MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-14, 04:27 CDT based on data in: /scratch/g/akwitek/wdemos/GSE301346

General Statistics

Showing ⁴³²/₄₃₂ rows and ⁶/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GSM9081278	86.3%
GSM9081278_SRR34323341_1				48.3%	48%	151 bp	151 bp	18%	37.1
GSM9081278_SRR34323341_2				52.4%	48%	151 bp	151 bp	36%	37.1
GSM9081278_SRR34323342_1				50.2%	48%	151 bp	151 bp	18%	39.6
GSM9081278_SRR34323342_2				53.7%	48%	151 bp	151 bp	27%	39.6
GSM9081278_STAR		88.5%	67.9
GSM9081279	84.2%
GSM9081279_SRR34323339_1				52.4%	48%	151 bp	151 bp	27%	49.6
GSM9081279_SRR34323339_2				56.6%	48%	151 bp	151 bp	36%	49.6
GSM9081279_SRR34323340_1				54.5%	48%	151 bp	151 bp	27%	52.8
GSM9081279_SRR34323340_2				58.2%	48%	151 bp	151 bp	36%	52.8
GSM9081279_STAR		86.7%	88.7
GSM9081280	86.0%
GSM9081280_SRR34323337_1				52.0%	48%	151 bp	151 bp	27%	51.7
GSM9081280_SRR34323337_2				55.9%	48%	151 bp	151 bp	36%	51.7
GSM9081280_SRR34323338_1				54.5%	48%	151 bp	151 bp	18%	55.7
GSM9081280_SRR34323338_2				57.7%	48%	151 bp	151 bp	27%	55.7
GSM9081280_STAR		88.0%	94.6
GSM9081281	85.3%
GSM9081281_SRR34323335_1				51.7%	48%	151 bp	151 bp	27%	44.2
GSM9081281_SRR34323335_2				55.1%	48%	151 bp	151 bp	36%	44.2
GSM9081281_SRR34323336_1				49.4%	48%	151 bp	151 bp	18%	41.7
GSM9081281_SRR34323336_2				53.7%	48%	151 bp	151 bp	36%	41.7
GSM9081281_STAR		87.7%	75.3
GSM9081282	87.6%
GSM9081282_SRR34323333_1				52.3%	48%	151 bp	151 bp	18%	49.3
GSM9081282_SRR34323333_2				56.1%	48%	151 bp	151 bp	27%	49.3
GSM9081282_SRR34323334_1				54.4%	48%	151 bp	151 bp	18%	53.6
GSM9081282_SRR34323334_2				57.7%	48%	151 bp	151 bp	27%	53.6
GSM9081282_STAR		89.1%	91.7
GSM9081283	87.1%
GSM9081283_SRR34323331_1				50.9%	48%	151 bp	151 bp	18%	42.5
GSM9081283_SRR34323331_2				55.1%	48%	151 bp	151 bp	27%	42.5
GSM9081283_SRR34323332_1				52.9%	48%	151 bp	151 bp	18%	45.7
GSM9081283_SRR34323332_2				56.4%	48%	151 bp	151 bp	27%	45.7
GSM9081283_STAR		88.9%	78.4
GSM9081284	86.0%
GSM9081284_SRR34323329_1				52.4%	48%	151 bp	151 bp	27%	46.2
GSM9081284_SRR34323329_2				56.4%	48%	151 bp	151 bp	36%	46.2
GSM9081284_SRR34323330_1				54.6%	48%	151 bp	151 bp	18%	49.4
GSM9081284_SRR34323330_2				58.1%	48%	151 bp	151 bp	27%	49.4
GSM9081284_STAR		87.5%	83.6
GSM9081285	85.8%
GSM9081285_SRR34323327_1				50.9%	48%	151 bp	151 bp	27%	37.8
GSM9081285_SRR34323327_2				54.8%	48%	151 bp	151 bp	36%	37.8
GSM9081285_SRR34323328_1				53.0%	48%	151 bp	151 bp	27%	40.9
GSM9081285_SRR34323328_2				56.5%	48%	151 bp	151 bp	36%	40.9
GSM9081285_STAR		88.1%	69.3
GSM9081286	86.1%
GSM9081286_SRR34323325_1				51.4%	48%	151 bp	151 bp	27%	40.4
GSM9081286_SRR34323325_2				55.5%	48%	151 bp	151 bp	36%	40.4
GSM9081286_SRR34323326_1				53.7%	48%	151 bp	151 bp	18%	43.7
GSM9081286_SRR34323326_2				57.3%	48%	151 bp	151 bp	27%	43.7
GSM9081286_STAR		87.3%	73.4
GSM9081287	85.6%
GSM9081287_SRR34323293_1				51.2%	48%	151 bp	151 bp	27%	44.2
GSM9081287_SRR34323293_2				55.7%	48%	151 bp	151 bp	36%	44.2
GSM9081287_SRR34323294_1				53.4%	48%	151 bp	151 bp	27%	46.7
GSM9081287_SRR34323294_2				57.1%	48%	151 bp	151 bp	36%	46.7
GSM9081287_STAR		87.4%	79.4
GSM9081288	84.5%
GSM9081288_SRR34323291_1				50.9%	48%	151 bp	151 bp	27%	45.7
GSM9081288_SRR34323291_2				55.3%	48%	151 bp	151 bp	36%	45.7
GSM9081288_SRR34323292_1				53.5%	48%	151 bp	151 bp	27%	49.7
GSM9081288_SRR34323292_2				57.4%	48%	151 bp	151 bp	36%	49.7
GSM9081288_STAR		86.7%	82.7
GSM9081289	74.5%
GSM9081289_SRR34323289_1				51.3%	48%	151 bp	151 bp	27%	38.8
GSM9081289_SRR34323289_2				56.4%	48%	151 bp	151 bp	36%	38.8
GSM9081289_SRR34323290_1				53.2%	48%	151 bp	151 bp	27%	40.1
GSM9081289_SRR34323290_2				57.2%	48%	151 bp	151 bp	36%	40.1
GSM9081289_STAR		80.6%	63.6
GSM9081290	87.5%
GSM9081290_SRR34323287_1				50.3%	48%	151 bp	151 bp	18%	47.2
GSM9081290_SRR34323287_2				54.8%	48%	151 bp	151 bp	27%	47.2
GSM9081290_SRR34323288_1				52.6%	48%	151 bp	151 bp	18%	51.0
GSM9081290_SRR34323288_2				56.6%	48%	151 bp	151 bp	27%	51.0
GSM9081290_STAR		88.4%	86.8
GSM9081291	87.0%
GSM9081291_SRR34323285_1				53.3%	47%	151 bp	151 bp	27%	42.9
GSM9081291_SRR34323285_2				57.5%	48%	151 bp	151 bp	36%	42.9
GSM9081291_SRR34323286_1				55.4%	48%	151 bp	151 bp	18%	45.9
GSM9081291_SRR34323286_2				59.1%	48%	151 bp	151 bp	27%	45.9
GSM9081291_STAR		88.3%	78.4
GSM9081292	84.4%
GSM9081292_SRR34323283_1				51.3%	48%	151 bp	151 bp	27%	49.2
GSM9081292_SRR34323283_2				55.9%	48%	151 bp	151 bp	36%	49.2
GSM9081292_SRR34323284_1				53.0%	48%	151 bp	151 bp	27%	51.9
GSM9081292_SRR34323284_2				57.0%	48%	151 bp	151 bp	36%	51.9
GSM9081292_STAR		87.2%	88.3
GSM9081293	82.7%
GSM9081293_SRR34323281_1				51.3%	48%	151 bp	151 bp	27%	41.6
GSM9081293_SRR34323281_2				53.2%	48%	151 bp	151 bp	36%	41.6
GSM9081293_SRR34323282_1				53.3%	48%	151 bp	151 bp	27%	43.5
GSM9081293_SRR34323282_2				55.0%	48%	151 bp	151 bp	36%	43.5
GSM9081293_STAR		85.8%	73.0
GSM9081294	82.1%
GSM9081294_SRR34323279_1				51.2%	48%	151 bp	151 bp	27%	44.3
GSM9081294_SRR34323279_2				55.3%	49%	151 bp	151 bp	36%	44.3
GSM9081294_SRR34323280_1				53.3%	48%	151 bp	151 bp	27%	47.2
GSM9081294_SRR34323280_2				56.8%	49%	151 bp	151 bp	36%	47.2
GSM9081294_STAR		84.6%	77.4
GSM9081295	85.9%
GSM9081295_SRR34323261_1				53.4%	48%	151 bp	151 bp	27%	47.2
GSM9081295_SRR34323261_2				57.4%	48%	151 bp	151 bp	36%	47.2
GSM9081295_SRR34323262_1				55.4%	48%	151 bp	151 bp	27%	50.6
GSM9081295_SRR34323262_2				59.0%	48%	151 bp	151 bp	36%	50.6
GSM9081295_STAR		87.1%	85.2
GSM9081296	87.7%
GSM9081296_SRR34323259_1				51.8%	48%	151 bp	151 bp	18%	41.2
GSM9081296_SRR34323259_2				56.4%	48%	151 bp	151 bp	27%	41.2
GSM9081296_SRR34323260_1				54.6%	48%	151 bp	151 bp	18%	44.8
GSM9081296_SRR34323260_2				58.3%	48%	151 bp	151 bp	27%	44.8
GSM9081296_STAR		88.3%	75.9
GSM9081297	87.1%
GSM9081297_SRR34323257_1				55.0%	48%	151 bp	151 bp	18%	44.7
GSM9081297_SRR34323257_2				59.4%	48%	151 bp	151 bp	36%	44.7
GSM9081297_SRR34323258_1				57.2%	48%	151 bp	151 bp	18%	47.5
GSM9081297_SRR34323258_2				60.9%	48%	151 bp	151 bp	27%	47.5
GSM9081297_STAR		87.9%	81.0
GSM9081298	84.7%
GSM9081298_SRR34323255_1				54.2%	48%	151 bp	151 bp	27%	53.4
GSM9081298_SRR34323255_2				59.1%	48%	151 bp	151 bp	36%	53.4
GSM9081298_SRR34323256_1				56.7%	48%	151 bp	151 bp	27%	57.4
GSM9081298_SRR34323256_2				60.6%	48%	151 bp	151 bp	36%	57.4
GSM9081298_STAR		86.9%	96.3
GSM9081299	84.6%
GSM9081299_SRR34323253_1				53.1%	48%	151 bp	151 bp	27%	46.2
GSM9081299_SRR34323253_2				57.9%	48%	151 bp	151 bp	36%	46.2
GSM9081299_SRR34323254_1				55.5%	48%	151 bp	151 bp	27%	49.5
GSM9081299_SRR34323254_2				59.4%	48%	151 bp	151 bp	36%	49.5
GSM9081299_STAR		87.0%	83.2
GSM9081300	86.3%
GSM9081300_SRR34323251_1				52.1%	48%	151 bp	151 bp	27%	41.9
GSM9081300_SRR34323251_2				56.6%	48%	151 bp	151 bp	36%	41.9
GSM9081300_SRR34323252_1				54.8%	48%	151 bp	151 bp	18%	45.3
GSM9081300_SRR34323252_2				58.3%	48%	151 bp	151 bp	27%	45.3
GSM9081300_STAR		87.1%	76.0
GSM9081301	85.5%
GSM9081301_SRR34323249_1				50.6%	48%	151 bp	151 bp	27%	33.2
GSM9081301_SRR34323249_2				54.9%	48%	151 bp	151 bp	36%	33.2
GSM9081301_SRR34323250_1				52.7%	48%	151 bp	151 bp	27%	35.9
GSM9081301_SRR34323250_2				56.8%	48%	151 bp	151 bp	36%	35.9
GSM9081301_STAR		87.5%	60.6
GSM9081302	84.7%
GSM9081302_SRR34323247_1				53.2%	48%	151 bp	151 bp	27%	46.1
GSM9081302_SRR34323247_2				57.0%	48%	151 bp	151 bp	36%	46.1
GSM9081302_SRR34323248_1				55.7%	48%	151 bp	151 bp	27%	49.7
GSM9081302_SRR34323248_2				59.2%	48%	151 bp	151 bp	36%	49.7
GSM9081302_STAR		86.8%	83.1
GSM9081303	87.2%
GSM9081303_SRR34323229_1				53.1%	48%	151 bp	151 bp	27%	46.0
GSM9081303_SRR34323229_2				57.9%	48%	151 bp	151 bp	36%	46.0
GSM9081303_SRR34323230_1				55.5%	48%	151 bp	151 bp	18%	50.3
GSM9081303_SRR34323230_2				59.6%	49%	151 bp	151 bp	27%	50.3
GSM9081303_STAR		88.4%	85.2
GSM9081304	87.4%
GSM9081304_SRR34323227_1				56.6%	48%	151 bp	151 bp	18%	54.1
GSM9081304_SRR34323227_2				61.1%	49%	151 bp	151 bp	36%	54.1
GSM9081304_SRR34323228_1				59.1%	48%	151 bp	151 bp	18%	58.7
GSM9081304_SRR34323228_2				63.2%	49%	151 bp	151 bp	27%	58.7
GSM9081304_STAR		87.9%	99.2
GSM9081305	87.1%
GSM9081305_SRR34323225_1				54.1%	48%	151 bp	151 bp	18%	43.5
GSM9081305_SRR34323225_2				58.7%	48%	151 bp	151 bp	27%	43.5
GSM9081305_SRR34323226_1				56.6%	48%	151 bp	151 bp	18%	47.0
GSM9081305_SRR34323226_2				60.5%	48%	151 bp	151 bp	27%	47.0
GSM9081305_STAR		87.1%	78.8
GSM9081306	86.3%
GSM9081306_SRR34323223_1				52.3%	48%	151 bp	151 bp	27%	43.9
GSM9081306_SRR34323223_2				57.1%	48%	151 bp	151 bp	36%	43.9
GSM9081306_SRR34323224_1				54.5%	48%	151 bp	151 bp	18%	46.8
GSM9081306_SRR34323224_2				58.6%	48%	151 bp	151 bp	27%	46.8
GSM9081306_STAR		87.6%	79.5
GSM9081307	85.6%
GSM9081307_SRR34323221_1				50.7%	48%	151 bp	151 bp	27%	34.9
GSM9081307_SRR34323221_2				55.0%	49%	151 bp	151 bp	36%	34.9
GSM9081307_SRR34323222_1				52.9%	48%	151 bp	151 bp	27%	37.5
GSM9081307_SRR34323222_2				56.4%	49%	151 bp	151 bp	36%	37.5
GSM9081307_STAR		86.6%	62.7
GSM9081308	87.9%
GSM9081308_SRR34323219_1				51.9%	48%	151 bp	151 bp	18%	38.9
GSM9081308_SRR34323219_2				56.6%	49%	151 bp	151 bp	27%	38.9
GSM9081308_SRR34323220_1				54.4%	48%	151 bp	151 bp	18%	42.3
GSM9081308_SRR34323220_2				58.3%	49%	151 bp	151 bp	27%	42.3
GSM9081308_STAR		88.7%	72.0
GSM9081309	85.8%
GSM9081309_SRR34323217_1				52.7%	48%	151 bp	151 bp	27%	39.2
GSM9081309_SRR34323217_2				57.1%	48%	151 bp	151 bp	36%	39.2
GSM9081309_SRR34323218_1				54.6%	48%	151 bp	151 bp	27%	41.5
GSM9081309_SRR34323218_2				58.3%	48%	151 bp	151 bp	36%	41.5
GSM9081309_STAR		87.3%	70.4
GSM9081310	88.2%
GSM9081310_SRR34323215_1				53.6%	48%	151 bp	151 bp	18%	39.1
GSM9081310_SRR34323215_2				58.4%	48%	151 bp	151 bp	27%	39.1
GSM9081310_SRR34323216_1				56.0%	48%	151 bp	151 bp	18%	42.7
GSM9081310_SRR34323216_2				60.1%	48%	151 bp	151 bp	27%	42.7
GSM9081310_STAR		88.9%	72.7
GSM9081311	86.6%
GSM9081311_SRR34323323_1				54.8%	48%	151 bp	151 bp	27%	43.1
GSM9081311_SRR34323323_2				59.7%	48%	151 bp	151 bp	36%	43.1
GSM9081311_SRR34323324_1				57.1%	48%	151 bp	151 bp	18%	46.0
GSM9081311_SRR34323324_2				61.2%	48%	151 bp	151 bp	27%	46.0
GSM9081311_STAR		87.9%	78.3
GSM9081312	83.1%
GSM9081312_SRR34323321_1				52.6%	48%	151 bp	151 bp	27%	43.4
GSM9081312_SRR34323321_2				57.3%	49%	151 bp	151 bp	36%	43.4
GSM9081312_SRR34323322_1				55.3%	48%	151 bp	151 bp	27%	46.2
GSM9081312_SRR34323322_2				59.3%	49%	151 bp	151 bp	36%	46.2
GSM9081312_STAR		85.6%	76.6
GSM9081313	83.8%
GSM9081313_SRR34323319_1				52.2%	49%	151 bp	151 bp	27%	40.1
GSM9081313_SRR34323319_2				56.5%	49%	151 bp	151 bp	36%	40.1
GSM9081313_SRR34323320_1				54.6%	49%	151 bp	151 bp	27%	43.5
GSM9081313_SRR34323320_2				58.5%	49%	151 bp	151 bp	36%	43.5
GSM9081313_STAR		86.0%	71.8
GSM9081314	81.3%
GSM9081314_SRR34323317_1				47.1%	48%	151 bp	151 bp	18%	32.4
GSM9081314_SRR34323317_2				49.9%	48%	151 bp	151 bp	27%	32.4
GSM9081314_SRR34323318_1				49.0%	48%	151 bp	151 bp	18%	33.9
GSM9081314_SRR34323318_2				51.5%	48%	151 bp	151 bp	36%	33.9
GSM9081314_STAR		84.9%	56.3
GSM9081315	83.2%
GSM9081315_SRR34323315_1				49.4%	48%	151 bp	151 bp	18%	39.1
GSM9081315_SRR34323315_2				53.1%	48%	151 bp	151 bp	36%	39.1
GSM9081315_SRR34323316_1				51.8%	48%	151 bp	151 bp	27%	42.2
GSM9081315_SRR34323316_2				54.9%	48%	151 bp	151 bp	36%	42.2
GSM9081315_STAR		85.8%	69.8
GSM9081316	85.3%
GSM9081316_SRR34323313_1				48.0%	48%	151 bp	151 bp	18%	33.5
GSM9081316_SRR34323313_2				51.6%	48%	151 bp	151 bp	36%	33.5
GSM9081316_SRR34323314_1				50.1%	48%	151 bp	151 bp	27%	35.5
GSM9081316_SRR34323314_2				53.2%	48%	151 bp	151 bp	36%	35.5
GSM9081316_STAR		87.4%	60.3
GSM9081317	83.9%
GSM9081317_SRR34323311_1				51.3%	48%	151 bp	151 bp	27%	42.4
GSM9081317_SRR34323311_2				54.9%	48%	151 bp	151 bp	36%	42.4
GSM9081317_SRR34323312_1				53.4%	48%	151 bp	151 bp	27%	45.1
GSM9081317_SRR34323312_2				56.7%	48%	151 bp	151 bp	36%	45.1
GSM9081317_STAR		85.5%	74.8
GSM9081318	82.6%
GSM9081318_SRR34323309_1				48.2%	48%	151 bp	151 bp	18%	30.0
GSM9081318_SRR34323309_2				51.5%	48%	151 bp	151 bp	36%	30.0
GSM9081318_SRR34323310_1				50.2%	48%	151 bp	151 bp	27%	31.9
GSM9081318_SRR34323310_2				53.0%	48%	151 bp	151 bp	36%	31.9
GSM9081318_STAR		85.2%	52.8
GSM9081319	82.0%
GSM9081319_SRR34323277_1				49.2%	48%	151 bp	151 bp	18%	35.8
GSM9081319_SRR34323277_2				53.0%	48%	151 bp	151 bp	36%	35.8
GSM9081319_SRR34323278_1				51.0%	48%	151 bp	151 bp	27%	37.2
GSM9081319_SRR34323278_2				54.1%	48%	151 bp	151 bp	36%	37.2
GSM9081319_STAR		85.0%	62.1
GSM9081320	84.9%
GSM9081320_SRR34323275_1				49.2%	48%	151 bp	151 bp	18%	33.3
GSM9081320_SRR34323275_2				52.5%	48%	151 bp	151 bp	36%	33.3
GSM9081320_SRR34323276_1				50.9%	48%	151 bp	151 bp	27%	35.3
GSM9081320_SRR34323276_2				53.7%	48%	151 bp	151 bp	36%	35.3
GSM9081320_STAR		85.9%	59.0
GSM9081321	85.7%
GSM9081321_SRR34323273_1				49.9%	48%	151 bp	151 bp	18%	38.6
GSM9081321_SRR34323273_2				53.7%	48%	151 bp	151 bp	36%	38.6
GSM9081321_SRR34323274_1				51.9%	48%	151 bp	151 bp	18%	41.4
GSM9081321_SRR34323274_2				55.0%	48%	151 bp	151 bp	36%	41.4
GSM9081321_STAR		87.5%	70.1
GSM9081322	85.0%
GSM9081322_SRR34323271_1				49.8%	48%	151 bp	151 bp	18%	38.6
GSM9081322_SRR34323271_2				53.8%	48%	151 bp	151 bp	36%	38.6
GSM9081322_SRR34323272_1				52.0%	48%	151 bp	151 bp	27%	40.9
GSM9081322_SRR34323272_2				55.3%	48%	151 bp	151 bp	36%	40.9
GSM9081322_STAR		87.6%	69.7
GSM9081323	82.5%
GSM9081323_SRR34323269_1				51.0%	48%	151 bp	151 bp	27%	40.8
GSM9081323_SRR34323269_2				55.1%	48%	151 bp	151 bp	36%	40.8
GSM9081323_SRR34323270_1				53.0%	48%	151 bp	151 bp	27%	42.9
GSM9081323_SRR34323270_2				56.2%	48%	151 bp	151 bp	36%	42.9
GSM9081323_STAR		86.1%	72.1
GSM9081324	84.2%
GSM9081324_SRR34323267_1				51.6%	48%	151 bp	151 bp	27%	42.9
GSM9081324_SRR34323267_2				55.5%	48%	151 bp	151 bp	36%	42.9
GSM9081324_SRR34323268_1				54.1%	48%	151 bp	151 bp	27%	45.8
GSM9081324_SRR34323268_2				57.0%	48%	151 bp	151 bp	36%	45.8
GSM9081324_STAR		86.4%	76.6
GSM9081325	87.1%
GSM9081325_SRR34323265_1				50.5%	48%	151 bp	151 bp	18%	42.9
GSM9081325_SRR34323265_2				54.3%	48%	151 bp	151 bp	27%	42.9
GSM9081325_SRR34323266_1				52.9%	48%	151 bp	151 bp	18%	46.6
GSM9081325_SRR34323266_2				56.2%	48%	151 bp	151 bp	27%	46.6
GSM9081325_STAR		88.4%	79.1
GSM9081326	82.5%
GSM9081326_SRR34323263_1				51.1%	48%	151 bp	151 bp	27%	41.8
GSM9081326_SRR34323263_2				55.1%	48%	151 bp	151 bp	36%	41.8
GSM9081326_SRR34323264_1				53.2%	48%	151 bp	151 bp	27%	44.3
GSM9081326_SRR34323264_2				56.8%	48%	151 bp	151 bp	36%	44.3
GSM9081326_STAR		85.9%	73.9
GSM9081327	83.9%
GSM9081327_SRR34323245_1				52.7%	47%	151 bp	151 bp	27%	31.6
GSM9081327_SRR34323245_2				56.6%	48%	151 bp	151 bp	36%	31.6
GSM9081327_SRR34323246_1				54.9%	47%	151 bp	151 bp	27%	33.6
GSM9081327_SRR34323246_2				58.3%	48%	151 bp	151 bp	36%	33.6
GSM9081327_STAR		86.3%	56.3
GSM9081328	85.3%
GSM9081328_SRR34323243_1				51.4%	48%	151 bp	151 bp	27%	41.5
GSM9081328_SRR34323243_2				55.4%	48%	151 bp	151 bp	36%	41.5
GSM9081328_SRR34323244_1				54.2%	48%	151 bp	151 bp	27%	44.6
GSM9081328_SRR34323244_2				57.2%	48%	151 bp	151 bp	36%	44.6
GSM9081328_STAR		87.0%	75.0
GSM9081329	86.7%
GSM9081329_SRR34323241_1				50.5%	48%	151 bp	151 bp	27%	34.3
GSM9081329_SRR34323241_2				54.2%	48%	151 bp	151 bp	36%	34.3
GSM9081329_SRR34323242_1				52.5%	48%	151 bp	151 bp	18%	36.9
GSM9081329_SRR34323242_2				55.8%	48%	151 bp	151 bp	27%	36.9
GSM9081329_STAR		87.3%	62.2
GSM9081330	85.4%
GSM9081330_SRR34323239_1				50.4%	48%	151 bp	151 bp	27%	37.4
GSM9081330_SRR34323239_2				54.4%	48%	151 bp	151 bp	36%	37.4
GSM9081330_SRR34323240_1				52.4%	48%	151 bp	151 bp	27%	40.3
GSM9081330_SRR34323240_2				55.9%	48%	151 bp	151 bp	36%	40.3
GSM9081330_STAR		87.4%	67.9
GSM9081331	86.4%
GSM9081331_SRR34323237_1				51.0%	48%	151 bp	151 bp	27%	40.6
GSM9081331_SRR34323237_2				54.8%	48%	151 bp	151 bp	36%	40.6
GSM9081331_SRR34323238_1				53.3%	48%	151 bp	151 bp	18%	43.3
GSM9081331_SRR34323238_2				56.4%	48%	151 bp	151 bp	27%	43.3
GSM9081331_STAR		88.5%	74.2
GSM9081332	88.4%
GSM9081332_SRR34323235_1				53.6%	48%	151 bp	151 bp	18%	49.7
GSM9081332_SRR34323235_2				57.6%	49%	151 bp	151 bp	27%	49.7
GSM9081332_SRR34323236_1				55.9%	48%	151 bp	151 bp	18%	52.9
GSM9081332_SRR34323236_2				59.5%	49%	151 bp	151 bp	27%	52.9
GSM9081332_STAR		88.9%	91.3
GSM9081333	87.7%
GSM9081333_SRR34323233_1				50.5%	48%	151 bp	151 bp	18%	39.8
GSM9081333_SRR34323233_2				54.6%	48%	151 bp	151 bp	27%	39.8
GSM9081333_SRR34323234_1				52.9%	48%	151 bp	151 bp	18%	43.0
GSM9081333_SRR34323234_2				56.5%	48%	151 bp	151 bp	27%	43.0
GSM9081333_STAR		89.1%	73.7
GSM9081334	87.2%
GSM9081334_SRR34323231_1				48.7%	48%	151 bp	151 bp	9%	33.2
GSM9081334_SRR34323231_2				53.0%	48%	151 bp	151 bp	27%	33.2
GSM9081334_SRR34323232_1				51.0%	48%	151 bp	151 bp	18%	36.5
GSM9081334_SRR34323232_2				54.9%	48%	151 bp	151 bp	27%	36.5
GSM9081334_STAR		89.0%	62.0
GSM9081335	87.4%
GSM9081335_SRR34323213_1				51.0%	48%	151 bp	151 bp	18%	43.7
GSM9081335_SRR34323213_2				54.7%	48%	151 bp	151 bp	27%	43.7
GSM9081335_SRR34323214_1				53.2%	48%	151 bp	151 bp	18%	47.3
GSM9081335_SRR34323214_2				56.7%	48%	151 bp	151 bp	27%	47.3
GSM9081335_STAR		89.2%	81.2
GSM9081336	86.4%
GSM9081336_SRR34323211_1				52.9%	48%	151 bp	151 bp	27%	50.4
GSM9081336_SRR34323211_2				57.2%	48%	151 bp	151 bp	36%	50.4
GSM9081336_SRR34323212_1				55.3%	48%	151 bp	151 bp	18%	54.1
GSM9081336_SRR34323212_2				59.1%	48%	151 bp	151 bp	27%	54.1
GSM9081336_STAR		88.1%	92.1
GSM9081337	84.2%
GSM9081337_SRR34323209_1				50.9%	48%	151 bp	151 bp	27%	40.7
GSM9081337_SRR34323209_2				55.0%	48%	151 bp	151 bp	36%	40.7
GSM9081337_SRR34323210_1				53.2%	48%	151 bp	151 bp	27%	43.2
GSM9081337_SRR34323210_2				56.2%	48%	151 bp	151 bp	36%	43.2
GSM9081337_STAR		86.6%	72.7
GSM9081338	87.2%
GSM9081338_SRR34323207_1				52.8%	48%	151 bp	151 bp	18%	43.0
GSM9081338_SRR34323207_2				57.4%	48%	151 bp	151 bp	36%	43.0
GSM9081338_SRR34323208_1				55.4%	48%	151 bp	151 bp	18%	46.4
GSM9081338_SRR34323208_2				59.4%	48%	151 bp	151 bp	27%	46.4
GSM9081338_STAR		88.5%	79.1
GSM9081339	83.6%
GSM9081339_SRR34323205_1				52.2%	48%	151 bp	151 bp	27%	41.1
GSM9081339_SRR34323205_2				56.5%	48%	151 bp	151 bp	36%	41.1
GSM9081339_SRR34323206_1				54.6%	48%	151 bp	151 bp	27%	44.1
GSM9081339_SRR34323206_2				58.3%	48%	151 bp	151 bp	36%	44.1
GSM9081339_STAR		85.9%	73.2
GSM9081340	86.7%
GSM9081340_SRR34323203_1				52.9%	48%	151 bp	151 bp	27%	43.1
GSM9081340_SRR34323203_2				57.2%	48%	151 bp	151 bp	36%	43.1
GSM9081340_SRR34323204_1				55.6%	48%	151 bp	151 bp	18%	47.3
GSM9081340_SRR34323204_2				58.8%	48%	151 bp	151 bp	27%	47.3
GSM9081340_STAR		87.7%	79.3
GSM9081341	88.3%
GSM9081341_SRR34323201_1				52.3%	48%	151 bp	151 bp	18%	43.4
GSM9081341_SRR34323201_2				56.8%	48%	151 bp	151 bp	27%	43.4
GSM9081341_SRR34323202_1				54.7%	48%	151 bp	151 bp	18%	47.1
GSM9081341_SRR34323202_2				58.7%	48%	151 bp	151 bp	27%	47.1
GSM9081341_STAR		89.3%	80.9
GSM9081342	88.3%
GSM9081342_SRR34323199_1				52.3%	48%	151 bp	151 bp	18%	47.6
GSM9081342_SRR34323199_2				57.2%	48%	151 bp	151 bp	27%	47.6
GSM9081342_SRR34323200_1				54.5%	48%	151 bp	151 bp	18%	51.0
GSM9081342_SRR34323200_2				58.5%	48%	151 bp	151 bp	27%	51.0
GSM9081342_STAR		89.2%	87.9
GSM9081343	88.0%
GSM9081343_SRR34323307_1				50.7%	48%	151 bp	151 bp	18%	36.3
GSM9081343_SRR34323307_2				54.9%	48%	151 bp	151 bp	27%	36.3
GSM9081343_SRR34323308_1				53.1%	48%	151 bp	151 bp	18%	39.0
GSM9081343_SRR34323308_2				56.7%	48%	151 bp	151 bp	27%	39.0
GSM9081343_STAR		88.5%	66.6
GSM9081344	86.2%
GSM9081344_SRR34323305_1				53.6%	48%	151 bp	151 bp	27%	47.5
GSM9081344_SRR34323305_2				57.9%	48%	151 bp	151 bp	36%	47.5
GSM9081344_SRR34323306_1				55.8%	48%	151 bp	151 bp	18%	51.2
GSM9081344_SRR34323306_2				59.9%	49%	151 bp	151 bp	27%	51.2
GSM9081344_STAR		87.1%	86.0
GSM9081345	88.4%
GSM9081345_SRR34323303_1				55.1%	48%	151 bp	151 bp	18%	46.0
GSM9081345_SRR34323303_2				59.5%	48%	151 bp	151 bp	27%	46.0
GSM9081345_SRR34323304_1				57.4%	48%	151 bp	151 bp	18%	49.7
GSM9081345_SRR34323304_2				61.2%	48%	151 bp	151 bp	27%	49.7
GSM9081345_STAR		89.2%	85.4
GSM9081346	88.0%
GSM9081346_SRR34323301_1				54.0%	48%	151 bp	151 bp	18%	43.2
GSM9081346_SRR34323301_2				58.5%	48%	151 bp	151 bp	27%	43.2
GSM9081346_SRR34323302_1				56.4%	48%	151 bp	151 bp	18%	46.1
GSM9081346_SRR34323302_2				60.2%	48%	151 bp	151 bp	27%	46.1
GSM9081346_STAR		88.7%	79.2
GSM9081347	87.8%
GSM9081347_SRR34323299_1				50.1%	48%	151 bp	151 bp	18%	34.0
GSM9081347_SRR34323299_2				54.2%	48%	151 bp	151 bp	27%	34.0
GSM9081347_SRR34323300_1				52.3%	48%	151 bp	151 bp	18%	36.3
GSM9081347_SRR34323300_2				55.8%	48%	151 bp	151 bp	27%	36.3
GSM9081347_STAR		89.1%	62.6
GSM9081348	86.8%
GSM9081348_SRR34323297_1				50.1%	48%	151 bp	151 bp	27%	35.0
GSM9081348_SRR34323297_2				53.8%	48%	151 bp	151 bp	36%	35.0
GSM9081348_SRR34323298_1				52.2%	48%	151 bp	151 bp	18%	37.9
GSM9081348_SRR34323298_2				55.7%	48%	151 bp	151 bp	27%	37.9
GSM9081348_STAR		88.2%	64.2
GSM9081349	88.2%
GSM9081349_SRR34323295_1				50.0%	48%	151 bp	151 bp	9%	33.4
GSM9081349_SRR34323295_2				54.2%	48%	151 bp	151 bp	27%	33.4
GSM9081349_SRR34323296_1				52.9%	48%	151 bp	151 bp	18%	36.2
GSM9081349_SRR34323296_2				56.4%	48%	151 bp	151 bp	27%	36.2
GSM9081349_STAR		89.4%	62.3

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

All samples have sequences of a single length (151bp).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

288 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	144	20291409	0.1633%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGAAGCAATCTGGGGG	2	110417	0.0009%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGTACCAATCTGGGGG	2	104589	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAGAAATCTGGGGG	2	96071	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAACGCCATCTGGGGG	2	135388	0.0011%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCTTGAATCTGGGGG	2	128413	0.0010%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAATACGATCTGGGGG	2	130966	0.0011%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTACCTGCAATCTGGGGG	2	95826	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGTTCAATCTGGGGG	2	84915	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGTATAGGATCTGGGGG	2	131572	0.0011%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATGAGCAATCTGGGGG	2	95750	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTACCACAATCTGGGGG	2	162724	0.0013%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAACACAGATCTGGGGG	2	177638	0.0014%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAACCGAATCTGGGGG	2	106281	0.0009%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCAGTCAATCTGGGGG	2	97049	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCTACCAATCTGGGGG	2	200141	0.0016%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATCACCATCTGGGGG	2	110040	0.0009%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCGATTGATCTGGGGG	2	218967	0.0018%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGACGCTAATCTGGGGG	2	196428	0.0016%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCTGAATCTGGGGG	2	94682	0.0008%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks