MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-21, 09:36 CDT based on data in: /scratch/g/akwitek/wdemos/GSE263155

General Statistics

Showing ⁴⁰²/₄₀₂ rows and ⁷/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GSM8186791	100.0%
GSM8186791_SRR28546237				50.0%	48%	75 bp	76 bp	18%	10.4
GSM8186791_STAR		91.3%	9.5
GSM8186792	100.0%
GSM8186792_SRR28546236				56.7%	48%	76 bp	76 bp	18%	18.7
GSM8186792_STAR		92.4%	17.3
GSM8186793	100.0%
GSM8186793_SRR28546235				50.4%	49%	76 bp	76 bp	18%	12.0
GSM8186793_STAR		92.5%	11.1
GSM8186794	100.0%
GSM8186794_SRR28546234				51.5%	49%	76 bp	76 bp	18%	12.6
GSM8186794_STAR		92.6%	11.7
GSM8186795	100.0%
GSM8186795_SRR28546233				51.5%	48%	75 bp	76 bp	18%	12.6
GSM8186795_STAR		92.8%	11.7
GSM8186796	100.0%
GSM8186796_SRR28546232				53.5%	48%	76 bp	76 bp	27%	13.1
GSM8186796_STAR		92.3%	12.0
GSM8186797	100.0%
GSM8186797_SRR28546231				49.9%	49%	76 bp	76 bp	18%	11.1
GSM8186797_STAR		92.8%	10.3
GSM8186798	100.0%
GSM8186798_SRR28546229				52.7%	49%	76 bp	76 bp	27%	8.6
GSM8186798_SRR28546230				72.6%	49%	75 bp	76 bp	18%	55.5
GSM8186798_STAR		92.7%	59.5
GSM8186799	100.0%
GSM8186799_SRR28546228				51.4%	49%	76 bp	76 bp	27%	13.3
GSM8186799_STAR		92.4%	12.3
GSM8186800	100.0%
GSM8186800_SRR28546192				48.1%	49%	76 bp	76 bp	18%	8.2
GSM8186800_SRR28546193				60.1%	48%	75 bp	76 bp	18%	26.4
GSM8186800_STAR		92.3%	31.9
GSM8186801	100.0%
GSM8186801_SRR28546191				51.7%	48%	76 bp	76 bp	18%	15.8
GSM8186801_STAR		92.8%	14.7
GSM8186802	100.0%
GSM8186802_SRR28546189				6.7%	47%	75 bp	76 bp	18%	0.0
GSM8186802_SRR28546190				49.5%	47%	75 bp	76 bp	9%	17.2
GSM8186802_STAR		92.4%	15.9
GSM8186803	100.0%
GSM8186803_SRR28546188				59.4%	47%	75 bp	76 bp	18%	28.9
GSM8186803_STAR		92.8%	26.8
GSM8186804	100.0%
GSM8186804_SRR28546186				46.4%	49%	75 bp	76 bp	9%	9.4
GSM8186804_SRR28546187				43.5%	49%	75 bp	76 bp	18%	9.0
GSM8186804_STAR		92.0%	16.9
GSM8186805	100.0%
GSM8186805_SRR28546185				55.4%	48%	76 bp	76 bp	18%	19.7
GSM8186805_STAR		92.4%	18.2
GSM8186806	100.0%
GSM8186806_SRR28546183				50.6%	49%	76 bp	76 bp	27%	9.4
GSM8186806_SRR28546184				56.4%	49%	75 bp	76 bp	18%	16.6
GSM8186806_STAR		91.9%	23.9
GSM8186807	100.0%
GSM8186807_SRR28546181				46.6%	49%	76 bp	76 bp	18%	8.5
GSM8186807_SRR28546182				50.8%	48%	75 bp	76 bp	18%	14.3
GSM8186807_STAR		92.2%	21.0
GSM8186808	100.0%
GSM8186808_SRR28546179				44.1%	48%	76 bp	76 bp	18%	7.7
GSM8186808_SRR28546180				51.8%	48%	75 bp	76 bp	18%	16.9
GSM8186808_STAR		92.4%	22.8
GSM8186809	100.0%
GSM8186809_SRR28546178				49.0%	49%	76 bp	76 bp	18%	10.0
GSM8186809_STAR		92.2%	9.2
GSM8186810	100.0%
GSM8186810_SRR28546176				53.4%	50%	76 bp	76 bp	27%	9.8
GSM8186810_SRR28546177				22.9%	51%	75 bp	76 bp	18%	0.0
GSM8186810_STAR		92.2%	9.1
GSM8186811	100.0%
GSM8186811_SRR28546175				50.3%	49%	75 bp	76 bp	18%	13.5
GSM8186811_STAR		92.4%	12.5
GSM8186812_SRR28546173				82.2%	63%	76 bp	76 bp	45%	0.2
GSM8186812_SRR28546174				86.8%	48%	28 bp	8 bp	73%	0.1
GSM8186812_STAR		10.8%	0.0
GSM8186813	100.0%
GSM8186813_SRR28546172				47.8%	49%	75 bp	76 bp	9%	11.7
GSM8186813_STAR		91.9%	10.8
GSM8186814	100.0%
GSM8186814_SRR28546171				52.1%	48%	75 bp	76 bp	18%	14.9
GSM8186814_STAR		92.5%	13.8
GSM8186815	100.0%
GSM8186815_SRR28546170				52.0%	48%	75 bp	76 bp	18%	12.3
GSM8186815_STAR		92.5%	11.4
GSM8186816	100.0%
GSM8186816_SRR28546161				54.6%	48%	76 bp	76 bp	27%	12.7
GSM8186816_STAR		92.2%	11.7
GSM8186817	100.0%
GSM8186817_SRR28546160				54.1%	50%	76 bp	76 bp	27%	15.1
GSM8186817_STAR		92.1%	13.9
GSM8186818	100.0%
GSM8186818_SRR28546159				52.9%	50%	76 bp	76 bp	27%	14.5
GSM8186818_STAR		92.1%	13.4
GSM8186819	100.0%
GSM8186819_SRR28546158				53.8%	48%	76 bp	76 bp	27%	12.0
GSM8186819_STAR		92.7%	11.1
GSM8186820	100.0%
GSM8186820_SRR28546157				52.6%	49%	76 bp	76 bp	27%	16.9
GSM8186820_STAR		92.5%	15.7
GSM8186821	100.0%
GSM8186821_SRR28546156				62.2%	48%	75 bp	76 bp	18%	14.4
GSM8186821_STAR		91.9%	13.2
GSM8186822	100.0%
GSM8186822_SRR28546154				54.2%	49%	75 bp	76 bp	18%	9.3
GSM8186822_SRR28546155				57.7%	49%	75 bp	76 bp	18%	15.1
GSM8186822_STAR		90.2%	21.9
GSM8186823	100.0%
GSM8186823_SRR28546152				51.9%	49%	76 bp	76 bp	18%	7.2
GSM8186823_SRR28546153				63.2%	49%	75 bp	76 bp	27%	18.3
GSM8186823_STAR		90.4%	23.1
GSM8186824	100.0%
GSM8186824_SRR28546227				55.8%	49%	75 bp	76 bp	18%	19.1
GSM8186824_STAR		90.8%	17.4
GSM8186825	100.0%
GSM8186825_SRR28546226				53.2%	49%	75 bp	76 bp	18%	12.4
GSM8186825_STAR		91.4%	11.3
GSM8186826	100.0%
GSM8186826_SRR28546225				56.1%	49%	75 bp	76 bp	27%	11.1
GSM8186826_STAR		89.6%	9.9
GSM8186827	100.0%
GSM8186827_SRR28546224				52.6%	49%	76 bp	76 bp	27%	10.3
GSM8186827_STAR		87.8%	9.0
GSM8186828	100.0%
GSM8186828_SRR28546223				28.8%	50%	75 bp	76 bp	18%	0.9
GSM8186828_STAR		88.1%	0.8
GSM8186829	100.0%
GSM8186829_SRR28546222				56.7%	50%	76 bp	76 bp	27%	12.0
GSM8186829_STAR		87.0%	10.4
GSM8186830	100.0%
GSM8186830_SRR28546221				70.9%	50%	75 bp	76 bp	27%	13.5
GSM8186830_STAR		84.2%	11.4
GSM8186831	100.0%
GSM8186831_SRR28546219				21.4%	49%	75 bp	76 bp	18%	0.0
GSM8186831_SRR28546220				42.0%	49%	75 bp	76 bp	18%	9.6
GSM8186831_STAR		90.3%	8.7
GSM8186832	100.0%
GSM8186832_SRR28546279				57.2%	48%	75 bp	76 bp	18%	19.6
GSM8186832_STAR		91.9%	18.0
GSM8186833	100.0%
GSM8186833_SRR28546278				52.7%	49%	75 bp	76 bp	18%	14.3
GSM8186833_STAR		91.8%	13.1
GSM8186834	100.0%
GSM8186834_SRR28546277				54.0%	49%	75 bp	76 bp	18%	10.4
GSM8186834_STAR		92.1%	9.6
GSM8186835	100.0%
GSM8186835_SRR28546276				56.0%	49%	75 bp	76 bp	18%	14.7
GSM8186835_STAR		90.4%	13.3
GSM8186836	100.0%
GSM8186836_SRR28546275				51.8%	51%	76 bp	76 bp	27%	11.1
GSM8186836_STAR		88.4%	9.8
GSM8186837	100.0%
GSM8186837_SRR28546273				38.3%	49%	76 bp	76 bp	18%	2.9
GSM8186837_SRR28546274				35.5%	49%	75 bp	76 bp	9%	2.7
GSM8186837_STAR		89.2%	5.1
GSM8186838	100.0%
GSM8186838_SRR28546272				52.1%	49%	76 bp	76 bp	27%	10.7
GSM8186838_STAR		90.3%	9.6
GSM8186839	100.0%
GSM8186839_SRR28546271				51.0%	49%	76 bp	76 bp	27%	10.8
GSM8186839_STAR		91.8%	9.9
GSM8186840	100.0%
GSM8186840_SRR28546150				55.1%	50%	75 bp	76 bp	27%	7.2
GSM8186840_SRR28546151				59.7%	49%	75 bp	76 bp	18%	11.1
GSM8186840_STAR		87.7%	16.0
GSM8186841	100.0%
GSM8186841_SRR28546149				54.5%	49%	76 bp	76 bp	18%	12.0
GSM8186841_STAR		90.9%	10.9
GSM8186842	100.0%
GSM8186842_SRR28546147				48.2%	50%	76 bp	76 bp	9%	9.1
GSM8186842_SRR28546148				46.4%	49%	75 bp	76 bp	9%	9.8
GSM8186842_STAR		91.3%	17.2
GSM8186843	100.0%
GSM8186843_SRR28546146				53.0%	49%	76 bp	76 bp	18%	13.4
GSM8186843_STAR		91.5%	12.2
GSM8186844	100.0%
GSM8186844_SRR28546145				69.5%	50%	75 bp	76 bp	18%	30.9
GSM8186844_STAR		91.2%	28.2
GSM8186845	100.0%
GSM8186845_SRR28546144				55.5%	49%	76 bp	76 bp	18%	12.0
GSM8186845_STAR		91.7%	11.0
GSM8186846	100.0%
GSM8186846_SRR28546142				32.1%	51%	75 bp	76 bp	18%	0.8
GSM8186846_SRR28546143				70.9%	50%	75 bp	76 bp	18%	8.8
GSM8186846_STAR		88.6%	8.5
GSM8186847	100.0%
GSM8186847_SRR28546140				61.3%	50%	76 bp	76 bp	27%	9.6
GSM8186847_SRR28546141				69.5%	50%	75 bp	76 bp	18%	18.0
GSM8186847_STAR		88.3%	24.4
GSM8186848	100.0%
GSM8186848_SRR28546138				78.5%	49%	76 bp	76 bp	27%	8.7
GSM8186848_SRR28546139				74.3%	49%	75 bp	76 bp	18%	7.7
GSM8186848_STAR		87.4%	14.3
GSM8186849	100.0%
GSM8186849_SRR28546137				65.9%	50%	76 bp	76 bp	27%	13.7
GSM8186849_STAR		86.6%	11.8
GSM8186850	100.0%
GSM8186850_SRR28546135				73.2%	48%	76 bp	76 bp	27%	8.5
GSM8186850_SRR28546136				73.2%	47%	75 bp	76 bp	18%	9.4
GSM8186850_STAR		89.4%	16.0
GSM8186851	100.0%
GSM8186851_SRR28546134				68.8%	47%	76 bp	76 bp	18%	15.7
GSM8186851_STAR		95.4%	15.0
GSM8186852	100.0%
GSM8186852_SRR28546133				70.0%	47%	75 bp	76 bp	18%	15.6
GSM8186852_STAR		95.7%	14.9
GSM8186853	100.0%
GSM8186853_SRR28546131				64.9%	46%	76 bp	76 bp	18%	7.9
GSM8186853_SRR28546132				65.5%	46%	75 bp	76 bp	18%	11.7
GSM8186853_STAR		95.4%	18.7
GSM8186854	100.0%
GSM8186854_SRR28546130				67.2%	47%	76 bp	76 bp	18%	13.1
GSM8186854_STAR		95.5%	12.5
GSM8186855	100.0%
GSM8186855_SRR28546128				63.6%	48%	75 bp	76 bp	18%	8.7
GSM8186855_SRR28546129				64.5%	47%	75 bp	76 bp	18%	14.3
GSM8186855_STAR		94.6%	21.8
GSM8186856	100.0%
GSM8186856_SRR28546270				71.5%	50%	76 bp	76 bp	27%	15.4
GSM8186856_STAR		94.0%	14.4
GSM8186857	100.0%
GSM8186857_SRR28546268				73.6%	47%	76 bp	76 bp	36%	7.0
GSM8186857_SRR28546269				79.1%	46%	75 bp	76 bp	27%	13.4
GSM8186857_STAR		94.3%	19.3
GSM8186858	100.0%
GSM8186858_SRR28546267				71.6%	48%	76 bp	76 bp	27%	15.9
GSM8186858_STAR		91.9%	14.6
GSM8186859	100.0%
GSM8186859_SRR28546266				69.1%	48%	76 bp	76 bp	27%	10.1
GSM8186859_STAR		92.8%	9.4
GSM8186860	100.0%
GSM8186860_SRR28546265				73.3%	49%	76 bp	76 bp	27%	26.7
GSM8186860_STAR		93.2%	24.9
GSM8186861	100.0%
GSM8186861_SRR28546263				66.5%	47%	75 bp	76 bp	18%	9.4
GSM8186861_SRR28546264				66.5%	47%	75 bp	76 bp	27%	13.6
GSM8186861_STAR		94.2%	21.7
GSM8186862	100.0%
GSM8186862_SRR28546262				69.5%	47%	75 bp	76 bp	18%	13.1
GSM8186862_STAR		94.9%	12.4
GSM8186863	100.0%
GSM8186863_SRR28546260				67.2%	47%	75 bp	76 bp	18%	8.9
GSM8186863_SRR28546261				66.4%	46%	75 bp	76 bp	18%	12.1
GSM8186863_STAR		95.3%	20.0
GSM8186864	100.0%
GSM8186864_SRR28546258				67.4%	46%	76 bp	76 bp	18%	6.9
GSM8186864_SRR28546259				67.1%	46%	75 bp	76 bp	18%	9.4
GSM8186864_STAR		95.3%	15.5
GSM8186865	100.0%
GSM8186865_SRR28546257				72.6%	46%	75 bp	76 bp	18%	21.3
GSM8186865_STAR		95.5%	20.3
GSM8186866	100.0%
GSM8186866_SRR28546256				70.9%	48%	76 bp	76 bp	27%	14.6
GSM8186866_STAR		92.4%	13.4
GSM8186867	100.0%
GSM8186867_SRR28546255				71.2%	48%	76 bp	76 bp	27%	13.0
GSM8186867_STAR		92.9%	12.1
GSM8186868	100.0%
GSM8186868_SRR28546254				75.6%	47%	76 bp	76 bp	27%	14.0
GSM8186868_STAR		92.5%	12.9
GSM8186869	100.0%
GSM8186869_SRR28546253				76.7%	48%	76 bp	76 bp	27%	13.7
GSM8186869_STAR		92.1%	12.6
GSM8186870	100.0%
GSM8186870_SRR28546251				81.6%	48%	76 bp	76 bp	27%	8.1
GSM8186870_SRR28546252				82.3%	48%	75 bp	76 bp	18%	10.5
GSM8186870_STAR		91.2%	17.0
GSM8186871	100.0%
GSM8186871_SRR28546249				67.4%	46%	75 bp	76 bp	18%	8.1
GSM8186871_SRR28546250				66.2%	46%	75 bp	76 bp	18%	10.0
GSM8186871_STAR		95.0%	17.2
GSM8186872	100.0%
GSM8186872_SRR28546217				68.6%	46%	75 bp	76 bp	18%	7.3
GSM8186872_SRR28546218				65.9%	45%	75 bp	76 bp	27%	7.0
GSM8186872_STAR		95.3%	13.7
GSM8186873	100.0%
GSM8186873_SRR28546215				66.8%	46%	75 bp	76 bp	27%	7.6
GSM8186873_SRR28546216				68.6%	45%	75 bp	76 bp	27%	15.7
GSM8186873_STAR		95.8%	22.4
GSM8186874	100.0%
GSM8186874_SRR28546213				66.8%	47%	75 bp	76 bp	27%	7.0
GSM8186874_SRR28546214				65.3%	47%	75 bp	76 bp	27%	8.4
GSM8186874_STAR		94.5%	14.6
GSM8186875	100.0%
GSM8186875_SRR28546211				65.4%	47%	75 bp	76 bp	27%	6.7
GSM8186875_SRR28546212				66.1%	46%	75 bp	76 bp	27%	10.1
GSM8186875_STAR		95.0%	16.0
GSM8186876	100.0%
GSM8186876_SRR28546210				74.9%	47%	76 bp	76 bp	36%	14.8
GSM8186876_STAR		92.7%	13.8
GSM8186877	100.0%
GSM8186877_SRR28546208				74.7%	49%	75 bp	76 bp	27%	9.7
GSM8186877_SRR28546209				75.1%	48%	75 bp	76 bp	27%	11.9
GSM8186877_STAR		89.2%	19.2
GSM8186878	100.0%
GSM8186878_SRR28546207				70.4%	47%	76 bp	76 bp	36%	10.2
GSM8186878_STAR		93.5%	9.5
GSM8186879	100.0%
GSM8186879_SRR28546206				73.5%	48%	76 bp	76 bp	27%	11.0
GSM8186879_STAR		94.4%	10.4
GSM8186880	100.0%
GSM8186880_SRR28546247				69.4%	48%	76 bp	76 bp	27%	8.2
GSM8186880_SRR28546248				70.2%	48%	75 bp	76 bp	18%	11.9
GSM8186880_STAR		92.2%	18.5
GSM8186881	100.0%
GSM8186881_SRR28546245				67.5%	46%	75 bp	76 bp	18%	7.1
GSM8186881_SRR28546246				61.8%	46%	75 bp	76 bp	27%	4.3
GSM8186881_STAR		95.9%	11.0
GSM8186882	100.0%
GSM8186882_SRR28546243				6.1%	47%	75 bp	76 bp	27%	0.0
GSM8186882_SRR28546244				67.2%	45%	75 bp	76 bp	27%	8.2
GSM8186882_STAR		96.1%	7.9
GSM8186883	100.0%
GSM8186883_SRR28546242				73.9%	46%	75 bp	76 bp	18%	19.0
GSM8186883_STAR		95.8%	18.2
GSM8186884	100.0%
GSM8186884_SRR28546241				70.1%	46%	75 bp	76 bp	18%	13.9
GSM8186884_STAR		95.3%	13.2
GSM8186885	100.0%
GSM8186885_SRR28546240				69.8%	46%	75 bp	76 bp	27%	14.3
GSM8186885_STAR		95.5%	13.6
GSM8186886	100.0%
GSM8186886_SRR28546239				70.6%	48%	76 bp	76 bp	27%	12.9
GSM8186886_STAR		93.2%	12.0
GSM8186887	100.0%
GSM8186887_SRR28546238				70.8%	48%	76 bp	76 bp	27%	14.0
GSM8186887_STAR		93.8%	13.1
GSM8186888	100.0%
GSM8186888_SRR28546126				69.9%	47%	76 bp	76 bp	27%	9.6
GSM8186888_SRR28546127				71.8%	47%	75 bp	76 bp	27%	15.1
GSM8186888_STAR		95.0%	23.5
GSM8186889	100.0%
GSM8186889_SRR28546125				74.6%	46%	76 bp	76 bp	27%	16.1
GSM8186889_STAR		94.3%	15.2
GSM8186890	100.0%
GSM8186890_SRR28546124				74.2%	47%	76 bp	76 bp	27%	11.8
GSM8186890_STAR		93.3%	11.0
GSM8186891	100.0%
GSM8186891_SRR28546123				73.8%	45%	75 bp	76 bp	27%	15.4
GSM8186891_STAR		95.7%	14.7
GSM8186892	100.0%
GSM8186892_SRR28546121				66.1%	47%	75 bp	76 bp	18%	8.2
GSM8186892_SRR28546122				64.8%	46%	75 bp	76 bp	27%	10.4
GSM8186892_STAR		95.2%	17.7
GSM8186893	100.0%
GSM8186893_SRR28546120				70.7%	46%	75 bp	76 bp	27%	12.1
GSM8186893_STAR		95.6%	11.5
GSM8186894	100.0%
GSM8186894_SRR28546282				69.2%	46%	76 bp	76 bp	27%	10.2
GSM8186894_STAR		95.5%	9.7
GSM8186895	100.0%
GSM8186895_SRR28546280				69.7%	46%	75 bp	76 bp	27%	8.7
GSM8186895_SRR28546281				71.5%	45%	75 bp	76 bp	27%	16.1
GSM8186895_STAR		95.8%	23.7
GSM8186896	100.0%
GSM8186896_SRR28546205				73.0%	48%	76 bp	76 bp	27%	12.3
GSM8186896_STAR		94.1%	11.6
GSM8186897	100.0%
GSM8186897_SRR28546203				67.4%	48%	76 bp	76 bp	27%	9.7
GSM8186897_SRR28546204				69.4%	48%	75 bp	76 bp	18%	14.7
GSM8186897_STAR		93.8%	22.9
GSM8186898	100.0%
GSM8186898_SRR28546202				70.4%	48%	76 bp	76 bp	27%	10.5
GSM8186898_STAR		93.2%	9.8
GSM8186899	100.0%
GSM8186899_SRR28546201				70.8%	47%	76 bp	76 bp	27%	11.1
GSM8186899_STAR		94.0%	10.4
GSM8186900	100.0%
GSM8186900_SRR28546199				69.6%	47%	76 bp	76 bp	27%	9.1
GSM8186900_SRR28546200				71.0%	47%	75 bp	76 bp	18%	13.7
GSM8186900_STAR		94.9%	21.6
GSM8186901	100.0%
GSM8186901_SRR28546197				13.3%	46%	75 bp	76 bp	18%	0.0
GSM8186901_SRR28546198				69.0%	45%	75 bp	76 bp	18%	12.2
GSM8186901_STAR		95.9%	11.7
GSM8186902	100.0%
GSM8186902_SRR28546195				68.8%	46%	75 bp	76 bp	18%	9.2
GSM8186902_SRR28546196				66.5%	46%	75 bp	76 bp	18%	9.8
GSM8186902_STAR		95.3%	18.1
GSM8186903	100.0%
GSM8186903_SRR28546194				72.3%	46%	75 bp	76 bp	18%	12.5
GSM8186903_STAR		95.9%	12.0
GSM8186904	100.0%
GSM8186904_SRR28546168				69.4%	47%	76 bp	76 bp	18%	9.8
GSM8186904_SRR28546169				66.3%	47%	75 bp	76 bp	18%	9.2
GSM8186904_STAR		94.8%	18.0
GSM8186905	100.0%
GSM8186905_SRR28546167				71.1%	47%	76 bp	76 bp	18%	10.3
GSM8186905_STAR		95.2%	9.8
GSM8186906	100.0%
GSM8186906_SRR28546166				73.5%	47%	76 bp	76 bp	27%	11.7
GSM8186906_STAR		95.0%	11.1
GSM8186907	100.0%
GSM8186907_SRR28546165				76.9%	48%	75 bp	76 bp	27%	10.7
GSM8186907_STAR		94.3%	10.1
GSM8186908	100.0%
GSM8186908_SRR28546164				81.2%	48%	76 bp	76 bp	27%	10.1
GSM8186908_STAR		93.2%	9.4
GSM8186909	100.0%
GSM8186909_SRR28546163				78.0%	49%	76 bp	76 bp	27%	10.4
GSM8186909_STAR		92.4%	9.6
GSM8186910	100.0%
GSM8186910_SRR28546162				76.1%	48%	76 bp	76 bp	27%	12.2
GSM8186910_STAR		92.7%	11.3

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
CTTCGAATGTGTGGTAGGGTGGGGGGCATCCATGCAGTCATTCTAGGTTA	82	1443017	0.0757%
CTTGAAACCAGTTGTAGGGGGTTCGAATCCTTCCTTTCTTATTTAACTTT	78	1195322	0.0627%
GTGGGCTTTTGCTCATGTGTCATTTAGGGTATAGCCTGAGAATAGTGGGA	65	878393	0.0461%
GTCAGTATCATGCTGCGGCTTCAAATCCGAAATGATGTTTTGATGTGAAGTGGAATTTTAGTTGTCGTAGTAGAC	62	1133339	0.0594%
GGCAGATGTAAAGTAGGCTCGGGTGTCTACATCTAGGCCTACTGTGAATA	54	659273	0.0346%
GGAAGAATTAAGATGTACACTTCTGGGTGGCCGAAGAATCAGAATAGGTG	50	637637	0.0334%
GGAAGGTTCTTCGAATGTGTGGTAGGGTGGGGGGCATCCATGCAGTCATT	45	621240	0.0326%
GTGGAAGTGAGCTACTACATAGTATGTATCATGAAGTACAATGTCAAGGG	34	407260	0.0214%
GTGGAATTTTAGTTGTCGTAGTAGACAGACAATTAGGAAAGTTGAGCCAA	31	389830	0.0204%
GGCTTCTCAAATCATGAAGATCATTACAAGGACGGCCGTAAGTGAGATGA	26	299595	0.0157%
GTACACTTCTGGGTGGCCGAAGAATCAGAATAGGTGTTGATAGAGAATTGGGTCTCCACCTCCAGCGGGGTCGA	22	269258	0.0141%
GCCAATAATTACGTGGAGGCCATGAAATCCCGTTGCTATGAAGAATGTTGAGCCGTAAATTCCGTCTGAGATAGA	20	231685	0.0121%
GGGGGTTCGAATCCTTCCTTTCTTATTTAACTTTTACGTAGGAAGGTTCTTCGAATGTGTGGTAGGGTGGGGGGC	18	231654	0.0121%
NNNNNNNN	18	613077	0.0322%
ATGAAATTGGCTTGAAACCAGTTGTAGGGGGTTCGAATCCTTCCTTTCTT	14	188993	0.0099%
GTAGGAATTGCGATAATTATAGTGGCAGATGTAAAGTAGGCTCGGGTGTC	9	105904	0.0056%
CTCATCAATAGATAGAAACGTATAGGAATAGTCAAACTACATCTACGAAGTGTCAGTATCATGCTGCGGCTTCAA	9	117124	0.0061%
CCTCCATGTAGTGTAGCGAGTCAGCTGAATACTTTTACGCCTGTAGGAATTGCGATAATTATAGTGGCAGATGTA	9	75750	0.0040%
CTCCGATTAGATGCATTAATAGATGGCCTGCTGTAATGTTTGCTGTTAGT	5	59019	0.0031%
GTCTTCAACAATTCCAGAGATTGGTATGAGAATGAGGATAATTGAAAAGTAGCTGATGGAGGCTAGTTGGCCAAT	4	37993	0.0020%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

No samples found with any adapter contamination > 0.1%

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks