGD_631597 Congenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 631598 LEW.1AV1.DA-(D10Got154-D10Rat135)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 101532360 108776963 1 - by flanking markers 10 100150192 108145987 1 - by flanking markers 10 100460820 108540162 1 - by flanking markers 10 97010147 104670812 1 - by flanking markers RRID:RGD_631598 Congenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 631599 SHRSP/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension; Neurobiology RRID:RGD_631599 Strain has been maintained at Kyoto University. 631600 WKY.SHRSP-(Mt1pa-D1Rat200)/Bbb Max-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany. congenic Unknown Mt1-ps1 3118 1 126938969 185690396 1 - by flanking markers 1 134116233 204941832 1 - by flanking markers 1 133076978 197963072 1 - by flanking markers 1 125611501 181133270 1 - by flanking markers RRID:RGD_631600 Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY 631601 WKY.SHRSP-(Asgr1-Vamp2)/Bbb Max-Delbruck Center for Molecular Medicine, Germany congenic Unknown Asgr1|Vamp2 2160|3949 10 55848264 56903173 1 - by flanking markers 10 55418231 56411205 1 - by flanking markers 10 55675171 56666086 1 - by flanking markers 10 53793581 54779642 1 - by flanking markers RRID:RGD_631601 Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki 631602 BN/Elh Department of Surgery and Biochemistry, University of Otago inbred Unknown RRID:RGD_631602 These rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony. 631603 WKY/Snk Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_631603 The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. 631604 SHR/Snk Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_631604 The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. 631605 SS.LEW-(D10Arb9-D10Got101)/Jr Medical College of Ohio, Toledo congenic Unknown 10 65068360 77547622 1 - by flanking markers 10 65339106 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_631605 Congenic strain originated from an inbred SS/Jr strain. 631606 SS.MNS-(D10Rat13-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 97152234 101848683 1 - by flanking markers 10 95701164 95701443 1 - by flanking markers 10 95967019 95967298 1 - by flanking markers 10 92698959 92699242 1 - by flanking markers RRID:RGD_631606 Congenic strain originated from an inbred SS/Jr strain. 631607 SS.WKY-(D2N35-Mme)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 153114515 1 - by flanking markers 2 173193501 173278946 1 - by flanking markers 2 153799203 153880910 1 - by flanking markers 2 147686913 147803808 1 - by flanking markers RRID:RGD_631607 Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr 631610 SS.LEW-(D1Rat39-D1Rat131)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 125983422 145648920 1 - by flanking markers 1 133172202 159182239 1 - by flanking markers 1 132134307 152871103 1 - by flanking markers 1 124668437 142990467 1 - by flanking markers RRID:RGD_631610 Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. 631691 SHRSP/A3Izm Research Institute, International Medical Center of Japan inbred Unknown RRID:RGD_631691 Substrain originates from the SHRSP/Izm strain. 631693 WKY.SHRSP-(Shbg-Atp1b2)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Atp1b2|Shbg 2171|3671 10 56418323 56435654 1 - by flanking markers 10 55951260 55983036 1 - by flanking markers 10 56205622 56237354 1 - by flanking markers 10 54318698 54350409 1 - by flanking markers RRID:RGD_631693 This strain has the blood pressure locus from chr 10 631694 WKY.SHRSP-(D1Rat200-D1Rat216)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 1 126938969 185923619 1 - by flanking markers 1 134116233 205161264 1 - by flanking markers 1 133076978 133164521 1 - by flanking markers 1 125611501 125611741 1 - by flanking markers RRID:RGD_631694 This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(D1Rat200-D1Rat216) 631695 SS/JrRkb Benjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany. inbred Unknown RRID:RGD_631695 This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin 631696 SHR/FubRkb Freie Universitat Berlin inbred Unknown RRID:RGD_631696 Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin. 631697 BBDP/Hri Hagedorn Research Institute, Gentofte, Denmark inbred Unknown RRID:RGD_631697 This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. 631698 BN/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_631698 This strain is maintained at the Mollegaard breeding center. 631699 BB.SHR-(D6Rat184-D6Rat101)/K University of Greifswald, Germany congenic Unknown 6 121381065 135964844 1 - by flanking markers 6 130448688 144756005 1 - by flanking markers 6 121224054 135658578 1 - by flanking markers 6 116506292 130245370 1 - by flanking markers RRID:RGD_631699 Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females. 631700 BB.SHR-(Gnal-D18Mit9)/K Department of Laboratory Animal Science, University Greifswald, Karlsburg, Germany congenic Unknown Gnal 2715 18 63595606 80370517 1 - by flanking markers 18 61991738 79748387 1 - by flanking markers 18 62805406 80696375 1 - by flanking markers 18 60622311 77209844 1 - by flanking markers RRID:RGD_631700 Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long. 631703 SS.LEW-(D10Rat207-D10Mgh1)/Ayd Research Centre-CHUM congenic Unknown 10 89896421 89896564 1 - by flanking markers 10 88662536 88662678 1 - by flanking markers 10 88865454 88865596 1 - by flanking markers 10 85887040 85887185 1 - by flanking markers RRID:RGD_631703 Congenic strain originated from an inbred SS strain 631844 Iusm:HAD1 high-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_631844 These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2). 631845 Iusm:LAD1 low-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_631845 These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2). 631846 F344.GK-(D1Mgh10-D1Rat90)/Swe Karolinska Institute congenic Unknown 1 204280278 267111153 1 - by flanking markers 1 223910550 289137268 1 - by flanking markers 1 217054291 281795785 1 - by flanking markers 1 199050459 259647894 1 - by flanking markers RRID:RGD_631846 Congenic strain originated from an inbred F344/Mcwi strain 631847 F344.GK-(D1Mit7-D1Mgh25)/Swe Karolinska Institute congenic Unknown 1 235677487 240980321 1 - by flanking markers 1 257430524 262617374 1 - by flanking markers 1 250195095 250195290 1 - by flanking markers 1 229550480 229550676 1 - by flanking markers RRID:RGD_631847 Congenic strain originated from an inbred F344 strain 631848 SHR/OlaIpcv Czech Academy of Sciences, Prague, Czech Republic inbred Unknown Sbf1m1Ipcv 10002755 RRID:RGD_631848 These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf1 was identified in this strain. 634359 WF.WKY-(D5Pas1-D5Uwm37)/Uwm University of Wisconsin-Madison congenic Unknown 5 26938679 130527490 1 - by flanking markers 5 30952629 132652105 1 - by flanking markers 5 26251767 128812854 1 - by flanking markers 5 26141669 123935338 1 - by flanking markers RRID:RGD_634359 WKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region. 634363 LEW/NIcoCrlf Charles River, France inbred Unknown RRID:RGD_634363 A substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. 634364 SHR/NIcoCrlf Charles River, France inbred Unknown RRID:RGD_634364 A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. 634365 SS/Hsd Harlan, Indianapolis, Indiana inbred Unknown RRID:RGD_634365 This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. 634366 SR/Hsd Harlan, Indianapolis, Indiana inbred Unknown RRID:RGD_634366 This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. 634367 BN/CrlCrlj Charles River Laboratories Japan, National BioResource Project for the Rat in Japan Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Ophthalmology; Immunology RRID:RGD_634367 1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced. 634369 WBN/KobSlc wistar bonn/kobori National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Diabetes Obesity; Ophthalmology RRID:RGD_634369 This strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1. 634370 F344.GK-(D1Mgh10-D1Rat119)/Swe Karolinska Institute congenic Unknown 1 204280278 242586311 1 - by flanking markers 1 223910550 264429516 1 - by flanking markers 1 217054291 256949019 1 - by flanking markers 1 199050459 236036450 1 - by flanking markers RRID:RGD_634370 GK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain. 634372 GHS Department of Medicine and Physiology, University of Rochester, Rochester, New York inbred Unknown RRID:RGD_634372 SD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain. 634373 DA/ZtmRhd Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_634373 DA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. 634374 E3/ZtmRhd Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_634374 E3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. 634376 LEA/Ncu Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown RRID:RGD_634376 These rats were established from a closed colony of Long-Evans. 634377 BN/Sea BN/Sea Sea Life Supply, Sand City, CA Sea Life Supply inbred Unknown RRID:RGD_634377 This inbred strain was obtained from Sea life Supply 634380 iP/Iusm inbred alcohol-preferring Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 RRID:RGD_634380 These were inbred alcohol-preferring rats developed from outbred alcohol-preferring rats (Iusm:P) at generation 30 at Indiana University for high-alcohol-preferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding. 634381 iNP/Iusm alcohol-nonpreferring Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 RRID:RGD_634381 These were inbred alcohol-nonpreferring rats developed from outbred alcohol-nonpreferring rats (Iusm:NP) at generation 30 at Indiana University for high-alcohol-nonpreferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding. 634382 SHR.BN-(D5Wox12-D5Wox20)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 5 147065698 147065912 1 - by flanking markers 5 149494416 149494629 1 - by flanking markers 5 145726049 145726262 1 - by flanking markers 5 139989554 139989768 1 - by flanking markers RRID:RGD_634382 This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background 634743 BIL NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_634743 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. 724569 MWF/FubRkb Munich Wistar Fromter Freie Universitdt Berlin, Berlin, Germany inbred Unknown RRID:RGD_724569 The MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm). 724570 LEW/Rkb Freie Universitdt Berlin, Berlin, Germany inbred Unknown RRID:RGD_724570 The LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany. 724571 MITE/Mna Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japan inbred Unknown RRID:RGD_724571 This strain was established from captured Japanese wild rats. 724572 SS.LEW-(D10Wox51-D10Rat27)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 71294871 77092169 1 - by flanking markers 10 70062921 74127968 1 - by flanking markers 10 70428844 75983805 1 - by flanking markers 10 68011827 73453136 1 - by flanking markers RRID:RGD_724572 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 724573 SS/JrTol Dahl salt-sensitive (SS/Jr) rats Housed at the University of Toledo College of Medicine and Life Sciences. inbred Live Animals (as of 2021-06-08) RRID:RGD_724573 In the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet. 724574 SHR/NHsd Envigo Envigo inbred Unknown RRID:RGD_724574 SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) 724575 SS.LEW-(D10Rat17-D10Mgh1)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 95066219 95066632 1 - by flanking markers 10 93641751 93641934 1 - by flanking markers 10 93886117 93886300 1 - by flanking markers 10 90627439 90627625 1 - by flanking markers RRID:RGD_724575 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 724576 KDP/Tky Komeda diabetes-prone rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_724576 This is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross. 724577 SS.LEW-(D10Rat27-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 77091834 87834315 1 - by flanking markers 10 74127825 86759484 1 - by flanking markers 10 75983662 86962563 1 - by flanking markers 10 73452992 84007272 1 - by flanking markers RRID:RGD_724577 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728133 BN-RT1n/Rj The Center dElevage R. Janvier, France. coisogenic Unknown RRID:RGD_728133 This coisogenic strain was produced by selecting BN rats with the RT1n allele. 728134 SS.LEW-(D1Rat35-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 157498254 1 - by flanking markers 1 131958920 171330794 1 - by flanking markers 1 130917121 165129939 1 - by flanking markers 1 123479780 154464242 1 - by flanking markers RRID:RGD_728134 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728135 SS.LEW-(D5Uwm14-D5Uwm31)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 48908533 48908825 1 - by flanking markers 5 52440414 52440705 1 - by flanking markers 5 47842131 47842422 1 - by flanking markers 5 47002982 47003274 1 - by flanking markers RRID:RGD_728135 S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain 728137 SS.LEW-(D10Rat141-D10Mgh1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 19 38295381 38295550 1 - by flanking markers 19 51402312 51402480 1 - by flanking markers 10;19 91548145;40571888 91548388;40572056 1 - by flanking markers;1 - by flanking markers 19 36511450 36511619 1 - by flanking markers RRID:RGD_728137 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728138 SS.MNS-(Mme-Gca)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme|Npr1 2167|3098|3195 2 153031724 182740242 1 - by flanking markers 2 173193501 209287892 1 - by flanking markers 2 153799203 189857032 1 - by flanking markers 2 147686913 175950118 1 - by flanking markers RRID:RGD_728138 Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive 728139 WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown RRID:RGD_728139 This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(Shbg-Atp1b2) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(Shbg-Atp1b2) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs 728140 SS.LEW-(D10Rat11-D10Mgh1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10;19 100633512;38295381 100633982;38295550 1 - by flanking markers;1 - by flanking markers 10;19 99184058;51402312 99184250;51402480 1 - by flanking markers;1 - by flanking markers 10;19 99492217;40571888 99492409;40572056 1 - by flanking markers;1 - by flanking markers 10;19 96120911;36511450 96121100;36511619 1 - by flanking markers;1 - by flanking markers RRID:RGD_728140 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728142 BN.SHR-(Il6-Cd36)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Cd36|Il6 2301|2901 4 456799 13554416 1 - by flanking markers 4 3095536 14166434 1 - by flanking markers 4 3043231 14191498 1 - by flanking markers 4 5214602 17410084 1 - by flanking markers RRID:RGD_728142 This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR. 728143 SS.LEW-(D1Mco38-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 110818690 157498254 1 - by flanking markers 1 117836211 171330794 1 - by flanking markers 1 116680361 165129939 1 - by flanking markers 1 110159449 154464242 1 - by flanking markers RRID:RGD_728143 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728144 BN.PD-(D8Rat39-D8Rat35)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 8 49035642 64617259 1 - by flanking markers 8 48981076 65325374 1 - by flanking markers 8 50356432 50356607 1 - by flanking markers 8 46358478 46358654 1 - by flanking markers RRID:RGD_728144 This congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM. 728145 SS.LEW-(D5Rat130-D5Rat108)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 5 31663789 128034027 1 - by flanking markers RRID:RGD_728145 S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain 728146 F344.BN-(D3Mgh13-D3Mgh7)/Dlw Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 3 112319451 112319585 1 - by flanking markers 3 11139240 123812293 1 - by flanking markers 3 5775856 117288411 1 - by flanking markers 3 10549351 112272465 1 - by flanking markers RRID:RGD_728146 This congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USA 728147 BN.PD-(D8Rat39-D8Rat35),SHR-(D4Mgh2-Cd36),SHR-(D20Wox3-D20Mgh5)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown RRID:RGD_728147 This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM. 728148 SS.LEW-(D16Uia2-D16Rat12)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 16 380245 4227730 1 - by flanking markers RRID:RGD_728148 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728151 UPL/Ncc Hiroshima University, School of Medicine, Hiroshima, Japan inbred Unknown RRID:RGD_728151 The UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony. 728152 SS.LEW-(D1Rat196-D1Mgh7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 106445306 1 - by flanking markers 1 59282428 114601028 1 - by flanking markers 1 58354072 113593716 1 - by flanking markers 1 57336763 106047988 1 - by flanking markers RRID:RGD_728152 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728153 SS.LEW-(D1Rat196-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 157498254 1 - by flanking markers 1 59282428 171330794 1 - by flanking markers 1 58354072 165129939 1 - by flanking markers 1 57336763 154464242 1 - by flanking markers RRID:RGD_728153 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728155 BBDR.BBDP-(D4Mit6-D4Mit7)/1Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_728155 This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. 728156 SS.LEW-(D5Mco34-D5Mco10)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 168173895 168174140 1 - by flanking markers 5 171686510 171686754 1 - by flanking markers 5 168109415 168109659 1 - by flanking markers 5 161481433 161481680 1 - by flanking markers RRID:RGD_728156 SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain 728157 SS.LEW-(D5Rat130-D5Mit19)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 140744137 1 - by flanking markers 5 36590997 142892672 1 - by flanking markers 5 31926122 139102349 1 - by flanking markers 5 31663789 133752767 1 - by flanking markers RRID:RGD_728157 SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain 728158 SS.LEW-(D5Uia4-D5Mco10)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 144865363 168174140 1 - by flanking markers 5 147288554 171686754 1 - by flanking markers 5 143523348 168109659 1 - by flanking markers 5 137790781 161481680 1 - by flanking markers RRID:RGD_728158 SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain 728159 SS.LEW-(D1Mco36-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 146189942 1 - by flanking markers 1 131958920 160138947 1 - by flanking markers 1 130917121 153834227 1 - by flanking markers 1 123479780 143506731 1 - by flanking markers RRID:RGD_728159 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. 728161 PD/Cub polydactylous Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic inbred Unknown RRID:RGD_728161 Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the polydactyly-luxate syndrome. 728162 SS.LEW-(D1Mco87-D1Rat71)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 145648742 206567907 1 - by flanking markers 1 159182062 226102807 1 - by flanking markers 1 152870926 219232156 1 - by flanking markers 1 142990289 201278233 1 - by flanking markers RRID:RGD_728162 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. 728163 SS.LEW-(D1Uia2-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_728163 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728165 SS.LEW-(D1Rat196-D1Mco36)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 122992360 1 - by flanking markers 1 59282428 130268180 1 - by flanking markers 1 58354072 129209407 1 - by flanking markers 1 57336763 121834139 1 - by flanking markers RRID:RGD_728165 Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. 728166 WKY.SHRSP-(D1Rat112-D1Wox29)/Izm Shimane Medical University, Izumo, Japan congenic Unknown 1 124614679 206574346 1 - by flanking markers 1 131822204 226109267 1 - by flanking markers 1 130779148 219238616 1 - by flanking markers 1 123350408 201284693 1 - by flanking markers RRID:RGD_728166 A segment from SHRSP/Izm was transferred on a WKY/Izm background 728167 SS.LEW-(Nos2-D10M11Mit119)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Nos2 3185 10 65036884 65072453 1 - by flanking markers 10 65423626 65456957 1 - by flanking markers 10 66188290 66221621 1 - by flanking markers 10 63815308 63851208 1 - by flanking markers RRID:RGD_728167 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728168 WOK Diabetes Research Center, Karlsberg, Germany inbred Unknown RRID:RGD_728168 The inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germany 728170 SS.MNS-(Mme-D2Mit14)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme 2167|3098 2 153031724 197256313 1 - by flanking markers 2 173193501 224018437 1 - by flanking markers 2 153799203 204585731 1 - by flanking markers 2 147686913 189599348 1 - by flanking markers RRID:RGD_728170 Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strain 728171 LEW-RT11/Rj The Center dElevage R. Janvier, France. coisogenic Unknown RRID:RGD_728171 This coisogenic strain was produced by selecting LEW rats with the RT11 allele. 728172 SS.MNS-(D2Mit6-Adh1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Adh1c|Agtr1b|Atp1a1 2044|2071|2167 2 77630629 235811584 1 - by flanking markers 2 98037122 262102977 1 - by flanking markers 2 78321410 243562243 1 - by flanking markers 2 76539322 226808892 1 - by flanking markers RRID:RGD_728172 Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNS 728183 WF/N NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_728183 To N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia. 728184 SHRSP/A3N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-04-21) RRID:RGD_728184 To NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517) 728185 N:NIH outbred Extinct RRID:RRRC_00237 Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony. 728186 LEW/SsN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728186 To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31. 728187 ACI/N-j NIH Autoimmune Rat Model Repository and Development Center congenic Extinct RRID:RGD_728187 Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. 728188 LOU/MN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-09-04) RRID:RGD_728188 To NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. 728189 SHR/N-di NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728189 Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. 728190 RCS-rdy-c Albino retinal dystrophy NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728190 This congenic strain is obtained from pink-eyed, tan-hooded RCS rats 728191 LOU/CN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728191 To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045) 728192 RCS-rdy-p NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728192 This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks. 728193 N:SD Sprague-Dawley NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center outbred Extinct RRID:RRRC_00239 To N 1945 from Sprague Dawley, Inc. Colony closed since then. 728194 SHR/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728194 To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. 728195 SHR/N-cp Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo (as of 2021-01-20) RRID:RRRC_00231 The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolerance. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis. 728196 RHA/N-j NIH Autoimmune Rat Model Repository and Development Center congenic Extinct RRID:RGD_728196 Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. 728197 RCS-rdy-+ NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728197 This congenic strain is obtained from pink-eyed, tan-hooded RCS rats 728198 BHE/N Bureau of Home Economics NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728198 To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University. 728199 RHA Roman high avoidance NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728199 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). 728200 ACI/N-di NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728200 Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41. 728358 SB R. Kalman, Authority for Animal Facilities outbred Unknown RRID:RGD_728358 This outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear. 728383 UPL/Cas Upjohn Pharmaceuticals Limited National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown Gja8m1Cas 13524999 RRID:RGD_728383 In 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating. 728384 SS.LEW-(D10Rat24-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79229067 87834315 1 - by flanking markers 10 78194957 86759484 1 - by flanking markers 10 78343027 86962563 1 - by flanking markers 10 75631887 84007272 1 - by flanking markers RRID:RGD_728384 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728385 WF.COP-(D2Rat2-D2M13Mit286)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 14747814 14747981 1 - by flanking markers 2 14095321 14095488 1 - by flanking markers 2 14237830 14237997 1 - by flanking markers 2 16491740 16491908 1 - by flanking markers RRID:RGD_728385 A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728386 SS.LEW-(D10Rat119-D10Rat133)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 65668639 1 - by flanking markers 10 53273326 64823355 1 - by flanking markers RRID:RGD_728386 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728387 WF.COP-(D2Mit29-D2Uwm13)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 11957973 1 - by flanking markers 2 5396621 11387756 1 - by flanking markers 2 5417336 11522696 1 - by flanking markers 2 7887772 13840758 1 - by flanking markers RRID:RGD_728387 A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728388 SS.LEW-(D10Rat119-D10Mgh1)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 53675478 1 - by flanking markers 10 53273326 53273444 1 - by flanking markers RRID:RGD_728388 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728389 WF.COP-(D2Mit29-D2Rat201)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 49691646 1 - by flanking markers 2 5396621 68633866 1 - by flanking markers 2 5417336 50260392 1 - by flanking markers 2 7887772 49657252 1 - by flanking markers RRID:RGD_728389 A segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728391 WF.COP-(D2Rat253-D2Uwm17)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 25663274 32051637 1 - by flanking markers 2 44171519 50382003 1 - by flanking markers 2 25012974 31224929 1 - by flanking markers 2 26559817 32374088 1 - by flanking markers RRID:RGD_728391 A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728392 RHA/N-di Roman high avoidance-di mutation NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728392 Brattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. 728393 SS.LEW-(D10Got125-D10Rat120)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 86983905 92373412 1 - by flanking markers 10 85965754 91041690 1 - by flanking markers 10 86168841 91270722 1 - by flanking markers 10 83212828 88132643 1 - by flanking markers RRID:RGD_728393 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728394 SS.LEW-(D10Rat55-D10Rat13)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 97152587 1 - by flanking markers 10 87933406 95701443 1 - by flanking markers 10 88140923 95967298 1 - by flanking markers 10 85160679 92699242 1 - by flanking markers RRID:RGD_728394 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728395 SS.LEW-(D10Rat55-D10Rat120)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 92373412 1 - by flanking markers 10 87933406 91041690 1 - by flanking markers 10 88140923 91270722 1 - by flanking markers 10 85160679 88132643 1 - by flanking markers RRID:RGD_728395 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728396 SS.LEW-(D10Mco15-D10Mgh1)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 98392296 98392508 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 10 93995749 93995963 1 - by flanking markers RRID:RGD_728396 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 731185 MWF/Fub Munich Wistar Fromter Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown RRID:RGD_731185 Munich Wistar Fromter rats were obtained from colonies at the Freie Universitat, Benjamin Franklin Campus Berlin, Germany 731186 SHR/Fub Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown RRID:RGD_731186 Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany 731187 Iusm:HAD2 high-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_731187 These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2). 731188 Iusm:LAD2 low-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_731188 These were developed by selective breeding for alcohol preference and consumption from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2). 731189 SHRSP.WKY-(Klk1-D1Rat116)/Izm Department of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, Japan congenic Unknown RRID:RGD_731189 A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method. 731190 SS.LEW-(D1Rat211-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17;1 1147796;43747374 1148037;43747532 1 - by flanking markers;1 - by flanking markers 1 35077728 50297622 1 - by flanking markers 1 33667777 49454378 1 - by flanking markers 1 31050840 49268520 1 - by flanking markers RRID:RGD_731190 A segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. 731191 SHRSP.WKY-(D2Rat14-D2Mgh12)/Gcrc University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 2 42804607 202447032 1 - by flanking markers RRID:RGD_731191 A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. 731192 SS.LEW-(D3Rat52-D3Rat130)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 44551542 1 - by flanking markers 3 19410399 55227748 1 - by flanking markers 3 14090411 48562146 1 - by flanking markers 3 18311454 47233430 1 - by flanking markers RRID:RGD_731192 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 731193 DA.PVG-(D4Rat141-D4Mgh11) Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 151158666 171204531 1 - by flanking markers 4 210231569 230565226 1 - by flanking markers 4 146942075 168047091 1 - by flanking markers 4 148090542 167139601 1 - by flanking markers RRID:RGD_731193 PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies. 731194 SS.LEW-(D3Chm64-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 52127226 121619110 1 - by flanking markers 3 62850379 133513825 1 - by flanking markers 3 56217734 127023997 1 - by flanking markers 3 54740735 121056321 1 - by flanking markers RRID:RGD_731194 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 731195 DA.E3-(D14Wox8-D14Rat64)/Rhd Medical Inflammation Research, BMC, University of Lund, Lund, Sweden congenic Unknown 14 68573958 68574165 1 - by flanking markers 14 67969510 67969716 1 - by flanking markers 14 67944692 67944898 1 - by flanking markers 14 63618971 63619178 1 - by flanking markers RRID:RGD_731195 The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain. 734471 SS.LEW-(D1Mgh7-D1Mco41)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 106445165 227693454 1 - by flanking markers 1 114600888 249451438 1 - by flanking markers 1 113593576 242177304 1 - by flanking markers 1 106047847 221920075 1 - by flanking markers RRID:RGD_734471 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background. 734472 SS.LEW-(D1Mco2-D1Wox6)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 131956599 131956825 1 - by flanking markers 1 58687835 138778112 1 - by flanking markers 1 57761120 137787460 1 - by flanking markers 1 56732484 56732668 1 - by flanking markers RRID:RGD_734472 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background. 734473 SS.LEW-(D17Mco3-D17Mco10)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 17 28967455 70289318 1 - by flanking markers 17 24748228 66699053 1 - by flanking markers 17 22774867 64946465 1 - by flanking markers 17 23080368 59555289 1 - by flanking markers RRID:RGD_734473 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. 734474 SS.LEW-(D5Mit9-D5Mco10)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 62555131 168174140 1 - by flanking markers 5 66128197 171686754 1 - by flanking markers 5 61612600 168109659 1 - by flanking markers 5 60293434 161481680 1 - by flanking markers RRID:RGD_734474 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. 734475 DA/OlaHsd inotiv inotiv inbred Unknown RRID:RGD_734475 Odell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965. 734476 Crl:CD(SD) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_734476 Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system. 734478 F344/DuCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_734478 This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960. 734479 SS.LEW-(D1Mco2-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 58687835 171330794 1 - by flanking markers 1 57761120 165129939 1 - by flanking markers 1 56732484 154464242 1 - by flanking markers RRID:RGD_734479 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background. 734480 SS.LEW-(D10Mit10-D10Mgh1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 102587587 1 - by flanking markers 10 27082535 101157704 1 - by flanking markers 10 27237530 101482600 1 - by flanking markers 10 26521957 98003205 1 - by flanking markers RRID:RGD_734480 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. 734481 SS.LEW-(D1Mco2-D1Mco35)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 238358625 238358813 1 - by flanking markers 1 58687835 259930393 1 - by flanking markers 1 57761120 252708858 1 - by flanking markers 1 56732484 231916666 1 - by flanking markers RRID:RGD_734481 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background. 734482 SS.LEW-(D1Rat45-D1Mco41)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 146189650 227693454 1 - by flanking markers 1 160138797 249451438 1 - by flanking markers 1 153834077 242177304 1 - by flanking markers 1 143506580 221920075 1 - by flanking markers RRID:RGD_734482 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. 734483 SS.LEW-(D1Rat42-D1Wox10)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 135418152 220639653 1 - by flanking markers 1 142342107 244066407 1 - by flanking markers 1 141381406 236763528 1 - by flanking markers 1 133587283 214537671 1 - by flanking markers RRID:RGD_734483 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. 734526 OLETF/Got Otsuka Long Evans Tokushima Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan inbred Unknown RRID:RGD_734526 Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating. 734527 OLETF.F344-(D1Rat169-D1Rat459)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 229876870 267593558 1 - by flanking markers 1 251652807 289700417 1 - by flanking markers 1 244401175 282365384 1 - by flanking markers 1 224054293 260122809 1 - by flanking markers RRID:RGD_734527 Female OLETF/Got rats were crossed with F344/DuCrlCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. 734528 OLETF.BN-(D1Rat76-D1Rat459)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 230411091 267593558 1 - by flanking markers 1 252243728 289700417 1 - by flanking markers 1 244992467 282365384 1 - by flanking markers 1 224569538 260122809 1 - by flanking markers RRID:RGD_734528 Female OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. 734531 OLETF.F344-(D1Rat306-D1Rat461)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 248583506 266234812 1 - by flanking markers 1 268967725 288207792 1 - by flanking markers 1 280850604 280850810 1 - by flanking markers 1 258843780 258843987 1 - by flanking markers RRID:RGD_734531 Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation. 734758 DA/Ham Dark-agouti Shizuoka Laboratory Animal Center Hamamatsu, Japan inbred Unknown RRID:RGD_734758 Original DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). 734759 SHRSP/Gcrc Spontaneously hypertensive rat, stroke prone University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown RRID:RGD_734759 SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH 734760 WKY/Gcrc Wistar-Kyoto University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown RRID:RGD_734760 WKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH 734761 WF/Kga Wistar-Furth Kagoshima University Dental School, Kagoshima, Japan inbred Unknown RRID:RGD_734761 Obtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan). 737657 LEW.1AV1 National Veterinary Institute, Uppsala, Sweden congenic Extinct RRID:RRRC_00201 Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region. 737658 PVG.1AV1 Piebald-Virol-Glaxo Harlan UK, Blackthorn, Bicester, UK congenic Unknown RRID:RGD_737658 Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany 737690 F344/Crli Charles River, Calco, Italy inbred Unknown RRID:RGD_737690 These animals were from Charles River Italia, Calco, LC, Italy 737691 BN/Crli Charles River Laboratories Italy Charles River Laboratories Italy inbred Unknown RRID:RGD_737691 These animals were from Charles River Italia, Calco, LC, Italy 737703 LEW-Tg(HLA-B*0702,B2M)120-4TrgTg/Tg Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-07-08) RRID:RRRC_00042 Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity. 737857 DA.PVG.1AV1-(D4Rat155-D4Rat84) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 185398415 185398530 1 - by flanking markers 4 47848402 246313537 1 - by flanking markers 4 48053950 182171018 1 - by flanking markers 4 49524674 180699135 1 - by flanking markers RRID:RGD_737857 Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737858 DA.PVG.1AV1-(D4Rat155-Spr) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown Spr 3753 4 119365578 119369308 1 - by flanking markers 4 47848402 181496612 1 - by flanking markers 4 48053950 116916073 1 - by flanking markers 4 49524674 117676292 1 - by flanking markers RRID:RGD_737858 Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737859 DA.PVG.1AV1-(D4Mgh17-D4Rat56) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 116611031 143663540 1 - by flanking markers 4 177782842 204673386 1 - by flanking markers 4 113100978 113247809 1 - by flanking markers 4 114921280 114921417 1 - by flanking markers RRID:RGD_737859 Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737861 DA.PVG.1AV1-(D4Rat63-D4Rat203) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 161435775 1 - by flanking markers 4 219683260 224843794 1 - by flanking markers 4 152598827 157826751 1 - by flanking markers 4 153274175 158112799 1 - by flanking markers RRID:RGD_737861 Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737862 SHRSP.WKY-(D2Rat14-D2Mit5)/Gcrc University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 2 42804607 66118463 1 - by flanking markers RRID:RGD_737862 A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. 737863 SHRSP.WKY-(D2Wox9-D2Mgh12)/Gcrc University of Glasgow, Glasgow, UK congenic Unknown Gstm1 2755 2 141259937 210636169 1 - by flanking markers 2 161271919 235592880 1 - by flanking markers 2 141583337 217498710 1 - by flanking markers 2 136445150 202447032 1 - by flanking markers RRID:RGD_737863 A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP 737864 SS.SR-(D13Mit9-D13Mit1)/Jr J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA congenic Unknown 13 25430110 55033994 1 - by flanking markers 13 14281836 63533335 1 - by flanking markers 13 9016742 58537177 1 - by flanking markers 13 5994668 53050594 1 - by flanking markers RRID:RGD_737864 Congenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain. 737865 WKY.SHRSP-(D2Rat14-D2Mgh12) University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 2 42804607 202447032 1 - by flanking markers RRID:RGD_737865 A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY. 737866 WKY.SHRSP-(D2Rat14-D2Mit5) University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 2 42804607 66118463 1 - by flanking markers RRID:RGD_737866 A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY 737867 SS.SR-(D13N1-D13Mit1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 13 25430110 38985930 1 - by flanking markers 13 14281836 48881269 1 - by flanking markers 13 9016742 43785939 1 - by flanking markers 13 5994668 37902821 1 - by flanking markers RRID:RGD_737867 Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain 737868 SS.SR-(Syt2-D13Mit1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Syt2 3804 13 25430110 47699094 1 - by flanking markers 13 14281836 56630530 1 - by flanking markers 13 9016742 51577824 1 - by flanking markers 13 5994668 46197976 1 - by flanking markers RRID:RGD_737868 Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain 737869 OLETF.BN-(D1Rat461-D1Rat459)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 266234605 267593558 1 - by flanking markers 1 288207586 289700417 1 - by flanking markers 1 280850604 282365384 1 - by flanking markers 1 258843780 260122809 1 - by flanking markers RRID:RGD_737869 Female OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study. 737870 DA.E3-(D20Wox3-D20Mgh4)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 3660646 6880472 1 - by flanking markers 20 6935875 7910747 1 - by flanking markers 20 4855475 5875448 1 - by flanking markers 20 3621656 6691706 1 - by flanking markers RRID:RGD_737870 A fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA. 737871 DA.E3-(D12Got46-D12Rat26)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23362298 23845733 1 - by flanking markers 12 27316608 30964880 1 - by flanking markers 12 25307118 29014362 1 - by flanking markers 12 22297209 22692658 1 - by flanking markers RRID:RGD_737871 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 737872 DA.E3-(D4Mit16-D4Mgh11)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 4 130228504 171204531 1 - by flanking markers 4 192286223 230565226 1 - by flanking markers 4 127777294 168047091 1 - by flanking markers 4 128289450 167139601 1 - by flanking markers RRID:RGD_737872 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 737873 DA.E3-(D6Wox5-D6Rat90)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6 117361909 117362003 1 - by flanking markers 6 126582753 126582846 1 - by flanking markers 6 117355600 117355693 1 - by flanking markers 6 112636280 112636374 1 - by flanking markers RRID:RGD_737873 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 737885 RHA/Kun Roman high avoidance Dept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlands inbred Unknown RRID:RGD_737885 Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands 737886 BDX/Cub Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737886 Recombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands 737887 AO/OlaHsd Envigo Envigo inbred Cryorecovery RRID:RGD_737887 These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands 737888 LEW/NHsdCpb Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737888 These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands 737889 LEW/Ipcv inbred Unknown RRID:RGD_737889 These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands 737891 Crl:SD Charles River Laboratories, Inc., Wilmington, MA outbred Unknown RRID:RGD_737891 Sprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory. 737892 ACI/SegHsd Envigo Envigo inbred Unknown Carcinogenesis; Estrogen-induced pituitary growth; Transplant immunology RRID:RGD_737892 This substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc. 737893 F344/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737893 Substrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannover 737894 LEW/Orl Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737894 Substrain of Lewis rats, maintained in Orleans, France 737895 WKY/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737895 Substrain of WKY rats maintained by Dr. H.J. Hedrich, Hannover 737896 BN/Maas Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown RRID:RGD_737896 Substrain of BN rats, maintained by Dr. Alex Maas, The Netherlands 737897 ACI/Kun Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown RRID:RGD_737897 Substrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands 737898 WOKA/K Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany inbred Unknown RRID:RGD_737898 Substrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germany 737899 BN/Cub Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737899 Recombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands 737900 WF/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737900 Recombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germany 737901 LH/Ztu inbred Unknown RRID:RGD_737901 A substrain of LH 737902 BDIX/Orl Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737902 Substrain of BDIX, now maintained in Orleans, France 737903 Hsd:SD Sprague Dawley Envigo outbred Unknown RRID:RGD_737903 Originated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratories' colonies are direct descendants of this original colony. 737904 U/A The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737904 Substrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Institute 737905 LEW/Maas University of Limburg, Netherlands inbred Unknown RRID:RGD_737905 Strain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. 737906 MWF/Hsd Munich Wistar Fromter Harlan inbred Unknown (as of 2020-04-03) RRID:RGD_737906 Substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley 737907 SS.SR-Inha/Jr J.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USA congenic Unknown RRID:RGD_737907 A chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strain 737908 WF/NHsd Envigo Envigo inbred Cryopreserved Embryo (as of 2022-03-24) RRID:RGD_737908 Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley. 737909 R/A The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737909 Substrain of R, from Wistar stock in 1947, to The Netherlands Cancer Institute 737910 ARISTORAT/Wsl Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown RRID:RGD_737910 Substrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgium 737911 BUF/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737911 Substrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germany 737912 SS/JrIpcv Czech Academy of Sciences inbred Unknown RRID:RGD_737912 strain originated from Dr. John P. Rapp, Medical College of Ohio, USA 737913 E3/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737913 Substrain of E3, from Dr. H.J. Hedrich, Hannover, Germany 737914 SDL/Ipcv inbred Unknown RRID:RGD_737914 Substrain of SDL 737915 R/AWa Dept of Genetics, Agricultural University, Wageningen, The Netherlands inbred Unknown RRID:RGD_737915 Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 737916 DZB/Gro Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown RRID:RGD_737916 Substrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningen 737917 WF/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737917 Substrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmark 737918 BN/Orl Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737918 Substrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, France 737919 LEW/Han Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737919 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany 737920 BH/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737920 Substrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973 737921 BDIV/lfz inbred Unknown RRID:RGD_737921 Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971) 737922 LEW/SsNHsd ENVIGO ENVIGO inbred Unknown RRID:RGD_737922 Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNHsd rats were descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland USA. Harlan became Envigo in 2015. 737923 SHR/Maas Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown RRID:RGD_737923 Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands 737924 WAG/Rij Harlan Sprague Dawley, Indianapolis, IN inbred Unknown RRID:RGD_737924 Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979 737925 BN/Gro Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown RRID:RGD_737925 Substrain of BN, from Billingham and Silvers 1958, to U of Groningen 737926 F344/NCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_737926 Derived from NIH stock in 1992 by SASCO. To Charles River in 1996. 737927 ALC/Colle inbred Unknown RRID:RGD_737927 Substrain of ALC 737928 BN/NHsdCpb Harlan CPB, Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737928 Substrain of BN, from Billingham and Silvers 1958 737929 Crl:WI Wistar rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_737929 To Scientific Products Farm, Ltd. [predecessor of Charles River United Kingdom (CRUK)] in 1947 from Wistar Institute. To Charles River in 1975 from CRUK. This particular colony was selected because of a low incidence of hydronephrosis. 737930 LEW/Ztm LEW/Ztm Tierlaboratorium der Medizinischen Hochschule Hannover, Germany inbred Unknown Ncf1 61307 RRID:RGD_737930 This inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, Germany 737931 GC/Kun inbred Unknown RRID:RGD_737931 737932 LEW/Crl Lewis Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_737932 Developed by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34. 737933 SD/A The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737933 Sprague-Dawley stock initiated by R. Dawley in 1925 737934 BN/RijKun Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown RRID:RGD_737934 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic University 737935 LEW/Nhg Gesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, Germany inbred Unknown RRID:RGD_737935 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germany 737936 SR/JrIpcv Baylor College of Medicine, Houston, TX inbred Unknown RRID:RGD_737936 Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962) 737937 SDH/Ztu inbred Unknown RRID:RGD_737937 unknown 737938 AUG/OlaHsd Envigo Envigo inbred Cryorecovery RRID:RGD_737938 Substrain of AUG, derived from US August substrains in 1951 737939 BBWB/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737939 unknown 737940 PAR/Wsl Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown RRID:RGD_737940 unknown 737941 LEP/Cub Dr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737941 Substrain of LEP, from Charles University cross of outbred animals 737942 LE/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737942 Substrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973 737943 R/AEurRij Dr. Adam Goedde, Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Unknown RRID:RGD_737943 Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 737944 BN/RijN Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Extinct (as of 2023-12-14) RRID:RGD_737944 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk 737945 BN/Han Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737945 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973. 737946 WAG/OlaHsd Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737946 Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawley 737947 BDII/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737947 Substrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971) 737948 BDE/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737948 Substrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color. 737949 A2/Colle Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown RRID:RGD_737949 unknown 737950 DA/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737950 Substrain of DA/OlaHsd, to Hannover after 1965 737951 CAP/Kuv Dr. HU Wottge, Universitat Kiel, Kiel, Germany inbred Unknown RRID:RGD_737951 unknown 737952 ACI/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737952 unknown 737953 LEW/Gut inbred Unknown RRID:RGD_737953 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germany 737954 AS/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737954 unknown 737955 Hooded/Colle Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown RRID:RGD_737955 unknown 737956 WF/Gut inbred Unknown RRID:RGD_737956 substrain of Wistar Furth stock, from J Furth in 1945 737957 WOKW/K Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany National BioResource Project for the Rat in Japan inbred Unknown Diabetes Obesity; Metabolism RRID:RGD_737957 Substrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991 737958 CHOC/Cub Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown RRID:RGD_737958 unknown 737959 RNU/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737959 unknown 737960 Hsd:WI Wistar Envigo outbred Unknown RRID:RGD_737960 These are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan. 737961 SR/JrMol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737961 Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaard 737962 SPRD/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737962 Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976 737963 LEW/Cub Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown RRID:RGD_737963 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Prague 737964 BN/OlaHsd Harlan inbred Unknown RRID:RGD_737964 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis 737965 AGUS/OlaHsd Harlan inbred Unknown RRID:RGD_737965 Substrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968 737966 LEW/Kuv Universitat Kiel, Kiel, Germany inbred Unknown RRID:RGD_737966 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germany 737967 BS/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737967 Substrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988 737968 BN/Gut inbred Unknown RRID:RGD_737968 Substrain of BN, from Billingham and Silvers 1958 737969 NAR/SaU non-albumin rat Dept of Laboratory Animal Science, University of Utrecht, The Netherlands inbred Unknown RRID:RGD_737969 Substrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrecht 737970 AMORAT/Wsl Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, Belgium inbred Unknown RRID:RGD_737970 unknown 737971 SHRSP/Rivm National Institute of Public Health and Environmental Protection, The Netherlands inbred Unknown RRID:RGD_737971 unknown 737972 BN/Crl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_737972 Silvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976. 738038 HEP high ethanol preferring Institut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, France inbred Unknown RRID:RGD_738038 High ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USA 738120 LEW-Tg(HLA-B*2705m1,B2M)133-1TrgTg/Tg Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-20) RRID:RRRC_00043 This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating. 738122 SD-Tg(UBC-EGFP)1BalRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) RRID:RRRC_00052 This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals. 1298093 LEW/NHsd Envigo inbred Unknown RRID:RGD_1298093 Descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. Maintained at Harlan-Sprague Dawley (Indianapolis, Indiana) . 1299868 SS.SR-(D7Uia1-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 113014423 1 - by flanking markers 7 112367543 116100169 1 - by flanking markers 7 112429186 112429483 1 - by flanking markers 7 103146217 103146515 1 - by flanking markers RRID:RGD_1299868 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 1299869 SS.SR-(Cyp11b1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_1299869 Congenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strain 1299870 SS.LEW-(D5Uia8-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 121964356 134872385 1 - by flanking markers 5 124025017 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 5 128033842 128034027 1 - by flanking markers RRID:RGD_1299870 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1299871 DA.F344-(D20Arb2-D20Arb8)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_1299871 Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299872 DA.F344-(D8Arb15-D8Arb22)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 8 71843628 124310337 1 - by flanking markers 8 77653284 127239929 1 - by flanking markers 8 73320439 128033168 1 - by flanking markers 8 68133439 119085047 1 - by flanking markers RRID:RGD_1299872 Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299873 SS.LEW-(D5Mco34-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 134871897 134872385 1 - by flanking markers 5 137107818 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 5 128033842 128034027 1 - by flanking markers RRID:RGD_1299873 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1299874 OLETF.F344-(D1Rat166-D1Rat90)/Tj Laboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_1299874 Female OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol. 1299875 DA.F344-(D7Rat22-D7Mit2)/Nsi The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 7 76615341 123191874 1 - by flanking markers 7 125794079 125794357 1 - by flanking markers 7 126080176 126080454 1 - by flanking markers 7 116294265 116294546 1 - by flanking markers RRID:RRRC_00679 Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous state 1299876 SS.LEW-(D5Rat54-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 126386030 134872385 1 - by flanking markers 5 128816449 137108002 1 - by flanking markers 5 124957483 133313852 1 - by flanking markers 5 120182440 128034027 1 - by flanking markers RRID:RGD_1299876 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1299877 DA.F344-(D10Rat204-D10Arb22)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 10 95695076 95695218 1 - by flanking markers 10 94240348 107484761 1 - by flanking markers 10 107857524 107857673 1 - by flanking markers 10 104060133 104060283 1 - by flanking markers RRID:RGD_1299877 Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299878 DA.F344-(D4Arb30-D4Arb4)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 73972453 154937227 1 - by flanking markers 4 216606296 216606455 1 - by flanking markers 4 150682435 150682594 1 - by flanking markers 4 151805502 151805662 1 - by flanking markers RRID:RGD_1299878 The DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley 1299879 SS.SR-(D7Mco7-D7Wox19)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 113044000 113044249 1 - by flanking markers 7 116151764 116152012 1 - by flanking markers 7 116249395 116249643 1 - by flanking markers 7 106839225 106839474 1 - by flanking markers RRID:RGD_1299879 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 1299880 F344.DA-(D20Arb2-D20Arb8)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_1299880 Region of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299881 SS.LEW-(D5Wox3-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 99080786 134872385 1 - by flanking markers 5 101964092 137108002 1 - by flanking markers 5 97921932 133313852 1 - by flanking markers 5 94858972 128034027 1 - by flanking markers RRID:RGD_1299881 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1300432 HAA/FDSC Hatano High Avoidance Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_1300432 In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation. 1300433 LAA/FDSC Hatano Low Avoidance Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_1300433 In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation. 1300439 SD-Tg(UBC-EGFP)2BalRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) RRID:RRRC_00065 This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21. 1302359 HsdFcen:SD Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred Unknown RRID:RGD_1302359 These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. 1302360 W/HsdFcen Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina inbred Unknown RRID:RGD_1302360 These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. 1302372 SDDIO/Rrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00044 This strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet. 1302373 SDDR/Rrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00045 This strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet. 1302377 SPRD-Anks6PKD/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-07) Anks6PKD 11534996 5 63633540 63674953 7 5 67163440 67204853 7 5 62642974 62684387 7 5 61309183 61350596 7 RRID:RRRC_00046 From outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 (Anks6) mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002. 1302416 ACI.DA-(D10Rat2-D10Rat19)/Arb Center for Genomics and Human Genetics, Manhasset, New York congenic Unknown RRID:RGD_1302416 A fragment from DA/OlaHsd rats is transferred to ACI/SegHsd. 1302597 LEXF7C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302597 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302598 FXLE26/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302598 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302599 WKY/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302599 This strain originated from Takeda Chemical Industries, Ltd., Japan 1302600 HTX/Kyo hydrocephalus texas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology RRID:RGD_1302600 1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992. 1302601 FXLE23/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302601 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302602 FXLE12/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302602 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302603 FXLE25/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302603 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302604 LEXF4/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302604 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302605 LEXF2A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer RRID:RGD_1302605 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302606 SHRSP/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302606 This strain originated from Takeda Chemical Industries, Ltd., Japan 1302607 FXLE21/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302607 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302608 CXH6/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302608 Strain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan 1302610 KMI/Tky miniature rat ishikawa National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis Prkg2 3401 RRID:RGD_1302610 Miniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College. 1302611 FXLE24/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302611 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302612 LEXF10C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302612 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302613 BN/fMaiHok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_1302613 Kyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21 1302614 WKY/NMna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302614 Inbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain. 1302615 FXLE14/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302615 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302616 LEXF10B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302616 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302617 LEXF6B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302617 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302618 LEXF9/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302618 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302619 FXLE16/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-16) Diabetes Obesity; Cancer RRID:RGD_1302619 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302620 SHR/Kyo spontaneous hypertension rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-12) Cardio Hypertension RRID:RGD_1302620 Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). 1302621 LEXF10A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302621 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302622 WF/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_1302622 Inbred originated from Kagoshima University, Japan. 1302623 TM/Kyo tester moriyama rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Hematology Rab38ru 1600311 RRID:RGD_1302623 Tester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 . 1302624 RICO/Ngs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Ophthalmology RRID:RGD_1302624 Strain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan. 1302625 F344.OLETF-(D16Wox4-D16Rat13)/Tj National BioResource Project for the Rat in Japan congenic Unknown 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 16 48143982 73187298 1 - by flanking markers RRID:RGD_1302625 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302626 BN.UPL-(D2Rat134-D2Rat2)/Cas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology 2 14747814 190963154 1 - by flanking markers 2 14095321 217785884 1 - by flanking markers 2 14237830 198298901 1 - by flanking markers 2 16491740 183719262 1 - by flanking markers RRID:RGD_1302626 Strain originated from Hiroshima University, Japan 1302627 F344/NSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302627 Strain originated from Japan SLC, Inc, Shizuoka, Japan. 1302628 ACIS/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302628 Spontaneous mutation from ACI/Hok in 1981. 1302629 WKY.SHRSP-(D1Rat49-D1Rat112)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302629 The desired fragment is transferred from SHRSP to WKY. 1302630 F344.OLETF-(D10Wox7-D10Wox6)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 10 98952626 98952741 1 - by flanking markers RRID:RGD_1302630 Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. 1302631 BN/SsNSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Immunology RRID:RGD_1302631 Strain originated from Japan SLC, Inc, Shizuoka, Japan. 1302632 WKY.SHRSP-(D1Smu11-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302632 The desired fragment is transferred from SHRSP to WKY. 1302633 FXLE20/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302633 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302634 BB/WorTky BioBreeding rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Diabetes Obesity; Immunology RRID:RGD_1302634 Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983. 1302635 F344.OLETF-(D12Rat8-D12Rat16)/Tj National BioResource Project for the Rat in Japan congenic Unknown 12 23934730 31489223 1 - by flanking markers 12 27805580 36160041 1 - by flanking markers 12 25799119 34265075 1 - by flanking markers 12 22779459 30427275 1 - by flanking markers RRID:RGD_1302635 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302636 WKY.SHRSP-(D1Wox29-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_1302636 This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background 1302637 LAA Hatano Low Avoidance Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown RRID:RGD_1302637 Strain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan 1302638 LEXF11/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302638 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302639 KHR/Kyo kaken hairless rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Dermatology Oca2 2318412 1 115683593 115991040 7 1 114661970 114987433 7 1 107116278 107446093 7 RRID:RGD_1302639 Kaken hairless rat were detected by Kimura from Gunn 1302640 ACI/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302640 Strain originated from The University of Tokushima, Tokushima, Japan. 1302641 LEXF1A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302641 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302642 LEA/Hkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_1302642 Strain originated at the University of Tokushima, Japan. 1302643 ACI/NKyo august copenhagen irish National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Reproduction RRID:RGD_1302643 NIH (1988, F143) > Kyo (F43) 1302644 CXA5/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302644 Strain originated at the University of Tokushima, Japan. 1302645 DMY/Kyo demyelination rat The Laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991 via Institute Pasteur, Paris National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29) Neurobiology Mrs2dmyKyo 12793071 RRID:RGD_1302645 From a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996). 1302646 LEXF2C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302646 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302647 F344.OLETF-(D5Rat166-D5Rat90)/Tj Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan congenic Unknown 5 137718909 139664499 1 - by flanking markers 5 140063670 141938308 1 - by flanking markers 5 136271682 138128882 1 - by flanking markers 5 130881210 132691399 1 - by flanking markers RRID:RGD_1302647 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302648 LEC/Hok Long Evans Cinnamon National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown (as of 2016-12-01) Cancer; Immunology Atp7bhts 11532742 RRID:RGD_1302648 At the Center for Experimental Plants and Animals, Hokkaido University, LEC, along with LEA, was established from a closed colony of Long-Evans rats obtained from Kobe University in 1975. In 1984, within the LEC rats of their F24 generation, a rat exhibiting spontaneous hepatitis with severe jaundice was found (Yoshida, 1987). The LEC was available from Charles River Japan, Inc., Kanagawa, as of spring, 1991. 1302649 LEXF7B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302649 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302650 F344.OLETF-(D9Mgh8-D9Rat15)/Tj National BioResource Project for the Rat in Japan congenic Unknown 9 33374546 62634991 1 - by flanking markers 9 40808491 71887966 1 - by flanking markers 9 41139089 70686886 1 - by flanking markers 9 36840385 65383934 1 - by flanking markers RRID:RGD_1302650 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302651 CXA1/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302651 Strain originated from the The University of Tokushima, Japan. 1302652 LEXF7A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302652 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302653 LEXF8A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302653 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302654 F344.OLETF-(D7Mgh16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 103612739 123191874 1 - by flanking markers 7 106942155 125794357 1 - by flanking markers 7 106995385 126080454 1 - by flanking markers 7 98011396 116294546 1 - by flanking markers RRID:RGD_1302654 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred. 1302655 TO/Hkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302655 Strain originated from the Graduate School of Medicine, Hokkaido University, Japan. 1302656 LEA/Hok Long Evans Agouti National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown (as of 2016-12-01) RRID:RGD_1302656 Long Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour . It is used as the control strain of the LEC rat, which is reported to exhibit several mutant phenotypes such as hepatic disorder (hts), blockage of the T cell differentiation (thid) and X-ray hypersensitivity (xhs1 and xhs2). 1302657 DOP/Nem dilute-opisthotonus (dop) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Myo5a 3143 RRID:RGD_1302657 Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established. 1302658 LEJ/Hkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302658 Strain originated at the Graduate School of Medicine, Hokkaido University, Japan. 1302659 CXH5/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302659 Strain originated at the University of Tokushima, Japan. 1302660 RCS/Kyo royal college of surgeons rat Department of Ophthalmology & Visual Sciences, Kyoto University National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29) Ophthalmology Mertkrdy 40902839 RRID:RGD_1302660 From Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998. 1302661 F344.OLETF-(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 14 1217606 39153750 1 - by flanking markers RRID:RGD_1302661 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred. 1302662 CXH2/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302662 Strain originated at the University of Tokushima, Japan. 1302663 F344.OLETF-(D11Rat4-D11Rat1)/Tj National BioResource Project for the Rat in Japan congenic Unknown 11 64573222 84443333 1 - by flanking markers 11 66731054 89693367 1 - by flanking markers 11 65352097 86593596 1 - by flanking markers 11 62790342 82450994 1 - by flanking markers RRID:RGD_1302663 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302664 WNA/Nshm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302664 Nagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research 1302665 FXLE13/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302665 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302666 LEXF1C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302666 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302667 F344.OLETF-(D5Mgh5-D5Mgh23)/Tj National BioResource Project for the Rat in Japan congenic Unknown 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 5 43726656 109897936 1 - by flanking markers RRID:RGD_1302667 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302668 IS-Tlk/Kyo tail anomaly lethal kyoto National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Osteosis RRID:RGD_1302668 Spontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto) 1302669 HAA Hatano High Avoidance Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown RRID:RGD_1302669 Strain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan. 1302670 ACI/NSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302670 Strain is from Japan SLC, Inc., Shizuoka, Japan. 1302671 WM/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302671 Strain is from the University of Tokushima, Japan. 1302672 W/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302672 Hok>Hkm>Kyo 1302673 FXLE15/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302673 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302674 VF/Kyo vacuole formation rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-10) Neurobiology RRID:RGD_1302674 The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS). A nonsense mutation in the dopey family member 1 (Dopey1) was identified as the likely causative gene for the neurological disease phenotype of the VF rat. 1302675 WKY.SHRSP-(D1Smu13-D1Smu11)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302675 The desired fragment is transferred from SHRSP to WKY. 1302676 NER/Slc noda epileptic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Neurobiology RRID:RGD_1302676 Strain is from Japan SLC, Inc. Shizuoka, Japan. 1302677 NIG-III/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302677 Strain is from the University of Tokushima, Japan. 1302678 NAR/Slc non albumin rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals (as of 2024-09-24) Hematology RRID:RGD_1302678 Strain originated from Japan SLC, Inc, Shizuoka, Japan. 1302679 TRMR/Kyo tremor resistant National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Unknown Aspa 621693 RRID:RGD_1302679 Tremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. This strain is a substrain of TRM/Kyo and does not show tremor behavior. This strain carrying wild type Hcn1, is considered as segregating inbred strain of TRM. 1302680 SHR/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302680 Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan. 1302681 WKY.SHRSP-(D1Smu11-D1Rat112)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302681 The desired fragment is transferred from SHRSP to WKY. 1302682 FXLE18/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302682 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302683 FXLE22/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer RRID:RGD_1302683 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302684 F344/NHok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1302684 Dwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals 1302685 F344.OLETF-(D14Rat8-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 14 30320092 65026991 1 - by flanking markers RRID:RGD_1302685 Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment. 1302686 F344/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302686 Derived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating. 1302687 WKAH/HkmSlc Wistar King A, Hokkaido National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302687 Strain originated from Japan SLC, Inc., Shizuoka, Japan. 1302688 ACI/NMna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302688 This strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan. 1302689 WKY.SHRSP-(Ntrk3-D1Smu13)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302689 The desired fragment is transferred from SHRSP to WKY. 1302690 FXLE19/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302690 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302691 ALB/Hok Albany National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Dentistry RRID:RGD_1302691 Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1302692 WKY.SHRSP-(D1Wox18-D1Rat44)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302692 The desired fragment is transferred from SHRSP to WKY. 1302693 KZ-LeprfaTky National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Metabolism Lepr 3001 RRID:RGD_1302693 A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980. 1302694 WKA/Seac National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology RRID:RGD_1302694 Wistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979 1302695 SER/Kyo spontaneously epileptic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrn|Aspa 69063|621693 RRID:RGD_1302695 Spontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac 1302696 FH/HamSlc fawn hooded rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302696 Strain originated at Japan SLC, Inc., Shizuoka , Japan. 1302697 KND/Tky komeda non-diabetic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity RRID:RGD_1302697 Komeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls. 1302698 SDR/Slc Spontaneous dwarf rat Japan SLC, Inc National BioResource Project for the Rat in Japan, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-05-04) Metabolism Gh1sdr 12880380 RRID:RRRC_00066 The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype. This spontaneous mutation affected the 3' splice/acceptor site. Judging from this point mutation, one would predict an abnormal splicing and a 1-base deletion in the GH mRNA. Strain is from Japan SLC, Inc., Shizuoka, Japan. 1302699 LEXF8D/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302699 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302700 HOB/Snk hobble rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology Unc5c|Unc5chob 735109|12802353 RRID:RGD_1302700 HOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13. 1302701 LEW/SsNSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2020-08-26) Immunology RRID:RGD_1302701 Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNSlc rats were descended from a colony obtained from the National Institutes of Health, Bethesda, Maryland USA in 1994 to Japan SLC, Inc.,Shizuoka, Japan. 1302702 TRM/Kyo tremor rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) Neurobiology Aspa|Hcn1A354V 621693|13464319 RRID:RGD_1302702 In 1980, a spontaneous tremor mutant rat was found in the colony of Kyo:Wistar (Yamada, 1985). This disorder was found to be caused by an autosomal recessive gene and was designated tremor (tm). Deletion of Aspa gene was identified in the animal with no aspartoacylase activity in the brain and measurable level of activity in the kidney. TRM was established as a segregating inbred strain. In F18 progeny, a rat which did not have tm mutation was separated and established as a control strain of WTC (NBRP No.0020). (Dec 8, 2010) 1302703 WKY.SHRSP-(D1Wox29-D1Rat112)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302703 The desired fragment is transferred from SHRSP to WKY. 1302704 WKY.SHRSP-(D1Wox29-D1Rat199)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302704 The desired fragment is transferred from SHRSP to WKY. 1302705 WKY.SHRSP-(D1Wox29-D1Smu13)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302705 The desired fragment is transferred from SHRSP to WKY. 1302706 F344.OLETF-(D5Rat32-D5Rat26)/Tj National BioResource Project for the Rat in Japan congenic Unknown 5 119332868 139659574 1 - by flanking markers 5 121495621 141933383 1 - by flanking markers 5 117554114 138123957 1 - by flanking markers 5 113558156 132686472 1 - by flanking markers RRID:RGD_1302706 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302707 LEXF3/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302707 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302708 FXLE17/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302708 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302709 WKY/Hcm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_1302709 Strain is from the Hyogo College of Medicine, Japan. 1302710 LEXF2B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302710 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302711 ExHC/Seac National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1302711 Isolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993 1302712 ZIMY/Kyo Zitter Masao Yamada National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-17) Neurobiology Atrn 69063 RRID:RGD_1302712 ZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada). This strain is homozygous for zi and wild-type for tm. ZIMY (Zitter Masao Yamada) 1302713 F344.OLETF-(D8Rat58-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown 8 19796514 48675424 1 - by flanking markers 8 21850030 48631820 1 - by flanking markers 8 50007641 50007776 1 - by flanking markers 8 46008836 46008974 1 - by flanking markers RRID:RGD_1302713 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302714 KZC/Tky Komeda Zucker Creeping rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Reln 3553 RRID:RGD_1302714 Komeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983. 1302715 WKY.SHRSP-(D1Wox18-D1Wox29)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302715 The desired fragment is transferred from SHRSP to WKY. 1302716 OM/NSlc Osborne-Mendel rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302716 The Instutite of Medical Science, The University of Tokyo to Slc (1985) 1302717 ACI/NHok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302717 NIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135 1302718 HWY/Slc hairless wistar yagi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Dermatology RRID:RGD_1302718 Strain is from Japan SLC, Inc., Shizuoka, Japan. 1302719 DON/Kyo Donryu rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302719 Japanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2 1302720 CXH10/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302720 Strain is from the University of Tokushima, Japan. 1302721 LEC/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) Cancer Atp7bhts 11532742 RRID:RGD_1302721 Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989 1302722 PVG/Seac Piebald Virol Glaxo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology RRID:RGD_1302722 Strain is from Seac Yoshitomi, LTD., Fukuoka, Japan. 1302723 LEXF5/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302723 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302724 SHR/Hcm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302724 Strain is from the Hyogo College of Medicine, Japan. 1302726 ZI/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology Atrnzi 40902832 RRID:RGD_1302726 Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. 1302727 SHRSR/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302727 Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan. 1302728 MES/Slc Matsumoto Eosinophilia Shinshu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Hematology Cybam1Sdi 13209000 RRID:RGD_1302728 Derived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999) 1302729 LEA/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer RRID:RGD_1302729 Found in Long Evans strain at Kobe University; Inbreeding at Hokkaido University; Otsuka Pharmaceutical Co.; The University of Tokushima 1989 1302795 HTG Prague hypertriglyceridemic Institute of Physiology, Academy of Sciences Prague, Czech Republic inbred Unknown RRID:RGD_1302795 These were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding. 1302921 F344-Tg(NPHS2-HBEGF)Wig Division of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, Michigan transgenic Unknown RRID:RGD_1302921 hDTR (HBEGF) cDNA was inserted at the 3' of the 2.5 kb human podocin (NPHS2) promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs. 1303393 LEC/Ncu Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown RRID:RGD_1303393 These rats were established from a closed colony of Long-Evans. 1304487 BBDR/Wor inbred Unknown RRID:RGD_1304487 Diabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies. 1331811 LEW.BN-(D10Rat32-D10Rat133)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 10 51779662 51779830 1 - by flanking markers RRID:RGD_1331811 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331812 LEW.BN-(D10Rat83-D10Rat133)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46860047 65668639 1 - by flanking markers 10 46728252 64823355 1 - by flanking markers 10 46955258 46955430 1 - by flanking markers 10 45393829 45394002 1 - by flanking markers RRID:RGD_1331812 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331813 BN.GK-(D8Rat29-D8Got130)/Ox Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 74769551 87069779 1 - by flanking markers 8 76345502 89012772 1 - by flanking markers 8 89482236 89482480 1 - by flanking markers 8 82872062 82872307 1 - by flanking markers RRID:RGD_1331813 This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 1331814 BN.GK-(D8Got302-D8Got130)/Ox Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 48185711 87069779 1 - by flanking markers 8 48160321 89012772 1 - by flanking markers 8 49533872 89482480 1 - by flanking markers 8 45539309 82872307 1 - by flanking markers RRID:RGD_1331814 This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 1331815 LEW/Mol LEW/Mol Mollegaard Breeding Center Ltd., Denmark inbred Unknown Ncf1 61307 RRID:RGD_1331815 This substrain can be traced originally to Scripps Clinic, La Jolla, to University of Pennsylvania to Simonsen Laboratories in 1966, to Institute of Pathological Anatomy, University of Copenhagen, Denmark 1973. From University of Copenhagen to M&B A/S (Mollegaard Breeding Center Ltd., Denmark ) from 1977 to 2002. (now Taconic Europe) 1331816 DA.ACI-(D10Rat2-D10Rat29)/Kini Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology; Immunology 10 68842878 68843272 1 - by flanking markers 10 67642121 110568670 1 - by flanking markers 10 67988035 110992275 1 - by flanking markers 10 107057622 107057807 1 - by flanking markers RRID:RGD_1331816 (DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA. 1331817 BN.LEW-(D10Rat32-D10Mgh4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 96799937 1 - by flanking markers 10 53381898 95372987 1 - by flanking markers 10 53630865 95638337 1 - by flanking markers 10 51779662 92369470 1 - by flanking markers RRID:RGD_1331817 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331818 LEW.BN-(D10Rat43-D10Mco4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 42042465 1 - by flanking markers 10 22266756 41793199 1 - by flanking markers 10 22402817 41976505 1 - by flanking markers 10 22918268 40741723 1 - by flanking markers RRID:RGD_1331818 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331819 F344/Eer F344/Eer Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown RRID:RGD_1331819 Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana 1331820 LEW.BN-(D10Got9-D10Rat2)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 5641331 5641541 1 - by flanking markers 10 4578252 110568670 1 - by flanking markers 10 5760565 110992275 1 - by flanking markers 10 5684047 107057807 1 - by flanking markers RRID:RGD_1331820 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331821 LEW.BN-(D10Wox26-D10Arb4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 30343658 46737218 1 - by flanking markers 10 30131785 46592053 1 - by flanking markers 10 30303447 46835685 1 - by flanking markers 10 29659462 45274336 1 - by flanking markers RRID:RGD_1331821 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331822 DA.ACI-(D10Rat2-D10Rat6) Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 106310811 106310957 1 - by flanking markers 10 104746165 110568670 1 - by flanking markers 10 105077900 110992275 1 - by flanking markers 10 101435864 107057807 1 - by flanking markers RRID:RGD_1331822 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331823 LEW.BN-(D10Rat43-D10Rat27)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 77092169 1 - by flanking markers 10 22266756 74127968 1 - by flanking markers 10 22402817 75983805 1 - by flanking markers 10 22918268 73453136 1 - by flanking markers RRID:RGD_1331823 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331824 DA.ACI-(D10Rat219-D10Rat29) Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 68842878 81986757 1 - by flanking markers 10 67642121 80884595 1 - by flanking markers 10 67988035 81042642 1 - by flanking markers 10 78306880 78307017 1 - by flanking markers RRID:RGD_1331824 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331826 LEW.BN-(D10Mgh7-D10Rat27)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 77092169 1 - by flanking markers 10 55720558 74127968 1 - by flanking markers 10 55978483 75983805 1 - by flanking markers 10 54098674 73453136 1 - by flanking markers RRID:RGD_1331826 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331827 DA.ACI-(D10Rat10-D10Rat142) Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 92448353 100301488 1 - by flanking markers 10 91113514 98868127 1 - by flanking markers 10 91345679 99171690 1 - by flanking markers 10 88207600 95803900 1 - by flanking markers RRID:RGD_1331827 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331828 DA.ACI-(D10Rat12-D10Rat144) Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 86290650 99198997 1 - by flanking markers 10 85276455 97759008 1 - by flanking markers 10 85487741 98044833 1 - by flanking markers 10 82538790 94725019 1 - by flanking markers RRID:RGD_1331828 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331829 BN.LEW-(D9Got8-D9Got200)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 9 3811425 3811711 1 - by flanking markers 9 2597055 9698468 1 - by flanking markers 9 2657610 10706733 1 - by flanking markers 9 1185844 4302019 1 - by flanking markers RRID:RGD_1331829 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331830 F344.BN-(D5Rat1-D5Mit5)/Dlw Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 5 35911094 109163425 1 - by flanking markers 5 39876314 112058005 1 - by flanking markers 5 35225432 108092802 1 - by flanking markers 5 34730116 104251008 1 - by flanking markers RRID:RGD_1331830 This congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USA 1331831 LEW.BN-(D10Rat173-D10Rat133)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 37505289 65668639 1 - by flanking markers 10 37209026 64823355 1 - by flanking markers 10 37435916 37436126 1 - by flanking markers 10 36244402 36244613 1 - by flanking markers RRID:RGD_1331831 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331832 BN.LEW-(D10Rat72-D10Arb4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 46737218 1 - by flanking markers 10 46591952 46592053 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 10 45274234 45274336 1 - by flanking markers RRID:RGD_1331832 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331833 DA.ACI-(D10Rat15-D10Rat29) Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 68842878 96667338 1 - by flanking markers 10 67642121 95243104 1 - by flanking markers 10 67988035 95508221 1 - by flanking markers 10 92238327 92238497 1 - by flanking markers RRID:RGD_1331833 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331834 BN.LEW-(D10Rat100-D10Rat126)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 26434477 26434620 1 - by flanking markers 10 26363403 42526523 1 - by flanking markers 10 26517020 42716241 1 - by flanking markers 10 25790546 41482228 1 - by flanking markers RRID:RGD_1331834 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331836 WKY/Eer WKY/Eer Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown RRID:RGD_1331836 Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana 1354669 BN/OrlIcoCrlf Charles River France Charles River France inbred Unknown RRID:RGD_1354669 Strain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991. 1354670 F344/IcoCrlf Charles River France Charles River France inbred Unknown RRID:RGD_1354670 These are inbred rats that were bought from Charles River, Les Oncins near Lyon, France. 1357172 WF.BBDR-(D4Arb29-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 121645621 1 - by flanking markers 4 63250011 183837621 1 - by flanking markers 4 63537179 63537431 1 - by flanking markers 4 64528739 64528994 1 - by flanking markers RRID:RGD_1357172 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357173 SS.MNS-(Vamp2-D10M11Mit84)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 55852132 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 10 53793581 53797815 1 - by flanking markers RRID:RGD_1357173 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 1357174 BBDR.BBDP-(D4Mit6-D4Mit24)/Rhw Department of Medicine University of Washington, Seattle, Washington congenic Unknown 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 4 76647384 78882945 1 - by flanking markers RRID:RGD_1357174 S. Bieg and coworkers (1998) generated this congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ñ 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. Lacks one C nucleotide at 478 position which causes a frameshift mutation in the ORF of exon 3 forming a significantly truncated protein. 1357175 F344.DR-(D4Mit6-D4Mit24)-Tg(Gimap5)Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin transgenic Unknown RRID:RGD_1357175 Wild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(D4Mit6-D4Mit24) 1357176 WF.BBDR-(D4Arb29-D4Rat96)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 65434807 1 - by flanking markers 4 63250011 65397196 1 - by flanking markers 4 63537179 65577249 1 - by flanking markers 4 64528739 66609456 1 - by flanking markers RRID:RGD_1357176 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357177 F344.DR(DP)-(D4Mit6-D4Mit24)/Rhw Department of Medicine University of Washington, Seattle, Washington Rat Resource & Research Center congenic Cryopreserved Embryo 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 4 76647384 78882945 1 - by flanking markers RRID:RRRC_00082 The lymphopenia locus from BBDR.BBDP-(D4Mit6-D4Mit24) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding. 1357178 CD Cohen diabetic rat Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_1357178 Originally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism. 1357179 SS.WKY-(D2N35-Mme),MNS-(D10Mit11-D10M11Mit119)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_1357179 SS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F1 were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister mating 1357180 SS.LEW-(D8Chm14-D8Rat16)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Grik4 2734 8 45510258 98878889 1 - by flanking markers 8 45279673 100781055 1 - by flanking markers 8 46804134 101305168 1 - by flanking markers 8 42903043 94388843 1 - by flanking markers RRID:RGD_1357180 Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada 1357181 CDR/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, Israel inbred Unknown RRID:RGD_1357181 Cohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. 1357182 Eker-Tg(Tsc2)28Hin Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 RRID:RGD_1357182 Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. 1357183 SS.MNS-(D10Mco10-Aldoc)/Jr Medical College of Ohio, Toledo congenic Unknown Nos2 3185 10 6849272 65072453 1 - by flanking markers 10 5706467 65456957 1 - by flanking markers 10 6908932 66221621 1 - by flanking markers 10 6813971 63851208 1 - by flanking markers RRID:RGD_1357183 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 1357184 Crl:ZUC-Leprfa Zucker rats Charles River Laboratories Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_1357184 The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company. 1357185 RHA.Gunn-Ugt1a1j/N Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USA congenic Unknown RRID:RGD_1357185 RHA/N rats were crossed with Gunn rats. F1 hybrids were intercrossed for 12 cycles while selecting for jaundice loci. 1357186 Gunn-Ugt1a1j/BluHsd Gunn rat Harlan mutant Unknown Ugt1a1j 13432064 9 87091241 87098362 7 9 94982916 94990037 7 9 95300017 95300017 8 9 88805660 88805660 8 RRID:RGD_1357186 This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. 1357187 WF.BBDR-(D4Rat16-D4Got39)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 56704967 1 - by flanking markers 4 56868238 56868336 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 4 58432133 58432232 1 - by flanking markers RRID:RGD_1357187 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357189 SS.LEW-(D8Rat56-D8Rat51)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 8 8294860 29559867 1 - by flanking markers 8 9505886 30947391 1 - by flanking markers 8 9531047 30918267 1 - by flanking markers 8 8462195 28243068 1 - by flanking markers RRID:RGD_1357189 Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada 1357190 SS.MNS-(Adh1-D2Mit5)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Adh1c 2044 2 235799396 235811584 1 - by flanking markers 2 262090818 262102977 1 - by flanking markers 2 243550655 243562243 1 - by flanking markers 2 226797303 226808892 1 - by flanking markers RRID:RGD_1357190 This congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr background 1357191 CDS/Ygl Cohen diabetic-sensitive rat Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_1357191 Cohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. 1357192 WF.BBDR-(D4Got39-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 121645621 1 - by flanking markers 4 56868238 183837621 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 4 58432133 58432232 1 - by flanking markers RRID:RGD_1357192 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357193 WF.BBDR-(D4Got51-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 70123187 121645621 1 - by flanking markers 4 136548956 183837621 1 - by flanking markers 4 71744558 71744763 1 - by flanking markers 4 71241724 71241930 1 - by flanking markers RRID:RGD_1357193 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357194 WF.BBDR-(D4Rat96-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65434709 121645621 1 - by flanking markers 4 65397099 183837621 1 - by flanking markers 4 65577152 65577249 1 - by flanking markers 4 66609358 66609456 1 - by flanking markers RRID:RGD_1357194 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357195 SS.MNS-(Aldoc-D10Mco1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Nos2 3185 10 67677924 67678060 1 - by flanking markers 10 63366082 63366218 1 - by flanking markers 10 64648175 64648311 1 - by flanking markers 10 61345276 61345413 1 - by flanking markers RRID:RGD_1357195 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 1357196 WF.BBDR-(D4Arb29-D4Rat265)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 82266081 1 - by flanking markers 4 63250011 148715224 1 - by flanking markers 4 63537179 84053053 1 - by flanking markers 4 64528739 83007655 1 - by flanking markers RRID:RGD_1357196 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357345 DA/K Dark Agouti/Karlsburg Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown RRID:RGD_1357345 Dark agouti rats which were bred and housed in Dept. of Laboratory Animal Science, Karlsburg, Germany 1357346 BB.SHR-(D4Mit6-Spr)/K Department of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, Germany congenic Unknown Npy|Spr 3197|3753 4 75732943 119369308 1 - by flanking markers 4 141978848 181496612 1 - by flanking markers 4 77307388 116916073 1 - by flanking markers 4 76647384 117676292 1 - by flanking markers RRID:RGD_1357346 BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected. 1357417 SD-Tg(Npy)400Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1357417 14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene. 1357953 WAG/RijHfr Envigo (Harlan France) inbred Unknown RRID:RGD_1357953 Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Envigo (Harlan France) 1357954 F344/NHfr Harlan France inbred Unknown RRID:RGD_1357954 Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France. 1357955 WF/NHfr Wistar-Furth Harlan France inbred Unknown RRID:RGD_1357955 Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France. 1357957 LEW/HanHfr ENVIGO France ENVIGO France inbred Unknown The LEW/HanHsd is very susceptible to the induction of EAE, while the LEW/SsNHsd is not susceptible to the induction of EAE RRID:RGD_1357957 Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. To Central Institute for Laboratory Animal Breeding, Hannover, in 1973 at F58. In 1994, to Harlan Netherlands through acquisition of Central Institute for Laboratory Animal Breeding. Harlan became Envigo in 2015 1357958 BN/RijHfr Harlan France inbred Unknown RRID:RGD_1357958 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France. 1357959 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin congenic Live Animals Ctsc|Grm5|Nox4|Rab38|Tyr 2445|2746|620600|628752|1589755 1 157084760 158516775 1 - by flanking markers 1 150775310 152202960 1 - by flanking markers 1 140879679 142314355 1 - by flanking markers RRID:RGD_1357959 The Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH. 1357960 LE/CpbHfr Envigo (Harlan France) inbred Unknown RRID:RGD_1357960 Substrain of LE which was bred at Harlan CPB now at Harlan France. 1357974 BB.SHR-(D4Got41-Gimap5)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown Gimap5 628871 4 60262965 76843214 1 - by flanking markers 4 60179409 143073003 1 - by flanking markers 4 60439127 78386683 1 - by flanking markers 4 61697658 77701025 1 - by flanking markers RRID:RGD_1357974 Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. 1357975 SS.LEW-(D1Mco4-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 29841428 43747532 1 - by flanking markers 1 33073397 50297622 1 - by flanking markers 1 31647701 49454378 1 - by flanking markers 1 29038037 49268520 1 - by flanking markers RRID:RGD_1357975 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357976 BB.SHR-(D4Got41-D4Rat171)/K Department of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 4 60262965 87996003 1 - by flanking markers 4 60179409 154162556 1 - by flanking markers 4 60439127 89342035 1 - by flanking markers 4 61697658 88217207 1 - by flanking markers RRID:RGD_1357976 Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. 1357977 SS.LEW-(D1Mco8-D1Rat213)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 32329137 81548909 1 - by flanking markers 1;9 84537073;7947583 84537228;7947744 1 - by flanking markers;1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 1 81777564 81777720 1 - by flanking markers RRID:RGD_1357977 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357978 SS.MNS-(D2Mit6-D2Rat303)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 131522430 1 - by flanking markers 2 98037122 155130826 1 - by flanking markers 2 78321410 135646395 1 - by flanking markers 2 76539322 127460910 1 - by flanking markers RRID:RGD_1357978 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain 1357979 SS.MNS-(Mme-D2Rat131)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Mme 3098 2 153031724 179302663 1 - by flanking markers 2 173193501 206015340 1 - by flanking markers 2 153799203 186612024 1 - by flanking markers 2 147686913 172711135 1 - by flanking markers RRID:RGD_1357979 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain 1357980 BB.SHR-(D4Got41-Tacr1)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Metabolism Tacr1 3811 4 60262965 116780394 1 - by flanking markers 4 60179409 178095041 1 - by flanking markers 4 60439127 113416139 1 - by flanking markers 4 61697658 115089733 1 - by flanking markers RRID:RGD_1357980 Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997. 1357981 SS.LEW-(D3Mco21-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 68499987 121619110 1 - by flanking markers 3 79183926 133513825 1 - by flanking markers 3 72672290 127023997 1 - by flanking markers 3 70348525 121056321 1 - by flanking markers RRID:RGD_1357981 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 1357982 SS.LEW-(D3Rat52-D3Chm63)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 51161895 1 - by flanking markers 3 19410399 61857467 1 - by flanking markers 3 14090411 55245509 1 - by flanking markers 3 18311454 53781346 1 - by flanking markers RRID:RGD_1357982 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 1357983 SS.LEW-(D1Mco75-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 43747374;2897342 43747532;2897591 1 - by flanking markers;1 - by flanking markers 1 36805624 50297622 1 - by flanking markers 1 35406399 49454378 1 - by flanking markers 1 32765502 49268520 1 - by flanking markers RRID:RGD_1357983 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357984 SS.MNS-(D2Mit6-D2Rat166)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 145701148 1 - by flanking markers 2 98037122 165313939 1 - by flanking markers 2 78321410 145903673 1 - by flanking markers 2 76539322 140636154 1 - by flanking markers RRID:RGD_1357984 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain 1357985 LOU/Ins INSERM, C.H.U. Bichat-Claude Bernard, Paris, France inbred Unknown RRID:RGD_1357985 originated from Universite Catholique de Louvain. 1357986 SS.LEW-(D1Uia8-D1Rat211)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 1147796 1148037 1 - by flanking markers 1 35077728 35077968 1 - by flanking markers 1 33667777 33668017 1 - by flanking markers 1 31050840 31051081 1 - by flanking markers RRID:RGD_1357986 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357987 SS.LEW-(D1Uia8-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 43747374 43747532 1 - by flanking markers 1 50297465 50297622 1 - by flanking markers 1 49454221 49454378 1 - by flanking markers 1 49268362 49268520 1 - by flanking markers RRID:RGD_1357987 A 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. 1357988 SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 121619110 1 - by flanking markers 3 19410399 133513825 1 - by flanking markers 3 14090411 127023997 1 - by flanking markers 3 18311454 121056321 1 - by flanking markers RRID:RGD_1357988 A segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 1357994 SHR/NCrl Charles River Laboratories Charles River Laboratories inbred Live Animals (as of 2020-01-23) RRID:RGD_1357994 To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneous hypertension. 1358112 WKY/NCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_1358112 Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11 1358114 SS-Chr 5BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_1358114 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 1358150 SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 350232 1 - by flanking markers 16 751266 1084414 1 - by flanking markers 16 756352 1090164 1 - by flanking markers 16 88524 380356 1 - by flanking markers RRID:RGD_1358150 This congenic strain originated from a SS/Jr parental strain. 1358151 FHH-Chr 8BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358151 A FHH genomic background with a BN chromosome 8 introgressed. 1358152 SS-Chr 14BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358152 A SS genomic background with a BN chromosome 14 introgressed. 1358153 COP/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_1358153 Inbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998. 1358154 SS-Chr 3BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_1358154 A SS genomic background with a BN chromosome 3 introgressed. 1358155 SS.LEW-(D10Rat119-D10Mgh1)(D16Rat21-D16Rat112)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown RRID:RGD_1358155 This double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (D10Rat119-D10Mgh1)and (D16Rat21-D16Rat112) from the LEW strain 1358156 SS.MNS-(D2Rat183-D2Chm113)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 144136724 145774334 1 - by flanking markers 2 163731761 165386311 1 - by flanking markers 2 144313532 145975996 1 - by flanking markers 2 139096736 140708949 1 - by flanking markers RRID:RGD_1358156 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358157 FHH-Chr 7BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358157 A FHH genomic background with a BN chromosome 7 introgressed. 1358158 FHH-Chr 16BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358158 A FHH genomic background with a BN chromosome 16 introgressed. 1358159 FHH-Chr 6BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358159 A FHH genomic background with a BN chromosome 6 introgressed. 1358160 SS.BN-(D8Rat163-D8Rat81)/Mcwi PhysGen congenic Unknown 8 31508524 124926877 1 - by flanking markers 8 32911182 127854519 1 - by flanking markers 8 32888352 128653291 1 - by flanking markers 8 30188867 119698120 1 - by flanking markers RRID:RGD_1358160 A SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81. 1358161 SS.LEW-(D16Rat38-D16Chm66)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 3080748 8612621 1 - by flanking markers 16 3405986 11276947 1 - by flanking markers 16 3439525 9316554 1 - by flanking markers 16 2995225 8336378 1 - by flanking markers RRID:RGD_1358161 This congenic strain originated from a SS/Jr parental strain. 1358162 SS-Chr 12BN/Mcwi PhysGen consomic Live Animals RRID:RGD_1358162 A SS genomic background with a BN chromosome 12 introgressed. 1358163 SS-Chr 15BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1358163 A SS genomic background with a BN chromosome 15 introgressed. 1358164 FHH-Chr 17BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358164 A FHH genomic background with a BN chromosome 17 introgressed. 1358165 SS.MNS-(D2Chm51-D2Rat341)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 151616735 155664303 1 - by flanking markers 2 171854997 177018102 1 - by flanking markers 2 152460836 157650873 1 - by flanking markers 2 146368688 150090572 1 - by flanking markers RRID:RGD_1358165 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain. 1358166 SS.LEW-(D16Mit3-D16Rat112)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 47434384 1 - by flanking markers 16 773329 47069744 1 - by flanking markers 16 778415 47346612 1 - by flanking markers 16 110590 44236047 1 - by flanking markers RRID:RGD_1358166 This congenic strain originated from a SS/Jr parental strain. 1358167 SS.MNS-(D2Wox27-Adh1)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Adh1c 2044 2 202186267 235811584 1 - by flanking markers 2 228956554 262102977 1 - by flanking markers 2 209489455 243562243 1 - by flanking markers 2 194352314 226808892 1 - by flanking markers RRID:RGD_1358167 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358168 SS.LEW-(D16Mit2-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 4304517 1 - by flanking markers 16 751266 5038806 1 - by flanking markers 16 756352 5098704 1 - by flanking markers 16 88524 4227730 1 - by flanking markers RRID:RGD_1358168 This congenic strain originated from a SS/Jr parental strain. 1358169 SS.MNS-(D2Chm25-D2Rat131)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 179302663 1 - by flanking markers 2 199188066 206015340 1 - by flanking markers 2 179779225 186612024 1 - by flanking markers 2 166144095 172711135 1 - by flanking markers RRID:RGD_1358169 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Chm90-D2Wox37)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358170 FHH-Chr 5BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358170 A FHH genomic background with a BN chromosome 5 introgressed. 1358171 SS-Chr 17BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358171 A SS genomic background with a BN chromosome 17 introgressed. 1358172 SS.MNS-(D2Chm25-Fgg)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Fgg 2613 2 172459883 174734594 1 - by flanking markers 2 199188066 201409143 1 - by flanking markers 2 179779225 181994523 1 - by flanking markers 2 166144095 168362325 1 - by flanking markers RRID:RGD_1358172 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358173 FHH-Chr 11BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358173 A FHH genomic background with a BN chromosome 11 introgressed. 1358174 SS-Chr 19BN/Mcwi PhysGen Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) RRID:RRRC_00601 A SS genomic background with a BN chromosome 19 introgressed. 1358175 FHH-Chr 20BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358175 A FHH genomic background with a BN chromosome 20 introgressed. 1358176 FHH-Chr 18BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358176 A FHH genomic background with a BN chromosome 18 introgressed. 1358177 SS.MNS-(D2Chm25-D2Mit14)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 197256313 1 - by flanking markers 2 199188066 224018437 1 - by flanking markers 2 179779225 204585731 1 - by flanking markers 2 166144095 189599348 1 - by flanking markers RRID:RGD_1358177 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358178 SS-Chr 10BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358178 A SS genomic background with a BN chromosome 10 introgressed. 1358179 FHH-Chr 13BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358179 A FHH genomic background with a BN chromosome 13 introgressed. 1358180 FHH-Chr 19BN/Mcwi PhysGen Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) RRID:RRRC_00581 A FHH genomic background with a BN chromosome 19 introgressed. 1358258 RCS/LavRrrc royal college of surgeons rat Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) RRID:RRRC_00314 Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Then to University of California- San Francisco, School of Medicine, deposited to Rat Resource & Research Center. 1358259 RCS-p+/LavRrrc Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) RRID:RRRC_00315 This strain has homozygous wild type at the pink eye (p+) locus and homozygous for a deletion in the Mertk gene. Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain. 1358277 RCS-rdy+/LavRrrc Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-07-16) RRID:RRRC_00317 Developed by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated. 1358278 RCS-rdy+p+/LavRrrc Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12) RRID:RRRC_00316 Developed by crossing a pink-eyed control(RCS-rdy+/Lav x black-eyed dystrophic(RCS-p+/Lav) The F12 progeny was backcrossed to RCS-rdy+/Lav. The strain is pigmented (p+) congenic control strain (rdy+, wild-type at the retinal dystrophy locus) for the pigmented RCS-p+ dystrophic (rdy-) strain 1358298 SD-Tg(Rho*P23H)1LavRrrc Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Live Animals (as of 2021-05-07) Rho 11239 RRID:RRRC_00639 This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). 1358299 SD-Tg(Rho*P23H)2Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358299 This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). 1358300 SD-Tg(Rho*P23H)3Lav Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown RRID:RRRC_00641 This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). 1358302 SD-Tg(Rho*S334X)3Lav Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center transgenic Unknown RRID:RRRC_00643 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358303 SD-Tg(Rho*S334X)4Lav Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown RRID:RRRC_00645 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358304 SD-Tg(Rho*S334X)5Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358304 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358305 SD-Tg(Rho*S334X)7Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358305 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358306 SD-Tg(Rho*S334X)9Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358306 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358632 MR/Har Maudsely reactive Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania. Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-20) RRID:RRRC_00691 This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. 1358633 MNRA/Har Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania inbred Unknown RRID:RGD_1358633 Originally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. 1358918 W-Plp1md/Nya W-Plp1md Division of Laboratories and Research, New York State Department of Health, Albany, New York mutant Unknown Plp1|Plp1md 3354|12802346 X 124488627 124503639 7 X 107379831 107394881 7 X 107505372 107505372 8 X 100195051 100195051 8 RRID:RGD_1358918 Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders. 1358919 F344/Seac SEAC Yoshitomi Co., Fukuoka, Japan inbred Unknown RRID:RGD_1358919 Inbred strain originated from F344 rats 1358921 WF.DA-(D19Mit1-D19Mit6)/Kop kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nqo1 2503 19 26536747 41612881 1 - by flanking markers 19 35433730 54715514 1 - by flanking markers 19 24455726 43907843 1 - by flanking markers 19 24817978 39654489 1 - by flanking markers RRID:RGD_1358921 Congenic strain originated from a parental DA/Slc strain. 1358922 BB.WOKW-(D4Got41-Fabp1)/K Dept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, Germany congenic Unknown Fabp1 2590 4 60262965 104415981 1 - by flanking markers 4 60179409 163844105 1 - by flanking markers 4 60439127 99066957 1 - by flanking markers 4 61697658 103194791 1 - by flanking markers RRID:RGD_1358922 Congenic strain originated from a BB/OK parental strain. 1358923 LE-Mbpmd Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada mutant Unknown Mbp|Mbpmd 3054|12802351 18 78943608 79057329 7 18 78385304 78504226 7 18 79326738 79437310 7 18 75855878 75966404 7 RRID:RGD_1358923 A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks. 1358989 WKY.SHR-(D2Rat174-D2Rat28)(D2Rat161-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown RRID:RGD_1358989 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl 1358990 DA.F344-(D10Mit9-D10Rat24)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 79229233 1 - by flanking markers 10 31740635 78195122 1 - by flanking markers 10 31919397 78343192 1 - by flanking markers 10 31224026 75632053 1 - by flanking markers RRID:RGD_1358990 Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd 1358991 F344.HTX-(D11Rat4-D11Arb4)/Hcj Department of Pharmacology, University of Florida, Gainesville congenic Unknown 11 64573222 68235010 1 - by flanking markers 11 66731054 72739915 1 - by flanking markers 11 65352097 69649936 1 - by flanking markers 11 62790342 66422377 1 - by flanking markers RRID:RGD_1358991 Congenic strain originated from F344/NHsd parental strain bred to HTX/Hcj 1358992 SHR.WKY-(D2Rat40-D2Rat50) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 163154227 200390471 1 - by flanking markers 2 189197858 227035367 1 - by flanking markers 2 169852670 207612467 1 - by flanking markers 2 157142078 192625452 1 - by flanking markers RRID:RGD_1358992 Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers 1358993 WKY.SHR-(D2Rat161-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 238140155 1 - by flanking markers 2 138120195 264423808 1 - by flanking markers 2 118446646 245893748 1 - by flanking markers 2 114837527 229059787 1 - by flanking markers RRID:RGD_1358993 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl 1358994 SHR.WKY-(D2Rat161-D2Rat241) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 217985582 1 - by flanking markers 2 138120195 242993417 1 - by flanking markers 2 118446646 118446793 1 - by flanking markers 2 114837527 114837675 1 - by flanking markers RRID:RGD_1358994 This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) congenic strain to the parental strain SHR/NCrl 1358995 F344.OLETF-(D1Rat166-D1Rat90)/Tj Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_1358995 Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. 1358996 SHR.WKY-(D2Rat10-D2Mgh13) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 35874553 244809764 1 - by flanking markers 2 54092967 270992875 1 - by flanking markers 2 34967269 252466565 1 - by flanking markers 2 36023184 235501121 1 - by flanking markers RRID:RGD_1358996 This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background 1358997 WKY.SHR-(D2Rat241-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 217985399 238140155 1 - by flanking markers 2 242993235 264423808 1 - by flanking markers 2 245893572 245893748 1 - by flanking markers 2 229059610 229059787 1 - by flanking markers RRID:RGD_1358997 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl 1358998 BUF/NHsd Harlan Harlan inbred Unknown RRID:RGD_1358998 Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan. 1358999 WKY.SHR-(D2Rat174-D2Rat28) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 107574826 1 - by flanking markers 2 83930202 126824737 1 - by flanking markers 2 60746052 107083569 1 - by flanking markers 2 59744817 104815148 1 - by flanking markers RRID:RGD_1358999 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl 1359000 DA.F344-(D10Arb27-D10Rat6)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 69160380 106310957 1 - by flanking markers 10 67971352 104746310 1 - by flanking markers 10 68305037 105078045 1 - by flanking markers 10 65927233 101436010 1 - by flanking markers RRID:RGD_1359000 Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd 1359001 WKY.SHR-(D2Rat42-D2Rat139) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 180768203 232533087 1 - by flanking markers 2 207416346 258769070 1 - by flanking markers 2 188013923 240243929 1 - by flanking markers 2 174110900 223490532 1 - by flanking markers RRID:RGD_1359001 Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers 1359002 NTac:WKY Taconic outbred Unknown RRID:RGD_1359002 The Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony. 1359003 LEW/Jr Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_1359003 This strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA. 1359004 DA.F344-(D10Mit9-D10Rat11)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 100633982 1 - by flanking markers 10 31740635 99184250 1 - by flanking markers 10 31919397 99492409 1 - by flanking markers 10 31224026 96121100 1 - by flanking markers RRID:RGD_1359004 Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd 1359005 SHR.WKY-(D2Rat15-D2Rat50) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 46251938 200390471 1 - by flanking markers 2 66171293 227035367 1 - by flanking markers 2 47783949 207612467 1 - by flanking markers 2 47137898 192625452 1 - by flanking markers RRID:RGD_1359005 This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) to parental strain SHR/NCrl 1359006 WKY.SHR-(D2Rat27-D2Rat243) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 96481750 221307793 1 - by flanking markers 2 116297660 248110514 1 - by flanking markers 2 96556622 228759752 1 - by flanking markers 2 94359407 212719943 1 - by flanking markers RRID:RGD_1359006 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl 1359007 WKY.SHR-(D2Rat174-D2Rat62) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 228664122 1 - by flanking markers 2 83930202 254867363 1 - by flanking markers 2 60746052 236318668 1 - by flanking markers 2 59744817 219753474 1 - by flanking markers RRID:RGD_1359007 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl 1359008 F344.HTX-(D11Rat4-D11Arb4)(D17Rat23-D17Rat154)/Hcj Department of Pharmacology, University of Florida, Gainesville congenic Unknown RRID:RGD_1359008 Double congenic strain originated from a cross between single congenic strains F344.HTX-(D11Rat4-D11Arb4)/Hcj and F344.HTX-(D17Rat23-D17Rat154)/Hcj. 1359009 WKY.SHR-(D2Rat174-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 238140155 1 - by flanking markers 2 83930202 264423808 1 - by flanking markers 2 60746052 245893748 1 - by flanking markers 2 59744817 229059787 1 - by flanking markers RRID:RGD_1359009 Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers 1359010 WF.BBDR-ART2a/Wor Wistar Furth University of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605 congenic Unknown RRID:RGD_1359010 Congenic strain created by backcrossing WF strain to BBDR strain which are RT1 u/u , ART2a. 1547865 FHH-Chr 3BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1547865 A FHH genomic background with a BN chromosome 3 introgressed. 1547866 F344/Jcl CLEA Japan, Inc CLEA Japan, Inc inbred Live Animals (as of 2021-04-22) RRID:RGD_1547866 Inbred strain originated from F344 1547867 FHH-Chr 4BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547867 A FHH genomic background with a BN chromosome 4 introgressed. 1547868 FHH-Chr 2BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547868 A FHH genomic background with a BN chromosome 2 introgressed. 1547869 ACI/Eur August x Copenhagen Irish Department of Pediatric Surery, Erasmus Medical Center, Rotterdam, Netherlands inbred Unknown RRID:RGD_1547869 Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH 1547870 FHH-Chr 14BN/Mcwi PhysGen consomic Live Animals RRID:RGD_1547870 A FHH genomic background with a BN chromosome 14 introgressed. 1547871 ACI.FHH-(D1Rat324-D1Rat156)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229301063 253410500 1 - by flanking markers 1 251109240 279213254 1 - by flanking markers 1 243853559 243853760 1 - by flanking markers 1 223506828 223507030 1 - by flanking markers RRID:RGD_1547871 Congenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains. 1547872 FHH-Chr XBN/Mcwi FHH-Chr XBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547872 A FHH genomic background with a BN chromosome X introgressed. 1547873 FHH-Chr 15BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547873 A FHH genomic background with a BN chromosome 15 introgressed. 1547874 FHH-Chr YBN/Mcwi FHH-Chr YBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547874 A FHH genomic background with a BN chromosome Y introgressed. 1547875 ACI.FHH-(D17Rat117-D17Arb5)(D17Rat180-D17Rat51)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 17 31007408 69257442 1 - by flanking markers 17 27537443 67580933 1 - by flanking markers 17 25609692 65831023 1 - by flanking markers 17 24982652 58691962 1 - by flanking markers RRID:RGD_1547875 Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. 1547876 FHH-Chr 10BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547876 A FHH genomic background with a BN chromosome 10 introgressed. 1549794 SS.LEW-(D2Rat199-D2Mco17)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2;4 41032071;157987925 76020140;157987994 1 - by flanking markers;1 - by flanking markers 2;4 60242455;221211532 95618891;221211601 1 - by flanking markers;1 - by flanking markers 2;4 41179255;154125111 75896315;154125180 1 - by flanking markers;1 - by flanking markers X;2;4 46603085;41243963;154786975 46603120;74997963;154787045 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_1549794 Congenic strain was created from a SS/Jr parental strain 1549795 SS.LEW-(D2Rat199-D2Rat143)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 41032071 106236206 1 - by flanking markers 2 60242455 125885146 1 - by flanking markers 2 41179255 106156987 1 - by flanking markers 2 41243963 103519040 1 - by flanking markers RRID:RGD_1549795 Congenic strain was created from a SS/Jr parental strain 1549796 BN/2Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo RRID:RGD_1549796 Transferred from Hokkaido University, Chromosome Research Unit, 1987 F16 1549797 BUF.ACI-(D16Rat31-D16Arb1)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown 16 8340080 8340453 1 - by flanking markers 16 11019972 11020174 1 - by flanking markers 16 9055590 9055792 1 - by flanking markers 16 8082906 8083107 1 - by flanking markers RRID:RGD_1549797 This congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method. 1549798 BB.PVG-RT1u/a/Tky National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology RRID:RGD_1549798 A congenic strain with the genetic background of the BB/WorTky strain (RT1.Bu,Du ) onto which the MHC locus of PVG.R23 strain (RT1.B,D) has been transferred. 1549799 BB.SHR-(D6Rat184-D6Rat3)/K National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Metabolism 6 121381065 145279536 1 - by flanking markers 6 130448688 154782041 1 - by flanking markers 6 121224054 145868598 1 - by flanking markers 6 116506292 138922889 1 - by flanking markers RRID:RGD_1549799 Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000. 1549800 BN/KunKtsSlc This strain is no longer available from NBRP-Rat (June 2022). inbred Unknown (as of 2022-06-09) Metabolism RRID:RGD_1549800 Kitasato University School of Medicine to Slc (2001) 1549801 BN/Seac Seac Yoshitomi, LTD, Fukuoka, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Behavior; Ophthalmology RRID:RGD_1549801 Seac Yoshitomi, LTD, Fukuoka, Japan 1549802 BN/1Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1549802 Transferred from Hokkaido University, Chromosome Research Unit, 1987 F15 1549803 ACI-Lystbg-Kyo/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Hematology RRID:RGD_1549803 Spontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999. 1549804 BUF/NacJcl Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan inbred Unknown RRID:RGD_1549804 CLEA Japan, Inc., Tokyo Japan 1549805 BUF.Cg-Foxn1rnu/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Urology RRID:RGD_1549805 BUF/Mna, NN1H-Rnu/Rnu 1549806 BUF.ACI-(D3Rat56-D3Rat83)/Ncc Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 3 3577905 42635088 1 - by flanking markers 3 2612834 52104192 1 - by flanking markers 3 2631421 46996487 1 - by flanking markers 3 8227194 45391731 1 - by flanking markers RRID:RGD_1549806 This strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strain 1549808 SS.LEW-(Prlr-D2Rat143)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown Prlr 3407 2 59507966 106236206 1 - by flanking markers 2 84360850 125885146 1 - by flanking markers 2 60131410 106156987 1 - by flanking markers 2 59134147 103519040 1 - by flanking markers RRID:RGD_1549808 Congenic strain was created from a SS/Jr parental strain 1549809 BN/KtsSlc This strain is no longer available from NBRP-Rat (June 2022). inbred Unknown (as of 2022-06-09) Immunology RRID:RGD_1549809 Kitasato University School of Medicine to Slc (2002) 1549810 AI/Msik amelogenesis imperfecta rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Dentistry RRID:RGD_1549810 This strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc. 1549811 ACI/NJcl Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1549811 ACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan. 1549813 F344.ACI-Lmx1aqc/Kyo Institute of Laboratory Animals at Kyoto University, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-12) Apoa2|Selp|Lmx1a 2131|3656|1304784 13 79886614 87116372 1 - by flanking markers 13 87308435 94225670 1 - by flanking markers 13 82428914 89598805 1 - by flanking markers 13 76476229 83646358 1 - by flanking markers RRID:RGD_1549813 Congenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. The short-tail mutation, “queue courte” in French (with qc as a symbol), occurred spontaneously in 1994, in the ACI/Pas inbred strain of rat maintained at the Institute Pasteur (Paris, France), and was kept segregating in this stock. Since importation into the Institute of Laboratory Animals at Kyoto University, it has been maintained as a congenic strain F344.ACI-qc using F344/NSlc as an inbred partner. 1554301 WKHA/Bord Universite Victor Segalen Bordeaux 2, Bordeaux cedex, France inbred Unknown RRID:RGD_1554301 Strain was originated from WHHA/Edh at the University of Vermont College of Medicine 1554302 HOB-Unc5chob/Snk hobble rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Unc5c|Unc5chob 735109|12802353 2 239365109 239721231 7 2 265573406 265926229 7 2 247045813 247397483 7 2 230180353 230535219 7 RRID:RGD_1554302 Homozygous hobble rats that were taken from the inbred hobble rat colony. 1554303 CVD/Opu Cerebellar vermis defect rat Department of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, Japan inbred Unknown Unc5c 735109 RRID:RGD_1554303 Originated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates. 1554304 GAERS/Mave Genetic Absence Epilepsy Rats from Strasbourg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_1554304 30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding. 1554305 DA-Tg(CAG-lacZ)30Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RRRC_00295 lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. 1554306 GK/Slc Goto Kakizaki Rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Diabetes Obesity RRID:RGD_1554306 Spontaneous mutant GK rat which were obtained from Japan SLC, Inc. 1554307 W-Tg(LAC3)Ys YS New Technology Institute, Tochigi, Japan transgenic Unknown RRID:RGD_1554307 These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase. 1554308 Gunn-Ugt1a1j/Slc Gunn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals Neurobiology; Metabolism Ugt1a1j 13432064 RRID:RGD_1554308 Segregated inbred Gunn rat which were obtained from Japan SLC, Inc. 1554309 W-Tg(CAG-GFP)184Ys National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00259 These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. 1554310 DA-Tg(CAG-lacZ)19Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00294 lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. 1556748 F344/Snk Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_1556748 Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan 1558660 SHRSP/Tkyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558660 Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo 1558661 WKY/Tkyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558661 Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo 1558662 SHR/Tkyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558662 Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo 1559030 LEC-Tg(ATP7B)Tohm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_1559030 A 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA. 1559031 NE/Mave National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_1559031 The control strain of GAERS, free of any spontaneous spike and wave discharges. 1559032 SS.LEW-(D17Rat65-D17Chm2)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 82247891 93930006 1 - by flanking markers 17 76483116 88435496 1 - by flanking markers 17 74823053 86731080 1 - by flanking markers 17 70973784 82479847 1 - by flanking markers RRID:RGD_1559032 This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment 1559033 SS.LEW-(D17Rat65-Prl)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown Prl 3403 17 44699101 93930006 1 - by flanking markers 17 41720751 88435496 1 - by flanking markers 17 39814236 86731080 1 - by flanking markers 17 37859999 82479847 1 - by flanking markers RRID:RGD_1559033 This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain 1559034 SS.LEW-(D17Chm14-D17Rat97)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 80182186 1 - by flanking markers 17 60264084 74265481 1 - by flanking markers 17 58467778 72580782 1 - by flanking markers 17 62109333 68784138 1 - by flanking markers RRID:RGD_1559034 This congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment 1559035 SS.LEW-(D17Chm14-D17Rat181)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 38257211 80182186 1 - by flanking markers 17 35100574 74265481 1 - by flanking markers 17 33208959 72580782 1 - by flanking markers 17 31896010 68784138 1 - by flanking markers RRID:RGD_1559035 This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain 1559036 LEW/Jms National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01) RRID:RRRC_00054 Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. 1559037 SS.LEW-(D17Chm9-D17Rat97)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 83074398 1 - by flanking markers 17 60264084 77361330 1 - by flanking markers 17 58467778 75705622 1 - by flanking markers 17 62109333 71774817 1 - by flanking markers RRID:RGD_1559037 This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment 1559039 ODS/Shi Osteogenic disorder Shionogi Shionogi & Co., Ltd. Japan inbred Unknown RRID:RGD_1559039 Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. 1559040 MD/Tama myelin deficient rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Neurobiology; Development RRID:RGD_1559040 X-linked mutant of the Wistar rat. 1559041 SHRSP/Ngsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension; Osteosis RRID:RGD_1559041 Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980. 1559042 SHR/Nig National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Pharmacology RRID:RGD_1559042 Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976. 1559043 MV/Opu myelin vacuolation rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology Atrnmv 40902835 RRID:RGD_1559043 The myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999. 1559044 SS.SR-(D3Mco19-D3Mco5)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Edn3 2534 7;3 23312460;147799021 23312636;167653069 1 - by flanking markers;1 - by flanking markers 7;3 27325365;158391833 27325541;183008351 1 - by flanking markers;1 - by flanking markers 3;7 153327515;27206010 153327695;27206186 1 - by flanking markers;1 - by flanking markers 3;7 145871677;21089863 145871858;21090040 1 - by flanking markers;1 - by flanking markers RRID:RGD_1559044 A region of chr 3 which contains the Edn3 gene was introgressed into the SS rats 1559045 LEW/Crlc Charles River Laboratories, La Salle, Quebec, Canada inbred Unknown RRID:RGD_1559045 LEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canada 1559046 SHR-Chr YW/K National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Unknown RRID:RGD_1559046 Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996. 1559047 SHRSP/Ezo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension RRID:RGD_1559047 Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan 1559048 SHR.ODS-Gulood/Shi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Osteosis Gulo 620701 RRID:RGD_1559048 A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995. 1566430 SimTac:LE Taconic outbred Unknown RRID:RGD_1566430 Taconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock. 1566431 BN/MolTac Taconic inbred Unknown RRID:RGD_1566431 The BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003. 1566432 WKY/NMolTac Wistar Kyoto Taconic inbred Unknown RRID:RGD_1566432 The inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit. 1566433 HanTac:WH Taconic outbred Unknown RRID:RGD_1566433 In 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000. 1566434 NTac:SHR Taconic outbred Unknown RRID:RGD_1566434 Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony. 1566437 SS-Chr XBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1566437 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 1566438 DA/MolTac Taconic inbred Unknown RRID:RGD_1566438 Developed at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004. 1566439 F344/NTac Taconic inbred Unknown RRID:RGD_1566439 Axenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH. 1566440 NTac:SD Taconic outbred Unknown RRID:RGD_1566440 Taconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies. 1566443 LEW/MolTac Lewis Taconic inbred Unknown RRID:RGD_1566443 Scripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived. 1566444 MolTac:SD Taconic outbred Unknown RRID:RGD_1566444 The SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993. 1566445 ACI.BN-(D5Mgh17-D5Rat205)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Extinct 5 14730738 14730949 1 - by flanking markers 5 19190627 19190837 1 - by flanking markers 5 14408903 14409113 1 - by flanking markers 5 14529225 14529436 1 - by flanking markers RRID:RGD_1566445 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 1566447 GK/MolTac Goto-Kakizaki Taconic inbred Unknown RRID:RGD_1566447 The Goto-Kakizaki inbred model was developed by Tohoku University in 1975. Aarhus University Hospital in Denmark received stock in 1994. M&B A/S (now Taconic Europe) received stock from Aarhus in 1997. The rats were derived by embryo transfer in 2005 at Taconic US. 1566448 FHH-Chr 9BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1566448 A FHH genomic background with a BN chromosome 9 introgressed. 1566453 SD-Tg(HIV-LacZ)AngRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00049 Fertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid. 1566454 BDIV/Zte BDIV/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_1566454 derived from Berlin-Druckrey strain BDIV 1566455 HTX/HcjRrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery RRID:RRRC_00050 Available at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30. 1566456 BDIX/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_1566456 derived from Berlin-Druckrey strain BDIX 1566457 SPRD Sprague-Dawley inbred Unknown RRID:RGD_1566457 From outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990). 1566458 F344-Tg(ROSA26-ALPP)EpsRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-07-01) ALPP 1314395 RRID:RRRC_00048 F344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP, ALPP). 1566459 F344-Tg(ROSA26-EGFP)Eps Department of Pathobiological Sciences, University of Wisconsin-Madison, Madison, Wisconsin transgenic Unknown RRID:RGD_1566459 F344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP). 1566460 SD-Tg(ICAM2-DAF)AngRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00051 Embryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter. 1578692 BN.LEW-(D10Rat32-D10Rat116)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 54220239 1 - by flanking markers 10 53381898 53807373 1 - by flanking markers 10 53630865 54057745 1 - by flanking markers 10 51779662 52200160 1 - by flanking markers RRID:RGD_1578692 Congenic strain was bred from BN.LEW-(D10Mco17-D10Mco14)/Ciml backcrossed to BN/Rj. 1578693 LEW.BN-(D10Mco17-D10Rat221)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578693 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578694 AT Alcohol-Tolerant Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00076 The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. 1578695 SHA/BruRrrc Syracuse High Avoidance Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00068 Selective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats. 1578696 LAS1 Low Alcohol Sensitive strain 1 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00080 Selectively bred for 24 generations for low sensitivity to ethanol then inbred. 1578697 BN.LEW-(D10Rat32-D10Rat31)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53616237 53786515 1 - by flanking markers 10 53216481 53382065 1 - by flanking markers 10 53465198 53631032 1 - by flanking markers 10 51611529 51779830 1 - by flanking markers RRID:RGD_1578697 Congenic strain was bred from BN.LEW-(D10Rat32-D10Rat221)/Ciml backcrossed to BN/Rj. 1578698 LAS2 Low Alcohol Sensitive strain 2 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00081 Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred 1578699 BG anemic Belgrade Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery RRID:RRRC_00072 These are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY. 1578700 HAS1 High Alcohol Sensitive strain 1 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00077 Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred 1578701 HAS2 High Alcohol Sensitive strain 2 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00079 Selectively bred for high ethanol sensitivity for 24 generations, then inbred. 1578702 LEW.BN-(D10Rat32-D10Rat133)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 10 51779662 51779830 1 - by flanking markers RRID:RGD_1578702 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578703 SLA/BruRrrc Syracuse Low Avoidance Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00069 Selective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats. 1578704 WLP Warsaw Low Prefering Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown RRID:RGD_1578704 These were bred from albino stock of Wistar rats as lines that had low ethanol preference. 1578705 LEW.BN-(D10Arb4-D10Rat133)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 65668639 1 - by flanking markers 10 46591952 64823355 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 10 45274234 45274336 1 - by flanking markers RRID:RGD_1578705 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578706 LEW.BN-(D10Mco17-D10Mco14)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578706 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578708 LEW.BN-(D10Mgh7-D10Rat221)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 56171177 1 - by flanking markers 10 55720558 55720772 1 - by flanking markers 10 55978483 55978697 1 - by flanking markers 10 54098674 54098889 1 - by flanking markers RRID:RGD_1578708 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578709 IA incisor absent Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00064 These rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption. 1578710 LEW.1AR1-iddm/Ztm Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany coisogenic Unknown Dock8m1Ztm 13830868 RRID:RGD_1578710 arose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.AaB/DuCu) in the intra-MHC recombinant inbred strain LEW.1AR1; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain since 1578711 LEW.BN-(D10Mco17-D10Rat133)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 65668639 1 - by flanking markers 10 44914976 64823355 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578711 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578712 BN.LEW-(D10Mco17-D10Mco14)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578712 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578713 BN/Ztm Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany inbred Unknown RRID:RGD_1578713 substrain of BN 1578714 BN.LEW-(D10Mco17-D10Rat80)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 61798393 1 - by flanking markers 10 44914976 61030524 1 - by flanking markers 10 45157430 61300905 1 - by flanking markers 10 43593509 59378278 1 - by flanking markers RRID:RGD_1578714 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578715 ANT Alcohol-Nontolerant Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Gabra6 61861 RRID:RRRC_00078 The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. 1578716 LEW.1AR1/Ztm Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany congenic Unknown RRID:RGD_1578716 Lewis strain containing MHC haplotype RT1.AaB/DuCu 1578717 WHP Warsaw High Prefering Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown RRID:RGD_1578717 These were bred from albino stock of Wistar rats as lines that had ethanol preference. 1579677 FHH-Maddm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Maddm1Mcwi 1578796 3 75498321 75541073 7 3 86669054 86711776 7 3 79960301 80003023 7 3 77114330 77157865 7 RRID:RGD_1579677 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated. 1579678 ACI.FHH-(D3Wox2-D3Rat59)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Live Animals; Cryopreserved Sperm 3 46419462 163443738 1 - by flanking markers 3 57173123 176609927 1 - by flanking markers 3 50533100 170534769 1 - by flanking markers 3 49162911 161299569 1 - by flanking markers RRID:RGD_1579678 Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. 1579680 Wild/Tku Wild Caught in Tokyo wild Unknown RRID:RGD_1579680 These rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed. 1579681 BN-Birc3m1Mcwi PhysGen mutant Extinct (as of 2016-10-24) Birc3m1Mcwi 1578788 8 4682202 4696856 7 8 6047454 6075236 7 8 6048590 6076828 7 8 5000844 5028470 7 RRID:RGD_1579681 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated. 1579682 FHH-Tlr4m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tlr4m1Mcwi 1578785 5 83564100 83577735 7 5 86690670 86704302 7 5 82587424 82601056 7 5 80145867 80159501 7 RRID:RRRC_00411 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V489A mutation is generated. 1579683 FHH-Ghsrm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsrm1Mcwi 1578794 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RRRC_00405 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. codon CAG/TAG mutation is generated which changes the AA Q343Stop. 1579684 FHH-Slc8a2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc8a2m1Mcwi 1578786 1 76473938 76498624 7 1 79296259 79320746 7 1 78029555 78054042 7 1 76816583 76852928 7 RRID:RRRC_00404 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y213Stop mutation is generated from the codon change TAT/TAA. 1579685 FHH-Tgfbr2m2Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tgfbr2m2Mcwi 1578782 8 120593595 120680453 7 8 123585765 123671209 7 8 124310288 124399345 7 8 115794537 115883615 7 RRID:RRRC_00400 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG. 1579686 GH/OmrMcwi PhysGen inbred Live Animals; Cryopreserved Embryo RRID:RGD_1579686 This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then. 1579687 FHH-Procm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Procm1Mcwi 1578790 18 24563368 24573715 7 18 24633206 24643623 7 18 24918402 24928822 7 18 23764367 23774816 7 RRID:RRRC_00410 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L312P mutation is generated. 1579688 BN-Tgfbr2m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Tgfbr2m1Mcwi 1578800 8 120593595 120680453 7 8 123585765 123671209 7 8 124310288 124399345 7 8 115794537 115883615 7 RRID:RGD_1579688 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG. 1579689 FHH-F10m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10m1Mcwi 1578783 16 81327237 81346544 7 16 81288536 81307842 7 16 81803169 81822476 7 16 76468834 76488141 7 RRID:RRRC_00401 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V453G mutation is generated from the codon change GTC/GGC. 1579690 FHH-Slc27a5m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Slc27a5m1Mcwi 1578799 1 72924630 72935223 7 1 66387832 66398425 7 1 65576599 65587192 7 1 73616556 73627149 7 RRID:RGD_1579690 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated. 1579691 SS.SHR-(D11Mgh3-D11Rat31)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 11 8176272 68234949 1 - by flanking markers 11 10373455 72739854 1 - by flanking markers 11 6673351 69649875 1 - by flanking markers 11 8200022 66422316 1 - by flanking markers RRID:RGD_1579691 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579692 FHH-Lcatm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcatm1Mcwi 1578793 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00402 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H353L mutation is generated from the codon change CAC/CTC. 1579693 T2DN/Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin inbred Unknown RRID:RGD_1579693 Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained. 1579694 FHH-Egln3m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Egln3m1Mcwi 1578781 6 74451038 74476506 7 6 84592894 84618360 7 6 75050329 75075795 7 6 71650297 71675766 7 RRID:RRRC_00409 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E60G mutation is generated. 1579695 ACI.FHH-(D1Rat298-D1Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 225625031 267111153 1 - by flanking markers 1 247303036 289137268 1 - by flanking markers 1 240017117 281795785 1 - by flanking markers 1 219932573 259647894 1 - by flanking markers RRID:RGD_1579695 Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. 1579696 SS.SHR-(D6Wox13-D6Rat84)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 6 136451997 136452267 1 - by flanking markers 6 144273721 144273990 1 - by flanking markers 6 136142742 136143011 1 - by flanking markers 6 130729205 130729475 1 - by flanking markers RRID:RGD_1579696 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579697 SS.SHR-(D13Rat63-D13Mit1)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 13 25430110 80482429 1 - by flanking markers 13 14281836 87877411 1 - by flanking markers 13 9016742 82995671 1 - by flanking markers 13 5994668 77046890 1 - by flanking markers RRID:RGD_1579697 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579698 FHH-Adra1am1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Adra1am1Mcwi 1578792 15 46173429 46263198 7 15 48197628 48297316 7 15 43296997 43398314 7 15 40830125 40935902 7 RRID:RRRC_00408 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a. 1579699 WKY.WKHA-(D5Rat45-D5Rat245)/Cfd WKY.WKHA-(D5Rat45-D5Rat245)/Cfd Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA congenic Unknown 5 159265355 159265706 1 - by flanking markers 5 162571275 162571427 1 - by flanking markers 5 158854038 158854190 1 - by flanking markers 5 152630083 152630236 1 - by flanking markers RRID:RGD_1579699 This congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain background 1579700 ACI.FHH-(D1Rat475-D1Rat90)(D3Rat84-D3Rat59)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1579700 Double congenic strain from backcross of ACI.FHH-(D1Rat298-D1Rat90)/Eur and ACI.FHH-(D3Wox2-D3Rat59)/Eur. 1579701 BN-Nos1m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Nos1m1Mcwi 1578795 12 39812500 39869484 7 12 46049288 46209569 7 12 44214949 44405530 7 12 38615111 38795492 7 RRID:RGD_1579701 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L72Stop mutation is generated. 1579702 SS.SHR-(D9Wox16-D9Rat64)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 21667066 21667256 1 - by flanking markers 9 27914255 97338238 1 - by flanking markers 9 29075079 97647719 1 - by flanking markers 9 25268044 91090963 1 - by flanking markers RRID:RGD_1579702 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579703 SS.SHR-(D2Rat61-D2Mco18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 2 79796833 227150249 1 - by flanking markers 2 88594475 100298539 1 - by flanking markers 2 68865414 80632096 1 - by flanking markers 18;2 79924734;78665619 79925127;78665763 1 - by flanking markers;1 - by flanking markers RRID:RGD_1579703 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579704 FHH-Agtr1bm1Mcwi PhysGen, Rat Resource & Research Center mutant Extinct (as of 2016-11-29) Agtr1bm1Mcwi 1578784 2 105503269 105602591 7 2 124879262 124954378 7 2 105149020 105224335 7 2 102844969 102920232 7 RRID:RGD_1579704 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A 3bp deletion generates a mutation at TTC (del251F)of rat Agtr1b. 1579705 FHH-Nr0b2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nr0b2m1Mcwi 1578798 5 151524685 151528000 7 5 155465275 155468590 7 5 151776004 151779319 7 5 145779294 145782609 7 RRID:RRRC_00403 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC. 1579706 FHH-Nr4a1m1Mcwi PhysGen mutant Cryopreserved Sperm (as of 2017-01-26) Nr4a1m1Mcwi 1578791 7 140012807 140020590 7 7 140700242 140721073 7 7 142899358 142920216 7 7 132368399 132389300 7 RRID:RGD_1579706 Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA. 1579707 FHH-Adipoqm2Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm2Mcwi 1578797 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00407 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq. 1579708 FHH-Desm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Desm1Mcwi 1578801 9 74637783 74645499 7 9 82325835 82333549 7 9 82556574 82564288 7 9 76850979 76858695 7 RRID:RGD_1579708 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated. 1579709 Wild/Mcwi Wild Caught in Milwaukee Wisconsin wild Unknown RRID:RGD_1579709 These rats were caught wild in Milwaukee, used for experiments and then sacrificed. 1579710 GK/Far Goto-Kakizaki James A. Haley Veterans Hospital, Tampa Florida inbred Unknown RRID:RGD_1579710 Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. 1579711 FHH-Adipoqm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm1Mcwi 1578787 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00406 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.Y162C mutation is generated on rat Adipoq. 1579712 FHH-Klf6m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Klf6m1Mcwi 1578789 17 75578498 75585072 7 17 69616967 69674031 7 17 67887939 67945052 7 17 64539456 64548451 7 RRID:RGD_1579712 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated. 1579894 SS.LEW-(D10Rat204-D10Rat9)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 94837236 99588446 1 - by flanking markers 10 93421499 93421719 1 - by flanking markers 10 93662786 93663006 1 - by flanking markers 10 90404397 90404618 1 - by flanking markers RRID:RGD_1579894 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. 1579895 FHH-Bdkrb2m1Mcwi PhysGen mutant Extinct (as of 2016-10-24) Bdkrb2m1Mcwi 1579889 6 129744781 129748851 7 6 138615812 138622272 7 6 129399468 129429676 7 6 124472317 124502497 7 RRID:RGD_1579895 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated. 1579896 SS.LEW-(D2Rat18-D2Chm277)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 40912197 56722286 1 - by flanking markers 2 60126669 76472773 1 - by flanking markers 2 41063439 56736627 1 - by flanking markers 2 41125789 56532139 1 - by flanking markers RRID:RGD_1579896 Congenic strain was created from a SS/Jr parental strain 1579897 SS.SR-(D9Rat69-D9Mco14)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 9 66679876 74437140 1 - by flanking markers 9 74640722 82125547 1 - by flanking markers 9 74858383 82356286 1 - by flanking markers 9 69371595 76650886 1 - by flanking markers RRID:RGD_1579897 A congenic strain derived from the progenitor strains SS and SR. 1579898 SS.LEW-(D10Chm128-D10Chm121)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 71365656 1 - by flanking markers 10 69272915 71014829 1 - by flanking markers 10 69638898 70499629 1 - by flanking markers 10 67232398 68082614 1 - by flanking markers RRID:RGD_1579898 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579899 SS.LEW-(D5Rat130-D5Rat31)/JrMcwi SS.LEW-(D5Rat130-D5Rat31)/JrMcwi Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 139996194 1 - by flanking markers 5 36590997 142265366 1 - by flanking markers 5 31926122 138454239 1 - by flanking markers 5 31663789 133011550 1 - by flanking markers RRID:RGD_1579899 This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. 1579900 SS.SR-(D9Rat89-Resp18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 72257996 74558151 1 - by flanking markers 9 80172493 82246695 1 - by flanking markers 9 80400409 82477136 1 - by flanking markers 9 74701668 76771824 1 - by flanking markers RRID:RGD_1579900 Congenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strain 1579901 SS.LEW-(D10Chm224-D10Chm6)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76000447 1 - by flanking markers 10 75100237 76438561 1 - by flanking markers 10 75001953 76556637 1 - by flanking markers 10 72508825 72509024 1 - by flanking markers RRID:RGD_1579901 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579902 SS.LEW-(D5Rat130-D5Rat108)/JrMcwi SS.LEW-(D5Rat130-D5Rat108)/JrMcwi Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 5 31663789 128034027 1 - by flanking markers RRID:RGD_1579902 This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. 1579903 SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 97152234 100633982 1 - by flanking markers 10 95701164 99184250 1 - by flanking markers 10 95967019 99492409 1 - by flanking markers 10 92698959 96121100 1 - by flanking markers RRID:RGD_1579903 A congenic substrain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. 1579904 SS.SR-(D9Mgh11-D9Mco33)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 10 86983905 86984155 1 - by flanking markers 10 85965754 85966003 1 - by flanking markers 10 86168841 86169090 1 - by flanking markers 10 83212828 83213078 1 - by flanking markers RRID:RGD_1579904 A congenic strain derived from the progenitor strains SS and SR. 1579905 SS.SR-(D9Rat89-D9Mco27)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 9;10 72257996;76477677 72258219;76477875 1 - by flanking markers;1 - by flanking markers 9;10 80172493;74600366 80172715;74600564 1 - by flanking markers;1 - by flanking markers 9;10 80400409;75505821 80400631;75506019 1 - by flanking markers;1 - by flanking markers 9;10 74701668;72976092 74701891;72976291 1 - by flanking markers;1 - by flanking markers RRID:RGD_1579905 Congenic strain derived from parental strains SS and SR. 1579906 FHH-Adipoqm3Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm3Mcwi 1579887 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00414 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L119P mutation is generated from the codon change CTG/CCG of rat Adipoq. 1579907 SS.LEW-(D10Chm128-D10Chm169)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 70654393 1 - by flanking markers 10 69272915 69442411 1 - by flanking markers 10 69638898 69809020 1 - by flanking markers 10 67232398 67400546 1 - by flanking markers RRID:RGD_1579907 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579908 SS.SR-(D9Mco95-Resp18)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80867159 82246695 1 - by flanking markers 9 81100315 82477136 1 - by flanking markers 9 75403227 76771824 1 - by flanking markers RRID:RGD_1579908 A congenic strain derived from the progenitor strains SS and SR. 1579909 FHH-Fgl2m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Fgl2m1Mcwi 1579885 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1579909 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA. 1579910 FHH-Ccr2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccr2m1Mcwi 1579888 8 128892784 128893905 7 8 123734465 123742483 7 RRID:RRRC_00399 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N117S mutation is generated from the codon change AAT/AGT. 1579911 SS.LEW-(D5Rat130-D5Rat72)/Mcwi SS.LEW-(D5Rat130-D5Rat72)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 120983466 1 - by flanking markers 5 36590997 123028200 1 - by flanking markers 5 31926122 119125145 1 - by flanking markers 5 31663789 114973531 1 - by flanking markers RRID:RGD_1579911 This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. 1579912 FHH-F10m2Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10m2Mcwi 1579886 16 81327237 81346544 7 16 81288536 81307842 7 16 81803169 81822476 7 16 76468834 76488141 7 RRID:RRRC_00412 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C388 Stop mutation is generated from the codon change TGC/TGA 1579913 SS.LEW-(D10Chm224-D10Chm222)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76477875 1 - by flanking markers 10 74600366 76309841 1 - by flanking markers 10 75505821 75506019 1 - by flanking markers 10 72976092 72976291 1 - by flanking markers RRID:RGD_1579913 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579914 SS.LEW-(D10Mco30-D10Got92)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 77956387 1 - by flanking markers 10 73693979 76919627 1 - by flanking markers 10 76420583 77055888 1 - by flanking markers 10 73887148 74372232 1 - by flanking markers RRID:RGD_1579914 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. 1580542 PCK-Pkhd1pck/CrljCrl Charles River Laboratories Charles River Laboratories coisogenic Unknown Pkhd1pck 11535943 RRID:RGD_1580542 This model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Harris and associates in 2002. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD). 1581616 DA.ACI-(D15Rat23-D15Rat71)/Kini DA.ACI-(D15Rat23-D15Rat71)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 83040937 85456512 1 - by flanking markers 15 87155990 89768452 1 - by flanking markers 15 83647062 86002030 1 - by flanking markers 15 76003569 78330139 1 - by flanking markers RRID:RGD_1581616 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581617 SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13Gar University of Texas Southwestern Medical Center, Dallas Texas transgenic Unknown RRID:RGD_1581617 This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) 1581618 SHRSP/Bbb Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown RRID:RGD_1581618 This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany. 1581619 BN.PD-(D8Rat39-D8Rat35),SHR-(D2Mit4-D2Rat28),SHR-(D2Rat103-D2Rat107)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown RRID:RGD_1581619 This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-Lx. 1581620 SS.SR-(D9Mco61-D9Mco27)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown RRID:RGD_1581620 A congenic strain derived from the progenitor strains SS and SR. 1581621 DA.ACI-(D15Rat6-D15Rat48)/Kini DA.ACI-(D15Rat6-D15Rat48)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 61161186 1 - by flanking markers 15 37103190 65959514 1 - by flanking markers 15 33219101 62301382 1 - by flanking markers 15 28030665 55302115 1 - by flanking markers RRID:RGD_1581621 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581622 SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrc University of Texas Southwestern Medical Center, Dallas, Texas Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-17) RRID:RRRC_00318 This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) 1581623 LA/Humd low autotomy Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581623 Low Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581624 FHH-Lipem1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Lipem1Mcwi 1581495 1 80663791 80682480 7 1 83511504 83530200 7 1 82248031 82266727 7 1 80965612 80984313 7 RRID:RGD_1581624 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L347P mutation is generated from the codon change CTA/CCA. 1581625 BN-Hand1m1Mcwi PGA mutant Unknown Hand1m1Mcwi 1581493 10 43423366 43425933 7 10 43050068 43052635 7 10 43250729 43253296 7 10 42006646 42009213 7 RRID:RGD_1581625 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC. 1581626 FHL/EurMcwi Fawn Hooded Low blood pressure PGA inbred Unknown RRID:RGD_1581626 The low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage. 1581627 WF.WKY-(D5Uwm66-D5Uwm67)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 73080117 79919776 1 - by flanking markers 5 76105513 82897734 1 - by flanking markers 5 71940894 78777811 1 - by flanking markers 5 69927283 76370048 1 - by flanking markers RRID:RGD_1581627 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581628 DA.ACI-(D15Rat6-D15Rat13)/Kini DA.ACI-(D15Rat 6-D15Rat13)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 43772355 1 - by flanking markers 15 37103190 51565184 1 - by flanking markers 15 33219101 47814460 1 - by flanking markers 15 28030665 38692741 1 - by flanking markers RRID:RGD_1581628 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581629 WF.WKY-(D5Wox8-D5Uwm62)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 4291144 61238981 1 - by flanking markers 5 4498411 64739489 1 - by flanking markers 5 4525738 60225339 1 - by flanking markers 5 5112159 58973694 1 - by flanking markers RRID:RGD_1581629 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581630 WF.WKY-(D5Uwm63-D5Uwm64)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 57848236 62299211 1 - by flanking markers 5 61271852 65886550 1 - by flanking markers 5 56733010 61370302 1 - by flanking markers 5 55564549 60051321 1 - by flanking markers RRID:RGD_1581630 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581631 WF.WKY-(D5Uwm61-D5Uwm37)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 84434303 130527490 1 - by flanking markers 5 87362775 132652105 1 - by flanking markers 5 83268986 128812854 1 - by flanking markers 5 80813116 123935338 1 - by flanking markers RRID:RGD_1581631 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581632 WF.WKY-(D5Uwm65-D5Uwm60)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 65553185 76159022 1 - by flanking markers 5 72838045 79426001 1 - by flanking markers 5 68395096 75274687 1 - by flanking markers 5 63190890 72943679 1 - by flanking markers RRID:RGD_1581632 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581633 DA.ACI-(D15Rat6-D15Rat71)/Kini DA.ACI-(D15Rat6-D15Rat71)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 85456512 1 - by flanking markers 15 37103190 89768452 1 - by flanking markers 15 33219101 86002030 1 - by flanking markers 15 28030665 78330139 1 - by flanking markers RRID:RGD_1581633 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581634 BN-Adora2am1Mcwi PhysGen mutant Extinct (as of 2016-10-24) Adora2am1Mcwi 1581476 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1581634 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a. 1581635 WKY/Bbb Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown RRID:RGD_1581635 This WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany. 1581636 BN-Cebpem1Mcwi PGA mutant Unknown Cebpem1Mcwi 1581494 15 32787946 32789344 7 15 37241081 37242479 7 15 33356119 33357517 7 15 28169711 28171471 7 RRID:RGD_1581636 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG. 1581637 FHH-Has1m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Has1m1Mcwi 1581477 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1581637 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG. 1581638 DA.ACI-(D15Rat126-D15Rat71)/Kini DA.ACI-(D15Rat126-D15Rat71)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 85456315 85456512 1 - by flanking markers 15 86610850 89768452 1 - by flanking markers 15 83094829 86002030 1 - by flanking markers 15 75448637 78330139 1 - by flanking markers RRID:RGD_1581638 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581639 HAn/Humd high autotomy new Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581639 Males and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581640 HA/Humd high autotomy Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581640 High Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581641 WF.WKY-(D5Uwm68-D5Mit4)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 77277626 94516069 1 - by flanking markers 5 80544432 97315322 1 - by flanking markers 5 76401130 93273395 1 - by flanking markers 5 74047272 90450412 1 - by flanking markers RRID:RGD_1581641 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581642 FHH-Ccr4m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ccr4m1Mcwi 1581492 8 118883148 118884230 7 8 121843005 121848545 7 8 122530152 122535959 7 8 114176291 114182033 7 RRID:RGD_1581642 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA. 1581643 LAn/Humd low autotomy new Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581643 Males and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581644 FHH-Htr1am1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Htr1am1Mcwi 1581496 2 36434518 36435786 7 2 55362662 55363930 7 2 36246628 36247896 7 2 36693462 36698026 7 RRID:RRRC_00413 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C266Y mutation is generated from the codon change TGT/TAT. 1581645 LL/Mav Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_1581645 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. 1582184 SR/JrHsd Dahl Salt-Resistant inotiv inbred Unknown RRID:RGD_1582184 Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. 1582185 SS.SR-(D3Mco36-D3Got166)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 166484910 171009778 1 - by flanking markers 3 178896560 181074971 1 - by flanking markers 3 172850273 177366660 1 - by flanking markers 3 163556062 168974694 1 - by flanking markers RRID:RGD_1582185 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582186 FHH.FHH.1BN-(D1Rat183-D1Rat76)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 131123181 230411453 1 - by flanking markers 1 138077032 252243871 1 - by flanking markers 1 137083889 244992610 1 - by flanking markers 1 129384185 224569684 1 - by flanking markers RRID:RGD_1582186 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582187 SS.SR-(D3Mco24-D3Got130)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 166525892 1 - by flanking markers 3 160026579 178936339 1 - by flanking markers 3 155586270 172890235 1 - by flanking markers 3 147739514 163596045 1 - by flanking markers RRID:RGD_1582187 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582188 SS.SR-(D3Mco36-D3Mco46)/Jr Medical College of Ohio, Toledo, Ohio, USA Rat Resource and Research Center, congenic Cryopreserved Sperm (as of 2019-02-18) 3 168983202 171009778 1 - by flanking markers 3 181074759 181830490 1 - by flanking markers 3 175283587 177366660 1 - by flanking markers 3 167003822 168974694 1 - by flanking markers RRID:RRRC_00660 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582189 SS.SR-(D3Mco39-D3Got130)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 149823173 1 - by flanking markers 3 160026579 180014700 1 - by flanking markers 3 155586270 176305870 1 - by flanking markers 3 147739514 167914627 1 - by flanking markers RRID:RGD_1582189 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582190 SS/JrHsd Dahl Salt-Sensitive Envigo Envigo inbred Unknown RRID:RGD_1582190 Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. 1582191 FHH.FHH.1BN-(D1Rat287-D1Rat84)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 190114247 259322833 1 - by flanking markers 1 208389496 281400240 1 - by flanking markers 1 201358068 273987019 1 - by flanking markers 1 185356336 252280168 1 - by flanking markers RRID:RGD_1582191 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582192 SS.SR-(D3Mco36-D3Got159)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 162807724 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 3 168974481 168974694 1 - by flanking markers RRID:RGD_1582192 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582193 FHH.FHH.1BN-(D1Mgh13-D1Rat89)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 252340389 265343617 1 - by flanking markers 1 274224224 287349830 1 - by flanking markers 1 266793821 279986079 1 - by flanking markers 1 245907761 257976495 1 - by flanking markers RRID:RGD_1582193 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582194 SS.SR-(D3Mco78-D3Got130)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 164079729 1 - by flanking markers 3 160026579 177341735 1 - by flanking markers 3 155586270 171277347 1 - by flanking markers 3 147739514 161994638 1 - by flanking markers RRID:RGD_1582194 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582195 FHH.FHH.1BN-(D1Rat173F6B-D1Rat84)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 259322503 259322833 1 - by flanking markers 1 281400069 281400240 1 - by flanking markers 1 273986848 273987019 1 - by flanking markers 1 252279996 252280168 1 - by flanking markers RRID:RGD_1582195 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582196 FHH.FHH.1BN-(D1Rat234-D1Rat265)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 41225047 90449243 1 - by flanking markers 1 95453405 95453561 1 - by flanking markers 1 94364073 94364229 1 - by flanking markers 1 90664883 90665040 1 - by flanking markers RRID:RGD_1582196 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1598797 WF.WKY-(D10Got124-D10Rat187)/Uwm Department of Oncology, University of Wisconsin, Madison Wisconsin congenic Unknown 10 89575059 110385665 1 - by flanking markers 10 88338460 109941891 1 - by flanking markers 10 88544136 110355174 1 - by flanking markers 10 85565469 106428971 1 - by flanking markers RRID:RGD_1598797 WKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL. 1598798 BBDP/WorN NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) RRID:RRRC_00092 Diabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. 1598799 ACI.FHH-(D1Rat384-D1Rat452)(D17Rat61-D1Arb5)(D17Rat51)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1598799 Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain. 1598800 ACI.FHH-(D1Rat384-D1Rat156)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229184432 253410500 1 - by flanking markers 1 250993318 279213254 1 - by flanking markers 1 243737319 243737466 1 - by flanking markers 1 223390805 223390953 1 - by flanking markers RRID:RGD_1598800 Congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain. 1598801 ACI.FHH-(D1Mit18-D1Mit8)(D14Mit11-D14Hmgc14b)(D14Rat65-D14Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1598801 Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. 1598802 BBDR/WorN NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) RRID:RRRC_00094 Diabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation 1598803 BBNB/WorN NIH Autoimmune Rat Model Repository and Dev Ctr. Rat Resource and Research Center inbred Unknown (as of 2020-02-24) RRID:RRRC_00093 Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. 1598804 WKY.GHS-(D1Rat32-D1Mit32) Department of Medicine and Physiology, University of Rochester, Rochester New York congenic Unknown 1 112148733 250430505 1 - by flanking markers 1 202649657 272443364 1 - by flanking markers 1 195598053 265002735 1 - by flanking markers 1 244113147 244113296 1 - by flanking markers RRID:RGD_1598804 GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTL 1599674 BBDP.WF-(D8Rat59-D8Sunn1467)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 112242639 128970675 1 - by flanking markers 8 115112735 132425312 1 - by flanking markers 8 133272922 133273132 1 - by flanking markers 8 123815688 123815899 1 - by flanking markers RRID:RGD_1599674 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1599675 BBDP.WF-(D13Rat124-D13Mgh5)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown Ptprc 3451 13 46721037 63301552 1 - by flanking markers 13 55662705 71178960 1 - by flanking markers 13 50609228 66204630 1 - by flanking markers 13 45228358 61058078 1 - by flanking markers RRID:RGD_1599675 The BBDP/WorSunn rats were crossed with inbred WF rats (that share the same MHC haplotype as BBDP/WorSunn rats but differ at the CD45 allele) obtained from Charles River. Introgression of the WF CD45 (RT7.2) allele into BBDP/WorSunn was performed by phenotypic selection of backcross breeders for >10 generations, followed by intercrossing. This led to WF RT7.2 allele introgressed onto the genetic background of BBDP rats and also called BBDP/WorSunn.WF-CD45 inbred line. 1599755 F344.BN-(D16Mit5-D16Rat75) Department of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, Italy congenic Unknown 16 24131965 24132402 1 - by flanking markers 16 24112631 24112769 1 - by flanking markers 16 24228228 24228366 1 - by flanking markers 16 22477482 22477621 1 - by flanking markers RRID:RGD_1599755 BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segment 1599756 BN-Has2m1Mcwi PGA mutant Unknown Has2m1Mcwi 1599566 7 93230135 93256139 7 7 97055458 97081461 7 7 96438046 96464049 7 7 88113326 88139337 7 RRID:RGD_1599756 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA. 1599757 BN-Adora2am2Mcwi PhysGen mutant Extinct (as of 2016-10-24) Adora2am2Mcwi 1599561 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1599757 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a. 1599758 SS-Sod3m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2021-11-03) Sod3m1Mcwi 1599567 14 63381447 63387180 7 14 61071304 61083776 7 14 60958583 60971143 7 14 58610104 58615845 7 RRID:RRRC_00415 Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT. 1599759 GRY/Idr groggy rat National BioResource Project for the Rat in Japan, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan National BioResource Project for the Rat in Japan, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan inbred Cryopreserved Embryo (as of 2024-09-24) Neurobiology Cacna1agry 12880382 RRID:RGD_1599759 Groggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003. 1599760 SPRD.WKY-(D18Wox8-D18Rat44)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 18 19892650 86863412 1 - by flanking markers 18 20030289 86114102 1 - by flanking markers 18 20285758 87080053 1 - by flanking markers 18 19278901 83218561 1 - by flanking markers RRID:RGD_1599760 SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. 1599761 BN-Lcatm2Mcwi PGA mutant Unknown Lcatm2Mcwi 1599570 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RGD_1599761 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG. 1599762 SS-Bdkrb2m2Mcwi PGA mutant Unknown Bdkrb2m2Mcwi 1599568 6 129744781 129748851 7 6 138615812 138622272 7 6 129399468 129429676 7 6 124472317 124502497 7 RRID:RGD_1599762 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA. 1599763 SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 5 24978084 24978263 1 - by flanking markers 5 29109097 29109277 1 - by flanking markers RRID:RGD_1599763 SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. 1599764 COP.DA-(D16Rat12-D16Rat90)/Mco University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 16 350121 85734479 1 - by flanking markers 16 1084304 85597057 1 - by flanking markers 16 1090054 86162972 1 - by flanking markers 16 380245 80345693 1 - by flanking markers RRID:RGD_1599764 Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. 1599765 SS-Klf4m2Mcwi PGA mutant Unknown Klf4m2Mcwi 1599559 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RGD_1599765 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC. 1599766 SS-Hps6m1Mcwi PGA mutant Unknown Hps6m1Mcwi 1599564 1 251226344 251228953 7 1 273191755 273194364 7 1 265761818 265764427 7 1 244853256 244855865 7 RRID:RGD_1599766 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG. 1599767 SS-Htr1am2Mcwi PGA mutant Unknown Htr1am2Mcwi 1599562 2 36434518 36435786 7 2 55362662 55363930 7 2 36246628 36247896 7 2 36693462 36698026 7 RRID:RGD_1599767 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC. 1599768 SS-Klf4m1Mcwi PGA mutant Unknown Klf4m1Mcwi 1599569 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RGD_1599768 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC. 1599769 COP.DA-(D3Rat233-D3Mgh14)/Mco University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 3 118863100 118863223 1 - by flanking markers 3 130198712 130198834 1 - by flanking markers 3 123700322 123700444 1 - by flanking markers 3 118376416 118376539 1 - by flanking markers RRID:RGD_1599769 Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. 1600337 F344.GK-(D1Mgh14-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 263698966 267111153 1 - by flanking markers 1 285604773 289137268 1 - by flanking markers 1 278228767 281795785 1 - by flanking markers 1 256448513 259647894 1 - by flanking markers RRID:RGD_1600337 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600338 SHR.F344-(D12Mgh5-D12Mgh6)/Snk Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan congenic Unknown 12 29130180 42387195 1 - by flanking markers 12 33647399 33647522 1 - by flanking markers 12 31723565 31723688 1 - by flanking markers 12 28064433 28064557 1 - by flanking markers RRID:RGD_1600338 Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique 1600339 BN.GK-(D1Wox18-D1Got254)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 1 94626541 264367394 1 - by flanking markers 1 101198387 286341689 1 - by flanking markers 1 100133276 278978026 1 - by flanking markers 1 94644435 257091168 1 - by flanking markers RRID:RGD_1600339 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 1600340 DA/BklArbNsi Feinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NY Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00693 Originally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI. 1600341 LEW-Tg(Ren2)27/Jmul Wake Forest University School of Medicine, Winston-Salem, North Carolina transgenic Unknown RRID:RGD_1600341 This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl rats 1600342 F344.GK-(D1Got250-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 259168938 267111153 1 - by flanking markers 1 281200731 289137268 1 - by flanking markers 1 273787505 281795785 1 - by flanking markers 1 252080660 259647894 1 - by flanking markers RRID:RGD_1600342 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600343 SHRSP.WKY-(D1Wox29-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_1600343 This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy 1600344 F344.GK-(D1Rat175-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 267110921 267111153 1 - by flanking markers 1 289137107 289137268 1 - by flanking markers 1 281795624 281795785 1 - by flanking markers 1 259647732 259647894 1 - by flanking markers RRID:RGD_1600344 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600345 F344.GK-(D1Rat83-D1Rat376)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 252133623 252133935 1 - by flanking markers 1 274017004 274017147 1 - by flanking markers 1 266587077 266587220 1 - by flanking markers 1 245700955 245701099 1 - by flanking markers RRID:RGD_1600345 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600346 F344.GK-(D1Swe4-D1Rat85)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 255386328 258599658 1 - by flanking markers 1 277075545 280845045 1 - by flanking markers 1 269633949 273433763 1 - by flanking markers 1 248746112 251790570 1 - by flanking markers RRID:RGD_1600346 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600490 SS-Chr 1BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1600490 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 1625284 Wild1/Hubr Hubrecht Laboratory, Utrecht, The Netherlands wild Unknown RRID:RGD_1625284 This rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolation 1626207 BN-Adora2am3Mcwi PhysGen mutant Extinct (as of 2016-10-24) Adora2am3Mcwi 1642070 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1626207 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E207K mutation is generated from the codon change GAG/AAG of rat Adora2a. 1626210 BN-Lipem2Mcwi PGA mutant Unknown Lipem2Mcwi 1642169 1 80663791 80682480 7 1 83511504 83530200 7 1 82248031 82266727 7 1 80965612 80984313 7 RRID:RGD_1626210 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q52L mutation is generated from the codon change CTG/CAG. 1626211 SS-Cpf2m1Mcwi PGA mutant Unknown RRID:RGD_1626211 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. 1626213 BN-Oxtrm1Mcwi PGA mutant Unknown Oxtrm1Mcwi 1642173 4 148314089 148326797 7 4 207701360 207717840 7 4 144399326 144417598 7 4 145598549 145614674 7 RRID:RGD_1626213 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F225Y mutation is generated from the codon change TTC/TAC. 1626214 BN-Slc27a5m2Mcwi PGA mutant Unknown Slc27a5m2Mcwi 1642170 1 72924630 72935223 7 1 66387832 66398425 7 1 65576599 65587192 7 1 73616556 73627149 7 RRID:RGD_1626214 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K160E mutation is generated from the codon change AAA/GAA. 1641831 MWF-Chr 6SHR/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_1641831 MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 1641849 SS.LEW-(D10Mit1-D10Mgh1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 95368898 95369088 1 - by flanking markers 10 93929621 93929812 1 - by flanking markers RRID:RGD_1641849 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641850 SHR.WKY-(D1Got158-D1Got161)/Njs Department of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UK congenic Unknown Spon1 619918 1 169571535 169571693 1 - by flanking markers 1 183593063 183593220 1 - by flanking markers 1 176611942 176612099 1 - by flanking markers 1 165908744 165908902 1 - by flanking markers RRID:RGD_1641850 This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region 1641851 SHR.PD-(D8Rat42-D8Arb23)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16Lx 727921|12910834 8 51376771 52822796 1 - by flanking markers 8 51046971 52459221 1 - by flanking markers 8 52446316 53840120 1 - by flanking markers 8 48432652 49868959 1 - by flanking markers RRID:RGD_1641851 A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-Lx strain 1641852 WF.BBDR-(D4Got48-D4Got43)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65628995 68036772 1 - by flanking markers 4 65594194 133430955 1 - by flanking markers 4 65776688 68645203 1 - by flanking markers 4 66800270 69276226 1 - by flanking markers RRID:RGD_1641852 This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. 1641853 SS.LEW-(D10Mco38-D10Mgh1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 65122086 1 - by flanking markers 10 65339106 66856515 1 - by flanking markers RRID:RGD_1641853 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641854 HAS.LAS-(D5Rat70-D5Rat37)/Rar Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado congenic Unknown 5 36386126 148460381 1 - by flanking markers 5 40446731 151220567 1 - by flanking markers 5 35788756 147487820 1 - by flanking markers 5 35189153 141643988 1 - by flanking markers RRID:RGD_1641854 HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, 1641855 BBDP.WF-(D8Rat73-D8Rat20)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 94870319 1 - by flanking markers 8 94761016 96840283 1 - by flanking markers 8 95257972 97339444 1 - by flanking markers 8 88552647 90508589 1 - by flanking markers RRID:RGD_1641855 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641856 P.NP-(D4Rat119-D4Rat55)/Iusm Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 4 126192368 126192555 1 - by flanking markers RRID:RGD_1641856 iP and iNP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection 1641857 BBDP.WF-(D8Rat16-D8Sunn1467)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 98878516 128970675 1 - by flanking markers 8 100780886 132425312 1 - by flanking markers 8 101304999 133273132 1 - by flanking markers 8 94388671 123815899 1 - by flanking markers RRID:RGD_1641857 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641858 SHR.WKY-(D1Rat420-D1Rat278)/Njs Department of Cardiovascular Sciences, University of Leicester, Glenfield Hospital, UK congenic Unknown 1 167931247 168930831 1 - by flanking markers 1 181904343 182965674 1 - by flanking markers 1 174905726 175980872 1 - by flanking markers 1 164310419 165279420 1 - by flanking markers RRID:RGD_1641858 This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region 1641859 SS.MNS-(D10Bra1-D10Mit11)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers RRID:RGD_1641859 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641860 SS.MNS-(D10Mco62-D10Mit1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 95369088 1 - by flanking markers 10 70763267 93929812 1 - by flanking markers RRID:RGD_1641860 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641861 HAS.LAS-(D2Rat53-D2Rat138)/Rar Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 2 204077549 230157845 1 - by flanking markers 2 230770662 256283467 1 - by flanking markers 2 211301116 237742948 1 - by flanking markers 2 196146703 221167075 1 - by flanking markers RRID:RRRC_00729 HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, 1641862 F344-ApcPirc/Uwm University of Wisconsin-Madison, Madison, Wisconsin Rat Resource and Research Center mutant Live Animals; Cryopreserved Sperm (as of 2018-07-16) ApcPirc 1554322 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RRRC_00782 Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam) 1641863 SHR.PD-(D8Mgh9-D8Rat149)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16Lx 727921|12910834 8 58692901 58693265 1 - by flanking markers 8 58297648 58297798 1 - by flanking markers 8 59716199 59716349 1 - by flanking markers 8 55523877 55524028 1 - by flanking markers RRID:RGD_1641863 A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv. 1641864 WF/CrCrli Charles River Laboratories Italy Charles River Laboratories Italy inbred Unknown RRID:RGD_1641864 J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute. 1641865 SD-Brca2m1Uwm University of Wisconsin-Madison, Madison, Wisconsin Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca2m1Uwm 728326 12 4282952 4323693 7 12 490733 535090 7 12 518257 518257 8 12 74070 74070 8 RRID:RRRC_00286 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. Nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon). 1641866 SS.LEW-(D10Mit10-D10Rat24)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 79229233 1 - by flanking markers 10 27082535 78195122 1 - by flanking markers 10 27237530 78343192 1 - by flanking markers 10 26521957 75632053 1 - by flanking markers RRID:RGD_1641866 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641867 Iusm:P alcohol-preferring Indiana Alcohol Research Center at the Indiana University School of Medicine outbred Unknown Snca 3729 RRID:RGD_1641867 These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop this preference line (P) and non-preference line (Iusm:NP, RGD:1641873). 1641868 WF.BBDR-(D4Rat93-D4Rat228)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown Tcrb 3834 4 67390393 67390598 1 - by flanking markers 4 67470286 67470490 1 - by flanking markers 4 67663300 67663504 1 - by flanking markers 4 68653456 68653663 1 - by flanking markers RRID:RGD_1641868 This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. 1641869 SS.MNS-(D10Mco31-D10Mit11)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 84284413 101848683 1 - by flanking markers 10 83219971 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 10 80536974 80537228 1 - by flanking markers RRID:RGD_1641869 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641870 BBDP.WF-(D8Rat73-D8Rat121)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 118705380 1 - by flanking markers 8 94761016 121648073 1 - by flanking markers 8 95257972 95258175 1 - by flanking markers 8 88552647 88552853 1 - by flanking markers RRID:RGD_1641870 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641871 SS.MNS-(D10Mco62-D10Mco31)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 84284667 1 - by flanking markers 10 70763267 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 10 80536974 80537228 1 - by flanking markers RRID:RGD_1641871 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641872 SS.LEW-(D10Mco38-D10Mco41)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 85793448 1 - by flanking markers 10 65339106 84798381 1 - by flanking markers 10 85007626 85007896 1 - by flanking markers 10 82057244 82057515 1 - by flanking markers RRID:RGD_1641872 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641873 Iusm:NP alcohol-nonpreferring Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown Snca 3729 RRID:RGD_1641873 These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop a preference line (Iusm:P, RGD:1641867) and this non-preference line (Iusm:NP). 1641874 BBDP.WF-(D8Rat73-D8Rat90)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 114974688 1 - by flanking markers 8 94761016 118204000 1 - by flanking markers 8 95257972 118862813 1 - by flanking markers 8 88552647 110572221 1 - by flanking markers RRID:RGD_1641874 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641875 SHR-Chr YBN/Cub Czech Academy of Sciences, Prague, Czech Republic consomic Unknown RRID:RGD_1641875 BN-Lx/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations 1641876 BBDP.WF-(D8Rat73-D8Sunn1467)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 128970675 1 - by flanking markers 8 94761016 132425312 1 - by flanking markers 8 95257972 133273132 1 - by flanking markers 8 88552647 123815899 1 - by flanking markers RRID:RGD_1641876 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641877 NP.P-(D4Rat119-D4Rat55)/Iusm Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown Akr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap1 2092|3197|3729|68368|735049|1307836|1308501|1310949|1311418 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 4 126192368 126192555 1 - by flanking markers RRID:RGD_1641877 Male iP and female iNP rats were crossed to get F1 animals which were further backcrossed to iNP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection 1641878 WF.BBDR-(Clcn1-D4Rat228)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown Clcn1 2360 4 70052319 70081449 1 - by flanking markers 4 136479719 136509472 1 - by flanking markers 4 71674218 71704318 1 - by flanking markers 4 71171949 71201483 1 - by flanking markers RRID:RGD_1641878 This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. 1641879 SS-Chr 19SHR/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_1641879 SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 1641880 SD-Brca1m1Uwm University of Wisconsin-Madison, Madison, Wisconsin Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca1|Brca1m1Uwm 2218|728298 10 90513630 90572676 7 10 89192653 89252760 7 10 89394821 89455093 7 10 86417441 86477762 7 RRID:RRRC_00285 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon. 1642017 BBDR/WorBrm Biomedical Research Models, Inc. Biomedical Research Models, Inc. inbred Unknown RRID:RGD_1642017 Diabetes resistant BB rats maintained in BRM. This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at Biomedical Research Models, Inc. 1642018 BBDP/WorBrm Biomedical Research Models, Inc. Biomedical Research Models, Inc. inbred Unknown RRID:RGD_1642018 This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester. 1642036 SHR/OlaIpcv-mtBN/Crl Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic conplastic Unknown RRID:RGD_1642036 Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic background 1642269 SS-Birc3m2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Birc3m2Mcwi 1642178 8 4682202 4696856 7 8 6047454 6075236 7 8 6048590 6076828 7 8 5000844 5028470 7 RRID:RGD_1642269 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K170E mutation is generated from the codon change AAG/GAG. 1642270 BN-Lcatm3Mcwi PGA Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery Lcatm3Mcwi 1642175 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00397 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC. 1642271 SS-Klf4m3Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klf4m3Mcwi 1642179 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RRRC_00417 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H344L mutation is generated from the codon change CAT/CTT. 1642272 SS.LEW-(D10Mco84-D10Got93)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 72827158 1 - by flanking markers 10 69542746 71779712 1 - by flanking markers 10 69910832 71870652 1 - by flanking markers 10 67502108 69424978 1 - by flanking markers RRID:RGD_1642272 This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642273 SS-Thbdm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Thbdm1Mcwi 1642182 3 137158955 137162607 7 3 149159895 149163547 7 3 142748673 142752325 7 3 135863366 135867018 7 RRID:RGD_1642273 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N256K mutation is generated from the codon change AAC/AAA. 1642274 SS-Has1m2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Has1m2Mcwi 1642171 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1642274 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V155L mutation is generated from the codon change GTC/CTC. 1642275 SS.LEW-(D10Rat29-D10Mco88)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 71513333 1 - by flanking markers 10 67642121 71109330 1 - by flanking markers 10 67988035 70647306 1 - by flanking markers 10 68230134 68230352 1 - by flanking markers RRID:RGD_1642275 This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642276 SS-Kcna5m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcna5m1Mcwi 1642177 4 162896283 162898091 7 4 226075051 226076859 7 4 159077195 159079003 7 4 159354689 159358173 7 RRID:RRRC_00418 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N152K mutation is generated from the codon change AAT/AAA. 1642277 SS-Cpt2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cpt2m1Mcwi 1642174 5 129007685 129025501 7 5 131353542 131370821 7 5 127505646 127523016 7 5 122664677 122682126 7 RRID:RRRC_00416 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F475L mutation is generated from the codon change TTC/CTC. 1642278 SS-Ghsrm2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ghsrm2Mcwi 1642180 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RGD_1642278 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S342P mutation is generated from the codon change TCC/CCC. 1642279 SS.LEW-(D10Arb9-D10Rat161)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 97589703 1 - by flanking markers 10 66048908 96133217 1 - by flanking markers 10 65590122 65590250 1 - by flanking markers 10 63221094 63221223 1 - by flanking markers RRID:RGD_1642279 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642281 SS-Podxlm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Podxlm1Mcwi 1642176 4 58611904 58658598 7 4 58581513 58645671 7 4 58829049 58893353 7 4 60135124 60181829 7 RRID:RGD_1642281 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA. 1642282 SS-Cacna1gm1Mcwi PGA mutant Unknown Cacna1gm1Mcwi 1642168 10 83043636 83112886 7 10 81950594 82017885 7 10 82129071 82197828 7 10 79354998 79422960 7 RRID:RGD_1642282 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S490T mutation is generated from the codon change TCT/ACT. 1642283 SS.LEW-(D10Rat29-D10Got93)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 72827158 1 - by flanking markers 10 67642121 71779712 1 - by flanking markers 10 67988035 71870652 1 - by flanking markers 10 69424852 69424978 1 - by flanking markers RRID:RGD_1642283 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642284 SS-Fgl2m2Mcwi PGA mutant Unknown Fgl2m2Mcwi 1642181 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1642284 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K129N mutation is generated from the codon change AAG/AAT. 1642285 SS.LEW-(D10Arb9-D10Rat57)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 74388696 1 - by flanking markers 10 66048908 73484175 1 - by flanking markers 10 65590122 73582866 1 - by flanking markers 10 63221094 70982751 1 - by flanking markers RRID:RGD_1642285 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642287 SS.LEW-(D10Arb9-D10Mco84)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 70757419 1 - by flanking markers 10 66048908 69542910 1 - by flanking markers 10 65590122 69910996 1 - by flanking markers 10 63221094 67502273 1 - by flanking markers RRID:RGD_1642287 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642288 SS.LEW-(D10Mco89-D10Got101)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72684998 78262332 1 - by flanking markers 10 71638135 77223025 1 - by flanking markers 10 71727774 77360263 1 - by flanking markers 10 69282350 74676620 1 - by flanking markers RRID:RGD_1642288 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642289 SS-Serpina5m1Mcwi PGA mutant Unknown Serpina5m1Mcwi 1642167 6 128156901 128161334 7 6 136972583 136990812 7 6 127753152 127772403 7 6 123009224 123028412 7 RRID:RGD_1642289 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H24R mutation is generated from the codon change CAT/CGT. 1642362 SS-Has1m3Mcwi PGA mutant Unknown Has1m3Mcwi 1642359 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1642362 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D167D mutation is generated from the codon change GAT/GAC. 1642363 BN-Fgl2m3Mcwi PGA mutant Unknown Fgl2m3Mcwi 1642355 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1642363 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N353H mutation is generated from the codon change AAT/CAT. 1642364 SS-Ghsrm3Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsrm3Mcwi 1642357 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RRRC_00421 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N26K mutation is generated from the codon change AAC/AAA. 1642365 SS-Fgl2m4Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fgl2m4Mcwi 1642354 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RRRC_00420 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H338P mutation is generated from the codon change CAT/CCT. 1642366 SS-Lcatm4Mcwi PhysGen, Rat Resource & Research Center mutant Extinct (as of 2017-01-26) Lcatm4Mcwi 1642358 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RGD_1642366 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT. 1642367 BN-Ccr2m2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ccr2m2Mcwi 1642356 8 128892784 128893905 7 8 123734465 123742483 7 RRID:RGD_1642367 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I99T mutation is generated from the codon change ATC/ACC. 1642439 SS-Lcatm5Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcatm5Mcwi 1642438 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00419 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y297Stop mutation is generated from the codon change TAC/TAA. 1642689 BN.OLETF-(D1Rat169-D1Rat90)/Got Otsuka Pharmacuetical Company, Tokushima, Japan congenic Unknown Prlhr 71037 1 229876870 267111153 1 - by flanking markers 1 251652807 289137268 1 - by flanking markers 1 244401175 281795785 1 - by flanking markers 1 224054293 259647894 1 - by flanking markers RRID:RGD_1642689 OLETF/Got females were crossed with BN/Crlj to produce F1 which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotyped 1642690 LA-cp/NJcr Department of Surgery, University of Alberta, Edmonton, Canada congenic Unknown RRID:RGD_1642690 Originated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta. 1642968 SS.LEW-(D10Mco84-D10Rat58)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 71067824 1 - by flanking markers 10 69542746 70966782 1 - by flanking markers 10 69910832 70202084 1 - by flanking markers 10 67502108 67785171 1 - by flanking markers RRID:RGD_1642968 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642969 SS.LEW-(D10Mco84-D10Mco134)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642969 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642970 SS.LEW-(D10Mco113-D10Got93)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72827032 72827158 1 - by flanking markers 10 71779587 71779712 1 - by flanking markers 10 71870527 71870652 1 - by flanking markers 10 69424852 69424978 1 - by flanking markers RRID:RGD_1642970 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642971 SS.LEW-(D10Mco84-D10Mco129)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642971 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642972 SS.LEW-(D10Mco84-D10Mco143)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642972 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642989 SS-Tg(CAG-EGFP)1Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Cryopreserved Sperm (as of 2019-04-04) RRID:RGD_1642989 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642990 SD-Tg(CAG-EGFP)63Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642990 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. 1642991 SS-Tg(CAG-eGFP)18Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642991 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642992 SS-Tg(CAG-EGFP)28Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642992 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642993 SD-Tg(CAG-EGFP)97Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642993 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. 1642994 SS-Tg(CAG-EGFP)43Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642994 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642995 SS-Tg(CAG-eGFP)10Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642995 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642996 SS-Tg(CAG-EGFP)2Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642996 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642997 SS-Tg(CAG-EGFP)23Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642997 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1643001 FH/Unc Fawn-hooded Department of Psychiatry, University of North Carolina, Chapel Hill, North Carolina inbred Unknown RRID:RGD_1643001 A substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hill 1643002 SHR.WKY-(D1Rat420-D1Got161)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Spon1 619918 1 167931247 167931390 1 - by flanking markers 1 181904343 181904486 1 - by flanking markers 1 174905726 174905869 1 - by flanking markers 1 164310419 164310563 1 - by flanking markers RRID:RGD_1643002 Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR 1643007 DA.ACI-(D12Wox12-D12Rat53)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 12 20932555 43863270 1 - by flanking markers 12 24663002 50380790 1 - by flanking markers 12 22650721 48598906 1 - by flanking markers 12 19610889 42828880 1 - by flanking markers RRID:RGD_1643007 ACI/SegHsd and DA/OlaHsd were crossed to get F2 animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsd 1643010 F344.OLETF-(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj University of Tokushima Graduate School, Kuramato-cho, Tokushima, Japan congenic Unknown RRID:RGD_1643010 double congenic strain generated by intercrossing F344.OLETF-(D7Rat18-D7Mit2)/Tj and F344.OLETF-(D14Rat23-D14Rat12)/Tj and F2 rats screened for homozygosity 2289819 SS.MNS-(D10Mco62-D10Got99)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 76465800 1 - by flanking markers 10 70763267 74612561 1 - by flanking markers 10 75493824 75493944 1 - by flanking markers 10 72964095 72964216 1 - by flanking markers RRID:RGD_2289819 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289820 SS.MNS-(D10Mco30-D10Got91)/1Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289820 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289821 SS.MNS-(D10Mco30-D10Got91)/3Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289821 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289822 SS.MNS-(D10Mco30-D10Got112)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 79857935 1 - by flanking markers 10 73693979 78816367 1 - by flanking markers 10 76420583 78970405 1 - by flanking markers 10 73887148 76246212 1 - by flanking markers RRID:RGD_2289822 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289823 SS.MNS-(D10Mco62-D10Mco30)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 77547622 1 - by flanking markers 10 70763267 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289823 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289824 SS.MNS-(D10Mco30-D10Got101)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78262332 1 - by flanking markers 10 73693979 77223025 1 - by flanking markers 10 76420583 77360263 1 - by flanking markers 10 73887148 74676620 1 - by flanking markers RRID:RGD_2289824 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289825 SS.MNS-(D10Rat24-D10Mco31)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 79229067 84284667 1 - by flanking markers 10 78194957 83220224 1 - by flanking markers 10 78343027 83411656 1 - by flanking markers 10 75631887 80537228 1 - by flanking markers RRID:RGD_2289825 This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289826 SS.MNS-(D10Mco30-D10Got91)/2Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289826 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289827 SS.MNS-(D10Mco30-D10Mco31)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 84284667 1 - by flanking markers 10 73693979 83220224 1 - by flanking markers 10 76420583 83411656 1 - by flanking markers 10 73887148 80537228 1 - by flanking markers RRID:RGD_2289827 This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289913 SS.MNS-(D10Rat13-D10Rat12)/Jr Medical College of Ohio, Toledo congenic Unknown 10 97152234 99198997 1 - by flanking markers 10 95701164 97759008 1 - by flanking markers 10 95967019 98044833 1 - by flanking markers 10 92698959 94725019 1 - by flanking markers RRID:RGD_2289913 This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289916 SS.MNS-(D10Mco15-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 98392296 101848683 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 10 93995749 93995963 1 - by flanking markers RRID:RGD_2289916 This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289917 SS.MNS-(D10Mco70-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 101355656 101848683 1 - by flanking markers 10 99976910 99977168 1 - by flanking markers 10 100287441 100287699 1 - by flanking markers 10 96836006 96836268 1 - by flanking markers RRID:RGD_2289917 This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2290056 F344-Elmod3Tn(sb-T2/Bart3)2.42Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Elmod3Tn(sb-T2/Bart3)2.42Mcwi 2290055 4 105866419 106099850 7 4 165192607 165237016 7 4 100422256 100465152 7 4 104614665 104653122 7 RRID:RRRC_00423 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene. 2290057 F344-TgTn(T2/Bart3)1Ceb PGA transgenic Cryopreserved Sperm RRID:RGD_2290057 The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. 2290064 F344-Trpc4Tn(sb-T2/Bart3)2.192Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Trpc4Tn(sb-T2/Bart3)2.192Mcwi 2290060 2 143350286 143485716 7 2 163115873 163282223 7 2 143433102 143605757 7 2 138307676 138476856 7 RRID:RRRC_00344 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. 2290065 F344-CA338503Tn(sb-T2/Bart3)2.196Mcwi PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.196Mcwi 2290059 RRID:RGD_2290065 this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD: 2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). 2290066 F344-Nell1Tn(sb-T2/Bart3)2.195Mcwi PGA mutant Unknown Nell1Tn(sb-T2/Bart3)2.195Mcwi 2290061 1 99805922 100758002 7 1 106397933 107260905 7 1 105348577 106218970 7 1 99709305 100573872 7 RRID:RGD_2290066 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the second intron of the Nell1. 2290067 F344-BI285226Tn(sb-T2/Bart3)2.193Mcwi PGA mutant Unknown BI285226Tn(sb-T2/Bart3)2.193Mcwi 2290062 RRID:RGD_2290067 this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). 2290078 F344-Myo9aTn(sb-T2/Bart3)2.186Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Myo9aTn(sb-T2/Bart3)2.186Mcwi 2290068 8 63578001 63783813 7 8 64335907 64534890 7 8 64573248 64777607 7 8 60149234 60352330 7 RRID:RRRC_00385 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene. 2290079 F344-BI285226Tn(sb-T2/Bart3)2.194Mcwi PGA mutant Unknown BI285226Tn(sb-T2/Bart3)2.194Mcwi 2290069 RRID:RGD_2290079 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290080 F344-BI284938Tn(sb-T2/Bart3)2.187Mcwi PGA mutant Unknown BI284938Tn(sb-T2/Bart3)2.187Mcwi 2290074 RRID:RGD_2290080 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290081 F344-BI284934Tn(sb-T2/Bart3)2.185Mcwi PGA Rat Resource & Research Center mutant Cryopreserved Sperm BI284934Tn(sb-T2/Bart3)2.185Mcwi 2290072 RRID:RRRC_00367 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290082 F344-Brinp3Tn(sb-T2/Bart3)2.189Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Brinp3Tn(sb-T2/Bart3)2.189Mcwi 2290071 13 60584348 61024196 7 13 68507826 68938032 7 13 63526486 63959390 7 13 58413883 58846828 7 RRID:RRRC_00425 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. 2290083 F344-Slc24a3Tn(sb-T2/Bart3)2.188Mcwi PGA mutant Unknown Slc24a3Tn(sb-T2/Bart3)2.188Mcwi 2290073 3 133734890 134249326 7 3 145760074 146259491 7 3 139333942 139835728 7 3 132552119 133051192 7 RRID:RGD_2290083 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene. 2290100 F344-Entpd6Tn(sb-T2/Bart3)2.174Mcwi PGA mutant Unknown Entpd6Tn(sb-T2/Bart3)2.174Mcwi 2290086 3 141385480 141407860 7 3 152905464 152927857 7 3 146546424 146568828 7 3 139575659 139598163 7 RRID:RGD_2290100 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene. 2290101 F344-CB706876Tn(sb-T2/Bart3)2.181Mcwi PGA mutant Unknown CB706876Tn(sb-T2/Bart3)2.181Mcwi 2290092 RRID:RGD_2290101 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290102 F344-Klhl13Tn(sb-T2/Bart3)2.176Mcwi PGA mutant Unknown Klhl13Tn(sb-T2/Bart3)2.176Mcwi 2290085 X 10344050 10424665 7 X 121716856 121876640 7 X 121578965 121735014 7 X 113942309 114107299 7 RRID:RGD_2290102 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene. 2290103 F344-Nrg1Tn(sb-T2/Bart3)2.183Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrg1Tn(sb-T2/Bart3)2.183Mcwi 2290090 16 63937796 64126183 7 16 62632432 63718738 7 16 62969573 64065063 7 16 59250658 60304519 7 RRID:RRRC_00343 this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb and F344-Tg(PGK2-sb11)Ceb. This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene. 2290104 F344-Cadm2Tn(sb-T2/Bart3)2.180Mcwi PGA mutant Unknown Cadm2Tn(sb-T2/Bart3)2.180Mcwi 2290088 11 4273771 5330393 7 11 7871257 8090100 7 11 4175078 4397335 7 11 4548367 5525420 7 RRID:RGD_2290104 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. 2290105 F344-Sptbn4Tn(sb-T2/Bart3)2.179Mcwi PGA mutant Unknown Sptbn4Tn(sb-T2/Bart3)2.179Mcwi 2290097 1 82436626 82523827 7 1 85379609 85467354 7 1 84168494 84254679 7 1 82650750 82738345 7 RRID:RGD_2290105 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. 2290106 F344-BQ195794Tn(sb-T2/Bart3)2.182Mcwi PGA mutant Unknown BQ195794Tn(sb-T2/Bart3)2.182Mcwi 2290070 RRID:RGD_2290106 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290107 F344-CyssTn(sb-T2/Bart3)2.173Mcwi PGA mutant Unknown CyssTn(sb-T2/Bart3)2.173Mcwi 2290095 3 138826625 138830963 7 3 150801395 150805733 7 3 144427430 144431768 7 3 137432049 137436654 7 RRID:RGD_2290107 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene. 2290108 F344-LOC290071Tn(sb-T2/Bart3)2.170Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LOC290071Tn(sb-T2/Bart3)2.170Mcwi 2290089 15 30634899 32273880 7 RRID:RRRC_00338 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene. 2290109 F344-CA338503Tn(sb-T2/Bart3)2.168Mcwi PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.168Mcwi 2290087 RRID:RGD_2290109 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290110 F344-Lims1Tn(sb-T2/Bart3)2.169Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lims1Tn(sb-T2/Bart3)2.169Mcwi 2290096 20 37349188 37397427 7 20 29715580 29824252 7 20 27895981 28004767 7 20 26309833 26418511 7 RRID:RRRC_00362 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. 2290111 F344-Cst3Tn(sb-T2/Bart3)2.172Mcwi PGA mutant Unknown Cst3Tn(sb-T2/Bart3)2.172Mcwi 2290093 3 137650903 137654776 7 3 149628692 149632565 7 3 143219671 143223544 7 3 136336923 136340796 7 RRID:RGD_2290111 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene. 2290112 F344-CA338503Tn(sb-T2/Bart3)2.175Mcwi PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.175Mcwi 2290094 RRID:RGD_2290112 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290113 F344-Fam19a2Tn(sb-T2/Bart3)2.184Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam19a2Tn(sb-T2/Bart3)2.184Mcwi 2290098 7 63388665 63566226 7 7 66221368 66695803 7 7 66017066 66496690 7 7 58942598 59418640 7 RRID:RRRC_00387 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. 2290114 F344-Slc24a3Tn(sb-T2/Bart3)2.178Mcwi PGA mutant Unknown Slc24a3Tn(sb-T2/Bart3)2.178Mcwi 2290091 3 133734890 134249326 7 3 145760074 146259491 7 3 139333942 139835728 7 3 132552119 133051192 7 RRID:RGD_2290114 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene. 2290135 F344-Chsy1Tn(sb-T2/Bart3)2.165Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Chsy1Tn(sb-T2/Bart3)2.165Mcwi 2290123 1 120539002 120600102 7 1 128095353 128156041 7 1 127010587 127071570 7 1 119689626 119750711 7 RRID:RRRC_00337 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1. 2290136 F344-Slc24a4Tn(sb-T2/Bart3)2.145Mcwi PGA mutant Unknown Slc24a4Tn(sb-T2/Bart3)2.145Mcwi 2290127 6 126403837 126538501 7 6 135226112 135364945 7 6 126015799 126158727 7 6 121279590 121419811 7 RRID:RGD_2290136 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene. 2290137 F344-BF522453Tn(sb-T2/Bart3)2.166Mcwi PGA Rat Resource & Research Center mutant Cryopreserved Sperm BF522453Tn(sb-T2/Bart3)2.166Mcwi 2290126 RRID:RRRC_00361 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290138 F344-Glis1Tn(sb-T2/Bart3)2.149Mcwi PGA mutant Extinct (as of 2016-12-12) Glis1Tn(sb-T2/Bart3)2.149Mcwi 2290128 5 128736183 128739369 7 5 130891667 131081696 7 5 127043344 127233395 7 5 122222155 122412141 7 RRID:RRRC_00332 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. 2290139 F344-AW527406Tn(sb-T2/Bart3)2.156Mcwi PGA mutant Unknown AW527406Tn(sb-T2/Bart3)2.156Mcwi 2290122 RRID:RGD_2290139 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290140 F344-BI285110Tn(sb-T2/Bart3)2.167Mcwi PGA mutant Unknown BI285110Tn(sb-T2/Bart3)2.167Mcwi 2290115 RRID:RGD_2290140 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290141 F344-AbatTn(sb-T2/Bart3)2.163Mcwi PGA, Transposagen. Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2016-11-11) AbatTn(sb-T2/Bart3)2.163Mcwi 2290121 10 7040725 7137154 7 10 5894187 6002068 7 10 7093406 7200439 7 10 6996688 7092835 7 RRID:RRRC_00381 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene. 2290142 F344-LOC681893Tn(sb-T2/Bart3)2.161Mcwi PGA mutant Unknown LOC681893Tn(sb-T2/Bart3)2.161Mcwi 2290118 RRID:RGD_2290142 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. 2290143 F344-NapbTn(sb-T2/Bart3)2.162Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) NapbTn(sb-T2/Bart3)2.162Mcwi 2290116 3 137447072 137490500 7 3 149431212 149473190 7 3 143017571 143063904 7 3 136132248 136179280 7 RRID:RRRC_00335 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. 2290144 F344-Adgrl3Tn(sb-T2/Bart3)2.151Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adgrl3Tn(sb-T2/Bart3)2.151Mcwi 2290129 14 28385112 28854677 7 14 28183727 29040121 7 14 28362176 29226085 7 14 26336320 27104060 7 RRID:RRRC_00334 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 gene. 2290145 F344-BI284938Tn(sb-T2/Bart3)2.155Mcwi PGA mutant Unknown BI284938Tn(sb-T2/Bart3)2.155Mcwi 2290120 RRID:RGD_2290145 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290146 F344-Plce1Tn(sb-T2/Bart3)2.146Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plce1Tn(sb-T2/Bart3)2.146Mcwi 2290125 1 242794858 243103437 7 1 264652842 264956664 7 1 257156023 257465440 7 1 236243445 236552571 7 RRID:RRRC_00380 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene. 2290147 F344-Sptlc3Tn(sb-T2/Bart3)2.147Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Sptlc3Tn(sb-T2/Bart3)2.147Mcwi 2290124 3 127691668 127825206 7 3 139023075 139151792 7 3 132560437 132689313 7 3 126847878 126978010 7 RRID:RRRC_00331 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene. 2290148 F344-Map2k5Tn(sb-T2/Bart3)2.150Mcwi PGA mutant Extinct (as of 2016-12-21) Map2k5Tn(sb-T2/Bart3)2.150Mcwi 2290117 8 67313472 67542723 7 8 67784868 68010809 7 8 68055976 68282656 7 8 63625220 63852090 7 RRID:RRRC_00333 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. 2290159 F344-Spetex-2HTn(sb-T2/Bart3)2.136Mcwi PGA mutant Unknown Spetex-2HTn(sb-T2/Bart3)2.136Mcwi 2290150 15 5180002 5186910 7 RRID:RGD_2290159 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Spetex-2H gene. 2290160 F344-Rph3aTn(sb-T2/Bart3)2.104Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rph3aTn(sb-T2/Bart3)2.104Mcwi 2290154 12 36678613 36753316 7 12 42938832 43014142 7 12 41073296 41149799 7 12 35542389 35618901 7 RRID:RRRC_00326 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene. 2290161 F344-Tmco1Tn(sb-T2/Bart3)2.135Mcwi PGA mutant Extinct (as of 2017-01-30) Tmco1Tn(sb-T2/Bart3)2.135Mcwi 2290156 13 82971926 82995262 7 13 90108152 90202246 7 13 85465015 85559113 7 13 79460229 79483557 7 RRID:RRRC_00328 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene. 2290162 F344-Inpp4bTn(sb-T2/Bart3)2.143Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Inpp4bTn(sb-T2/Bart3)2.143Mcwi 2290149 19 27722430 28363639 7 19 40508684 41132035 7 19 29592889 30341528 7 19 25920189 26670085 7 RRID:RRRC_00379 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. 2290163 F344-TgTn(T2/Bart3)2Ceb transposon sleeping beauty PGA transgenic Extinct (as of 2016-11-14) RRID:RGD_2290163 The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. 2290164 F344-Syne1Tn(sb-T2/Bart3)2.68Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Syne1Tn(sb-T2/Bart3)2.68Mcwi 2290153 1 35803552 36269628 7 1 42947742 43158478 7 1 41608287 42086662 7 1 41512146 41983382 7 RRID:RRRC_00325 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. 2290165 F344-NtmTn(sb-T2/Bart3)2.130Mcwi PGA mutant Extinct (as of 2017-01-24) NtmTn(sb-T2/Bart3)2.130Mcwi 2290157 8 28587019 29019888 7 8 30073163 31070882 7 8 30039332 31041755 7 8 27376582 28366604 7 RRID:RRRC_00327 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene. 2290166 F344-Plcb3Tn(sb-T2/Bart3)2.69Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plcb3Tn(sb-T2/Bart3)2.69Mcwi 2290155 1 209628425 209643694 7 1 229198739 229215831 7 1 222207887 222224993 7 1 204143257 204160384 7 RRID:RRRC_00424 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene. 2290167 F344-Dlg1Tn(sb-T2/Bart3)2.133Mcwi PGA mutant Unknown Dlg1Tn(sb-T2/Bart3)2.133Mcwi 2290152 11 70735283 70930374 7 11 75239783 75454358 7 11 72164566 72378895 7 11 68911883 69103230 7 RRID:RGD_2290167 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. 2290168 F344-Pde5aTn(sb-T2/Bart3)2.144Mcwi PGA mutant Extinct (as of 2017-01-24) Pde5aTn(sb-T2/Bart3)2.144Mcwi 2290151 2 219410394 219550910 7 2 246260843 246406296 7 2 226899604 227044916 7 2 210858515 211003480 7 RRID:RRRC_00330 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). The trap construct targeted to the 4th intron of the Pde5a gene. 2290169 F344-Tg(PGK2-sb11)Ceb Sleeping beauty transposase transgenic PGA transgenic Extinct (as of 2016-11-14) RRID:RGD_2290169 sb11 cDNA linked to human PGK2 promoter was used. 2290170 F344-Cd226Tn(sb-T2/Bart3)2.141Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cd226Tn(sb-T2/Bart3)2.141Mcwi 2290158 18 86064574 86157909 7 18 85337942 85433295 7 18 86299392 86394772 7 18 82449924 82545107 7 RRID:RRRC_00329 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene. 2290171 F344-LOC681893Tn(sb-T2/Bart3)2.159Mcwi PGA mutant Unknown LOC681893Tn(sb-T2/Bart3)2.159Mcwi 2290119 RRID:RGD_2290171 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. 2290186 SD-Tg(SOD1*G93A)39 Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 RRID:RGD_2290186 SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation 2290187 SD-Tg(SOD1*H46R)4 Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 RRID:RGD_2290187 SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutation 2290272 SS/JrNgs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2290272 strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan 2290273 SHRSP.WKY-(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension RRID:RGD_2290273 The desired fragment is transferred from WKY to SHRSP 2290274 SHRSP.WKY-(D15Rat2-D15Rat94)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 11832728 76115762 1 - by flanking markers 15 15643978 80627247 1 - by flanking markers 15 11605245 77072316 1 - by flanking markers 15 10355054 69625966 1 - by flanking markers RRID:RGD_2290274 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290275 SHRSP.WKY-(D3Tkyo7-D3Rat1)/Tkyo National Bio Resource Project Japan National Bio Resource Project Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 170016252 170016653 1 - by flanking markers 3 180127863 180128021 1 - by flanking markers 3 176417943 176418101 1 - by flanking markers 3 168026691 168026850 1 - by flanking markers RRID:RGD_2290275 The desired fragment is transferred from WKY to SHRSP 2290276 SHRSP.WKY-(D3Mgh16-D3Mgh15)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 118757096 1 - by flanking markers 3 11361699 130099054 1 - by flanking markers 3 6000748 123599709 1 - by flanking markers 3 10778704 118275626 1 - by flanking markers RRID:RGD_2290276 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290277 SHRSP.WKY-(D3Rat227-D3Rat166)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 101359980 1 - by flanking markers 3 50522686 113470358 1 - by flanking markers 3 45406058 106900596 1 - by flanking markers 3 43827364 102200699 1 - by flanking markers RRID:RGD_2290277 The desired fragment is transferred from WKY to SHRSP 2290278 SR/JrNgs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2290278 strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan 2290279 SHRSP.WKY-(D15Rat68-D15Rat106)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 106177917 1 - by flanking markers 15 67139660 109944957 1 - by flanking markers 15 63498932 106550657 1 - by flanking markers 15 56484420 98288169 1 - by flanking markers RRID:RGD_2290279 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290280 SHRSP.WKY-(D3Mgh16-D3Rat110)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 3 10778704 10778823 1 - by flanking markers RRID:RGD_2290280 The desired fragment is transferred from WKY to SHRSP 2290281 SHRSP.WKY-(D3Rat227-D3Rat1)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 170016653 1 - by flanking markers 3 50522686 180128021 1 - by flanking markers 3 45406058 176418101 1 - by flanking markers 3 43827364 168026850 1 - by flanking markers RRID:RGD_2290281 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290282 SHRSP.WKY-(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension RRID:RGD_2290282 The desired fragment is transferred from WKY to SHRSP 2290298 SHR-Tg(Thy1-MAPT)318 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 RRID:RGD_2290298 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 2290299 SHR-Tg(Thy1-MAPT)72 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 RRID:RGD_2290299 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 2290311 SD-Tg(SOD1*G93A)26Dwc Ludwig Institute of Cancer Research, University of California at San Diego, La Jolla, California transgenic Unknown SOD1 730855 RRID:RGD_2290311 SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation 2290386 SD-Tg(Wlds)23Cole University of Cologne, Cologne, Germany transgenic Unknown RRID:RGD_2290386 SD rats were microinjected with a mouse Wlds with a Ube4b-derived domain with A46R and M60T amino acid changes 2290387 SD-Tg(UbC-APPswe)6590 Karolinska Institutet, Stockholm, Sweden transgenic Unknown APP 736021 RRID:RGD_2290387 SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutation 2290391 SD-Tg(Wlds)79Cole University of Cologne, Cologne, Germany transgenic Unknown RRID:RGD_2290391 SD rats were microinjected with a mouse Wlds with a Ube4b-derived domain with A46R and M60T amino acid changes 2290429 SS-Tg(ApoC3-CETP)53Opaz Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00310 SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter 2291840 F344-Dzank1Tn(sb-T2/Bart3)2.164Mcwi PGA mutant Extinct (as of 2016-10-17) Dzank1Tn(sb-T2/Bart3)2.164Mcwi 2291839 3 133021912 133073987 7 3 145054445 145114445 7 3 138624517 138684530 7 3 131855890 131908217 7 RRID:RGD_2291840 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene. 2292168 ISIAH Inherited stress-induced arterial hypertension Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_2292168 Selected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stress 2292384 SS.LEW-(D10Chm167-D10Chm257)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70589279 71366998 1 - by flanking markers 10 69375493 71016171 1 - by flanking markers 10 69742043 70500971 1 - by flanking markers 10 67335465 68083956 1 - by flanking markers RRID:RGD_2292384 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. 2292385 SS.LEW-(D10Mco30-D10Got107)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 78712717 1 - by flanking markers 10 73693979 77664589 1 - by flanking markers 10 76420583 77803328 1 - by flanking markers 10 73887148 75121215 1 - by flanking markers RRID:RGD_2292385 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. 2292386 SS.LEW-(D10Chm155-D10Rat127)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 87272312 100040883 1 - by flanking markers 10 86214887 98591695 1 - by flanking markers 10 86418952 98888676 1 - by flanking markers 10 83463114 95552352 1 - by flanking markers RRID:RGD_2292386 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. 2292387 SS.LEW-(D10Chm224-D10Chm259)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 75291923 1 - by flanking markers 10 75776633 76309841 1 - by flanking markers 10 74325927 74326153 1 - by flanking markers 10 71831756 71831983 1 - by flanking markers RRID:RGD_2292387 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. 2292388 SS.LEW-(D10Chm246-D10Chm257)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 71262405 71366998 1 - by flanking markers 10 70027256 71016171 1 - by flanking markers 10 70396378 70500971 1 - by flanking markers 10 67979320 68083956 1 - by flanking markers RRID:RGD_2292388 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. 2292389 SS.LEW-(D10Chm10-D10Chm14)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 96778676 99233951 1 - by flanking markers 10 95351725 97793613 1 - by flanking markers 10 95617075 98079438 1 - by flanking markers 10 92348201 94759977 1 - by flanking markers RRID:RGD_2292389 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat13-D10Rat11)/Ayd. 2292390 SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 75706467 76081753 1 - by flanking markers 10 75018615 75388855 1 - by flanking markers 10 74712046 75083773 1 - by flanking markers 10 72219294 72590339 1 - by flanking markers RRID:RGD_2292390 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. 2292451 F344-Stxbp5lTn(sb-T2/Bart3)2.202Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Stxbp5lTn(sb-T2/Bart3)2.202Mcwi 2292450 11 65129572 65455115 7 11 69337663 69661463 7 11 66246624 66566331 7 11 63334667 63654270 7 RRID:RRRC_00386 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene. 2292452 F344-Syndig1Tn(sb-T2/Bart3)2.171Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Syndig1Tn(sb-T2/Bart3)2.171Mcwi 2292449 3 139434170 139834916 7 3 151405855 151571801 7 3 145031427 145199273 7 3 138030995 138234646 7 RRID:RRRC_00342 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. 2292453 F344-BE329202Tn(sb-T2/Bart3)2.198Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm BE329202Tn(sb-T2/Bart3)2.198Mcwi 2292448 RRID:RRRC_00345 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2292454 F344-RGD1564304Tn(sb-T2/Bart3)2.201Mcwi PhysGen mutant Extinct (as of 2017-01-26) RGD1564304Tn(sb-T2/Bart3)2.201Mcwi 2292447 RRID:RGD_2292454 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene. 2292459 WF.LEW-RVFV Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-11-15) RRID:RRRC_00208 This rat strain was developed by classical breeding technique inserting the gene for resistance to lethal RVFV infection from the LEW rat strain into the genetic background of the WF rat strain. 2292526 SS-Tg(Atp1a1)48Opaz Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24) RRID:RRRC_00281 SS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase 2292527 SS-Tg(RA1V9)64Opaz Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00308 Dahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal. 2292528 F344-Tg(APPswe)Opaz Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00283 F344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter 2292529 LEW-Tg((ROSA)26Sor-luc)11Jmsk Rat Resource and Research Center, National BioResource Project for the Rat in Japan Rat Resource and Research Center, National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-08) Development RRID:RRRC_00299 LEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site 2292530 SD-Tg(Pou5f1-Dsred) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00320 This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells. 2292531 SD-Tg(Pou5f1-EGFP) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-04-23) RRID:RRRC_00319 This transgenic strain carries a random insertion of a construct containing mouse promoter Pou5f1 to drive the expression of EGFP. 2292532 F344-Tg(betaCTF-l45F) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00277 F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein 2292564 ACI.COP-(D6Rat80-D6Rat146)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 6 16302145 16302283 1 - by flanking markers 6 26052697 26052834 1 - by flanking markers 6 16100120 16100257 1 - by flanking markers 6 2299357 2299495 1 - by flanking markers RRID:RGD_2292564 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292565 ACI.COP-(D3Mgh16-D3Rat119)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 6373335 52643538 1 - by flanking markers 3 11361699 63334520 1 - by flanking markers 3 6000748 56715367 1 - by flanking markers 3 10778704 55223816 1 - by flanking markers RRID:RGD_2292565 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292566 ACI.COP-(D3Rat130-D3Rat114)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 44551252 149496698 1 - by flanking markers 3 55227530 160347840 1 - by flanking markers 3 48561928 155263151 1 - by flanking markers 3 47233211 147415807 1 - by flanking markers RRID:RGD_2292566 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292567 ACI.COP-(D10Mgh20-D10Rat4)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 10 53781126 107033716 1 - by flanking markers 10 53376677 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 10 102134116 102134272 1 - by flanking markers RRID:RGD_2292567 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292647 SS.LEW-(D1Mco36-D1Rat106)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 139471673 1 - by flanking markers 1 130267716 146282094 1 - by flanking markers 1 129208943 145354344 1 - by flanking markers 1 121833674 137184926 1 - by flanking markers RRID:RGD_2292647 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292648 SS.LEW-(D1Mco36-D1Mco77)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 122992360 1 - by flanking markers 1 130267716 130268180 1 - by flanking markers 1 129208943 129209407 1 - by flanking markers 1 121833674 121834139 1 - by flanking markers RRID:RGD_2292648 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292649 SS.LEW-(D1Mco36-D1Rat131)/1Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 1 121833674 142990467 1 - by flanking markers RRID:RGD_2292649 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292650 SS.LEW-(D1Mco36-D1Rat131)/2Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 1 121833674 142990467 1 - by flanking markers RRID:RGD_2292650 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292651 SS.LEW-(D1Mco99-D1Rat49)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_2292651 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292652 SS.LEW-(D1Mco85-D1Rat49)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_2292652 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292653 SS.LEW-(D1Mco36-D1Mco101)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 97174943 122992360 1 - by flanking markers 1 103735751 130268180 1 - by flanking markers 1 102658741 129209407 1 - by flanking markers 1 97146283 121834139 1 - by flanking markers RRID:RGD_2292653 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2293012 ACI.BBDP-(RT1u)(Gimap5)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada. Rat Resource and Research Center congenic Unknown RRID:RRRC_00788 2 BBDP regions [Iddm1(RT1u) and Iddm2(Gimap5)] were introgressed into the ACI/SegHsd background 2293120 LOU.BN-(D10Mgh1-D10Mgh14)/Ins Cardiovascular Physiopathology, INSERM, Montpellier, France congenic Unknown Ace 2493 10 65379850 65379965 1 - by flanking markers 10 65109232 65109346 1 - by flanking markers 10 66539729 66539843 1 - by flanking markers 10 64155469 64155584 1 - by flanking markers RRID:RGD_2293120 segment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOU 2293143 SS.BN-(D13Rat20-D13Rat127)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13 38329089 55373537 1 - by flanking markers 13 23200281 47267192 1 - by flanking markers 13 17996178 42155682 1 - by flanking markers 13 37262092 53383120 1 - by flanking markers RRID:RGD_2293143 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293144 SS.BN-(D13Rat91-D13Rat179)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46911975 60669696 1 - by flanking markers 13 55853015 68592209 1 - by flanking markers 13 50799478 63611529 1 - by flanking markers 13 45417753 58498119 1 - by flanking markers RRID:RGD_2293144 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293145 SS.BN-(D13Hmgc64-RN34_13048990782)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13;13;13 49428397;48990782;45215472 49428577;48990782;45215667 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13 58314588;54170894 58314767;54171089 1 - by flanking markers;1 - by flanking markers 13;13 49102205;53264698 49102400;53264877 1 - by flanking markers;1 - by flanking markers 13;13 43763752;47841075 43763948;47841255 1 - by flanking markers;1 - by flanking markers RRID:RGD_2293145 SS/JrHsdMcwi were crossed with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293146 SS.BN-(D13Rat20-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 38329089;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 47267053;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 42155543;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 13;5 37262092;93541170 37262232;93542503 1 - by flanking markers;1 - by flanking markers RRID:RGD_2293146 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293354 LEW.WKY-(D16Rat88-D16Rat40)/Tja Imperial College, London, UK Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 16 832236 56733837 1 - by flanking markers RRID:RRRC_00708 segment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsd 2293355 WKY.LEW-(D16Rat88-D16Rat40)/Tja Imperial College, London, UK congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 16 832236 56733837 1 - by flanking markers RRID:RRRC_00706 22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrl 2293729 SHR-Gja8m1-/-Cub Department of Biology, Charles University in Prague, Prague, Czech Republic mutant Unknown Gja8m1Cub 12791992 2 218536831 218538447 7 2 199052374 199052374 8 2 184492360 184492360 8 RRID:RGD_2293729 This strain is a coisogenic mutant derived from SHR/OlaIpcv where a mutation is observed in the NH2-terminal cytosolic domain of Cx50, L7Q 2293761 LH-Chr 17BN/Mav Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2293761 Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped 2293770 SHHF/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown RRID:RGD_2293770 Initial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breeding 2293832 LOU.BN-(D6Rat128-D6Rat115)/Ins INSERM, Paris, France congenic Unknown 6 76613351 116550459 1 - by flanking markers 6 86645162 125802733 1 - by flanking markers 6 77111071 116576287 1 - by flanking markers 6 73691999 111838254 1 - by flanking markers RRID:RGD_2293832 segment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercross 2298494 Kini:DA,PVG-G10 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown RRID:RGD_2298494 Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F1 generation, 7 couples of F1 with DA/Han and PVG.1AV1 females founders generated F2. F3 generation originated from breeding 50 random couples 2298498 W/Gaox Department of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China inbred Unknown RRID:RGD_2298498 Generated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine University 2298772 WFfzHsd Fuzzy rat Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-14) RRID:RRRC_00340 Sparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987) 2299122 F344-Tasp1Tn(sb-T2/Bart3)2.219Mcwi PhysGen mutant Extinct (as of 2017-01-26) Tasp1Tn(sb-T2/Bart3)2.219Mcwi 2299101 3 128002479 128228127 7 3 139347611 139588372 7 3 132888785 133131213 7 3 127176416 127408039 7 RRID:RGD_2299122 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene. 2299123 F344-AW921689Tn(sb-T2/Bart3)2.209Mcwi PhysGen mutant Unknown AW921689Tn(sb-T2/Bart3)2.209Mcwi 2299108 RRID:RGD_2299123 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2299124 F344-Ubqln4Tn(sb-T2/Bart3)2.230Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ubqln4Tn(sb-T2/Bart3)2.230Mcwi 2299109 2 180669525 180684724 7 2 207318101 207333435 7 2 187915701 187931035 7 2 174012726 174028062 7 RRID:RRRC_00350 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene. 2299125 F344-Ccdc85aTn(sb-T2/Bart3)2.248Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccdc85aTn(sb-T2/Bart3)2.248Mcwi 2299113 14 109197317 109434306 7 14 112609601 112636341 7 14 112719482 112900724 7 14 102126574 102359207 7 RRID:RRRC_00356 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. 2299126 F344-Kcnip4Tn(sb-T2/Bart3)2.225Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnip4Tn(sb-T2/Bart3)2.225Mcwi 2299100 14 66284290 67452628 7 14 65635533 66780362 7 14 65549362 66749181 7 14 61380699 62531399 7 RRID:RRRC_00348 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene. 2299127 F344-Eva1aTn(sb-T2/Bart3)2.233Mcwi PhysGen mutant Extinct (as of 2017-01-26) Eva1aTn(sb-T2/Bart3)2.233Mcwi 2299094 4 116280880 116330122 7 4 177461600 177511382 7 4 112714023 112823659 7 4 114593773 114643011 7 RRID:RGD_2299127 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. 2299128 F344-Lama2Tn(sb-T2/Bart3)2.2013Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Lama2Tn(sb-T2/Bart3)2.2013Mcwi 2299103 1 18203466 18885462 7 1 20002787 20647256 7 1 18491264 19143486 7 1 17672675 18320641 7 RRID:RRRC_00432 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene. 2299129 F344-Lrrc4cTn(sb-T2/Bart3)2.224Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Lrrc4cTn(sb-T2/Bart3)2.224Mcwi 2299107 3 80921606 82413671 7 3 92119546 93502229 7 3 85421169 86821783 7 3 82305495 83684039 7 RRID:RGD_2299129 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene. 2299130 F344-AdaTn(sb-T2/Bart3)2.237Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-13) AdaTn(sb-T2/Bart3)2.237Mcwi 2299093 3 154636530 154660637 7 3 166306001 166330108 7 3 160115840 160139947 7 3 152398745 152422854 7 RRID:RRRC_00426 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene. 2299131 F344-Grk1Tn(sb-T2/Bart3)2.234Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Grk1Tn(sb-T2/Bart3)2.234Mcwi 2299115 16 80979323 80991796 7 16 80641991 80657693 7 16 81153489 81165442 7 16 76122501 76135792 7 RRID:RRRC_00388 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene. 2299132 F344-Cadm1Tn(sb-T2/Bart3)2.229Mcwi PhysGen mutant Extinct (as of 2017-01-26) Cadm1Tn(sb-T2/Bart3)2.229Mcwi 2299116 8 50765645 51108962 7 8 50460752 50796128 7 8 51858906 52200591 7 8 47847836 48178703 7 RRID:RGD_2299132 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. 2299133 F344-Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi 2299098 2 236522381 236638692 7 2 262787595 262899803 7 2 244258550 244370983 7 2 227500366 227645213 7 RRID:RRRC_00357 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene. 2299134 F344-Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi 2299105 1 188518590 188643804 7 1 209449940 209577459 7 1 202432366 202560628 7 1 183829794 183959319 7 RRID:RRRC_00347 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene. 2299135 F344-Mgat4cTn(sb-T2/Bart3)2.244Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mgat4cTn(sb-T2/Bart3)2.244Mcwi 2299106 7 40171454 40383441 7 7 43829446 44052611 7 7 43249369 44024278 7 7 36709564 37485810 7 RRID:RRRC_00354 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. 2299136 F344-SnphTn(sb-T2/Bart3)2.214Mcwi PhysGen mutant Extinct (as of 2017-01-26) SnphTn(sb-T2/Bart3)2.214Mcwi 2299117 3 141921547 141961697 7 3 153455882 153496985 7 3 147102394 147143576 7 3 140098540 140139342 7 RRID:RGD_2299136 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene. 2299137 F344-Erbb4Tn(sb-T2/Bart3)2.208Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Erbb4Tn(sb-T2/Bart3)2.208Mcwi 2299110 9 66843898 67967970 7 9 74804287 75310350 7 9 75021790 76178936 7 9 69523733 70596743 7 RRID:RRRC_00383 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. 2299138 F344-Nrxn2Tn(sb-T2/Bart3)2.250Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrxn2Tn(sb-T2/Bart3)2.250Mcwi 2299118 1 209211740 209318064 7 1 228789462 228899340 7 1 221792191 221908047 7 1 203726420 203842301 7 RRID:RRRC_00449 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene. 2299139 F344-Dnhd1Tn(sb-T2/Bart3)2.243Mcwi PhysGen mutant Extinct (as of 2017-01-26) Dnhd1Tn(sb-T2/Bart3)2.243Mcwi 2299114 1 163380065 163467261 7 1 177487073 177576072 7 1 170473792 170570220 7 1 159990785 160077990 7 RRID:RGD_2299139 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. 2299140 F344-DccTn(sb-T2/Bart3)2.205Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) DccTn(sb-T2/Bart3)2.205Mcwi 2298938 18 68026795 69140741 7 18 65688901 66793126 7 18 66518213 67629801 7 18 64868987 65972783 7 RRID:RRRC_00384 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. 2299141 F344-Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi 2299104 18 35865837 36318308 7 18 36647298 37076455 7 18 36985709 37421383 7 18 34653716 35080889 7 RRID:RGD_2299141 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene. 2299142 F344-Inpp4bTn(sb-T2/Bart3)2.232Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Inpp4bTn(sb-T2/Bart3)2.232Mcwi 2299095 19 27722430 28363639 7 19 40508684 41132035 7 19 29592889 30341528 7 19 25920189 26670085 7 RRID:RGD_2299142 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. 2299143 F344-Kif16bTn(sb-T2/Bart3)2.200Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kif16bTn(sb-T2/Bart3)2.200Mcwi 2299111 3 130967515 131250402 7 3 143103727 143381598 7 3 136596621 136936809 7 3 129974692 130254194 7 RRID:RRRC_00346 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene. 2299144 F344-TrdnTn(sb-T2/Bart3)2.238Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) TrdnTn(sb-T2/Bart3)2.238Mcwi 2299099 1 24514752 24925948 7 1 26865461 27248423 7 1 25403390 25787664 7 1 23955651 24410494 7 RRID:RRRC_00368 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene. 2299145 F344-Rprd1aTn(sb-T2/Bart3)2.247Mcwi PhysGen mutant Extinct (as of 2017-01-26) Rprd1aTn(sb-T2/Bart3)2.247Mcwi 2299096 18 16283291 16328357 7 18 16209135 16256883 7 18 16450160 16497913 7 18 15791418 15839338 7 RRID:RGD_2299145 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. 2299146 F344-PtpreTn(sb-T2/Bart3)236Mcwi PhysGen mutant Extinct (as of 2017-01-26) PtpreTn(sb-T2/Bart3)236Mcwi 2299097 1 195263489 195303249 7 1 214818446 214920034 7 1 207820719 207987123 7 1 190344331 190494815 7 RRID:RGD_2299146 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene. 2299147 F344-Prr5lTn(sb-T2/Bart3)2.228Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Prr5lTn(sb-T2/Bart3)2.228Mcwi 2299112 3 86868129 86948468 7 3 97950297 98119477 7 3 91290207 91461208 7 3 88001951 88173532 7 RRID:RRRC_00349 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. 2299148 F344-Immp1lTn(sb-T2/Bart3)2.246Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Immp1lTn(sb-T2/Bart3)2.246Mcwi 2299102 3 91408864 91436603 7 3 102575250 102646194 7 3 95955126 96024316 7 3 92385329 92449559 7 RRID:RRRC_00355 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene. 2300018 SHRSP.ZUC-(D5Rat4-D5Rat36)/IzmDmcr Mukogawa Women's University, Nishinomiya, Hyogo Japan National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension RRID:RGD_2300018 Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm 2300195 EHC.BN-(D14Rat43-D14Rat132)/Kyu Kyushu University, Fukuoka, Japan congenic Unknown 14 79256324 107101727 1 - by flanking markers 14 78419915 110102984 1 - by flanking markers 14 78446303 110402569 1 - by flanking markers 14 100147356 100147478 1 - by flanking markers RRID:RGD_2300195 EHC/Seac and BN/Seac were crossed to get F1 progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenics 2300215 SHR.BN-(D10Mgh3-D10Rat85)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 10 48994688 100090454 1 - by flanking markers 10 49018990 98640289 1 - by flanking markers 10 49239646 98939361 1 - by flanking markers 10 47494000 95600487 1 - by flanking markers RRID:RGD_2300215 Congenic substrain derived from SHR.BN-(D10Mgh3-Srebf1)/Ipcv 2300216 SHR-Tg(PEPCK-SREBF1)1Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 RRID:RGD_2300216 SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal 2300217 SHR.BN-(D10Mgh3-Srebf1)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Srebf1 69423 10 46461684 100090454 1 - by flanking markers 10 46326015 98640289 1 - by flanking markers 10 46570996 98939361 1 - by flanking markers 10 45007637 95600487 1 - by flanking markers RRID:RGD_2300217 53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background 2301079 F344-Lrrc7Tn(sb-T2/Bart3)2.253Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc7Tn(sb-T2/Bart3)2.253Mcwi 2301078 2 256228792 256644029 7 2 283549882 283934360 7 2 264910594 265300860 7 2 247146616 247634945 7 RRID:RRRC_00360 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7. 2301080 F344-Lrrc4cTn(sb-T2/Bart3)2.254Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc4cTn(sb-T2/Bart3)2.254Mcwi 2301076 3 80921606 82413671 7 3 92119546 93502229 7 3 85421169 86821783 7 3 82305495 83684039 7 RRID:RRRC_00359 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene. 2301081 F344-Mmel1Tn(sb-T2/Bart3)2.255Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mmel1Tn(sb-T2/Bart3)2.255Mcwi 2301077 5 171675007 171703353 7 5 175729143 175759868 7 5 172273450 172303905 7 5 165431278 165461716 7 RRID:RRRC_00358 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1. 2301246 SS.LEW-(D3Rat61-D3Wox1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 147852788 168149595 1 - by flanking markers 3 158115782 182470017 1 - by flanking markers 3 153381237 174632112 1 - by flanking markers 3 145925360 166177555 1 - by flanking markers RRID:RGD_2301246 A segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 2301247 SS.LEW-(D16Got3-D16Rat112)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 64718 3531727 1 - by flanking markers 16 773329 4149422 1 - by flanking markers 16 778415 4203372 1 - by flanking markers 16 110590 3447332 1 - by flanking markers RRID:RGD_2301247 A sub congenic strain derived from the progenitor strain SS.LEW-(D16Mit2-D16Chm23)/Ayd 2301248 SS.LEW-(D3Got33-D3Chm68)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 45100293 60708929 1 - by flanking markers 3 55769295 71451283 1 - by flanking markers 3 49115270 64892832 1 - by flanking markers 3 47769862 62962984 1 - by flanking markers RRID:RGD_2301248 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 2301249 SS.LEW-(D18Rat30-D18Chm29)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 5682011 12249935 1 - by flanking markers 18 5795276 15461904 1 - by flanking markers 18 5825946 15691464 1 - by flanking markers 18 5584537 11796356 1 - by flanking markers RRID:RGD_2301249 A segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 2301315 LE/Orl Long-Evans/Cryptorchid Centre Nationale de la Researche Scientifique, Orleans, France inbred Unknown RRID:RGD_2301315 Obtained from Centre Nationale de la Researche Scientifique, Orleans, France 2301330 KH International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, Oklahoma inbred Unknown RRID:RGD_2301330 Develped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahoma 2301367 SHRSP.WKY-(D2Mit5-D2Rat133)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 66680022 170817807 1 - by flanking markers 2 86560119 197513270 1 - by flanking markers 2 66828049 178177553 1 - by flanking markers 2 66118275 164552628 1 - by flanking markers RRID:RGD_2301367 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301368 SHRSP.WKY-(D2Wox15-D2Rat133)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 170817613 170817807 1 - by flanking markers 2 197513076 197513270 1 - by flanking markers 2 178177359 178177553 1 - by flanking markers 2 164552433 164552628 1 - by flanking markers RRID:RGD_2301368 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301369 SHRSP.WKY-(D2Rat132-D2Rat53)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 196277776 204077687 1 - by flanking markers 2 223058573 230770799 1 - by flanking markers 2 203613889 211301253 1 - by flanking markers 2 188657176 196146841 1 - by flanking markers RRID:RGD_2301369 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301370 SHRSP.WKY-(D2Wox9-D2Rat231)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 141259937 190384899 1 - by flanking markers 2 161271919 216143762 1 - by flanking markers 2 141583337 196645063 1 - by flanking markers 2 136445150 183048631 1 - by flanking markers RRID:RGD_2301370 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301371 SHRSP.WKY-(D2Mit21-D2Rat157)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Gstm1|Vcam1|S1pr1 2755|3952|61958 2 182724363 216711836 1 - by flanking markers 2 209270725 241761983 1 - by flanking markers RRID:RGD_2301371 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301381 SS.LEW-(D18Chm41-D18Rat92)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 53898282 1 - by flanking markers 18 30797572 52299753 1 - by flanking markers 18 31109532 53083766 1 - by flanking markers 18 29804982 51515008 1 - by flanking markers RRID:RGD_2301381 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301382 SS.LEW-(D18Chm91-D18Rat67)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 12677191 23780206 1 - by flanking markers 18 15053338 23867696 1 - by flanking markers 18 15274408 24147513 1 - by flanking markers 18 12205066 23012468 1 - by flanking markers RRID:RGD_2301382 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301383 SS.LEW-(D18Chm31-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 54856651 1 - by flanking markers 18 2761846 53346447 1 - by flanking markers 18 2745212 54108474 1 - by flanking markers 18 52539763 52539863 1 - by flanking markers RRID:RGD_2301383 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301384 SS.LEW-(D18Chm41-D18Rat45)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 77511190 1 - by flanking markers 18 30797572 76318715 1 - by flanking markers 18 31109532 77212332 1 - by flanking markers 18 29804982 74055742 1 - by flanking markers RRID:RGD_2301384 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301385 SS.LEW-(D18Rat29-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 13904295 54856651 1 - by flanking markers 18 13042236 53346447 1 - by flanking markers 18 13257458 54108474 1 - by flanking markers 18 13529795 52539863 1 - by flanking markers RRID:RGD_2301385 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301386 SS.LEW-(D18Rat61-D18Rat45)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 61571526 77511190 1 - by flanking markers 18 60167906 76318715 1 - by flanking markers 18 60971508 77212332 1 - by flanking markers 18 58805687 74055742 1 - by flanking markers RRID:RGD_2301386 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301387 SS.LEW-(D18Rat67-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 23779885 54856651 1 - by flanking markers 18 23867550 53346447 1 - by flanking markers 18 24147367 54108474 1 - by flanking markers 18 23012321 52539863 1 - by flanking markers RRID:RGD_2301387 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301388 SS.LEW-(D18Chm56-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 49014933 54856651 1 - by flanking markers 18 47711090 53346447 1 - by flanking markers 18 48499359 54108474 1 - by flanking markers 18 46969392 52539863 1 - by flanking markers RRID:RGD_2301388 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301700 F344-Spata13Tn(sb-T2/Bart3)2.267Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spata13Tn(sb-T2/Bart3)2.267Mcwi 2301697 15 39722469 39849214 7 15 44749770 44878760 7 15 40937652 41066645 7 15 34778479 34907645 7 RRID:RRRC_00373 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene. 2301701 F344-PtpraTn(sb-T2/Bart3)2.261Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) PtpraTn(sb-T2/Bart3)2.261Mcwi 2301698 3 118061713 118171300 7 3 129475237 129582992 7 3 122976066 123084585 7 3 117650146 117759744 7 RRID:RRRC_00370 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene. 2301702 F344-Sf4Tn(sb-T2/Bart3)2.264Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Sf4Tn(sb-T2/Bart3)2.264Mcwi 2301696 16 19835921 19866795 7 16 20950430 21047301 7 16 21100923 21131795 7 16 19352659 19383533 7 RRID:RRRC_00371 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene. 2301937 BN.GH-(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 18 59279066 79585133 1 - by flanking markers 18 57699045 79012652 1 - by flanking markers 18 58476128 79948741 1 - by flanking markers 18;6 56594589;118921813 76477940;118921891 1 - by flanking markers;1 - by flanking markers RRID:RGD_2301937 Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations 2301938 BN.GH-(D6Mit12-D6Rat15)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 3158401 105011726 1 - by flanking markers 6 2916444 113050815 1 - by flanking markers 6 104890044 104890216 1 - by flanking markers 6 100873387 100873560 1 - by flanking markers RRID:RGD_2301938 Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations 2301939 BN.GH-(D2Rat22-D2Mgh11)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2 69302718 69303085 1 - by flanking markers 2 88968735 223460027 1 - by flanking markers 2 69243686 204022555 1 - by flanking markers 2 68462860 189039377 1 - by flanking markers RRID:RGD_2301939 Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations 2301986 BN.GH-(D2Rat22-D2Mgh11)(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301986 desired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh background 2301987 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301987 desired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh background 2301988 BN.GH-(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301988 desired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh background 2301989 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301989 desired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh background 2302067 F344/DuCrlSwe Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_2302067 Substrain of Fischer rats maintained at Malmo, Sweden 2302080 Rhd:F344,GK-G21 Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden advanced_intercross_line Unknown RRID:RGD_2302080 GK/Swe and F344/Swe were bred to create F1 generation, couples of F1 with GK/Swe and F344/Swe females founders generated F2. F3 generation originated from breeding random couples which were intercrossed to get further generations 2302081 DA.E3-(D11Got79-D11Wox5)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 11 82238710 85432136 1 - by flanking markers 11 86800287 90495881 1 - by flanking markers 11 83727048 87444587 1 - by flanking markers 11 80039141 83440803 1 - by flanking markers RRID:RGD_2302081 This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers. The region corresponding with he production of RF-Igl ambda antibodies was mapped to a narrower region 'D11Got79-D11Rat50.' 2302106 SHRSP.WKY-(D1Rat44-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 1 150872626 182418476 1 - by flanking markers RRID:RGD_2302106 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302108 SHRSP.WKY-(D1Mgh5-D1Wox29)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 124614852 1 - by flanking markers 1 80946174 131822376 1 - by flanking markers 1 79689548 130779320 1 - by flanking markers 1 78430536 123350581 1 - by flanking markers RRID:RGD_2302108 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302109 SHRSP.WKY-(D1Mgh5-D1Rat44)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 153754250 1 - by flanking markers 1 80946174 167707569 1 - by flanking markers 1 79689548 161493868 1 - by flanking markers 1 78430536 150872737 1 - by flanking markers RRID:RGD_2302109 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302110 SHRSP.WKY-(Apbb1-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension Apbb1 2122 1 163282918 187092492 1 - by flanking markers 1 177393531 206277202 1 - by flanking markers 1 170387625 199254774 1 - by flanking markers 1 159896889 182418476 1 - by flanking markers RRID:RGD_2302110 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302132 SHRSP-Tg(Tagln-ACE2)6918Bdr Max-Delbruck-Center for Molecular Medicine, Berlin-Buch, Germany transgenic Unknown Tagln|ACE2 3723|1347174 RRID:RGD_2302132 Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos 2302141 F344-Tg(Cyp1a1-Ren2)10Jmul University of Edinburgh Medical School, Edinburgh, UK transgenic Unknown Cyp1a1|Ren2 2458|1622375 RRID:RGD_2302141 Generated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression. The integration site was on Y chromosome as suggested by Southern blot analysis. 2302148 SHR-Tg(EEF1A1-Cd36)10Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302148 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) 2302149 SHR-Tg(EEF1A1-Cd36)19Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302149 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) 2302150 SHR-Tg(EEF1A1-Cd36)93Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302150 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter). 2302151 SHR-Tg(EEF1A1-Cd36)106Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302151 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) 2302279 F344.SDT-(D3Wox9-D3Arb20)/Kbe Kobe University School of Medicine, Chuo-ku, Kobe, Japan congenic Unknown 3 47722501 47722628 1 - by flanking markers 3 58456360 58456486 1 - by flanking markers 3 51821710 51821836 1 - by flanking markers 3 50436913 50437042 1 - by flanking markers RRID:RGD_2302279 Female F344/NSlc were crossed with male SDT/CrljJcl, then female F1 were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markers 2302387 DA.ACI-(D2Mit12-D2Mgh29)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 174730375 227310008 1 - by flanking markers 2 74640967 201405160 1 - by flanking markers 2 181990297 235290110 1 - by flanking markers 2 168358098 218414891 1 - by flanking markers RRID:RRRC_00667 Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsi 2302649 F344-Nsun4Tn(sb-T2/Bart3)2.286Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nsun4Tn(sb-T2/Bart3)2.286Mcwi 2302645 5 136277224 136297339 7 5 138152068 138689234 7 5 134885377 134905492 7 5 129511224 129532498 7 RRID:RRRC_00435 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene. 2302650 F344-Enox1Tn(sb-T2/Bart3)2.282Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Enox1Tn(sb-T2/Bart3)2.282Mcwi 2302641 15 58555747 58762870 7 15 63013519 63564418 7 15 59331134 59884512 7 15 52517833 53079752 7 RRID:RRRC_00470 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. 2302651 F344-Klra1Tn(sb-T2/Bart3)2.279Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klra1Tn(sb-T2/Bart3)2.279Mcwi 2302638 4 168892865 168928286 7 4 227986994 228022556 7 4 165426365 165460140 7 4 164873735 164985429 7 RRID:RRRC_00431 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene. 2302652 F344-Pde4dTn(sb-T2/Bart3)2.285Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pde4dTn(sb-T2/Bart3)2.285Mcwi 2302644 2 40196097 41311012 7 2 59292847 60521358 7 2 40219999 41468551 7 2 40014933 41529190 7 RRID:RRRC_00436 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene. 2302653 F344-Mov10Tn(sb-T2/Bart3)2.281Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mov10Tn(sb-T2/Bart3)2.281Mcwi 2302647 2 200053185 200075536 7 2 226696252 226717551 7 2 207277088 207301245 7 2 192292041 192315142 7 RRID:RRRC_00377 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene. 2302654 F344-Csmd3Tn(sb-T2/Bart3)2.288Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Csmd3Tn(sb-T2/Bart3)2.288Mcwi 2302637 7 83586771 84932392 7 7 86689912 87802035 7 7 86695703 88072106 7 7 78747322 80066466 7 RRID:RRRC_00390 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene. 2302655 F344-Tmtc2Tn(sb-T2/Bart3)2.276Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tmtc2Tn(sb-T2/Bart3)2.276Mcwi 2302646 7 43667983 44133854 7 7 47197110 47603261 7 7 47179596 47586777 7 7 40392377 40806685 7 RRID:RRRC_00376 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene. 2302656 F344-Casp7Tn(sb-T2/Bart3)2.280Mcwi PhysGen mutant Extinct (as of 2017-01-26) Casp7Tn(sb-T2/Bart3)2.280Mcwi 2302642 1 262689300 262721591 7 1 284572208 284623736 7 1 277190557 277242779 7 1 255437438 255476737 7 RRID:RGD_2302656 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. 2302657 F344-Orc3Tn(sb-T2/Bart3)2.275Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Orc3Tn(sb-T2/Bart3)2.275Mcwi 2302648 5 51172243 51226644 7 5 54588113 54644440 7 5 50019159 50075533 7 5 49123758 49181552 7 RRID:RRRC_00375 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene. 2302658 F344-BbxTn(sb-T2/Bart3)2.291Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) BbxTn(sb-T2/Bart3)2.291Mcwi 2302640 11 51655446 51799132 7 11 56153038 56397255 7 11 52983286 53228557 7 11 50381249 50628934 7 RRID:RRRC_00428 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. 2302659 F344-Snx25Tn(sb-T2/Bart3)2.270Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Snx25Tn(sb-T2/Bart3)2.270Mcwi 2302636 16 49415658 49518663 7 16 49051539 49159381 7 16 49328958 49432415 7 16 46134552 46238471 7 RRID:RRRC_00374 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene. 2302660 F344-Nectin1Tn(sb-T2/Bart3)2.284Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nectin1Tn(sb-T2/Bart3)2.284Mcwi 2302639 8 46739657 46799051 7 8 46714981 46777484 7 8 48094233 48198499 7 8 44101776 44164863 7 RRID:RRRC_00378 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1. 2302661 F344-Gramd1bTn(sb-T2/Bart3)2.287Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gramd1bTn(sb-T2/Bart3)2.287Mcwi 2302635 8 43260379 43429258 7 8 61200537 61378124 7 8 44160634 44399110 7 8 40654492 40893869 7 RRID:RRRC_00389 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene. 2302662 F344-Slc7a11Tn(sb-T2/Bart3)2.266Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a11Tn(sb-T2/Bart3)2.266Mcwi 2302643 2 139241142 139317101 7 2 158930294 159004937 7 2 139453774 139528479 7 2 134382002 134517622 7 RRID:RRRC_00372 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene. 2302666 Scr:sP Sardinian alcohol-preferring rats The Scripps Research Institute, LaJolla, California outbred Unknown RRID:RGD_2302666 sP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding. 2302984 SS.BN-(D13Rat151-D13Rat197)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 64083138 80109632 1 - by flanking markers 13 71941043 87516988 1 - by flanking markers 13 66971778 66971975 1 - by flanking markers 13 61825626 61825824 1 - by flanking markers RRID:RGD_2302984 SS/JrHsdMcwi were crossed with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302985 SS.BN-(D13Rat111-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;13;13;5 32030139;42627610;45828608;97701780 32030259;42627837;45828716;97703112 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;13;5 54791498;40421740;51509286;100631702 54791605;40421859;51509512;100633034 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 5;13;13;13 96601805;49720575;46444570;35301263 96603137;49720682;46444796;35301382 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;5 41184022;30395351;93541170 41184251;30395471;93542503 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_2302985 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302986 SS.BN-(D13Rat88-D13Rat91)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 46912163 1 - by flanking markers 13 51509286 55853202 1 - by flanking markers 13 46444570 50799665 1 - by flanking markers 13 41184022 45417941 1 - by flanking markers RRID:RGD_2302986 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302987 SS.BN-(D13Rat7-D13Rat60)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 13053933 1 - by flanking markers 13 19518130 32069874 1 - by flanking markers 13 14279081 26919398 1 - by flanking markers 13 11766535 23001904 1 - by flanking markers RRID:RGD_2302987 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302989 SS.BN-(D13Rat57-D13Rat192)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 80109432 100133413 1 - by flanking markers 13 87516787 109040616 1 - by flanking markers 13 104392076 104392271 1 - by flanking markers 13 95722244 95722440 1 - by flanking markers RRID:RGD_2302989 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302994 SS.BN-(D13Rat127-D13Rat61)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 63301678 1 - by flanking markers 13 23200281 71179041 1 - by flanking markers 13 17996178 66204711 1 - by flanking markers 13 53382878 61058159 1 - by flanking markers RRID:RGD_2302994 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302995 SS.BN-(D13Rat115-D13Rat101)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 35719010 49428577 1 - by flanking markers 13 44763184 58314767 1 - by flanking markers 13 39639775 53264877 1 - by flanking markers 13 34778619 47841255 1 - by flanking markers RRID:RGD_2302995 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302996 SS.BN-(D13Rat7-D13Rat88)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 38329229 1 - by flanking markers 13 19518130 47267192 1 - by flanking markers 13 14279081 42155682 1 - by flanking markers 13 11766535 37262232 1 - by flanking markers RRID:RGD_2302996 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302997 SS.BN-(D13Rat91-D13Got45)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 63301678 1 - by flanking markers 13 53846466 71179041 1 - by flanking markers 13 48776655 66204711 1 - by flanking markers 13 43437904 61058159 1 - by flanking markers RRID:RGD_2302997 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302999 SS.BN-(D13Rat178-D13Got45)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 57566232 64083335 1 - by flanking markers 13 65516837 71941240 1 - by flanking markers 13 60528276 66971975 1 - by flanking markers 13 55481090 61825824 1 - by flanking markers RRID:RGD_2302999 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303000 SS.BN-(D13Rat123-D13Rat150)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 57566359 1 - by flanking markers 13 53846466 65516963 1 - by flanking markers 13 48776655 60528402 1 - by flanking markers 13 43437904 55481217 1 - by flanking markers RRID:RGD_2303000 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303001 SS.BN-(D13Rat111-D13Rat127)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 49428577 1 - by flanking markers 13 40421740 58314767 1 - by flanking markers 13 35301263 53264877 1 - by flanking markers 13 30395351 47841255 1 - by flanking markers RRID:RGD_2303001 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303002 SS.BN-(D13Rat123-D13Rat197)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 76779489 1 - by flanking markers 13 51509286 83929327 1 - by flanking markers 13 46444570 79034003 1 - by flanking markers 13 41184022 73485113 1 - by flanking markers RRID:RGD_2303002 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303003 SS.BN-(D13Rat7-D13Rat127)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 49428577 1 - by flanking markers 13 19518130 58314767 1 - by flanking markers 13 14279081 53264877 1 - by flanking markers 13 11766535 47841255 1 - by flanking markers RRID:RGD_2303003 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303004 SS.BN-(D13Rat115-D13Rat61)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 67752598 1 - by flanking markers 13 71178814 75143303 1 - by flanking markers 13 66204484 70172216 1 - by flanking markers 13 61057931 64901750 1 - by flanking markers RRID:RGD_2303004 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303005 SS.BN-(D13Rat127-D13Rat77)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 57922038 1 - by flanking markers 13 23200281 65861506 1 - by flanking markers 13 17996178 60876578 1 - by flanking markers 13 53382878 55829942 1 - by flanking markers RRID:RGD_2303005 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303006 SS.BN-(D13Rat101-D13Rat46)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46269934 72638941 1 - by flanking markers 13 55560677 79943775 1 - by flanking markers 13 75026588 75026713 1 - by flanking markers 13 69535761 69535887 1 - by flanking markers RRID:RGD_2303006 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303007 SS.BN-(D13Rat127-D13Rat46)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 72638941 1 - by flanking markers 13 23200281 79943775 1 - by flanking markers 13 17996178 75026713 1 - by flanking markers 13 53382878 69535887 1 - by flanking markers RRID:RGD_2303007 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303008 SS.BN-(D13Rat61-D13GRat197)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 76779489 1 - by flanking markers 13 71178814 83929327 1 - by flanking markers 13 66204484 79034003 1 - by flanking markers 13 61057931 73485113 1 - by flanking markers RRID:RGD_2303008 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303009 SS.BN-(D13Rat183-D13Rat192)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 77336098 100133413 1 - by flanking markers 13 84460970 109040616 1 - by flanking markers 13 79567081 104392271 1 - by flanking markers 13 74023918 95722440 1 - by flanking markers RRID:RGD_2303009 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303010 SS.BN-(D13Got51-D13Rat192)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 100133413 1 - by flanking markers 13 76974692 109040616 1 - by flanking markers 13 72031440 104392271 1 - by flanking markers 13 66706825 95722440 1 - by flanking markers RRID:RGD_2303010 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303011 SS.BN-(D13Got51-D13Rat57)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 80109632 1 - by flanking markers 13 76974692 87516988 1 - by flanking markers 13 72031440 72031708 1 - by flanking markers 13 66706825 66707096 1 - by flanking markers RRID:RGD_2303011 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303099 F344-Kcnh7Tn(sb-T2/Bart3)2.295Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnh7Tn(sb-T2/Bart3)2.295Mcwi 2303095 3 44657361 45153509 7 3 55325680 55822973 7 3 48662450 49168716 7 3 47329338 47822122 7 RRID:RRRC_00430 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene. 2303100 F344-Slc16a12Tn(sb-T2/Bart3)2.298Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc16a12Tn(sb-T2/Bart3)2.298Mcwi 2303097 1 238643040 238665699 7 1 260197556 260275962 7 1 252976071 253054500 7 1 232184004 232262170 7 RRID:RRRC_00438 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene. 2303101 F344-Kcnab1Tn(sb-T2/Bart3)2.300Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnab1Tn(sb-T2/Bart3)2.300Mcwi 2303094 2 154837841 155145882 7 2 174966379 175400010 7 2 155555798 156011438 7 2 149137025 149603540 7 RRID:RRRC_00471 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene. 2303102 F344-Dnah11Tn(sb-T2/Bart3)2.293Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Dnah11Tn(sb-T2/Bart3)2.293Mcwi 2303098 6 145190931 145516859 7 6 154698519 155011384 7 6 145784893 146099212 7 6 138839175 139155554 7 RRID:RRRC_00429 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. 2303103 F344-Pebp4Tn(sb-T2/Bart3)2.299Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pebp4Tn(sb-T2/Bart3)2.299Mcwi 2303096 15 50225405 50460627 7 15 55252902 55466149 7 15 51528587 51740626 7 15 44920946 45134188 7 RRID:RRRC_00455 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene. 2303116 SPRD.WKY-(D10Rat91-D10Rat135)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 10 9762188 108776963 1 - by flanking markers 10 8619955 108145987 1 - by flanking markers 10 9841807 108540162 1 - by flanking markers 10 9658275 104670812 1 - by flanking markers RRID:RGD_2303116 SPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. 2303117 SPRD.WKY-(D5Rat190-D5Rat114)(D18Rat102-D18Rat44)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown RRID:RGD_2303117 Double congenic strain generated by intercrossing SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm and SPRD.WKY-(D18Rat102-D18Rat44)/Ibmm; F1 animals were intercrossed and F2 screened for heterozygousity by markers 2303148 SS.SHR-(D9Wox16-D9Rat76)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 33497026 1 - by flanking markers 9 24681016 40929956 1 - by flanking markers 9 25819185 41261265 1 - by flanking markers 9 22198773 36962591 1 - by flanking markers RRID:RGD_2303148 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303149 SS.SHR-(D9Wox16-D9Mco73)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 47764357 1 - by flanking markers 9 24681016 55323208 1 - by flanking markers 9 25819185 55627498 1 - by flanking markers 9 22198773 50687400 1 - by flanking markers RRID:RGD_2303149 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region. 2303150 SS.SHR-(D9Mco74-D9Rat64)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 25174989 91131755 1 - by flanking markers 9 31484855 98715585 1 - by flanking markers 9 32677807 99041268 1 - by flanking markers 9 28806563 92491790 1 - by flanking markers RRID:RGD_2303150 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303151 SS.SHR-(D9Wox16-D9Mco77)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 54083264 1 - by flanking markers 9 24681016 64294638 1 - by flanking markers 9 25819185 64491201 1 - by flanking markers 9 22198773 56777289 1 - by flanking markers RRID:RGD_2303151 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303152 SS.SHR-(D9Mco72-D9Mco93)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 90249887 1 - by flanking markers 9 52352690 97845437 1 - by flanking markers 9 52686874 98164303 1 - by flanking markers 9 47902208 91616855 1 - by flanking markers RRID:RGD_2303152 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303153 SS.SHR-(D9Rat7-D9Mco93)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77170797 90249887 1 - by flanking markers 9 83451810 97845437 1 - by flanking markers 9 83686153 98164303 1 - by flanking markers 9 79271511 91616855 1 - by flanking markers RRID:RGD_2303153 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303154 SS.SHR-(D9Wox16-D9Mco85)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 76456066 1 - by flanking markers 9 24681016 82659881 1 - by flanking markers 9 25819185 82890620 1 - by flanking markers 9 22198773 78595166 1 - by flanking markers RRID:RGD_2303154 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303504 LEW/JmsNgs congenital hydrocephalus rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Dentistry RRID:RGD_2303759 In 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating. 2303761 SD-Tg(CAG-EGFP)4Osb Green rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals RRID:RGD_2303761 This transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc. 2303779 OLETF-Chr 14F344/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303779 Chromosome 14 from F344 is introgressed in OLETF background 2303784 SHR-Chr 4WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2303784 Chromosome 3 from WKY is introgressed into the genomic background of SHR 2303785 SHRSP-Chr 3WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2303785 Chromosome 3 from WKY is introgressed into the genomic background of SHRSP 2303792 WTC.ZI-Atrnzi/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrnzi 40902832 RRID:RGD_2303792 Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University 2303793 WTC.DMY-dmy/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_2303793 Congenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University 2303971 OLETF.F344-(D7Mgh16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 96492203 1 - by flanking markers 7 100584458 100584693 1 - by flanking markers 7 100004559 100004794 1 - by flanking markers 7 91256311 91256547 1 - by flanking markers RRID:RGD_2303971 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. 2303972 BN-Chr 13SS/Mcwi PhysGen consomic Unknown RRID:RGD_2303972 A cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed 2303973 OLETF.F344-(D10Wox7-D10Wox6)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 10 98952626 98952741 1 - by flanking markers RRID:RGD_2303973 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating. 2303976 F344-Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi 2303974 2 103102679 103271273 7 2 122442002 122610354 7 2 102701903 102871257 7 2 100502791 100669713 7 RRID:RRRC_00472 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. 2303977 F344-Ano3Tn(sb-T2/Bart3)2.307Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ano3Tn(sb-T2/Bart3)2.307Mcwi 2303975 3 96123925 96237157 7 3 108441370 108751911 7 3 101843516 102203368 7 3 97235671 97550090 7 RRID:RRRC_00477 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene. 2303978 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303978 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303979 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303979 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303986 WKAH.LEC-Atp7bhts/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-11) Cancer Atp7bhts 11532742 16 74607988 74680080 7 16 74495179 74575822 7 16 74865516 74944935 7 16 69952286 70024404 7 RRID:RGD_2303986 A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. 2303987 F344.OLETF-(D17Mgh4-Edn1)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity Edn1 2532 17 28303886 28309775 1 - by flanking markers 17 24117499 24124188 1 - by flanking markers 17 22136814 22143745 1 - by flanking markers 17 22454924 22460812 1 - by flanking markers RRID:RGD_2303987 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303988 F344.OLETF-(D14Rat23-D14Rat12)(D8Rat54-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303988 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303989 F344.OLETF-(D9Mgh8-D9Mit2)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2303989 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303990 F344.OLETF-(D1Mit20-D1Mgh26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 1 172711200 172711337 1 - by flanking markers RRID:RGD_2303990 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303991 F344.OLETF-(D7Rat31-D7Rat35)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 20307479 28488710 1 - by flanking markers 7 24326613 32338830 1 - by flanking markers 7 24175337 32258115 1 - by flanking markers 7 18169505 26029351 1 - by flanking markers RRID:RGD_2303991 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303992 F344.OLETF-(D5Mgh29-D5Mgh22)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 157584332 157584492 1 - by flanking markers 5 160953624 160953783 1 - by flanking markers 5 157212263 157212422 1 - by flanking markers 5 151005994 151006154 1 - by flanking markers RRID:RGD_2303992 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303993 OLETF.F344-(D9Mgh8-D9Mit2)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2303993 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. 2303994 F344.OLETF-(D5Mgh4-D5Rat21)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 99344678 99344842 1 - by flanking markers 5 102264251 102264414 1 - by flanking markers 5 98224053 98224216 1 - by flanking markers 5 95112065 95112231 1 - by flanking markers RRID:RGD_2303994 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303995 F344.OLETF-(D8Rat54-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2303995 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303996 F344.Cg-Foxn1rnu/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology; Cancer Foxn1 3970 10 64243323 64256847 1 - by flanking markers 10 66004940 66030134 1 - by flanking markers 10 65621142 65634666 1 - by flanking markers 10 63251400 63273710 1 - by flanking markers RRID:RGD_2303996 This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. 2303997 F344.OLETF-(D7Mgh8-D7Mgh16)(D14Rat23-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303997 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303998 WKAH.LEC-Ptprkthid/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Ptprk 619706 1 17328563 17752200 1 - by flanking markers 1 18602550 19574958 1 - by flanking markers 1 17445052 18058266 1 - by flanking markers 1 16738896 17236687 1 - by flanking markers RRID:RGD_2303998 A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. 2303999 F344.OLETF-(D14Rat8-D14Rat26)(D14Rat18-D14Rat22)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303999 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304000 F344.OLETF-(D12Wox5-D12Rat21)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 12 13635523 42767729 1 - by flanking markers RRID:RGD_2304000 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304001 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2304001 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304002 F344.OLETF-(D11Mgh4-D11Mgh1)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 11 59802622 82566702 1 - by flanking markers RRID:RGD_2304002 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304003 F344.OLETF-(D16Rat19-D16Rat13)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 35339929 77968799 1 - by flanking markers 16 35126908 77759249 1 - by flanking markers 16 35307110 78172206 1 - by flanking markers 16 31951520 73187298 1 - by flanking markers RRID:RGD_2304003 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304004 F344.OLETF-(D7Mit2-D7Mgh16)(D14Rat23-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2304004 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304016 BUF.ACI-(D4Rat192-D4Rat66)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 161023350 161023765 1 - by flanking markers 4 224435359 224435481 1 - by flanking markers 4 157417581 157417703 1 - by flanking markers 4 157704599 157704722 1 - by flanking markers RRID:RGD_2304016 This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. 2304017 F344.CVD-Unc5ccvd/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-05) Neurobiology Unc5c|Unc5ccvd 735109|12802355 2 239365109 239721231 7 2 265573406 265926229 7 2 247352390 247352390 8 2 230489880 230489880 8 RRID:RGD_2304017 CVD ( Cerebellar vermis defect) rat originated from spontanious mutation of LEW inbred at Osaka Prefecture University in 1992. A mutation in Unc5c has been identified in CVD rats. A congenic strain was produced by backcrossing CVD to F344/NSlc strain at Kyoto University. 2304018 BUF.ACI-(D4Rat226-D4Rat109)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 61542056 117094107 1 - by flanking markers 4 61331785 178404466 1 - by flanking markers 4 61612433 113728420 1 - by flanking markers 4 62837725 115401611 1 - by flanking markers RRID:RGD_2304018 This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. 2304019 BUF.ACI-(D15Rat68-D15Rat29)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 62521452 108387411 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 15 56484420 56484560 1 - by flanking markers RRID:RGD_2304019 This congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method. 2304020 ACI.BUF-(D15Rat97-D15Rat29)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 78048029 108387411 1 - by flanking markers 15 82573157 82573380 1 - by flanking markers 15 79033484 79033707 1 - by flanking markers 15 71477067 71477291 1 - by flanking markers RRID:RGD_2304020 This congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method. 2304037 DDI/Ddia dokkyo diabetes insipidus rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Metabolism; Urology RRID:RGD_2304037 Strain developed at Dokkyo University, School of Medicine, Tochigi, Japan 2304038 OP/Jtt Opacitas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Ophthalmology RRID:RGD_2304038 Maintained in sib mating between opacitas rats (heterozygoutes) and normal rats. 2304039 WIC-Tgrdw/Kts School of Medicine, Kitasato University National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism Tgrdw 12879860 7 104035776 104220754 7 7 107399165 107602400 7 7 107567063 107567063 8 7 98517376 98517376 8 RRID:RGD_2304039 Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. This strain has a spontaneous missense mutation, G2320R, in the thyroglobul gene. 2304040 F344.OP-Op/Jtt National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology RRID:RGD_2304040 Opacitas rats (heterozygtes) are backcorssed with F344/DuCrj. 2304041 SD-Tg(CAG-Rgn)Slc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals Osteosis Rgn 3560 RRID:RGD_2304041 Transgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and the rat Rgn gene 2304045 F344.ZUC-Leprfa(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 14 1217606 39153750 1 - by flanking markers RRID:RGD_2304045 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. 2304046 F344.ZUC-(Leprfa)(D7Rat16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 108647236 108647376 1 - by flanking markers 7 112143411 112143550 1 - by flanking markers 7 112204378 112204517 1 - by flanking markers 7 102920123 102920263 1 - by flanking markers RRID:RGD_2304046 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. 2304047 F344.ZUC-Leprfa/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity Lepr|Leprfa 3001|13432153 RRID:RGD_2304047 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating. 2304050 F344.OLETF-(D14Rat23-D14Rat55)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 27571792 1 - by flanking markers 14 2222207 27510976 1 - by flanking markers 14 2227825 27686562 1 - by flanking markers 14 1217606 25656577 1 - by flanking markers RRID:RGD_2304050 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304051 F344.OLETF-(D14Rat8-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 41707592 1 - by flanking markers 14 32389647 61886417 1 - by flanking markers 14 32593926 61783215 1 - by flanking markers 14 30320092 39153750 1 - by flanking markers RRID:RGD_2304051 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304052 F344.OLETF-(D14Rat55-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 27571487 41707592 1 - by flanking markers 14 27510756 61886417 1 - by flanking markers 14 27686342 61783215 1 - by flanking markers 14 25656356 39153750 1 - by flanking markers RRID:RGD_2304052 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304053 F344.OLETF-(D14Rat23-D14Rat5)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 11589751 1 - by flanking markers 14 2222207 11868597 1 - by flanking markers 14 2227825 11926177 1 - by flanking markers 14 1217606 10277166 1 - by flanking markers RRID:RGD_2304053 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304054 F344.OLETF-(D14Rat23-D14Rat10)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 33157602 1 - by flanking markers 14 2222207 32957654 1 - by flanking markers 14 2227825 33163485 1 - by flanking markers 14 1217606 30883947 1 - by flanking markers RRID:RGD_2304054 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304055 F344.OLETF-(D14Wox1-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 41707423 41707592 1 - by flanking markers 14 61886249 61886417 1 - by flanking markers 14 61783047 61783215 1 - by flanking markers 14 39153581 39153750 1 - by flanking markers RRID:RGD_2304055 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304056 F344.OLETF-(D14Rat23-D14Wox14)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 21885861 1 - by flanking markers 14 2222207 21925011 1 - by flanking markers 14 2227825 22009966 1 - by flanking markers 14 1217606 1217776 1 - by flanking markers RRID:RGD_2304056 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304057 F344.OLETF-(D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in JapanD14Rat143-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 19738306 41707592 1 - by flanking markers 14 19754557 61886417 1 - by flanking markers 14 19847829 61783215 1 - by flanking markers 14 18212584 39153750 1 - by flanking markers RRID:RGD_2304058 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304059 F344.OLETF-(D14Rat5-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 11589293 41707592 1 - by flanking markers 14 11868448 61886417 1 - by flanking markers 14 11926028 61783215 1 - by flanking markers 14 10277016 39153750 1 - by flanking markers RRID:RGD_2304059 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304060 F344.OLETF-(D14Wox14-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 21885743 41707592 1 - by flanking markers 14 21924894 61886417 1 - by flanking markers 14 22009849 61783215 1 - by flanking markers 14 39153581 39153750 1 - by flanking markers RRID:RGD_2304060 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304061 F344.OLETF-(D14Rat23)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 1764554 1 - by flanking markers 14 2222207 2222374 1 - by flanking markers 14 2227825 2227992 1 - by flanking markers 14 1217606 1217776 1 - by flanking markers RRID:RGD_2304061 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. 2304063 KDP-Tg(H2Kd-Cblb)2Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304063 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304064 KDP-Tg(H2Kd-Cblb)1Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304064 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304065 KDP-Tg(INS-Cblb)1Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304065 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304066 KDP-Tg(CAG-Cblb)1Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown Cblb 620535 RRID:RGD_2304066 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304074 WKY.BUF-Tsr1d/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304074 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred. 2304075 ACI.BUF-Pur1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304075 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred. 2304076 WKY.BUF-Thym1, Thym2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2018-03-14) Cancer RRID:RGD_2304076 This double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (Thym1) (on chr.1) and Ten2 (Thym2)(on chr. 13) has been transferred. 2304077 WKY.BUF-Pur1s/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304077 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. 2304078 ACI.BUF-Ten1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304078 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. 2304079 WKY.BUF-Ten1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304079 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. 2304080 ACI.BUF-Aftm1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_2304080 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred. 2304081 WKY.BUF-Pur1w/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304081 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. 2304082 WKY.BUF-Ten2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304082 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. 2304083 ACI.BUF-Ten2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304083 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. 2304093 SHRSP.WKY-(D1Rat106-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 139471535 187092492 1 - by flanking markers 1 146068162 206277202 1 - by flanking markers 1 145140412 199254774 1 - by flanking markers 1 137184788 182418476 1 - by flanking markers RRID:RGD_2304093 Developed by the depositor 2304094 SHRSP.WKY-(D1Smu12-D1Rat44)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cardio Hypertension 1 153754139 153754250 1 - by flanking markers 1 167707459 167707569 1 - by flanking markers 1 161493758 161493868 1 - by flanking markers 1 150872626 150872737 1 - by flanking markers RRID:RGD_2304094 This is a congenic strain developed by the depositor. 2304095 W-Tg(Plcb2-WGA-EGFP)F1Abek National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo RRID:RGD_2304095 This is a transgenic strain developed by the depositor. 2304096 SHRSP.WKY-(D1Rat49-D1Arb21)/1Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 1 154464069 182418476 1 - by flanking markers RRID:RGD_2304096 Developed by the depositor 2304097 SHRSP.WKY-(D1Rat49-D1Arb21)/2Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 1 154464069 182418476 1 - by flanking markers RRID:RGD_2304097 This is a congenic strain developed by the depositor. 2304098 SHRSP.WKY-(D1Smu13-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304098 Developed by the depositor 2304099 SHRSP.WKY-(D1Smu12-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304099 This is a congenic strain developed by the depositor. 2304100 SHRSP.WKY-(D1Rat39-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 125983422 187092492 1 - by flanking markers 1 133172202 206277202 1 - by flanking markers 1 132134307 199254774 1 - by flanking markers 1 124668437 182418476 1 - by flanking markers RRID:RGD_2304100 This is a congenic strain developed by the depositor. 2304101 SHRSP.WKY-(D1Rat43-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 144634295 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304101 This is a congenic strain developed by the depositor. 2304102 SHRSP.WKY-(D1Mgh5-D1Rat106)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 1 78430536 137184926 1 - by flanking markers RRID:RGD_2304102 This is a congenic strain developed by the depositor. 2304104 W-Tg(Plcb2-WGA-EGFP)M1Abek National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo RRID:RGD_2304104 This is a transgenic strain developed by the depositor. 2304120 SHRSP/2Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2304120 Kyo > Ta (1972) 2304121 DA.WF-(D1Mit1-D1Mit3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 1 146971846 146971983 1 - by flanking markers 1 162692213 162692800 1 - by flanking markers 1 156446196 156446783 1 - by flanking markers 1 144267353 144267916 1 - by flanking markers RRID:RGD_2304121 This congenic strain in the DA background by introgressing a segment from WF 2304122 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304122 This congenic strain in the DA background by introgressing a segment from WF 2304123 DA.WF-(D4Mit11-Nos3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nos3 3186 4 6158847 91330856 1 - by flanking markers 4 7333272 157291359 1 - by flanking markers 4 7321908 92484312 1 - by flanking markers 4 10793834 91360801 1 - by flanking markers RRID:RGD_2304123 This congenic strain in the DA background by introgressing a segment from WF 2304124 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)(D1Mit1-D1Mit3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304124 This congenic strain in the DA background by introgressing a segment from WF 2304125 DRH.F344-(D1Mgh8-D1Mgh12)/Shigm National BioResource Project for the Rat in Japan, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan National BioResource Project for the Rat in Japan, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1 156124624 247322277 1 - by flanking markers 1 169999389 270717037 1 - by flanking markers 1 163796316 163796432 1 - by flanking markers 1 153136852 153136969 1 - by flanking markers RRID:RGD_2304125 desired fragment from F344 was introgressed into DRH background 2304200 W-Tg(CAG-ABO*A)32Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304200 This transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. 2304201 F344-Galntl6Tn(sb-T2/Bart3)2.311McwiRrrc PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Galntl6Tn(sb-T2/Bart3)2.311Mcwi 2304194 16 34557663 35853849 7 16 34380195 35619972 7 16 34551052 35803840 7 16 31192880 32443979 7 RRID:RRRC_00450 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene. 2304202 F344-RGD1565323Tn(sb-T2/Bart3)2.312Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1565323Tn(sb-T2/Bart3)2.312Mcwi 2304193 17 38022396 38039975 7 17 34865901 34882646 7 17 32973695 32990440 7 17 31661713 31678816 7 RRID:RRRC_00437 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323. 2304203 W-Tg(CAG-DsRed2/GFP)1Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304203 DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. 2304204 W-Tg(CAG-ABO*B)13Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304204 This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. 2304205 W-Tg(Alb-DsRed2)34Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RGD_2304205 This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. 2304206 W-Tg(CAG-DsRed2/GFP)15Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00300 DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. 2304207 F344-LzicTn(sb-T2/Bart3)2.309Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LzicTn(sb-T2/Bart3)2.309Mcwi 2304196 5 166567412 166579423 7 5 170076617 170089776 7 5 166430305 166443485 7 5 159928260 159941512 7 RRID:RRRC_00434 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene. 2304208 F344-Rapgef4Tn(sb-T2/Bart3)2.314Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rapgef4Tn(sb-T2/Bart3)2.314Mcwi 2304197 3 54396312 54717148 7 3 65122705 65409814 7 3 58632338 58925127 7 3 56809388 57101332 7 RRID:RRRC_00479 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene. 2304209 F344-RorbTn(sb-T2/Bart3)2.304Mcwi PhysGen mutant Extinct (as of 2017-01-26) RorbTn(sb-T2/Bart3)2.304Mcwi 2304199 1 222545682 222726307 7 1 241354340 241541103 7 1 234252757 234442597 7 1 216363629 216544390 7 RRID:RGD_2304209 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene. 2304210 W-Tg(Alb-DsRed2)42Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00260 This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. 2304211 W-Tg(CAG-cre)81Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo (as of 2018-07-16) Development RRID:RRRC_00301 This strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School. 2304212 F344-RGD1563503Tn(sb-T2/Bart3)2.313Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1563503Tn(sb-T2/Bart3)2.313Mcwi 2304198 17 21066144 21067040 7 17 17584757 17585688 7 17 15526295 15527253 7 RRID:RRRC_00453 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503. 2304213 F344-P3h3Tn(sb-T2/Bart3)2.310Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) P3h3Tn(sb-T2/Bart3)2.310Mcwi 2304195 4 160964297 160978321 7 4 224377005 224392881 7 4 157359331 157375186 7 4 157646242 157662035 7 RRID:RRRC_00433 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene. 2304214 W-Tg(CAG-ABO*B)2Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304214 This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. 2304215 F344-Tg(XPO1)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer; Infectious RRID:RGD_2304215 F344/DuCrj Tg rat inoculated with human crm1 genome (BAC) 2304221 WTC-swh/Kyo Kyoto University National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-11) Dermatology EdaraddswhKyo 14398765 17 67056373 67143933 7 17 92462305 92503399 7 17 90802280 90843476 7 17 85866629 85910612 7 RRID:RGD_2304221 The rat showed abnormal hair texture and mammary gland hypoplasia which occurred in the WTC.ZI-Atrnzi colony at the National Cancer Center Research Institute in 1998. After elimination of zi allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. In 2011, Kuramoto et al. (RGD:14398762) identified a missense mutation in the Edaradd gene. 2304222 WIAR/Iar Inbred Wistar-Imamichi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism; Development RRID:RGD_2304222 Strain developed by the depositor. This strain was established by inbreeding of Wistar-Imamichi rats by sib-mating. Strain characteristic is same as that of Wistar-Imamichi. (Nov 6, 2009) 2304241 F344-Tg(CXCR4)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious CXCR4 732176 RRID:RGD_2304241 Transgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj. 2304242 WTC-Kcnq1dfkKyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-04-05) Otorhinology; Internal Organ Kcnq1|Kcnq1dfk 621503|12802344 1 203383401 203803687 7 1 223154713 223490458 7 1 216377021 216379067 8 1 198374486 198376539 8 RRID:RGD_2304242 Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-Atrnzi congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-Kcnq1dfk/Kyo rat is a mutant for circling behavior. although the Atrnzi allele of WTC.ZI-Atrnzi congenic rats was eliminated, the circling behavior remained. 2304277 SHRSP.WKY-(D1Rat36-D1Rat106)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 128874534 139471673 1 - by flanking markers 1 136045631 146282094 1 - by flanking markers 1 135022396 145354344 1 - by flanking markers 1 127453884 137184926 1 - by flanking markers RRID:RGD_2304277 Developed by the DEPOSITOR 2304278 DA-Tg(Alb-HSVtk)5Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304278 This strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in these transgenic rats causes hepatitis. 2304279 W-Tg(MT2A-Myc)1Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 RRID:RGD_2304279 This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). 2304280 SHR/Shi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2304280 Developed by the DEPOSITOR 2304281 SERC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm (as of 2024-09-24) Neurobiology RRID:RGD_2304281 Developed by the DEPOSITOR 2304282 IEW/Ihr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Neurobiology; Ophthalmology RRID:RGD_2304282 mutant of Ihara epileptic rat. 2304283 SHRSP.WKY-(D1Mgh5-D1Wox18)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 1 78430536 94644553 1 - by flanking markers RRID:RGD_2304283 Developed by the DEPOSITOR 2304284 SHRSP.WKY-(D1Mgh5-D1Rat116)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 218467340 1 - by flanking markers 1 80946174 239429964 1 - by flanking markers 1 79689548 232297227 1 - by flanking markers 1 78430536 212458660 1 - by flanking markers RRID:RGD_2304284 Developed by the DEPOSITOR 2304285 BDIX/NemOda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown Cancer RRID:RGD_2304285 This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992. 2304286 DMYC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Cryopreserved Sperm RRID:RGD_2304286 Developed by the DEPOSITOR 2304287 ACI.F344-(D16Rat17-D16Rat15)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304287 F344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain. 2304288 ACI.BUF-(D20Img2-D20Rat5)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 20 17617832 17617956 1 - by flanking markers RRID:RGD_2304288 Developed by the DEPOSITOR 2304289 SHRSP.WKY-(D1Mgh5-D1Rat349)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 130788777 1 - by flanking markers 1 80946174 137735636 1 - by flanking markers 1 79689548 136742994 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2304289 Developed by the DEPOSITOR 2304290 BUF.ACI-(D20Img2-D20Rat5)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 20 17617832 17617956 1 - by flanking markers RRID:RGD_2304290 Developed by the DEPOSITOR 2304291 LEW-Tg(CAG-EGFP)1Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RGD_2304291 This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. 2304292 LEW-Tg((ROSA)26Sor-luc)21Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RGD_2304292 This strain expresses luciferase ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. 2304293 F344.LEC-xhs1/1Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2304293 LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay 2304294 MPOD/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cancer; Immunology RRID:RGD_2304294 Myeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait. 2304295 SHRSP.WKY-(Igf1r-D1Rat36)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Igf1r 2869 1 122704976 128874670 1 - by flanking markers 1 129985761 136045766 1 - by flanking markers 1 128924921 135022531 1 - by flanking markers 1 121549831 127454022 1 - by flanking markers RRID:RGD_2304295 Developed by the DEPOSITOR 2304296 KB/Oda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo RRID:RGD_2304296 Maintained by crossing heterozygotes of the albino locus (segregating inbred strain). 2304297 TM.KDP-Cblb/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 11 49690402 49856762 1 - by flanking markers 11 54218260 54383403 1 - by flanking markers 11 51037383 51202761 1 - by flanking markers 11 48589878 48756940 1 - by flanking markers RRID:RGD_2304297 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304298 SD-Tg(Tuba1a-EYFP)Okn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown RRID:RGD_2304298 This strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter. 2304299 LEW-Tg(Alb-GFP)6Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304299 This strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School. 2304300 W-Tg(S100b-EGFP)Scell National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Metabolism RRID:RGD_2304300 Developed by microinjecting the transgene into Wistar rats 2304301 SHRSP.WKY-(Slco3a1-D1Rat106)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Slco3a1 620227 1 129580126 139471673 1 - by flanking markers 1 136793300 146282094 1 - by flanking markers 1 135790854 145354344 1 - by flanking markers 1 128106232 137184926 1 - by flanking markers RRID:RGD_2304301 Developed by the DEPOSITOR 2304302 SHRSP.WKY-(D1Rat44-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 1 150872626 182418476 1 - by flanking markers RRID:RGD_2304302 Developed by the DEPOSITOR 2304303 W-Tg(MT2A-Myc)2Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 RRID:RGD_2304303 This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). 2304304 SHRSP.WKY-(D1Rat209-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 142486986 199254774 1 - by flanking markers 1 134641522 182418476 1 - by flanking markers RRID:RGD_2304304 Developed by the DEPOSITOR 2304305 DOB/Oda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_2304305 This strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000. 2304306 BUF.ACI-(D20Img2-Cdkn1a)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 20 7149177 7159727 1 - by flanking markers RRID:RGD_2304306 Developed by the DEPOSITOR 2304307 ACI.BUF-(D20Img2-Cdkn1a)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 20 7149177 7159727 1 - by flanking markers RRID:RGD_2304307 Developed by the DEPOSITOR 2304308 ICR/Ihr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2019-08-05) Neurobiology; Ophthalmology RRID:RGD_2304308 A new rat strain has been developed, in which a spontaneous cataract occurs without exception at 3-4 months after birth and matures completely at 4-6 months of age, indicating that this strain possesses a maturity-onset cataract. 2304309 SHRSP.WKY-(D1Mgh5-D1Rat106)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 1 78430536 137184926 1 - by flanking markers RRID:RGD_2304309 Developed by the DEPOSITOR 2304310 SD-Tg(Nes/Hspa1b-EGFP)Okn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_2304310 This strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter. 2304311 LEW-Tg((ROSA)26Sor-lacZ)44JmskRrrc National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RRRC_00298 This strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. 2304312 SHRSP.WKY-(D1Mgh5-D1Rat36)(D1Rat44-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2304312 Developed by the DEPOSITOR 2304313 SHRSP.WKY-(D1Mgh5-D1Rat178)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2304313 Developed by the DEPOSITOR 2304314 BDIX.Cg-Tal/NemOda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Osteosis RRID:RGD_2304314 Mating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain). 2304315 SHRSP.WKY-(Calca-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Calca 2254 1 172686168 187092492 1 - by flanking markers 1 191158061 206277202 1 - by flanking markers 1 184184018 199254774 1 - by flanking markers 1 168878212 182418476 1 - by flanking markers RRID:RGD_2304315 Developed by the DEPOSITOR 2304316 F344.LEC-xhs1/2Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2304316 LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay 2304329 WKY/Ezo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension RRID:RGD_2304329 Deposited by the DEPOSITOR 2304330 SD-Tg(HRAS)128Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-04-30) Cancer RRID:RGD_2304330 This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region. 2304331 F344-Tg(CCR5)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious RRID:RGD_2304331 Deposited by the DEPOSITOR 2304332 HER/Wkmt National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology RRID:RGD_2304332 Developed by the DEPOSITOR 2305934 F344-Spta1Tn(sb-T2/Bart3)2.315Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spta1Tn(sb-T2/Bart3)2.315Mcwi 2305932 13 89951924 90028592 7 13 96782387 96860327 7 13 92264231 92340091 7 13 86203504 86279371 7 RRID:RRRC_00439 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene. 2305935 F344-Rtn4Tn(sb-T2/Bart3)2.316Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rtn4Tn(sb-T2/Bart3)2.316Mcwi 2305933 14 110725089 110772578 7 14 113792257 113839936 7 14 114126931 114174459 7 14 103450074 103497687 7 RRID:RRRC_00476 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene. 2305939 SHRSP.WKY-(D9Mit6-D9Rat83)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305939 Developed by the DEPOSITOR 2305940 SHRSP-Chr 7WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305940 Chromosome 7 from WKY is introgressed into the genomic background of SHRSP 2305941 SHR-Chr 15WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305941 Chromosome 15 from WKY is introgressed into the genomic background of SHR 2305942 SHR-Chr 3WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305942 Chromosome 3 from WKY is introgressed into the genomic background of SHR 2305943 SHRSP-Chr 15WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305943 Chromosome 15 from WKY is introgressed into the genomic background of SHRSP 2305944 SHRSP-Chr 4WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305944 Chromosome 4 from WKY is introgressed into the genomic background of SHRSP 2305945 SHRSP-Chr 13WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305945 Chromosome 13 from WKY is introgressed into the genomic background of SHRSP 2305946 SHR-Chr 1WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305946 Chromosome 1 from WKY is introgressed into the genomic background of SHR 2305947 SHR-Chr 19WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305947 Chromosome 19 from WKY is introgressed into the genomic background of SHR 2305948 SHRSP.WKY-(D8Rat77-D8Rat16)(D8Tkyo10)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305948 Developed by the DEPOSITOR 2305949 SHRSP-Chr 1WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305949 Chromosome 1 from WKY is introgressed into the genomic background of SHRSP 2305966 SHR.SHRSP-(D1Rat93-D1Rat269)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 1 65677942 124977364 1 - by flanking markers RRID:RGD_2305966 Developed by the DEPOSITOR 2305967 SHR.SHRSP-(D18Rat73-D18Rat11)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 18 49999958 68414117 1 - by flanking markers RRID:RGD_2305967 Developed by the DEPOSITOR 2305968 SHRSP.WKY-(D1Wox18-D1Rat39)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 94626541 125983558 1 - by flanking markers 1 101198387 133172336 1 - by flanking markers 1 100133276 132134441 1 - by flanking markers 1 94644435 124668572 1 - by flanking markers RRID:RGD_2305968 Developed by the DEPOSITOR 2305969 SHRSP.WKY-(D1Mgh5-D1Rat178)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2305969 Developed by the DEPOSITOR 2305970 DA-Tg(Alb-TTR*V30M)7Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2305970 This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. 2305971 SHRSP.SHR-(D18Rat73-D18Rat11)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 18 49999958 68414117 1 - by flanking markers RRID:RGD_2305971 Developed by the DEPOSITOR 2305972 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)(Bcl2-D13Mgh7)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305972 Developed by the DEPOSITOR 2305973 SHRSP.SHR-(D1Rat93-D1Rat269)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 1 65677942 124977364 1 - by flanking markers RRID:RGD_2305973 Developed by the DEPOSITOR 2305974 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305974 Developed by the DEPOSITOR 2305975 SHRSP.WKY-(D1Mgh5-D1Wox18)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 1 78430536 94644553 1 - by flanking markers RRID:RGD_2305975 Developed by the DEPOSITOR 2305976 DA-Tg(Alb-TTR*V30M)9Jmsk National BioResource Project for the Rat in Japan, Rat Resource & Research Center National BioResource Project for the Rat in Japan, Rat Resource & Research Center transgenic Cryopreserved Embryo Development RRID:RRRC_00339 This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. 2305977 ACI.F344-(D16Rat12-D16Mco2)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 350121 67547357 1 - by flanking markers 16 1084304 67099528 1 - by flanking markers 16 1090054 1090164 1 - by flanking markers 16 380245 380356 1 - by flanking markers RRID:RGD_2305977 F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals. 2305978 LEW-Tg((ROSA)26Sor-DsRed*)7Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RGD_2305978 This strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School. 2305979 WKY.SHRSP-(D1Wox29-D1Arb21)(Bcl2-D13Mgh7)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305979 Developed by the DEPOSITOR 2305987 F344.OLETF-(D7Mgh16-D7Wox46)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 113050225 1 - by flanking markers 7 100584458 116158165 1 - by flanking markers 7 100004559 116255796 1 - by flanking markers 7 91256311 106845450 1 - by flanking markers RRID:RGD_2305987 Developed by the DEPOSITOR 2305988 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305988 Developed by the DEPOSITOR 2305989 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Z-Leprfa/Tj)F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305989 Developed by the DEPOSITOR 2305990 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305990 Developed by the DEPOSITOR 2305991 (F344.OLETF-(D7Mgh16-D7Mgh20)/Tj X F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305991 Developed by the DEPOSITOR 2305992 F344.OLETF-(D7Mit16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 7 113886156 113886318 1 - by flanking markers RRID:RGD_2305992 Developed by the DEPOSITOR 2305993 F344.OLETF-(D14Rat23)(D14Rat12)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305993 Developed by the DEPOSITOR 2305994 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/1Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity RRID:RGD_2305994 Developed by the DEPOSITOR 2305995 F344.OLETF-(D7Got130-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305995 Developed by the DEPOSITOR 2305996 F344.Cg-Leprfa(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305996 Developed by the DEPOSITOR 2305997 (F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/2Tj x F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305997 Developed by the DEPOSITOR 2305998 F344.Cg-Leprfa(D8Rat54-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2305998 Developed by the DEPOSITOR 2305999 F344.OLETF-(D7Mgh16-D7Rat70)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 117397170 1 - by flanking markers 7 100584458 120641361 1 - by flanking markers 7 100004559 120648531 1 - by flanking markers 7 91256311 110979877 1 - by flanking markers RRID:RGD_2305999 Developed by the DEPOSITOR 2306000 F344.OLETF-(D7Rat70-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 117396947 117397170 1 - by flanking markers 7 120641139 120641361 1 - by flanking markers 7 120648309 120648531 1 - by flanking markers 7 110979654 110979877 1 - by flanking markers RRID:RGD_2306000 Developed by the DEPOSITOR 2306001 F344.OLETF-(D7Rat176-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 111200727 111200952 1 - by flanking markers 7 114641525 114641749 1 - by flanking markers 7 114708083 114708307 1 - by flanking markers 7 105399233 105399458 1 - by flanking markers RRID:RGD_2306001 Developed by the DEPOSITOR 2306002 F344.OLETF-(D14Rat23)(D14Rat12)/1Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306002 Developed by the DEPOSITOR 2306003 F344.OLETF-(D7Wox46-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 113050053 113050225 1 - by flanking markers 7 116157993 116158165 1 - by flanking markers 7 116255624 116255796 1 - by flanking markers 7 106845277 106845450 1 - by flanking markers RRID:RGD_2306003 Developed by the DEPOSITOR 2306004 F344.OLETF-(D7Mgh16-D7Mit16)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 120746007 1 - by flanking markers 7 100584458 123587717 1 - by flanking markers 7 100004559 123602998 1 - by flanking markers 7 91256311 113886318 1 - by flanking markers RRID:RGD_2306004 Developed by the DEPOSITOR 2306013 F344.OLETF-(D14Rat8-D14Rat26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 14 30320092 65026991 1 - by flanking markers RRID:RGD_2306013 Developed by the DEPOSITOR 2306014 F344.OLETF-(D8Rat54-D8Mgh17)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2306014 Developed by the DEPOSITOR 2306015 F344.OLETF-(D12Wox5-D12Rat21)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 12 13635523 42767729 1 - by flanking markers RRID:RGD_2306015 Developed by the DEPOSITOR 2306016 F344.OLETF-(D11Mgh4-D11Mgh1)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 11 59802622 82566702 1 - by flanking markers RRID:RGD_2306016 Developed by the DEPOSITOR 2306017 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D14Rat23-D14Rat12))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306017 Developed by the DEPOSITOR 2306018 F344.OLETF-(D9Mgh8-D9Mit2)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2306018 Developed by the DEPOSITOR 2306019 F344.OLETF-(D1Mit20-D1Mgh26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 1 172711200 172711337 1 - by flanking markers RRID:RGD_2306019 Developed by the DEPOSITOR 2306020 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306020 Developed by the DEPOSITOR 2306021 SHR-Chr 2WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2306021 Developed by the DEPOSITOR 2306022 KCI/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm (as of 2024-09-24) Neurobiology Pcdh15 1590969 RRID:RGD_2306022 Rats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003. 2306023 F344-Tg(CCNT1)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious CCNT1 1322457 RRID:RGD_2306023 Developed by the DEPOSITOR 2306024 FOK/Ncu Furuyama rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_2306024 These are resistant to hot environment. 2306025 WMN/Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism RRID:RGD_2306025 Developed by the DEPOSITOR 2306026 F344.OLETF-(D16Wox4-D16Rat13)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 16 48143982 73187298 1 - by flanking markers RRID:RGD_2306026 Developed by the DEPOSITOR 2306027 WM/Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism RRID:RGD_2306027 Developed by the DEPOSITOR 2306028 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306028 Developed by the DEPOSITOR 2306029 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306029 Developed by the DEPOSITOR 2306030 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306030 Developed by the DEPOSITOR 2306033 SHR.Cg-Leprcp/NDmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension Leprcp 11570565 RRID:RGD_2306033 Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999. 2306034 NER.F344-(D1Mgh6-D1Rat132)(D5Rat100-D5Rat234)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology RRID:RGD_2306034 Developed by the DEPOSITOR 2306035 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals Neurobiology RRID:RGD_2306035 This double congenic strain was established by crossing F344.NER-(D1Mgh6-D1Rat73)/Kyo and F344.NER-(D5Mgh4-D5Rat36)/Kyo 2306036 F344-Apcm1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-03-14) Cancer Apc|Apcm1Kyo 2123|12792252 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RGD_2306036 F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven). 2306037 F344-Tg(CD4)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious RRID:RGD_2306037 Developed by the DEPOSITOR 2306041 F344-Scn1am2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology Scn1am2Kyo 12792284 3 48238528 48364143 7 3 59016641 59135580 7 3 52437310 52437310 8 3 50998498 50998498 8 RRID:RGD_2306041 Established by ENU mutagenesis. A point mutation in Scn1a gene. 2306042 F344-Scn1am1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Neurobiology Scn1am1Kyo 12792283 3 48238528 48364143 7 3 59016641 59135580 7 3 52408707 52408707 8 3 50969024 50969024 8 RRID:RGD_2306042 Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model. 2306043 SHR/4Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306043 Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure 2306044 SHRSP/3Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306044 Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line 2306045 SHR/2Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306045 Developed by the DEPOSITOR, one of the SHR substrains from B2 line 2306046 W-Tg(CAG-EGFP)3Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo RRID:RGD_2306046 This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. 2306047 W-Tg(Gnrh1-EGFP)Nphy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Gnrh1 2720 RRID:RGD_2306047 This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence. 2306048 SHR/3Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306048 Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure 2306049 SHRSP/4Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306049 Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis 2306050 SHRSP/5Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306050 Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis 2306051 SHRSP/2Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306051 Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line 2306058 LEC.W-Tg(CAG-Zfml)30Ncms/Ncms National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306058 Developed by the DEPOSITOR 2306059 DA.Cg-Foxn1rnu Lystbg/Slc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Immunology; Hematology Foxn1|Lyst 3970|621837 RRID:RGD_2306059 Developed by the DEPOSITOR 2306060 LEC.W-Tg(CAG-Zfml)26Ncms/Ncms National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306060 Developed by the DEPOSITOR 2306061 ACI.BUF-Pur1, Thym2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Metabolism RRID:RGD_2306061 The proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (Thym2) (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002. 2306062 W-Tg(Per1-luc)1Oa National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00273 Developed by the DEPOSITOR 2306063 LEC.W-Tg(CAG-Zfml)21Ncms/Ncms National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306063 Developed by the DEPOSITOR 2306064 MPR/Iar National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Metabolism; Osteosis Arsb|ArsbMPR 2158|12792967 RRID:RGD_2306064 Developed by the DEPOSITOR 2306070 WIC-Tg(Wap-GH1)1Mni National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism RRID:RGD_2306070 Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). 2306071 F344-Tg(CAG-EGFP)Ncco National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer; Metabolism RRID:RGD_2306071 Transgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method 2306072 ACI.F344-(D16Nkg74)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306072 A sub congenic strain of ACI/N.F344-(D16Rat12-D16Mco2)/Nkg 2306073 WIC-Tg(Wap-GH1)2Mni National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism RRID:RGD_2306073 Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). 2306076 ACI.F344-(D16Nkg9-D16Nkg38)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306076 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals. 2306077 ACI.F344-(D16Rat64-D16Nkg105)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 59398206 59398647 1 - by flanking markers 16 58966446 58966664 1 - by flanking markers 16 59285775 59285993 1 - by flanking markers 16 55711087 55711306 1 - by flanking markers RRID:RGD_2306077 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating. 2306078 KFRS4A/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2024-09-24) Neurobiology; Behavior RRID:RGD_2306078 Developed by the DEPOSITOR 2306079 ACI.F344-(D16Nkg87-D16Nkg105)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306079 This congenic strain was established by backcrossing ACI.F344-(D16Rat64-D16Nkg105)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals. 2306085 TCR/Ibu Toyoda Circling Rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Behavior RRID:RGD_2306085 A male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007. 2306089 ACI.BUF-(D7Wox16-D7Rat69)/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer 7 64611964 113044228 1 - by flanking markers 7 67991394 116151991 1 - by flanking markers 7 67801457 67801690 1 - by flanking markers 7 60460452 60460686 1 - by flanking markers RRID:RGD_2306089 The thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing. 2306090 ExHC/Ta Exogenously hypercholesterolemic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2017-04-19) Metabolism RRID:RGD_2306090 Developed by the DEPOSITOR 2306098 ACI.F344-(D16Nkg30-D16Mgh6)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 16 49150370 49150515 1 - by flanking markers 16 48766016 48766115 1 - by flanking markers 16 49051407 49051506 1 - by flanking markers 16 45868397 45868497 1 - by flanking markers RRID:RGD_2306098 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. 2306099 SHR.WKY-(D15Tkyo3-D15Rat68)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 62521592 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 15 56484420 56484560 1 - by flanking markers RRID:RGD_2306099 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306100 SHR.WKY-(D3Tkyo7-D3Rat1)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 99858951 170016653 1 - by flanking markers 3 112038782 180128021 1 - by flanking markers 3 105465332 176418101 1 - by flanking markers 3 100769917 168026850 1 - by flanking markers RRID:RGD_2306100 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306101 LEC.BN-(D4Mgh16-D4Rat233)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 61646674 108329449 1 - by flanking markers 4 61427427 170105737 1 - by flanking markers 4 61708103 105384025 1 - by flanking markers 4 62933269 107032773 1 - by flanking markers RRID:RGD_2306101 Developed by the DEPOSITOR 2306102 BN.LEC-(D4Rat128-D4Rat106)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 117887968 1 - by flanking markers 4 145335315 179959894 1 - by flanking markers 4 80666353 115372927 1 - by flanking markers 4 79986873 116179656 1 - by flanking markers RRID:RGD_2306102 Developed by the DEPOSITOR 2306103 SHRSP/Sums National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_2306103 Developed by the DEPOSITOR 2306104 BN.LEC-(D4Rat184-D4Rat238)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 120665583 142160377 1 - by flanking markers 4 182854846 203361566 1 - by flanking markers 4 118283596 138891201 1 - by flanking markers 4 118928273 139725596 1 - by flanking markers RRID:RGD_2306104 Developed by the DEPOSITOR 2306105 BN.LEC-(D4Rat128-D4Rat238)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 142160377 1 - by flanking markers 4 145335315 203361566 1 - by flanking markers 4 80666353 138891201 1 - by flanking markers 4 79986873 139725596 1 - by flanking markers RRID:RGD_2306105 Developed by the DEPOSITOR 2306106 CLX/Ta Circling behavior linked to the X-chromosome (CLX) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) Behavior RRID:RGD_2306106 Developed by the DEPOSITOR 2306107 SD-Tg(Sp6)58Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-22) Dentistry; Development Sp6 1306768 RRID:RGD_2306107 The transgenic construct carrying rat Sp6 coding region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. 2306108 SHR.WKY-(D3Mit9-D3Wox16)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 26674018 89245110 1 - by flanking markers 3 39535971 100667805 1 - by flanking markers 3 34394121 94028641 1 - by flanking markers 3 30356773 90477342 1 - by flanking markers RRID:RGD_2306108 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306109 SHR.WKY-(D3Mgh6-D3Rat1)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 50522618 170016653 1 - by flanking markers 3 61249840 180128021 1 - by flanking markers 3 54630948 176418101 1 - by flanking markers 3 53184593 168026850 1 - by flanking markers RRID:RGD_2306109 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306110 IER/Sums National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Neurobiology RRID:RGD_2306110 Developed by the DEPOSITOR 2306111 LEC.BN-(D4Mgh16-D4Rat233)(D4Rat271-D4Rat238)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306111 Developed by the DEPOSITOR 2306112 ZDF-LeprfaCrlCrlj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo Diabetes Obesity Lepr 3001 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_2306112 Developed by the DEPOSITOR 2306113 SD-Tg(Sp6)6Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 RRID:RGD_2306113 Developed by the DEPOSITOR 2306114 SHR.WKY-(D3Mgh16-D3Rat110)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 3 10778704 10778823 1 - by flanking markers RRID:RGD_2306114 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306115 SHR.WKY-(D3Mgh16-D3Rat166)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 101359980 1 - by flanking markers 3 11361699 113470358 1 - by flanking markers 3 6000748 106900596 1 - by flanking markers 3 10778704 102200699 1 - by flanking markers RRID:RGD_2306115 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306116 SD-Tg(Sp6)5Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 RRID:RGD_2306116 The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. 2306117 ACI.F344-(D16Nkg9-D16Nkg27)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306117 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. 2306118 SHR.WKY-(D15Rat95-D15Rat106)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 69469532 106177917 1 - by flanking markers 15 74166614 109944957 1 - by flanking markers 15 70559420 106550657 1 - by flanking markers 15 63180675 98288169 1 - by flanking markers RRID:RGD_2306118 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306119 F344-Tg(CD4,CCNT1)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious RRID:RGD_2306119 Developed by the DEPOSITOR 2306120 SHR.WKY-(D4Wox27-D4Rat15)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 4 460493 47890193 1 - by flanking markers 4 3096322 48448808 1 - by flanking markers 4 3044017 48656399 1 - by flanking markers 4 5218294 50119996 1 - by flanking markers RRID:RGD_2306120 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306276 F344-Exoc4Tn(sb-T2/Bart3)2.317Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Exoc4Tn(sb-T2/Bart3)2.317Mcwi 2306273 4 60406942 61284294 7 4 60287465 61081401 7 4 60549128 61358305 7 4 61807706 62584316 7 RRID:RRRC_00456 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. 2306277 F344-Gng12Tn(sb-T2/Bart3)2.320Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gng12Tn(sb-T2/Bart3)2.320Mcwi 2306274 4 96622363 96624479 7 4 162420268 162549350 7 4 97634925 97763478 7 4 96011118 96134767 7 RRID:RRRC_00454 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene. 2306278 F344-AW915325Tn(sb-T2/Bart3)2.319Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-31) AW915325Tn(sb-T2/Bart3)2.319Mcwi 2306272 RRID:RRRC_00448 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325. 2306279 F344-Diaph3Tn(sb-T2/Bart3)2.318Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Diaph3Tn(sb-T2/Bart3)2.318Mcwi 2306275 15 68905784 69267707 7 15 73538942 74007617 7 15 69928507 70400077 7 15 62543375 63013060 7 RRID:RRRC_00446 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. 2306529 BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75808584 77809321 1 - by flanking markers 4 142052025 144005977 1 - by flanking markers 4 77380565 79326833 1 - by flanking markers 4 76721312 78654798 1 - by flanking markers RRID:RGD_2306529 Parental strain BBDR.BBDP-(D4Rhw17-ss99306861)(D4Rhw11-D4Rhw10)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenic 2306532 BBDR.F344-(D4Rat27-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306532 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306533 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/2Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RRRC_00469 Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw 2306534 BBDR.F344-(D4Rat102-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306534 Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw 2306535 BBDR.F344-(D4Rat253-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306535 Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw 2306536 BBDR.F344-(D4Arb11-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306536 Congenic substrains generated by intercrossing male BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw and female BBDR/Rhw 2306537 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/1Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306537 Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw 2306538 BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306538 Congenic substrains generated by intercrossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutation 2306539 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/3Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306539 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306540 BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306540 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306541 BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington Rat Resource and Research Center congenic Unknown RRID:RRRC_00457 BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed 2306542 BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306542 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306543 BBDR.F344-(D4Got59-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306543 BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed 2306544 BBDR.F344-(D4Rat26-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306544 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306709 BBDR.BBDP-(D4Mit6-D4Mit7)/3Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_2306709 This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. 2306710 F344-LmlnTn(sb-T2/Bart3)2.322Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LmlnTn(sb-T2/Bart3)2.322Mcwi 2306701 11 69481117 69547133 7 11 73980288 74048100 7 11 70895141 70963121 7 11 67656241 67725889 7 RRID:RRRC_00447 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene. 2306711 F344-FM117003Tn(sb-T2/Bart3)2.321McwiRrrc PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm FM117003Tn(sb-T2/Bart3)2.321Mcwi 2306703 RRID:RRRC_00475 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2306712 BBDR.BBDP-(D4Mit6-D4Mit7)/2Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_2306712 This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. 2306717 BBDP/WorSunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada Rat Resource and Research Center inbred Cryopreserved Sperm; Cryorecovery (as of 2018-11-12) RRID:RRRC_00787 These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada. 2306784 Kini:DA,PVG-G12 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown RRID:RGD_2306784 Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1a MHC haplotype were bred to create F1 generation, 7 couples of F1 with DA/Han and PVG/OlaHsd females founders generated F2. F3 generation originated from breeding 50 random couples 2306815 SS.SR-(D7Rat67-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111506104 113014423 1 - by flanking markers 7 114961803 116100169 1 - by flanking markers 7 115041287 115041463 1 - by flanking markers 7 105699315 105699492 1 - by flanking markers RRID:RGD_2306815 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306816 SS.SR-(D7Mco19-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112800232 113014423 1 - by flanking markers 7 115828017 116100169 1 - by flanking markers 7 115922628 115922885 1 - by flanking markers 7 106571501 106571759 1 - by flanking markers RRID:RGD_2306816 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306817 SS.SR-(D7Uia1-D7Mco19)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 112800489 1 - by flanking markers 7 112367543 115828274 1 - by flanking markers 7 112429186 115922885 1 - by flanking markers 7 103146217 106571759 1 - by flanking markers RRID:RGD_2306817 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306818 SS.SR-(D7Rat131-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111882387 113014423 1 - by flanking markers 7 115334997 116100169 1 - by flanking markers 7 115421039 115421228 1 - by flanking markers 7 106074002 106074194 1 - by flanking markers RRID:RGD_2306818 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306819 SS.SR-(D7Uia1-D7Rat131)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 111882577 1 - by flanking markers 7 112367543 115335186 1 - by flanking markers 7 112429186 115421228 1 - by flanking markers 7 103146217 106074194 1 - by flanking markers RRID:RGD_2306819 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306820 SS.SR-(D3Arb14-D3Mco36)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 171009566 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 3 168974481 168974694 1 - by flanking markers RRID:RGD_2306820 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 2306823 SS.SR-(D3Arb14-D3Mco36)(D7Mco19-D7Mco7)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_2306823 SS.SR-(D3Arb14-D3Mco36)/Mco were crossed with SS.SR-(D7Mco19-D7Mco7)/Jr and then F1 rats were backcrossed with SS.SR-(D3Arb14-D3Mco36)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bred 2306840 E3.DA-(D4Wox22-D4Got132)(D12Wox5-D12Rat26)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown RRID:RGD_2306840 This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers 2306841 E3.DA-(D12Wox5-D12Rat26)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23845554 23845733 1 - by flanking markers 12 17721341 27718984 1 - by flanking markers 12 15714609 25711626 1 - by flanking markers 12 13635523 22692658 1 - by flanking markers RRID:RGD_2306841 This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers 2306842 E3.DA-(D20Rat45-D20Rat47)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6;20 133455626;1616332 133455718;5447494 1 - by flanking markers;1 - by flanking markers 20 4059279 8810333 1 - by flanking markers 20 2018654 6567533 1 - by flanking markers 20 1527842 5304690 1 - by flanking markers RRID:RGD_2306842 This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers 2306874 F344-IntuTn(sb-T2/Bart3)2.324Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) IntuTn(sb-T2/Bart3)2.324Mcwi 2306873 2 127564813 127639564 7 2 147063971 147216092 7 2 127459089 127521327 7 2 123600972 123685331 7 RRID:RRRC_00441 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene. 2306875 F344-FaslgTn(sb-T2/Bart3)2.325Mcwi PhysGen mutant Extinct (as of 2017-01-26) FaslgTn(sb-T2/Bart3)2.325Mcwi 2306872 13 77472950 77480210 7 13 84590119 84605900 7 13 79696811 79717581 7 13 74151519 74172760 7 RRID:RGD_2306875 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. 2306892 SHR.BN-(D2Rat114-D2Rat123)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 36432989 112326568 1 - by flanking markers 2 55361257 131889716 1 - by flanking markers 2 36245223 112175725 1 - by flanking markers 2 109366814 109366971 1 - by flanking markers RRID:RGD_2306892 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306893 SHR.BN-(D16Rat87-D16Mgh1)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 16 3464719 46137590 1 - by flanking markers 16 4082652 45651269 1 - by flanking markers 16 4136355 45905331 1 - by flanking markers 16 3380150 43025077 1 - by flanking markers RRID:RGD_2306893 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306894 SHR.BN-(D4Rat33-D4Rat54)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 4 80205349 121829076 1 - by flanking markers 4 146540904 184799673 1 - by flanking markers 4 81874073 119546974 1 - by flanking markers 4 81006124 120102625 1 - by flanking markers RRID:RGD_2306894 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306895 SHR.BN-(D2Rat226-D2Rat294)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 170338294 236153712 1 - by flanking markers 2 197020226 262435073 1 - by flanking markers 2 177680772 243901375 1 - by flanking markers 2 164073756 227146641 1 - by flanking markers RRID:RGD_2306895 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306961 RLA/Verh Roman low avoidance Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown RRID:RGD_2306961 Bignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium 2306962 RHA/Verh Roman high avoidance Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown RRID:RGD_2306962 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium 2307077 HXB4/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307077 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307078 HXB27/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307078 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307079 HXB3/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307079 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307080 HXB20/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307080 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307081 HXB31/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307081 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307082 HXB18/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307082 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307083 HXB10/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307083 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307084 HXB24/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307084 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307085 HXB17/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307085 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307086 HXB7/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307086 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307087 SHR.BN-(D18Rat32-D18Rat12)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_2307087 A segment of chr 18 from BN was introgressed into the SHR background 2307088 HXB22/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307088 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307089 HXB29/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307089 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307090 SHR.BN10/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_2307090 A segment of chr 10 from BN was introgressed into the SHR background 2307091 HXB13/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307091 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307092 HXB14/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307092 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307093 HXB23/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307093 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307094 HXB1/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307094 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307095 HXB15/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307095 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307096 HXB2/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307096 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307097 HXB21/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307097 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307098 HXB25/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307098 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307099 HXB5/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307099 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307115 BXH5/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307115 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307116 PXO3-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307116 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307117 PXO5-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307117 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307118 PXO9/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307118 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307119 PXO7-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307119 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307120 PXO7-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307120 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307121 BXH2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307121 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307122 PXO8-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307122 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307123 BXH13/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307123 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307124 BXH10/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307124 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307125 PXO6-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307125 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307126 BXH8/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307126 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307127 BXH11/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307127 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307128 PXO5-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307128 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307129 BXH9/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307129 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307130 PXO6-3/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307130 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307131 PXO8-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307131 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307132 PXO10/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307132 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307134 BXH3/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307134 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307135 PXO4/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307135 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307136 BXH6/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307136 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307137 PXO6-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307137 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307138 PXO1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307138 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307139 BXH12/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307139 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307155 SHR/1NCrl MRC Clinical Sciences Centre, College School of Medicine, London, UK inbred Unknown RRID:RGD_2307155 To Charles River from NIH in 1973 at F32. 2307156 DA/ZtmKini Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307156 Substrain of DA, to Hannover after 1965, now at Stockholm, Sweden. 2307157 PVG.1AV1/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown RRID:RGD_2307157 Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden. 2307159 SHRSR.SHRSP-(Klk1-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 1 94378103 181133270 1 - by flanking markers RRID:RGD_2307159 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307160 SHRSR.SHRSP-(Klk1-D1Mit3)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 1 94378103 144267916 1 - by flanking markers RRID:RGD_2307160 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307161 SHRSR.SHRSP-(D1Rat134-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 1 133634986 181133270 1 - by flanking markers RRID:RGD_2307161 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307166 SHRSP.SHRSR-(Klk1-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 1 94378103 181133270 1 - by flanking markers RRID:RGD_2307166 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307167 SHRSP.SHRSR-(Klk1-D1Mit3)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 1 94378103 144267916 1 - by flanking markers RRID:RGD_2307167 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307168 SHRSR/Bbb Spontaneously Hypertensive Rat, Stroke Resistant Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown RRID:RGD_2307168 This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany. 2307169 SHRSP.SHRSR-(D1Rat134-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 1 133634986 181133270 1 - by flanking markers RRID:RGD_2307169 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307298 BN/HanKini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307298 Substrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany) 2307299 ACI/ZtmKini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307299 substrain of ACI derived from ACI/Ztm 2307300 LEW.1AV1/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown RRID:RGD_2307300 Substrain of LEW.1AV1 2307301 DA.LEW.RT1f-(D20Wox15-D20Wox13)/Rhd Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden congenic Unknown 20 2790524 6695696 1 - by flanking markers 20 5249993 10234922 1 - by flanking markers 20 3151827 8034632 1 - by flanking markers 20 2646407 6515143 1 - by flanking markers RRID:RGD_2307301 RT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markers 2307317 MHS Milan Hypertensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy outbred Unknown RRID:RGD_2307317 Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure 2307318 BDIX/Ifz Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_2307318 derived from Berlin-Druckrey strain BDIX 2307319 MNS/N Milan normotensive strain Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo RRID:RRRC_00171 Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. 2307355 PXO3-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307355 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307356 PXO2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307356 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307357 BDV/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_2307357 Developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. 2307358 LUDW/OlaHsd Ludwig Envigo Envigo inbred Cryorecovery RRID:RGD_2307358 Wistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979. 2307359 BUF/SimRijHsd Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_2307359 Developed by Heston in 1946 from a Buffalo 2307360 DA.BI.RT1i-(D20Rat42-D20Rat31)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 4582054 10410227 1 - by flanking markers 20 6265460 12972703 1 - by flanking markers 20 4186104 10800530 1 - by flanking markers 20 4459698 10078919 1 - by flanking markers RRID:RGD_2307360 RT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han. 2307441 F344-Cyyr1Tn(sb-T2/Bart3)2.328Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyyr1Tn(sb-T2/Bart3)2.328Mcwi 2307440 11 25036792 25157304 7 11 28591553 28702298 7 11 24967936 25078740 7 11 24557620 24664007 7 RRID:RRRC_00452 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. 2307442 F344-Robo1Tn(sb-T2/Bart3)2.327Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Robo1Tn(sb-T2/Bart3)2.327Mcwi 2307439 11 10784947 11720646 7 11 13314508 13808775 7 11 9079291 10146302 7 11 10580863 11621675 7 RRID:RRRC_00451 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene. 2308816 Crl:WI(Han) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308816 Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL (under structural changed to RCC). Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system. 2308851 Crl:OP(CD) Obese Prone Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308851 Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD). 2308852 Crl:LE Long-Evans Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308852 Originated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978. 2308853 Crl:OR(CD) Obese Resistant Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308853 Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets. 2308885 GK/CskCrljCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2308885 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006. 2308886 SS/HsdMcwiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2308886 Inbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001. 2311049 SHROB/KolGmiCrl-Leprcp/Crl Charles River Laboratories Charles River Laboratories coisogenic Unknown Leprcp 11570565 RRID:RGD_2311049 This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001. 2311051 SHRSP/A3NCrl Stroke Prone Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311051 The Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002. 2311070 BUF/CrCrl Buffalo Rat Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311070 Heston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). 2311071 ZDF-Leprfa/Crl Charles River Laboratories Charles River Laboratories coisogenic Unknown Lepr 3001 RRID:RGD_2311071 A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001. 2311072 FHH/EurMcwiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311072 An outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001. 2311073 NBL/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311073 Bogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998. 2311074 BDIX/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311074 Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). 2311078 Crl:CD-Hrhr CD hairless rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2311078 This spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic. 2311079 WF/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311079 J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). 2311082 SS-Chr 13BN/McwiCrl Charles River Laboratories Charles River Laboratories consomic Unknown RRID:RGD_2311082 Developed at the Medical College of Wisconsin. To Charles River in 2003. 2311692 F344-Myo1dTn(sb-T2/Bart3)2.334Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Myo1dTn(sb-T2/Bart3)2.334Mcwi 2311691 10 68720729 68997721 7 10 67520649 67811744 7 10 67866939 68142864 7 10 65489153 65765812 7 RRID:RRRC_00478 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene. 2311693 F344-Tmem22Tn(sb-T2/Bart3)2.332Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Tmem22Tn(sb-T2/Bart3)2.332Mcwi 2311689 8 105416072 105443969 7 8 108269643 108297339 7 8 108854134 108881519 7 8 101085579 101113339 7 RRID:RGD_2311693 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene. 2311694 F344-Fam227aTn(sb-T2/Bart3)2.333Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam227aTn(sb-T2/Bart3)2.333Mcwi 2311687 7 117441099 117469873 7 7 120839737 120881869 7 7 120846166 120891738 7 7 111174362 111216513 7 RRID:RRRC_00484 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. 2312352 LEW.1N Zentralinstitut fur Versuchstierzucht, Hannover, Germany congenic Unknown RRID:RGD_2312352 These congenic rats carry the RTln haplotype on the LEW strain genetic background. 2312447 SD-Tg(Pmp22)Kan Max Planck Institute for Experimental Medicine, Gottingen, Germany transgenic Unknown Pmp22 11125 RRID:RGD_2312447 This transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid library 2312466 Crl:LIS Lister Hooded Rat Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312466 These rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance. 2312471 Crl:ZUC(Orl)-Leprfa Charles River Laboratories Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_2312471 The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991. 2312472 Crl:WI(WU) Wistar Wu Rat Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312472 Selection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987. 2312473 BDIX/OrlCrl BDIX Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2312473 Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991. 2312474 Crl:OFA(SD) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312474 The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968. 2312498 WAG/RijCrl WAG Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2312498 A.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993. 2312499 Crl:NIH-Foxn1rnu Nude Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312499 The NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs. 2312504 Crlj:WI Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312504 Wistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981) 2312511 WF/IcoCrl Wistar Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2312511 Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970. 2312512 ZSF1-Leprfa, Leprcp/Crl Genetic Models International, Indianapolis. Charles River Laboratories , Charles River Laboratories hybrid Unknown RRID:RGD_2312512 This F1 model was developed by crossing rat strains with two separate leptin receptor mutations (fa and cp), the lean female ZDF rat (+/fa) and the lean male SHHF rat (+/facp) ( RGD:401901201). Offspringcarring both mutations (fa:facp) are obese and develop insulin resistance, hyperglycaemia, and mild hypertension (ZSF1 obese). The heterozygous or wild type offspring (ZSF1 lean) are lean and exhibit no signs of obesity and diabetes. This model was developed at Genetic Models International, Indianapolis. To Charles River in 2001. The progeny that are heterozygous for leptin receptor or wild type are lean and are used as control for the obese counter part. 2312513 Crlj:DON Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312513 Dr. Sato(1952) to Nippon Rat to CRLJ(1990) 2312514 Crlj:LEC Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312514 Hokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991). 2312518 Crlj:ZUC-Leprfa Charles River Laboratories Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_2312518 Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000) 2312577 SHR.BN-(D18Rat99-D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 31654683 73666623 1 - by flanking markers 18 32165265 72695235 1 - by flanking markers 18 32487692 73016546 1 - by flanking markers 18 30558524 70263868 1 - by flanking markers RRID:RGD_2312577 F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity 2312578 SHR.BN-(D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 73016379 73016546 1 - by flanking markers 18 70263698 70263868 1 - by flanking markers RRID:RGD_2312578 F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity 2312579 SHR.BN-(D18Rat40-D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 62106066 73666623 1 - by flanking markers 18 60695794 72695235 1 - by flanking markers 18 61499531 73016546 1 - by flanking markers 18 59330409 70263868 1 - by flanking markers RRID:RGD_2312579 F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity 2312580 SHR.BN-(D18Rat113-D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 3719547 73016546 1 - by flanking markers 18 70263698 70263868 1 - by flanking markers RRID:RGD_2312580 SHR/OlaIpcv were crossed with BN/Crl, F1 animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes 2312609 MWF-Chr 8SHR/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_2312609 MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing 2312644 DA.WOKW-(D3Mit10-D3Rat189)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 35797577 35797756 1 - by flanking markers 3 44863125 44863303 1 - by flanking markers 3 39773247 39773425 1 - by flanking markers 3 38710365 38710544 1 - by flanking markers RRID:RGD_2312644 A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background 2312645 DA.WOKW-(D16Rat88-D16Wox7)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 16 819225 63306215 1 - by flanking markers 16 1534408 62873174 1 - by flanking markers 16 1550187 63210301 1 - by flanking markers 16 832236 59492508 1 - by flanking markers RRID:RGD_2312645 A cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K background 2312646 DA.WOKW-(D5Mgh6-D5Mit5)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 5 71814715 109163425 1 - by flanking markers 5 75334610 112058005 1 - by flanking markers 5 71154828 108092802 1 - by flanking markers 5 68984307 104251008 1 - by flanking markers RRID:RGD_2312646 A cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K background 2312647 DA.WOKW-(D3Mgh5-D3Rat1)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 97523869 170016653 1 - by flanking markers 3 109733850 180128021 1 - by flanking markers 3 103141814 176418101 1 - by flanking markers 3 98535255 168026850 1 - by flanking markers RRID:RGD_2312647 A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background 2312648 DA.WOKW-(D10Mgh2-D10Rat4)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 10 106422174 107033716 1 - by flanking markers 10 105533457 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 10 102134116 102134272 1 - by flanking markers RRID:RGD_2312648 A cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K background 2312733 BN-Chr 13SS Chr 18SS/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_2312733 A cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed 2313181 LEW.1WR1/WorBrm Biomedical Research Models, Inc. Biomedical Research Models, Inc. congenic Unknown RRID:RGD_2313181 Obtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc. 2313209 WF.ART2/Wor Universtiy of Massachusetts, Worcester, MA congenic Unknown RRID:RGD_2313209 developed at the Universtiy of Massachusetts, Medical School 2313221 SHHF-Leprcp/Crl Charles River Laboratories Charles River Laboratories congenic Unknown Leprcp 11570565 RRID:RGD_2313221 Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001. 2313222 BN/HsdMcwiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2313222 BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River 2313231 LEWBNF1/Crl Charles River Laboratories Charles River Laboratories hybrid Unknown RRID:RGD_2313231 This hybrid rat is a cross between a LEW female and a BN male rat. 2313232 WFF344F1/Crl Charles River Laboratories Charles River Laboratories hybrid Unknown RRID:RGD_2313232 This hybrid rat is a cross between a WF female and a F344 male rat. 2313342 BN-Chr 17LH/Mav Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2313342 Chr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped 2313343 LH-Chr 13BN/Mav Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2313343 Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped 2313384 Wild/Nov Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia wild Unknown RRID:RGD_2313384 These are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia 2313463 F344-Ppfia2Tn(sb-T2/Bart3)2.339Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppfia2Tn(sb-T2/Bart3)2.339Mcwi 2313459 7 45140154 45616620 7 7 48563521 49058116 7 7 48548932 49045852 7 7 41765716 42240104 7 RRID:RRRC_00474 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene. 2313464 F344-LargeTn(sb-T2/Bart3)2.336Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) LargeTn(sb-T2/Bart3)2.336Mcwi 2313460 19 12043818 12497663 7 19 23595328 24054765 7 19 12481563 12945320 7 19 11603129 12048930 7 RRID:RGD_2313464 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene. 2313465 F344-Pld5Tn(sb-T2/Bart3)2.340Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pld5Tn(sb-T2/Bart3)2.340Mcwi 2313462 13 91715000 92058036 7 13 98486317 98812030 7 13 94025696 94355219 7 13 87895694 88232868 7 RRID:RRRC_00483 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene. 2313466 F344-Agbl4Tn(sb-T2/Bart3)2.337Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Agbl4Tn(sb-T2/Bart3)2.337Mcwi 2313461 5 134582789 135484937 7 5 130742297 131656581 7 5 125254963 126534367 7 RRID:RRRC_00473 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene. 2313588 SD-Tg(Ins2-IAPP)Soel Pfizer, Inc, Groton, Connecticut transgenic Unknown RRID:RGD_2313588 Crl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoter 2313693 SHR-Tg(PEPCK-SREBF1)2Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 RRID:RGD_2313693 SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal 2313734 SD-Tg(H1/tetO-RNAi:Insr)29Bdr Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown RRID:RGD_2313734 Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter 2313735 SD-Tg(H1/tetO-RNAi:Insr)14Bdr Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown RRID:RGD_2313735 Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter 2313922 F344-Tg(Cyp1a1-Ren2)10.LEW-(D10Rat142-D10Rat15)/Jmul Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 92448353 96667338 1 - by flanking markers 10 91113514 95243104 1 - by flanking markers 10 91345679 95508221 1 - by flanking markers 10 88207600 92238497 1 - by flanking markers RRID:RGD_2313922 F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to F344 females to produce BC-F344. After 12 backcross nerations, males and females heterozygous for F344/Lew in the reduced MOD QTLregion were brother-sister mated to generate aimals that were homozygous Lew/Lew for the MOD QTL region but homozygous F344/F344 for the rest of the genome. 2313923 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10.F344-(D10Rat99-D10Rat11)/Jmul Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 89278229 100633982 1 - by flanking markers 10 88043769 99184250 1 - by flanking markers 10 88250522 99492409 1 - by flanking markers 10 85269536 96121100 1 - by flanking markers RRID:RGD_2313923 F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to Lew females to produce BC-Lew. After 12 backcross generations, males and females heterozygous for F344/Lew in the MOD QTLregion were brother-sister mated to generate aimals that were homozygous F344/F344 for the MOD QTL region but homozygous LEW/LEW for the rest of the genome. 2313924 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10/Jmul Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK consomic Unknown RRID:RGD_2313924 F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markers 2314001 N:HS Heterogeneous stock Dept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain outbred Unknown RRID:RGD_2314001 Originated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsin 2314009 NMcwi:HS Heterogeneous stock Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin outbred Unknown RRID:RGD_2314009 25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. A rotational delay of 1 is used, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc. 2314027 SDT.Cg-Leprfa/Jtt SDT fatty Japan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, Japan congenic Unknown RRID:RGD_2314027 Leprfa allele from ZDF was introgressed into SDT rats using the speed congenic method 2314161 F344-Kuru1/Kyo Kuru1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314161 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314162 F344-Oune/Kyo Oune National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Tbx6 1307716 RRID:RGD_2314162 A mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314163 F344-Kcna1Adms/Kyo ADMS (autosomal dominant myokymia and seizures) rat The University of Tokyo, The Institute of Medical Science National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Kcna1Adms 12880383 4 163011777 163013522 7 4 226188851 226190596 7 4 159190781 159192526 7 4 159464223 159472905 7 RRID:RGD_2314163 This strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model. 2314164 F344-Kuru2/Kyo Kuru2 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314164 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314165 ACI-Chib/Kyo Chibi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology RRID:RGD_2314165 This strain was established by phenotype-driven ENU mutagenesis. 2314166 F344-Tbr2/Kyo Tsubura2 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314166 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314167 F344-Kmch/Kyo Komachi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm RRID:RGD_2314167 This strain was established by phenotype-driven ENU mutagenesis. 2314168 F344-Tbr1/Kyo Tsubura1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314168 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314169 WTC.F344-Scn1am1Kyo/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2024-04-16) Scn1am1Kyo 12792283 RRID:RGD_2314169 This congenic strain was established by backcrossing F344-Scn1am1Kyo onto WTC/Kyo. 2314170 F344-Egrm1Kyo EGR (Excessive Grooming Rat), Kaikai, Kyo1897 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314170 This strain was established by phenotype-driven ENU mutagenesis. 2314224 F344.OLETF-(D1Rat166-D1Rat90)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_2314224 Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. 2314225 F344-Chr 15OLETF/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2314225 Developed by the depositor 2314226 WI-Tg(WSCD2)3Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314226 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314227 WI-Tg(WSCD2)4Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314227 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314228 WI-Tg(WSCD2)5Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314228 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314229 F344.OLETF-(D7Uwm22-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 123733466 123733601 1 - by flanking markers 7 126334525 126334660 1 - by flanking markers 7 126622888 126623023 1 - by flanking markers 7 116836447 116836583 1 - by flanking markers RRID:RGD_2314229 Developed by the DEPOSITOR 2314230 F344-Hrkrh/Kyo Hairless Kyoto, Hanako National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology; Urology RRID:RGD_2314230 A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314231 F344.OLETF-(D5Mgh5-D5Mgh23)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 5 43726656 109897936 1 - by flanking markers RRID:RGD_2314231 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 2314232 WI-Tg(WSCD2)1Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314232 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314243 SHR.WKY-(D1Mgh2-D1Wox10)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1 22842898 220639653 1 - by flanking markers 1 24875821 244066407 1 - by flanking markers 1 23406428 236763528 1 - by flanking markers 1 22340647 214537671 1 - by flanking markers RRID:RGD_2314243 Developed by the depositor 2314244 BCR/Nn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology RRID:RGD_2314244 In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). 2314245 WI-Tg(WSCD2)6Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314245 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314246 SHRSP.WKY-(D1Rat117-D1Rat90)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 219629755 267111153 1 - by flanking markers 1 240604381 289137268 1 - by flanking markers 1 233490105 281795785 1 - by flanking markers 1 213533809 259647894 1 - by flanking markers RRID:RGD_2314246 Developed by the Depositor 2314247 WI-Tg(Prl-EGFP)Yamp National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Metabolism; Development RRID:RGD_2314247 A transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats 2314313 NER.F344-(D5Rat100-D5Rat234)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 5 68843563 68843964 1 - by flanking markers 5 70180341 70180484 1 - by flanking markers 5 65696672 65696815 1 - by flanking markers 5 66174080 66174226 1 - by flanking markers RRID:RGD_2314313 The Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. 2314314 NER.F344-(D1Mgh6-D1Rat132)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 1 87656636 165996388 1 - by flanking markers 1 92524380 179788206 1 - by flanking markers 1 91394009 172789257 1 - by flanking markers 1 87790149 162457491 1 - by flanking markers RRID:RGD_2314314 The Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. 2314315 F344.NER-(D5Mgh4-D5Rat36)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 5 145186817 145187034 1 - by flanking markers 5 147610023 147610238 1 - by flanking markers 5 143846157 143846372 1 - by flanking markers 5 138113556 138113774 1 - by flanking markers RRID:RGD_2314315 The Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. 2314316 F344.NER-(D1Mgh6-D1Rat73)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 87656636 224420760 1 - by flanking markers 1 92524380 246113473 1 - by flanking markers 1 91394009 238824901 1 - by flanking markers 1 87790149 218748178 1 - by flanking markers RRID:RGD_2314316 The Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. 2314317 WTC.GRY-Cacna1agry/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-05-04) Neurobiology Cacna1a|Cacna1agry 2244|12880382 RRID:RGD_2314317 Developed by the depositor 2314339 F344-PatjTn(sb-T2/Bart3)2.343Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) PatjTn(sb-T2/Bart3)2.343Mcwi 2314335 5 118806744 119131114 7 5 120981525 121281044 7 5 117038548 117340308 7 5 113061985 113364807 7 RRID:RRRC_00480 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene. 2314340 F344-AcoxlTn(sb-T2/Bart3)2.342Mcwi PhysGen mutant Extinct (as of 2016-10-24) AcoxlTn(sb-T2/Bart3)2.342Mcwi 2314337 3 115365279 115687566 7 3 126606586 126919666 7 3 120414311 120724809 7 3 115061069 115367032 7 RRID:RGD_2314340 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene. 2314341 F344-Auts2Tn(sb-T2/Bart3)2.344Mcwi PhysGen mutant Extinct (as of 2016-10-24) Auts2Tn(sb-T2/Bart3)2.344Mcwi 2314338 12 25518248 25541023 7 12 24104187 25194123 7 RRID:RGD_2314341 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene. 2314342 F344-PalldTn(sb-T2/Bart3)2.341Mcwi PhysGen mutant Extinct (as of 2017-01-26) PalldTn(sb-T2/Bart3)2.341Mcwi 2314336 16 31144028 31144544 7 16 31198863 31240064 7 16 31349140 31390340 7 16 27981315 28143129 7 RRID:RGD_2314342 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene. 2314360 ACI.F344-(D16Mit5-D16Nkg27)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer RRID:RGD_2314360 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals. 2314361 W-Tg(Slc32a1-YFP*)1Yyan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development RRID:RGD_2314361 This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. 2314362 F344-Hrdk/Kyo Hairless dominant Kyoto National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314362 Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven). 2314363 W-Tg(Slc32a1-YFP*)2Yyan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development RRID:RGD_2314363 This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. 2314364 ACI.F344-(D16Nkg112-D16Nkg27)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer RRID:RGD_2314364 This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. 2314365 KFRS2/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology Tyr|TyrsiaKyo 1589755|13207345 1 143641257 143746315 7 1 157322968 157416594 7 1 151012598 151106802 7 1 141115036 141210207 7 RRID:RGD_2314365 A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. 2314368 F344-Kcnn2Trdk/Kyo Tremor dominant Kyoto The University of Tokyo, The Institute of Medical Science National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-15) Neurobiology Kcnn2Trdk 149735330 18 39560962 39705037 7 18 38822146 38864110 7 18 39331894 39479574 7 18 37817966 38258347 7 RRID:RGD_2314368 Tremor dominant Kyoto (Trdk) mutation is an autosomal dominant mutation that appeared in 2008 in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU) (Mashimo et al., 2008). Rats heterozygous for Trdk (Trdk/+) exhibited tremor behavior that was evident around weaning. To remove latent ENU-induced mutations, the laboratory established an F344-Trdk/+ congenic strain by nine rounds of backcrossing. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2. 2314375 LE.AR-Ednrbsl/Okkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-03-28) Internal Organ Ednrb|Ednrbsl 2536|10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_2314375 AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008). 2314376 KFRS4/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo (as of 2021-10-05) Ophthalmology; Dermatology RRID:RGD_2314376 A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14. 2314377 KFRS3B/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology RRID:RGD_2314377 A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding. 2314378 AR-Ednrbsl/Okkm Aganglionosis rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-10-31) Internal Organ Ednrb|Ednrbsl 2536|10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_2314378 Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR) 2314379 KFRS6/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals Dermatology RRID:RGD_2314379 A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo. 2314380 SD-Tg(CAG-lacZ)541Htsu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_2314380 Developed by the depositor 2314381 KFRS5A/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology Krt71Rex 11570416 7 141143396 141166531 7 7 143345201 143371346 7 7 132873532 132898975 7 RRID:RGD_2314381 A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo. 2314382 SD-Tg(CAG-HRAS*G12V)250Htsu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Cancer HRAS 730881 RRID:RGD_2314382 This transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter 2314383 KFRS3A/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology RRID:RGD_2314383 A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding. 2314396 LCR/Mco Low-capacity runners Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_2314396 Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. 2314397 HCR/Mco High-capacity runners Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_2314397 Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill. 2314414 LEW-Tg(H1/tetO-RNAi:Insr)87Hrjb Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 RRID:RGD_2314414 LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter 2314415 LEW-Tg(H1/tetO-RNAi:Insr)4Hrjb Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 RRID:RGD_2314415 LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter 2314477 LEW-RT1DA/Rrrc Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00391 Sprague-Dawley RT1u haplotype backcrossed onto Lewis inbred strain. 2314478 LEW-RT1.Bm1Trg/Rrrc RT1.B Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00392 ENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain. 2314492 SBN.SBH-(D1Rat148-D1Rat89)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 16325337 265343617 1 - by flanking markers 1 18951160 287349830 1 - by flanking markers 1 16470664 279986079 1 - by flanking markers 1 15760582 257976495 1 - by flanking markers RRID:RGD_2314492 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl 2314493 SBH.SBN-(D1Mgh2-D1Rat74)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 227005733 1 - by flanking markers 1 24875821 248763894 1 - by flanking markers 1 23406428 241482368 1 - by flanking markers 1 22340647 221264292 1 - by flanking markers RRID:RGD_2314493 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl 2314494 SBH.SBN-(D1Rat137-D1Rat123)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 223729371 1 - by flanking markers 1 95325941 245519018 1 - by flanking markers 1 94225372 238220385 1 - by flanking markers 1 90532338 218108781 1 - by flanking markers RRID:RGD_2314494 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl 2314495 SBN.SBH-(D1Rat27-D1Mit7)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90282040 240980321 1 - by flanking markers 1 95301716 262617374 1 - by flanking markers 1 94201400 94201552 1 - by flanking markers 1 90508614 90508767 1 - by flanking markers RRID:RGD_2314495 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl 2314496 SBH.SBN-(D1Mgh2-D1Mgh11)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 22843363 1 - by flanking markers 1 24875821 24875970 1 - by flanking markers 1 23406428 23406577 1 - by flanking markers 1 22340647 22340797 1 - by flanking markers RRID:RGD_2314496 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl 2314497 SBN.SBH-(D1Rat101-D1Rat74)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 97174943 227005733 1 - by flanking markers 1 103735751 248763894 1 - by flanking markers 1 102658741 241482368 1 - by flanking markers 1 97146283 221264292 1 - by flanking markers RRID:RGD_2314497 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl 2314498 SBH.SBN-(D1Rat137-D1Rat83)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 252133935 1 - by flanking markers 1 95325941 274017147 1 - by flanking markers 1 94225372 266587220 1 - by flanking markers 1 90532338 245701099 1 - by flanking markers RRID:RGD_2314498 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl 2314499 SBN.SBH-(D1Mgh17-D1Mgh14)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 9082836 263699089 1 - by flanking markers 1 10007292 285604895 1 - by flanking markers 1 8387052 278228889 1 - by flanking markers 1 8606496 256448636 1 - by flanking markers RRID:RGD_2314499 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl 2314500 SBH.SBN-(D1Mgh2-D1Rat101)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 97175101 1 - by flanking markers 1 24875821 103735908 1 - by flanking markers 1 23406428 102658898 1 - by flanking markers 1 22340647 97146439 1 - by flanking markers RRID:RGD_2314500 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl 2314501 SBH.SBN-(D1Wox11-D1Rat137)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 64145811 90306478 1 - by flanking markers 1 63399232 95326185 1 - by flanking markers 1 64407177 94225616 1 - by flanking markers 1 65832929 90532583 1 - by flanking markers RRID:RGD_2314501 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl 2314530 SS.SHR-(D8Uia1-D8Rat90)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 8 110572032 110572221 1 - by flanking markers RRID:RGD_2314530 SS/Jr females were bred with SHR/NHsd males and their female F1 were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markers 2314531 SHR.SS-(D13Rat1-D13Mgh6)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 13 10555730 101704301 1 - by flanking markers 13 29679984 108279142 1 - by flanking markers 13 24501968 103613733 1 - by flanking markers 13 20605555 97213863 1 - by flanking markers RRID:RGD_2314531 SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers 2314532 SHR.SS-(D8Uia1-D8Rat90)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 8 110572032 110572221 1 - by flanking markers RRID:RGD_2314532 SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers 2314655 BRAT-Avpdi/BluHsd Brattleboro Harlan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) Avpdi 13627261 3 118205007 118206985 7 3 129615610 129627147 7 3 123117482 123119460 7 3 117793447 117805091 7 RRID:RGD_2314655 Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. 2314861 WAG/RijYcb Comparative Medicine, Yale University, Connecticut Comparative Medicine, Yale University, Connecticut inbred Unknown RRID:RGD_2314861 Substrain of WAG/Rij; from Netherlands to Yale University. 2314904 WAG-F8m1Ycb Comparative Medicine, Yale University, Connecticut Comparative Medicine, Yale University, Connecticut mutant Unknown F8m1Ycb 2314903 18 121134 162008 7 18 413447 444491 7 18 394478 394478 8 18 145719 145719 8 RRID:RGD_2314904 This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. 2314928 Slc:W Slc: Wistar SLC, Japan SLC, Japan outbred Unknown RRID:RGD_2314928 Institute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain. 2314934 WST.F344-Ker/Kyo Wistar/ST-Boo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2314934 This congenic strain was established by backcrossing F344-Ker/Kyo (NBRP No.0458) onto Slc:WST 2314935 WST.F344-Kmch/Kyo Wistar/ST-Komachi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2314935 This congenic strain was established by backcrossing F344-Kmch/Kyo (NBRP No.0458) onto Slc:WST. 2314936 WI-Tg(WSCD2)Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-24) RRID:RGD_2314936 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314937 F344.OLETF-(D5Mgh20-D5Mgh22)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 140925168 157584492 1 - by flanking markers 5 143051962 160953783 1 - by flanking markers 5 139267814 157212422 1 - by flanking markers 5 133916727 151006154 1 - by flanking markers RRID:RGD_2314937 Developed by the depositor 2316631 F344.GK-(D1Swe8-D1Gpam-1)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown Adra2a|Pdcd4|Shoc2 2056|620816|1308146 1 259866528 259866737 1 - by flanking markers 1 281763458 281763667 1 - by flanking markers 1 274353782 274353991 1 - by flanking markers 1 252645447 252645657 1 - by flanking markers RRID:RGD_2316631 This sub-congenic strain is generated from an F2- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe 2316632 NEDH/KSim New England Deaconess Hospital Simonsen Laboratories Simonsen Laboratories inbred Unknown RRID:RGD_2316632 Inbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman 2316633 F344.GK-(D1Got251-D1Gpam-1)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 260641680 260641846 1 - by flanking markers 1 282550224 282550389 1 - by flanking markers 1 275138749 275138914 1 - by flanking markers 1 253439653 253439819 1 - by flanking markers RRID:RGD_2316633 This sub-congenic strain is generated from an F2- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe 2316653 SS.LEW-(D1Mco102-D1Got46)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 38394289;2374083 38394434;2374266 1 - by flanking markers;1 - by flanking markers 1 36290530 45656739 1 - by flanking markers 1 34888392 44326906 1 - by flanking markers 1 32249735 44011366 1 - by flanking markers RRID:RGD_2316653 A sub-congenic strain derived from SS.LEW-(D1Uia8-D1Rat18)/Mco contributing to the introgressed LEW allele 2316654 SS.LEW-(D1Mco102-D1Mco129)/1Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 1 32249735 33038814 1 - by flanking markers RRID:RGD_2316654 A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2316655 SS.LEW-(D1Mco102-D1Mco129)/2Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 1 32249735 33038814 1 - by flanking markers RRID:RGD_2316655 A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2316925 SHR.BN-(D3Rat159-D3Rat1)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 119437175 170016653 1 - by flanking markers 3 130776038 180128021 1 - by flanking markers 3 124284647 176418101 1 - by flanking markers 3 118950053 168026850 1 - by flanking markers RRID:RGD_2316925 50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd 2316927 SHR.BN-(D6Rat40-D6Rat170)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 6 1301952 46792623 1 - by flanking markers 6 1111498 56881356 1 - by flanking markers 6 1120393 48179481 1 - by flanking markers 6 16536243 45547114 1 - by flanking markers RRID:RGD_2316927 45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd 2316928 SHR.BN-(D3Rat159-D3Rat1)(D6Rat40-D6Rat170)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_2316928 this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele 2317196 DA.PVG.1AV1-(D8Rat146-D8Got145) Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 73105403 91329867 1 - by flanking markers 8 76885501 93261060 1 - by flanking markers 8 74920991 93746162 1 - by flanking markers 8 69352596 87043114 1 - by flanking markers RRID:RGD_2317196 Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interest 2317197 DA.PVG.1AV1-(D8Rat41-D8Rat24) Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 50354908 82247243 1 - by flanking markers 8 50240107 84140836 1 - by flanking markers 8 51633707 84569318 1 - by flanking markers 8 47627235 78138314 1 - by flanking markers RRID:RGD_2317197 Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interest 2317201 DA.PVG.1AV1-(D8Rat24-D8Got145) Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 82246890 91329867 1 - by flanking markers 8 84140683 93261060 1 - by flanking markers 8 84569165 93746162 1 - by flanking markers 8 78138158 87043114 1 - by flanking markers RRID:RGD_2317201 DA.PVG.1AV1-(D8Rat146-D8Got145) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locus 2317278 Taiep/Dun Dept of Medical Sciences, University of Wisconsin-Madison, Madison, Wisconsin mutant Unknown RRID:RGD_2317278 These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 2317590 DA.PVG.1AV1-(D4Rat23-D4Rat108)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 82090355 1 - by flanking markers 4 58518376 148552304 1 - by flanking markers 4 83889402 83889539 1 - by flanking markers 4 82844048 82844186 1 - by flanking markers RRID:RGD_2317590 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317595 DA.PVG.1AV1-(D4Rat23-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 104416171 1 - by flanking markers 4 58518376 163844298 1 - by flanking markers 4 99066972 99067150 1 - by flanking markers 4 103194805 103194984 1 - by flanking markers RRID:RGD_2317595 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317596 DA.PVG.1AV1-(D4Rat103-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 82700691 104416171 1 - by flanking markers 4 149135946 163844298 1 - by flanking markers 4 84475257 99067150 1 - by flanking markers 4 83428419 103194984 1 - by flanking markers RRID:RGD_2317596 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317598 DA.PVG.1AV1-(D4Rat231-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 88462327 104416171 1 - by flanking markers 4 154593964 163844298 1 - by flanking markers 4 89777552 99067150 1 - by flanking markers 4 88656681 103194984 1 - by flanking markers RRID:RGD_2317598 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317599 DA.PVG.1AV1-(D4Got211-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 79604076 104416171 1 - by flanking markers 4 145804154 163844298 1 - by flanking markers 4 81136696 99067150 1 - by flanking markers 4 80445377 103194984 1 - by flanking markers RRID:RGD_2317599 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317791 DA.PVG.1AV1-(D4Got60-D4Kini1)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 80704779 81729771 1 - by flanking markers 4 147125280 148194009 1 - by flanking markers 4 83531021 83531176 1 - by flanking markers 4 82490359 82490515 1 - by flanking markers RRID:RGD_2317791 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317812 AT.ANT-(D1Uia12-D1Rat288)/Rar University of Colorado Denver, Colorado Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 1 134007903 192038535 1 - by flanking markers 1 140949643 211567839 1 - by flanking markers 1 139972085 139972231 1 - by flanking markers 1 132214399 132214546 1 - by flanking markers RRID:RRRC_00728 F2 males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were tested 2317813 AT.ANT-(D1Rat234-D1Rat47)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 158511230 1 - by flanking markers 1 172296302 172296459 1 - by flanking markers 1 166100317 166100474 1 - by flanking markers 1 155422851 155423009 1 - by flanking markers RRID:RGD_2317813 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317814 AT.ANT-(D1Rat273-D1Rat158)/Rar University of Colorado Denver, Colorado congenic Unknown 1 140644473 153578547 1 - by flanking markers 1 147436666 167535765 1 - by flanking markers 1 146507930 161321256 1 - by flanking markers 1 138344856 150700247 1 - by flanking markers RRID:RGD_2317814 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317815 AT.ANT-(D1Rat35-D1Rat47)/Rar University of Colorado Denver, Colorado congenic Unknown 1 124748920 158511230 1 - by flanking markers 1 131958920 172296459 1 - by flanking markers 1 130917121 166100474 1 - by flanking markers 1 123479780 155423009 1 - by flanking markers RRID:RGD_2317815 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317816 AT.ANT-(D1Rat234-D1Rat158)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 153578547 1 - by flanking markers 1 167535661 167535765 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 1 150700142 150700247 1 - by flanking markers RRID:RGD_2317816 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317817 AT.ANT-(D1Rat183-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 131123181 192038535 1 - by flanking markers 1 138077032 211567839 1 - by flanking markers 1 137083889 137084126 1 - by flanking markers 1 129384185 129384427 1 - by flanking markers RRID:RGD_2317817 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317818 AT.ANT-(D1Rat273-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 140644473 192038535 1 - by flanking markers 1 147436666 211567839 1 - by flanking markers 1 146507930 146508090 1 - by flanking markers 1 138344856 138345017 1 - by flanking markers RRID:RGD_2317818 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317819 AT.ANT-(D1Rat35-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 124748920 192038535 1 - by flanking markers 1 131958920 211567839 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 1 123479780 123479925 1 - by flanking markers RRID:RGD_2317819 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317820 AT.ANT-(D1Rat158-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 153578442 192038535 1 - by flanking markers 1 167535661 211567839 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 1 150700142 150700247 1 - by flanking markers RRID:RGD_2317820 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317822 AT.ANT-(D1Rat35-D1Rat38)/Rar University of Colorado Denver, Colorado congenic Unknown 1 124748920 133567105 1 - by flanking markers 1 131958920 140507239 1 - by flanking markers 1 130917121 139524104 1 - by flanking markers 1 123479780 131763614 1 - by flanking markers RRID:RGD_2317822 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317825 AT.ANT-(D1Rat234-D1Rat35)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 124749065 1 - by flanking markers 1 131958920 131959064 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 1 123479780 123479925 1 - by flanking markers RRID:RGD_2317825 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317827 AT.ANT-(D1Rat234-D1Rat38)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 133567105 1 - by flanking markers 1 140507063 140507239 1 - by flanking markers 1 139523928 139524104 1 - by flanking markers 1 131763437 131763614 1 - by flanking markers RRID:RGD_2317827 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317891 SHR-Chr 6MWF/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_2317891 SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 2324631 DA.E3-(D4Wox49-D4Got136)/Rhd Medical Inflammation Research, Karolinska Institutet, Stockholm, Sweden. congenic Unknown Clec4a3 1359528 4 159060677 160528447 1 - by flanking markers 4 222438489 223964695 1 - by flanking markers 4 155414290 156945571 1 - by flanking markers 4 155828194 157232313 1 - by flanking markers RRID:RGD_2324631 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 2325143 SHR/NHsdMco Spontaneously Hypertensive Rat University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325143 SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. 2325145 LEW/CrlMco Lewis University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325145 These were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. 2325146 MNS/NMco Milan normotensive strain University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325146 These were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. 2325202 SS/JrSeac Dahl Salt-Sensitive National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio- Hypertension RRID:RGD_2325202 Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP 2325206 LEW/Seac Seac Yoshitomi, LTD Japan inbred Unknown RRID:RGD_2325206 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan 2325209 SHRSP/Hos Sankyo Lab Service, Japan. inbred Unknown RRID:RGD_2325209 Substrain of SHRSP purchased from Sankyo Lab Service, Japan. 2325724 PVG.LEW-(D1Rat270-D1Rat68)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 130290073 193070197 1 - by flanking markers 1 136616460 212591221 1 - by flanking markers 1 135611773 205603226 1 - by flanking markers 1 128593600 188377506 1 - by flanking markers RRID:RGD_2325724 63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1 2325754 SD-Pax6Sey/Mce Department of Ophthalmology, Okayama University Medical School, Okayama, Japan mutant Unknown Pax6|Pax6Sey 3258|737688 3 91127605 91149178 7 3 102320059 102348223 7 3 95724051 95724052 8 3 92152512 92152513 8 RRID:RGD_2325754 Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. 2325773 WKY.LEW-(D13Arb15-D13Rat58)/Tja Imperial College, London, UK congenic Unknown 13 71116479 96441728 1 - by flanking markers 13 78673431 103987907 1 - by flanking markers 13 73748382 98985851 1 - by flanking markers 13 68269576 92436175 1 - by flanking markers RRID:RGD_2325773 Segment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrl 2325774 WKY.LEW-(D13Arb10-D13Arb15)(D16Rat88-D16Rat40)/Tja Imperial College, London, UK Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00707 WKY.LEW-(D13Arb10-D13Arb15) were crossed with WKY.LEW-(D16Rat88-D16Rat40), the F1 were backcrossed to WKY.LEW-(D13Arb10-D13Arb15) and then the offsprings were intercrossed 2325796 SS.LEW-(D3Rat52-D3Chm57)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 24716931 1 - by flanking markers 3 19410399 34290625 1 - by flanking markers 3 14090411 29084626 1 - by flanking markers 3 18311454 28441896 1 - by flanking markers RRID:RGD_2325796 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat130)/Ayd 2325798 SS.LEW-(D10Got112-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79857808 87834315 1 - by flanking markers 10 78816241 86759484 1 - by flanking markers 10 78970279 86962563 1 - by flanking markers 10 76246085 84007272 1 - by flanking markers RRID:RGD_2325798 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd 2325801 SS.LEW-(D16Chm36-D16Mit2)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 890512 4304517 1 - by flanking markers 16 1604056 5038806 1 - by flanking markers 16 1619835 5098704 1 - by flanking markers 16 903314 4227730 1 - by flanking markers RRID:RGD_2325801 A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd 2325803 SS.LEW-(D16Rat112-D16Chm60)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 3165043 1 - by flanking markers 16 773329 3491557 1 - by flanking markers 16 778415 3525217 1 - by flanking markers 16 110590 3080679 1 - by flanking markers RRID:RGD_2325803 A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd 4107048 SS.SR-(D7Rat16-D7Rat189)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 120385575 1 - by flanking markers 7 112143411 123228091 1 - by flanking markers 7 112204378 123243402 1 - by flanking markers 7 102920123 113526566 1 - by flanking markers RRID:RGD_4107048 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107052 SS.SR-(D7Rat16-D7Mgh5)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 115820414 1 - by flanking markers 7 112143411 119125830 1 - by flanking markers 7 112204378 119131068 1 - by flanking markers 7 102920123 109483487 1 - by flanking markers RRID:RGD_4107052 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107055 SS.SR-(D7Rat16-D7Rat176)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 111200952 1 - by flanking markers 7 112143411 114641749 1 - by flanking markers 7 112204378 114708307 1 - by flanking markers 7 102920123 105399458 1 - by flanking markers RRID:RGD_4107055 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107057 SS.SR-(D7Mco7-D7Rat81)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112979256 129500555 1 - by flanking markers 7 116059683 131926277 1 - by flanking markers 7 132252091 132252361 1 - by flanking markers 7 122220558 122220831 1 - by flanking markers RRID:RGD_4107057 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107063 SS.LEW-(D1Uia8-D1Rat124)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown RRID:RGD_4107063 A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele 4107065 SS.LEW-(D1Uia8-D1Rat213)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 81548753 81548909 1 - by flanking markers 1 84537073 84537228 1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 1 81777564 81777720 1 - by flanking markers RRID:RGD_4107065 A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele 4139872 SS-Nckap5em2Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5em2Mcwi 4139862 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139872 This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6. 4139873 SS-Rag1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag1em2Mcwi 4139866 3 86780782 86791878 7 3 97866048 97877145 7 3 91212228 91212244 8 3 87922895 87922911 8 RRID:RGD_4139873 This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1. 4139874 SS-Ets1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ets1em1Mcwi 4139856 8 32481694 32545237 7 8 33798598 33921593 7 8 33851478 33851485 8 8 31045909 31168010 7 RRID:RGD_4139874 This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3. 4139875 FHH-Chr 1BN-Sorcs1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs1em1Mcwi 4139864 1 255767411 256279565 7 1 277404996 277912261 7 1 269965824 270473097 7 1 249207764 249207777 8 RRID:RGD_4139875 This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20. 4139876 SS-Mmp2em1Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Mmp2em1Mcwi 4139860 19 15246036 15275061 7 19 26629728 26658966 7 19 15542771 15570589 7 19 14154657 14182870 7 RRID:RGD_4139876 This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. 4139877 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rab38em1Mcwi 4139867 1 144783919 144864573 7 1 158385888 158466621 7 1 152072716 152153449 7 1 142182566 142262923 7 RRID:RGD_4139877 This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1. 4139878 SS-Mmp2em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Mmp2em2Mcwi 4139869 19 15246036 15275061 7 19 26646695 26646702 8 19 15542771 15570589 7 19 14154657 14182870 7 RRID:RGD_4139878 This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7. 4139879 SS-Nckap5em1Mcwi PhysGen Knockouts mutant Extinct Nckap5em1Mcwi 4139859 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139879 This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. 4139880 SS-Renem1Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Renem1Mcwi 4139863 13 46262936 46275213 7 13 55555583 55566812 7 13 50502724 50513953 7 13 44803412 44803421 8 RRID:RGD_4139880 This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. 4139881 SS-Nckap5em3Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5em3Mcwi 4139861 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139881 This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. 4139882 SS-Nppaem4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Nppaem4Mcwi 4139857 5 165074518 165075827 7 5 168466309 168467618 7 5 164808762 164808783 8 5 158429042 158430351 7 RRID:RGD_4139882 This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2. 4139883 SS-Nox4em2Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Nox4em2Mcwi 4139868 1 143415816 143603554 7 1 157106652 157285107 7 1 150861996 150862003 8 1 140900886 141078844 7 RRID:RGD_4139883 This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. 4139884 SS-Rag1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag1em1Mcwi 4139865 3 86780782 86791878 7 3 97866048 97877145 7 3 91212237 91212249 8 3 87922904 87922916 8 RRID:RGD_4139884 This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1. 4139885 SS-Sh2b3em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em1Mcwi 4139858 12 35954679 35958446 7 12 42132947 42136714 7 12 40262913 40262918 8 12 34750772 34750777 8 RRID:RGD_4139885 This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. 4139889 BHD/Dspe Birt-Hogg-Dube rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2018-06-06) Flcn 735088 RRID:RGD_4139889 A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. 4139890 TT/Sgn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Fkbp6 1308926 12 22474002 22544784 7 12 26363264 26435311 7 12 24365941 24438088 7 12 21318251 21390350 7 RRID:RGD_4139890 Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats. 4139891 F344-Chr 3SDT/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_4139891 This consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background. 4139892 ALD/Hyo acid lipase deficiency rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Metabolism Lipam1Hyo 150519893 RRID:RGD_4139892 In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. 4140402 W-Tg(Gh1as)Nibs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_4140402 The construct which contains of rat growth hormone (Gh1) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat Gh1 cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science. 4140403 SD-Tg(Eno2-ATXN3*64Q)29Kakiz National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140403 Background strain is Slc:SD. 4140404 ODS-Gulood/od/ShiJcl Osteogenic disorder Shionagi rat CLEA Japan, Inc CLEA Japan, Inc inbred Live Animals (as of 2021-04-29) Gulood 126848761 RRID:RGD_4140404 Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. 4140405 LEXF6A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140405 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140406 SHRSP.WKY-(D1Wox29-D1Arb21)/IzmDmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_4140406 To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. 4140407 SDT.BN-Gluco13/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4140407 The Gluco13 (Gisdt1) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-Gluco14/Nyo (NBRP No. 0602). 4140408 LEXF8C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140408 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140409 COP-Chr 16DA/McoRrrc University of Toledo College of Medicine, Toledo, Ohio consomic Unknown RRID:RGD_4140409 Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background 4140410 SD-Tg(Eno2-ATXN3*64Q)16Kakiz National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140410 Background strain is Slc:SD. 4140411 SDT.BN-Gluco14/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4140411 The Gluco14 (Gisdt2) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN- Gluco13/Nyo (NBRP No. 0601). 4140412 LEXF1D/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140412 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140413 LEXF1B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140413 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140414 WKY.SHRSP-(D1Wox29-D1Arb21)/IzmDmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_4140414 To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. 4140415 TRMRC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Sperm RRID:RGD_4140415 The coisogenic control strain for the TRMR strain (NBRP No.0016). 4140416 SD-Tg(Eno2-Vcp)16Kakiz National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140416 This transgenic strain was generated by microinjection into Slc:SD fertilized eggs. 4140469 F344-Kmch/NSlc Komachi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown RRID:RGD_4140469 from NBRP 4142540 SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 26280781 47890193 1 - by flanking markers 4 26659360 48448808 1 - by flanking markers 4 26753655 48656399 1 - by flanking markers 4 29593287 50119996 1 - by flanking markers RRID:RGD_4142540 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142541 W-Tg(Tek-GFP)1Soh National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_4142541 This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion. 4142542 BN.SDT-Gluco14/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4142542 The Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo. 4142543 BN.SDT-Gluco13/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4142543 The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo. 4142544 WKY/Kiha National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) RRID:RGD_4142544 A WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University. 4142545 SHR.WKY-(D3Rat108-D3Rat166)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 3 59676608 101359980 1 - by flanking markers 3 70419858 113470358 1 - by flanking markers 3 63849481 106900596 1 - by flanking markers 3 61934079 102200699 1 - by flanking markers RRID:RGD_4142545 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142546 AMI/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Dentistry RRID:RGD_4142546 Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. 4142547 SHR.WKY-(D4Wox27-D4Rat11)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 33407710 1 - by flanking markers 4 3096322 34240072 1 - by flanking markers 4 3044017 34379894 1 - by flanking markers 4 5218294 36405277 1 - by flanking markers RRID:RGD_4142547 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142548 SHR.WKY-(D4Wox27-D4Rat10)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 26280949 1 - by flanking markers 4 3096322 26659527 1 - by flanking markers 4 3044017 26753822 1 - by flanking markers 4 5218294 29593455 1 - by flanking markers RRID:RGD_4142548 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142549 SHR.WKY-(D4Wox27-D4Rat4)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 3237361 1 - by flanking markers 4 3096322 4400584 1 - by flanking markers 4 3044017 4364885 1 - by flanking markers 4 5218294 7935781 1 - by flanking markers RRID:RGD_4142549 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142550 SHR.WKY-(D4Rat101-D4Rat15)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 46605924 47890193 1 - by flanking markers 4 46704280 48448808 1 - by flanking markers 4 46898276 48656399 1 - by flanking markers 4 49131906 50119996 1 - by flanking markers RRID:RGD_4142550 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142799 LEW.SS-(D2Uia5-D2Rat143)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 2 13909383 106236206 1 - by flanking markers 2 13186164 125885146 1 - by flanking markers 2 13328947 106156987 1 - by flanking markers 2 15575840 103519040 1 - by flanking markers RRID:RGD_4142799 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain 4142800 LEW.SS-(D18Chm31-D18Mit8)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 18 59796478 59796643 1 - by flanking markers RRID:RGD_4142800 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain 4143165 SD-Tg(Aqp5-GFP)ZboroRrrc Aqp5EGFP Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Aqp5 2144 RRID:RRRC_00427 This rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained. 4143456 BN.GK-(D2Wox30-D2Wox68)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown RRID:RGD_4143456 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4143457 BN.GK-(D2Rat40-D2Wox35)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 163154358 1 - by flanking markers 2 189197858 189197988 1 - by flanking markers 2 169852670 244719662 1 - by flanking markers 2 157142078 157142209 1 - by flanking markers RRID:RGD_4143457 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4143458 BN.GK-(D2Wox49-D2Rat70)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 191000085 254933362 1 - by flanking markers 2 217822782 281850471 1 - by flanking markers 2 198335799 263179188 1 - by flanking markers 2 183756199 245889826 1 - by flanking markers RRID:RGD_4143458 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4143459 BN.GK-(D2Rat40-D2Got149)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 222343164 1 - by flanking markers 2 189197858 248391122 1 - by flanking markers 2 169852670 229036415 1 - by flanking markers 2 157142078 213653017 1 - by flanking markers RRID:RGD_4143459 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4145088 SS.BN-(D6Rat119-D6Arb3)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 111239053 138260635 1 - by flanking markers 6 120420333 147057860 1 - by flanking markers 6 111134524 138065254 1 - by flanking markers 6 106752656 132339866 1 - by flanking markers RRID:RGD_4145088 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145089 SS.BN-(D6Rat149-D6Rat18)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 93374504 1 - by flanking markers 6 6959479 103168177 1 - by flanking markers 6 7009971 93706327 1 - by flanking markers 6 10894415 89763029 1 - by flanking markers RRID:RGD_4145089 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145090 SS.BN-(D6Rat149-D6Got171)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 123782965 1 - by flanking markers 6 6959479 132827005 1 - by flanking markers 6 7009971 123598338 1 - by flanking markers 6 10894415 118863044 1 - by flanking markers RRID:RGD_4145090 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145091 SS.BN-(D6Rat149-D6Arb3)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 138260635 1 - by flanking markers 6 6959479 147057860 1 - by flanking markers 6 7009971 138065254 1 - by flanking markers 6 10894415 132339866 1 - by flanking markers RRID:RGD_4145091 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145374 ACI.FHH-(D1Mit18-D1Rat90)(D14Rat98-D14Hmgc18)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_4145374 Congenic strain developed by crossing ACI.FHH-(D1Rat74-D1Rat90)/Eur (Rf-1a) males to ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi (Rf-1a+4) double congenic females 4889411 SHRSP.WKY-(D1Smu13-D1Wox33)/Izm Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio- Hypertension 1;2 160754901;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 2;1 224991853;173074640 224991955;174300801 1 - by flanking markers;1 - by flanking markers 1 166884926 166885141 1 - by flanking markers 1 156170341 156170557 1 - by flanking markers RRID:RGD_4889411 About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(D1Smu13-D1Arb21)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain 4889414 WKY.SHRSP-(D1Rat171-D1Wox33)/Izm Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1;2 158964262;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 1;2 172767534;224991853 174300801;224991955 1 - by flanking markers;1 - by flanking markers 1 166577232 166577467 1 - by flanking markers 1 155866514 155866750 1 - by flanking markers RRID:RGD_4889414 About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(D1Smu13-D1Smu11)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain 4889450 DA.PVG.1AV1-(D1Rat248-D1Rat10)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 6253932 25271177 1 - by flanking markers 1 7306802 86917075 1 - by flanking markers 1 5655772 85706974 1 - by flanking markers 1 5925877 24697545 1 - by flanking markers RRID:RGD_4889450 DA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb) 4889464 GK/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK inbred Unknown RRID:RGD_4889464 Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK 4889499 CDS-Chr 4CDR/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889499 Homozygous male CDS/Ygl were bred with CDR/Ygl females; F1 heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixed 4889817 SBN-Chr 1SBH/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889817 Homozygous male SBN/Ygl were bred with SBH/Ygl females; F1 heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed 4889820 SBH-Chr 1SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889820 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889822 SBN-Chr 17SBH/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889822 Homozygous male SBN/Ygl were bred with SBH/Ygl females; F1 heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed 4889875 SBH-Chr 2SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889875 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889877 SBH-Chr 20SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889877 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889879 SBH-Chr XSBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889879 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889882 SBH-Chr 17SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889882 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889890 DA.PVG.1AV1-(D17Rat8-D17Rat37)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Immunology 17 27618789 75802944 1 - by flanking markers 17 25486196 69844594 1 - by flanking markers 17 23522321 68114865 1 - by flanking markers 17 21782841 64759263 1 - by flanking markers RRID:RGD_4889890 DA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37 4891048 SS.LEW-(D7Rat73-D7Rat128)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 7 53612714 114528048 1 - by flanking markers RRID:RGD_4891048 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 4891051 LEW.SS-(D7Rat73-D7Rat128)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 7 53612714 114528048 1 - by flanking markers RRID:RGD_4891051 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 4891103 WMI/EerRrrc WKY most immobile Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois Rat Resource and Research Center inbred Unknown RRID:RRRC_00973 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. 4891107 WLI/EerRrrc WKY least immobile Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois Rat Resource and Research Center inbred Unknown RRID:RRRC_00967 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. 4891165 Wig/Ymas wiggling Human Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan congenic Unknown RRID:RGD_4891165 These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain 4891380 SS.SR-(D9Mco95-D9Mco98)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 80946065 1 - by flanking markers 9 81100315 81180041 1 - by flanking markers 9 75403227 75482161 1 - by flanking markers RRID:RGD_4891380 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891383 SS.SR-(D9Mco98-Resp18)/1Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 9 75481963 76771824 1 - by flanking markers RRID:RGD_4891383 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891386 SS.SR-(D9Mco98-Resp18)/2Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 9 75481963 76771824 1 - by flanking markers RRID:RGD_4891386 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891388 SS.SR-(D9Mco95-D9Mco100)/1Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 9 75403227 75990271 1 - by flanking markers RRID:RGD_4891388 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891390 SS.SR-(D9Mco95-D9Mco100)/2Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 9 75403227 75990271 1 - by flanking markers RRID:RGD_4891390 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891392 SS.SR-(D9Mco95-D9Mco102)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81641213 1 - by flanking markers 9 81100315 81878831 1 - by flanking markers 9 75403227 76175576 1 - by flanking markers RRID:RGD_4891392 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891394 SS.SR-(D9Mco101-Resp18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 81611825 82246695 1 - by flanking markers 9 81847677 82477136 1 - by flanking markers 9 76145766 76771824 1 - by flanking markers RRID:RGD_4891394 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891396 SS.SR-(D9Mco72-Resp18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 44842118 74558151 1 - by flanking markers 9 52352690 82246695 1 - by flanking markers 9 52686874 82477136 1 - by flanking markers 9 47902208 76771824 1 - by flanking markers RRID:RGD_4891396 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891400 SS.SR-(D9Mco14-Resp18)/1Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891400 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891402 SS.SR-(D9Mco14-Resp18)/2Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891402 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891404 SS.SR-(D9Mco14-Resp18)/3Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891404 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4892563 WF.WKY-(D5Rat26-D5Uwm42)/Uwm University of Wisconsin-Madison congenic Unknown 5 119332868 153554465 1 - by flanking markers 5 121495621 156871691 1 - by flanking markers 5 117554114 153097789 1 - by flanking markers 5 113558156 146996127 1 - by flanking markers RRID:RGD_4892563 WKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region. 5130721 HXB1/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5130721 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131094 BN-Lx/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California mutant Unknown RRID:RGD_5131094 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131095 BXH13/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131095 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131097 BXH12/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131097 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131099 BXH11/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131099 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131101 BXH10/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131101 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131104 BXH9/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131104 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131106 BXH8/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131106 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131108 BXH6/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131108 Embryo-rederived from breeder stock BXH6/Cub provided by Dr. Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131110 BXH5/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131110 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131113 HXB31/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131113 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131115 HXB29/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131115 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131118 HXB27/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131118 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131120 HXB26/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131120 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131122 HXB25/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131122 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131124 HXB23/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131124 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131126 HXB20/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131126 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131128 HXB17/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131128 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131130 HXB15/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131130 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by