MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-02-07, 01:10 CST based on data in: /scratch/g/akwitek/wdemos/Dwinell_GRCr8

General Statistics

Showing ³⁸⁴/₃₈₄ rows and ⁶/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
167_1GM	93.8%
167_1GM_1				73.4%	49%	99 bp	100 bp	27%	40.2
167_1GM_2				69.7%	49%	99 bp	100 bp	18%	40.2
167_1GM_STAR		91.9%	37.0
167_1LRFP	93.3%
167_1LRFP_1				72.2%	48%	99 bp	100 bp	18%	38.0
167_1LRFP_2				68.3%	49%	99 bp	100 bp	9%	38.0
167_1LRFP_STAR		90.1%	34.2
167_1THY	92.9%
167_1THY_1				63.6%	48%	99 bp	100 bp	18%	42.6
167_1THY_2				58.9%	48%	99 bp	100 bp	9%	42.6
167_1THY_STAR		90.0%	38.3
167_2GM	92.1%
167_2GM_1				79.3%	50%	99 bp	100 bp	27%	51.4
167_2GM_2				74.3%	50%	99 bp	100 bp	18%	51.4
167_2GM_STAR		90.3%	46.5
167_2LRFP	94.0%
167_2LRFP_1				69.4%	49%	99 bp	100 bp	18%	34.2
167_2LRFP_2				66.5%	49%	99 bp	100 bp	9%	34.2
167_2LRFP_STAR		91.3%	31.2
167_2THY	93.6%
167_2THY_1				62.2%	48%	99 bp	100 bp	18%	45.8
167_2THY_2				58.9%	48%	99 bp	100 bp	9%	45.8
167_2THY_STAR		90.7%	41.5
237_5GM	88.7%
237_5GM_1				69.4%	49%	99 bp	100 bp	27%	34.1
237_5GM_2				63.6%	48%	99 bp	100 bp	18%	34.1
237_5GM_STAR		87.3%	29.8
237_5LRFP	94.3%
237_5LRFP_1				67.0%	48%	99 bp	100 bp	18%	40.6
237_5LRFP_2				63.7%	48%	99 bp	100 bp	9%	40.6
237_5LRFP_STAR		92.5%	37.6
237_5THY	94.2%
237_5THY_1				58.2%	47%	99 bp	100 bp	18%	45.1
237_5THY_2				54.7%	47%	99 bp	100 bp	9%	45.1
237_5THY_STAR		91.9%	41.4
237_6GM	93.9%
237_6GM_1				76.0%	49%	99 bp	100 bp	27%	43.7
237_6GM_2				73.5%	49%	99 bp	100 bp	18%	43.7
237_6GM_STAR		92.0%	40.2
237_6LRFP	92.2%
237_6LRFP_1				67.3%	48%	99 bp	100 bp	18%	43.6
237_6LRFP_2				63.9%	48%	99 bp	100 bp	9%	43.6
237_6LRFP_STAR		90.5%	39.4
237_6THY	93.8%
237_6THY_1				54.8%	48%	99 bp	100 bp	18%	44.8
237_6THY_2				51.9%	48%	99 bp	100 bp	9%	44.8
237_6THY_STAR		91.2%	40.9
263_1GM	94.5%
263_1GM_1				77.9%	50%	99 bp	100 bp	27%	60.7
263_1GM_2				76.0%	50%	99 bp	100 bp	18%	60.7
263_1GM_STAR		92.7%	56.3
263_1LK	94.2%
263_1LK_1				73.4%	48%	99 bp	100 bp	18%	58.1
263_1LK_2				71.3%	48%	99 bp	100 bp	9%	58.1
263_1LK_STAR		92.2%	53.5
263_1THY	93.3%
263_1THY_1				65.8%	49%	99 bp	100 bp	18%	58.5
263_1THY_2				63.5%	49%	99 bp	100 bp	9%	58.5
263_1THY_STAR		90.4%	52.9
263_2GM	93.6%
263_2GM_1				77.0%	51%	99 bp	100 bp	18%	53.8
263_2GM_2				74.9%	51%	99 bp	100 bp	9%	53.8
263_2GM_STAR		91.9%	49.4
263_2LK	82.2%
263_2LK_1				70.3%	48%	99 bp	100 bp	18%	42.3
263_2LK_2				62.4%	47%	99 bp	100 bp	18%	42.3
263_2LK_STAR		79.7%	33.7
263_2THY	95.8%
263_2THY_1				63.1%	49%	99 bp	100 bp	18%	54.4
263_2THY_2				61.4%	49%	99 bp	100 bp	9%	54.4
263_2THY_STAR		93.2%	50.7
263_3GM	92.4%
263_3GM_1				76.2%	51%	99 bp	100 bp	18%	45.1
263_3GM_2				72.8%	50%	99 bp	100 bp	18%	45.1
263_3GM_STAR		90.9%	41.0
263_3LK	92.4%
263_3LK_1				70.9%	48%	99 bp	100 bp	18%	38.3
263_3LK_2				67.5%	48%	99 bp	100 bp	9%	38.3
263_3LK_STAR		90.4%	34.6
263_3THY	89.1%
263_3THY_1				66.4%	49%	99 bp	100 bp	18%	49.4
263_3THY_2				62.3%	49%	99 bp	100 bp	9%	49.4
263_3THY_STAR		86.8%	42.8
265_1GM	92.4%
265_1GM_1				75.6%	49%	99 bp	100 bp	27%	47.7
265_1GM_2				71.9%	49%	99 bp	100 bp	18%	47.7
265_1GM_STAR		90.5%	43.1
265_1LK	95.2%
265_1LK_1				74.3%	48%	99 bp	100 bp	18%	49.8
265_1LK_2				71.7%	48%	99 bp	100 bp	9%	49.8
265_1LK_STAR		91.6%	45.6
265_1THY	92.1%
265_1THY_1				60.9%	48%	99 bp	100 bp	18%	49.5
265_1THY_2				57.5%	48%	99 bp	100 bp	9%	49.5
265_1THY_STAR		90.3%	44.7
265_2GM	93.8%
265_2GM_1				72.1%	50%	99 bp	100 bp	27%	25.3
265_2GM_2				69.3%	50%	99 bp	100 bp	18%	25.3
265_2GM_STAR		91.9%	23.2
265_2LK	93.8%
265_2LK_1				71.9%	48%	99 bp	100 bp	18%	47.9
265_2LK_2				69.2%	48%	99 bp	100 bp	9%	47.9
265_2LK_STAR		90.7%	43.5
265_2THY	93.4%
265_2THY_1				65.3%	49%	99 bp	100 bp	18%	54.3
265_2THY_2				62.8%	49%	99 bp	100 bp	9%	54.3
265_2THY_STAR		90.1%	49.0
265_3GM	93.4%
265_3GM_1				79.4%	51%	99 bp	100 bp	18%	59.8
265_3GM_2				76.8%	51%	99 bp	100 bp	9%	59.8
265_3GM_STAR		91.7%	54.8
265_3LK	91.1%
265_3LK_1				71.9%	47%	99 bp	100 bp	18%	46.2
265_3LK_2				67.4%	47%	99 bp	100 bp	9%	46.2
265_3LK_STAR		88.4%	40.9
265_3THY	91.8%
265_3THY_1				65.8%	49%	99 bp	100 bp	18%	69.1
265_3THY_2				61.6%	49%	99 bp	100 bp	18%	69.1
265_3THY_STAR		90.2%	62.3
265_4GM	95.4%
265_4GM_1				77.6%	50%	99 bp	100 bp	18%	64.2
265_4GM_2				76.1%	50%	99 bp	100 bp	18%	64.2
265_4GM_STAR		93.4%	60.0
265_4LK	95.0%
265_4LK_1				72.9%	48%	99 bp	100 bp	18%	50.3
265_4LK_2				70.5%	48%	99 bp	100 bp	9%	50.3
265_4LK_STAR		91.8%	46.2
265_4THY	94.9%
265_4THY_1				58.0%	49%	99 bp	100 bp	18%	28.3
265_4THY_2				55.1%	49%	99 bp	100 bp	9%	28.3
265_4THY_STAR		92.0%	26.1
346_2GM	91.5%
346_2GM_1				77.5%	50%	99 bp	100 bp	27%	44.6
346_2GM_2				72.6%	50%	99 bp	100 bp	18%	44.6
346_2GM_STAR		88.9%	39.6
346_2LRFP	88.2%
346_2LRFP_1				70.6%	48%	99 bp	100 bp	18%	43.0
346_2LRFP_2				63.7%	48%	99 bp	100 bp	9%	43.0
346_2LRFP_STAR		84.7%	36.4
346_2THY	92.2%
346_2THY_1				57.9%	48%	99 bp	100 bp	18%	40.7
346_2THY_2				54.0%	48%	99 bp	100 bp	9%	40.7
346_2THY_STAR		89.7%	36.5
346_3GM	93.4%
346_3GM_1				73.5%	49%	99 bp	100 bp	27%	47.7
346_3GM_2				69.8%	49%	99 bp	100 bp	18%	47.7
346_3GM_STAR		91.1%	43.5
346_3LRFP	90.0%
346_3LRFP_1				68.9%	48%	99 bp	100 bp	18%	39.0
346_3LRFP_2				63.1%	48%	99 bp	100 bp	9%	39.0
346_3LRFP_STAR		87.2%	34.0
346_3THY	86.4%
346_3THY_1				58.9%	48%	99 bp	100 bp	18%	39.8
346_3THY_2				53.4%	48%	99 bp	100 bp	9%	39.8
346_3THY_STAR		84.6%	33.7
346_4GM	84.9%
346_4GM_1				74.4%	49%	99 bp	100 bp	27%	40.9
346_4GM_2				65.4%	49%	99 bp	100 bp	18%	40.9
346_4GM_STAR		83.7%	34.2
346_4LRFP	91.0%
346_4LRFP_1				69.0%	48%	99 bp	100 bp	18%	40.9
346_4LRFP_2				63.4%	47%	99 bp	100 bp	9%	40.9
346_4LRFP_STAR		88.0%	35.9
346_4THY	84.1%
346_4THY_1				58.2%	48%	99 bp	100 bp	18%	40.2
346_4THY_2				51.9%	48%	99 bp	100 bp	18%	40.2
346_4THY_STAR		83.8%	33.7
346_5GM	93.3%
346_5GM_1				70.6%	49%	99 bp	100 bp	18%	44.1
346_5GM_2				66.8%	49%	99 bp	100 bp	18%	44.1
346_5GM_STAR		91.3%	40.3
346_5LRFP	95.0%
346_5LRFP_1				68.4%	49%	99 bp	100 bp	18%	37.8
346_5LRFP_2				66.3%	48%	99 bp	100 bp	9%	37.8
346_5LRFP_STAR		92.9%	35.1
346_5THY	91.5%
346_5THY_1				60.1%	48%	99 bp	100 bp	18%	44.4
346_5THY_2				56.1%	48%	99 bp	100 bp	9%	44.4
346_5THY_STAR		89.1%	39.6
346_6GM	91.0%
346_6GM_1				74.5%	49%	99 bp	100 bp	27%	39.1
346_6GM_2				69.4%	49%	99 bp	100 bp	18%	39.1
346_6GM_STAR		88.9%	34.8
346_6LRFP	91.1%
346_6LRFP_1				69.4%	48%	99 bp	100 bp	18%	35.4
346_6LRFP_2				64.2%	48%	99 bp	100 bp	9%	35.4
346_6LRFP_STAR		88.3%	31.3
346_6THY	91.5%
346_6THY_1				64.7%	48%	99 bp	100 bp	18%	42.8
346_6THY_2				60.6%	48%	99 bp	100 bp	9%	42.8
346_6THY_STAR		88.2%	37.8
384_1GM	94.1%
384_1GM_1				77.0%	50%	99 bp	100 bp	27%	43.3
384_1GM_2				73.9%	50%	99 bp	100 bp	18%	43.3
384_1GM_STAR		91.9%	39.7
384_1LRFP	86.1%
384_1LRFP_1				67.5%	48%	99 bp	100 bp	18%	33.3
384_1LRFP_2				59.6%	47%	99 bp	100 bp	9%	33.3
384_1LRFP_STAR		85.2%	28.4
384_1THY	86.6%
384_1THY_1				73.9%	48%	99 bp	100 bp	18%	44.6
384_1THY_2				66.6%	47%	99 bp	100 bp	9%	44.6
384_1THY_STAR		85.6%	38.2
394_3GM	95.3%
394_3GM_1				78.7%	50%	99 bp	100 bp	27%	46.2
394_3GM_2				75.0%	50%	99 bp	100 bp	18%	46.2
394_3GM_STAR		92.2%	42.6
394_3LRFP	87.8%
394_3LRFP_1				73.3%	48%	99 bp	100 bp	18%	41.1
394_3LRFP_2				66.0%	47%	99 bp	100 bp	9%	41.1
394_3LRFP_STAR		85.3%	35.0
394_3THY	94.9%
394_3THY_1				59.5%	48%	99 bp	100 bp	18%	37.5
394_3THY_2				56.4%	48%	99 bp	100 bp	9%	37.5
394_3THY_STAR		92.0%	34.5
394_4GM	95.7%
394_4GM_1				72.4%	50%	99 bp	100 bp	27%	32.0
394_4GM_2				70.3%	50%	99 bp	100 bp	18%	32.0
394_4GM_STAR		93.0%	29.8
394_4LRFP	95.6%
394_4LRFP_1				71.4%	48%	99 bp	100 bp	18%	43.0
394_4LRFP_2				68.3%	49%	99 bp	100 bp	9%	43.0
394_4LRFP_STAR		93.3%	40.1
394_4THY	94.3%
394_4THY_1				60.8%	48%	99 bp	100 bp	18%	48.7
394_4THY_2				58.1%	48%	99 bp	100 bp	9%	48.7
394_4THY_STAR		91.6%	44.6
394_5GM	94.5%
394_5GM_1				81.2%	50%	99 bp	100 bp	18%	44.8
394_5GM_2				77.8%	50%	99 bp	100 bp	18%	44.8
394_5GM_STAR		90.1%	40.4
394_5LRFP	94.7%
394_5LRFP_1				75.0%	48%	99 bp	100 bp	18%	46.7
394_5LRFP_2				72.1%	48%	99 bp	100 bp	9%	46.7
394_5LRFP_STAR		91.8%	42.9
394_5THY	95.3%
394_5THY_1				67.2%	49%	99 bp	100 bp	18%	47.6
394_5THY_2				64.5%	49%	99 bp	100 bp	9%	47.6
394_5THY_STAR		89.1%	42.4
394_6GM	97.2%
394_6GM_1				74.1%	50%	99 bp	100 bp	27%	39.0
394_6GM_2				72.6%	50%	99 bp	100 bp	18%	39.0
394_6GM_STAR		94.7%	37.0
394_6LRFP	96.7%
394_6LRFP_1				69.6%	48%	99 bp	100 bp	18%	33.4
394_6LRFP_2				67.1%	48%	99 bp	100 bp	9%	33.4
394_6LRFP_STAR		92.8%	31.0
394_6THY	96.3%
394_6THY_1				61.2%	48%	99 bp	100 bp	18%	44.6
394_6THY_2				58.6%	48%	99 bp	100 bp	9%	44.6
394_6THY_STAR		93.2%	41.5
394_7GM	96.0%
394_7GM_1				73.3%	50%	99 bp	100 bp	18%	40.4
394_7GM_2				70.9%	50%	99 bp	100 bp	18%	40.4
394_7GM_STAR		93.6%	37.8
394_7LRFP	95.7%
394_7LRFP_1				71.6%	49%	99 bp	100 bp	18%	40.0
394_7LRFP_2				69.6%	49%	99 bp	100 bp	9%	40.0
394_7LRFP_STAR		91.6%	36.6
394_7THY	94.2%
394_7THY_1				60.5%	49%	99 bp	100 bp	18%	44.4
394_7THY_2				57.7%	49%	99 bp	100 bp	9%	44.4
394_7THY_STAR		91.4%	40.5
394_8GM	94.6%
394_8GM_1				76.1%	50%	99 bp	100 bp	18%	47.7
394_8GM_2				72.8%	50%	99 bp	100 bp	18%	47.7
394_8GM_STAR		92.5%	44.1
394_8LRFP	93.4%
394_8LRFP_1				81.0%	48%	99 bp	100 bp	18%	48.2
394_8LRFP_2				77.0%	48%	99 bp	100 bp	9%	48.2
394_8LRFP_STAR		88.1%	42.5
394_8THY	93.4%
394_8THY_1				62.4%	48%	99 bp	100 bp	18%	36.5
394_8THY_2				56.7%	49%	99 bp	100 bp	9%	36.5
394_8THY_STAR		90.4%	33.0
510_1GM	96.2%
510_1GM_1				75.9%	50%	99 bp	100 bp	18%	50.7
510_1GM_2				74.4%	50%	99 bp	100 bp	9%	50.7
510_1GM_STAR		93.3%	47.3
510_1LK	96.8%
510_1LK_1				72.1%	48%	99 bp	100 bp	18%	45.7
510_1LK_2				70.9%	48%	99 bp	100 bp	9%	45.7
510_1LK_STAR		93.2%	42.6
510_1THY	95.6%
510_1THY_1				66.9%	49%	99 bp	100 bp	18%	60.9
510_1THY_2				65.1%	49%	99 bp	100 bp	9%	60.9
510_1THY_STAR		92.1%	56.1
510_2GM	91.0%
510_2GM_1				75.5%	51%	99 bp	100 bp	18%	39.4
510_2GM_2				72.7%	51%	99 bp	100 bp	18%	39.4
510_2GM_STAR		88.8%	35.0
510_2LK	93.6%
510_2LK_1				72.9%	48%	99 bp	100 bp	18%	45.4
510_2LK_2				70.6%	48%	99 bp	100 bp	9%	45.4
510_2LK_STAR		90.3%	41.0
510_2THY	92.6%
510_2THY_1				62.1%	49%	99 bp	100 bp	18%	40.5
510_2THY_2				59.1%	49%	99 bp	100 bp	9%	40.5
510_2THY_STAR		89.8%	36.3
510_3GM	93.4%
510_3GM_1				74.4%	50%	99 bp	100 bp	18%	37.8
510_3GM_2				71.7%	50%	99 bp	100 bp	18%	37.8
510_3GM_STAR		91.2%	34.5
510_3LK	92.6%
510_3LK_1				78.0%	49%	99 bp	100 bp	18%	40.0
510_3LK_2				73.7%	49%	99 bp	100 bp	9%	40.0
510_3LK_STAR		88.6%	35.4
510_3THY	95.1%
510_3THY_1				67.6%	49%	99 bp	100 bp	18%	44.8
510_3THY_2				65.3%	49%	99 bp	100 bp	9%	44.8
510_3THY_STAR		90.7%	40.6
510_4GM	94.2%
510_4GM_1				76.2%	50%	99 bp	100 bp	18%	49.3
510_4GM_2				73.3%	50%	99 bp	100 bp	9%	49.3
510_4GM_STAR		91.9%	45.3
510_4LK	94.7%
510_4LK_1				70.9%	48%	99 bp	100 bp	18%	53.4
510_4LK_2				68.7%	48%	99 bp	100 bp	9%	53.4
510_4LK_STAR		92.4%	49.4
510_4THY	93.7%
510_4THY_1				65.4%	49%	99 bp	100 bp	18%	45.9
510_4THY_2				63.3%	49%	99 bp	100 bp	9%	45.9
510_4THY_STAR		90.3%	41.4
510_5GM	90.2%
510_5GM_1				82.0%	51%	99 bp	100 bp	27%	40.4
510_5GM_2				77.9%	50%	99 bp	100 bp	18%	40.4
510_5GM_STAR		87.9%	35.5
510_5LK	92.0%
510_5LK_1				70.5%	48%	99 bp	100 bp	18%	45.0
510_5LK_2				67.8%	48%	99 bp	100 bp	9%	45.0
510_5LK_STAR		89.2%	40.2
510_5THY	90.7%
510_5THY_1				62.5%	49%	99 bp	100 bp	18%	26.1
510_5THY_2				58.4%	49%	99 bp	100 bp	9%	26.1
510_5THY_STAR		87.4%	22.8
510_6GM	88.8%
510_6GM_1				79.4%	51%	99 bp	100 bp	18%	43.6
510_6GM_2				74.7%	51%	99 bp	100 bp	27%	43.6
510_6GM_STAR		85.8%	37.4
510_6LK	95.1%
510_6LK_1				75.4%	47%	99 bp	100 bp	18%	78.9
510_6LK_2				73.1%	47%	99 bp	100 bp	9%	78.9
510_6LK_STAR		92.7%	73.2
510_6THY	94.0%
510_6THY_1				60.8%	49%	99 bp	100 bp	18%	30.9
510_6THY_2				58.4%	50%	99 bp	100 bp	9%	30.9
510_6THY_STAR		90.3%	27.9
510_7GM	92.8%
510_7GM_1				79.5%	50%	99 bp	100 bp	18%	61.4
510_7GM_2				76.4%	50%	99 bp	100 bp	18%	61.4
510_7GM_STAR		90.9%	55.8
510_7LK	94.1%
510_7LK_1				63.8%	48%	99 bp	100 bp	18%	25.5
510_7LK_2				60.8%	48%	99 bp	100 bp	9%	25.5
510_7LK_STAR		92.1%	23.5
510_7THY	91.1%
510_7THY_1				62.5%	49%	99 bp	100 bp	18%	52.1
510_7THY_2				59.4%	49%	99 bp	100 bp	9%	52.1
510_7THY_STAR		89.2%	46.5
586_1GM	91.9%
586_1GM_1				76.9%	50%	99 bp	100 bp	18%	41.4
586_1GM_2				73.4%	50%	99 bp	100 bp	18%	41.4
586_1GM_STAR		90.0%	37.3
586_1LK	95.1%
586_1LK_1				67.3%	48%	99 bp	100 bp	18%	26.6
586_1LK_2				64.2%	48%	99 bp	100 bp	9%	26.6
586_1LK_STAR		93.0%	24.7
586_1THY	93.1%
586_1THY_1				63.1%	49%	99 bp	100 bp	18%	40.9
586_1THY_2				60.4%	49%	99 bp	100 bp	9%	40.9
586_1THY_STAR		89.9%	36.8
730_1GM	89.8%
730_1GM_1				75.8%	50%	99 bp	100 bp	18%	40.6
730_1GM_2				70.8%	50%	99 bp	100 bp	18%	40.6
730_1GM_STAR		88.4%	35.9
730_1LK	88.7%
730_1LK_1				71.1%	50%	99 bp	100 bp	18%	54.1
730_1LK_2				66.5%	50%	99 bp	100 bp	9%	54.1
730_1LK_STAR		87.0%	47.1
730_1THY	88.2%
730_1THY_1				66.7%	50%	99 bp	100 bp	18%	49.9
730_1THY_2				62.5%	50%	99 bp	100 bp	9%	49.9
730_1THY_STAR		86.0%	42.9

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁸/₈ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	22842735	0.2674%
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN	3	167412	0.0020%
CCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGATAGCTCTTTCT	1	44556	0.0005%
CTTCGAATGTGTGGTAGGGTGGGGGGCATCCATGCAGTCATTCTAGGTTA	1	62348	0.0007%
GCCGTAAGTGAGATGAATGAGCCTATAGAGGAGACTGTATTTCATGTGGT	1	54538	0.0006%
GGGGGTTCGAATCCTTCCTTTCTTATTTAACTTTTACGTAGGAAGGTTCT	1	50150	0.0006%
CTCCGATTAGATGCATTAATAGATGGCCTGCTGTAATGTTTGCTGTTAGT	1	43822	0.0005%
GTCAGTATCATGCTGCGGCTTCAAATCCGAAATGATGTTTTGATGTGAAG	1	43556	0.0005%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

No samples found with any adapter contamination > 0.1%

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks