MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-03-13, 06:39 CDT based on data in: /scratch/g/akwitek/wdemos/GSE216263

General Statistics

Showing ³²⁸/₃₂₈ rows and ⁶/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GSM6665158	96.0%
GSM6665158_SRR21999328_1				65.6%	48%	150 bp	150 bp	10%	43.9
GSM6665158_SRR21999328_2				63.9%	48%	150 bp	150 bp	10%	43.9
GSM6665158_STAR		94.2%	41.3
GSM6665159	96.0%
GSM6665159_SRR21999329_1				61.2%	48%	150 bp	150 bp	10%	35.3
GSM6665159_SRR21999329_2				60.0%	48%	150 bp	150 bp	10%	35.3
GSM6665159_STAR		94.1%	33.2
GSM6665160	95.9%
GSM6665160_SRR21999330_1				61.6%	48%	150 bp	150 bp	10%	36.8
GSM6665160_SRR21999330_2				60.0%	48%	150 bp	150 bp	10%	36.8
GSM6665160_STAR		94.0%	34.6
GSM6665161	95.5%
GSM6665161_SRR21999331_1				59.3%	48%	150 bp	150 bp	10%	42.1
GSM6665161_SRR21999331_2				57.3%	48%	150 bp	150 bp	10%	42.1
GSM6665161_STAR		94.1%	39.6
GSM6665162	96.5%
GSM6665162_SRR21999332_1				65.3%	49%	150 bp	150 bp	10%	38.7
GSM6665162_SRR21999332_2				64.6%	49%	150 bp	150 bp	10%	38.7
GSM6665162_STAR		91.9%	35.6
GSM6665163	95.6%
GSM6665163_SRR21999333_1				61.7%	48%	150 bp	150 bp	10%	56.1
GSM6665163_SRR21999333_2				60.1%	48%	150 bp	150 bp	10%	56.1
GSM6665163_STAR		94.2%	52.8
GSM6665164	95.4%
GSM6665164_SRR21999334_1				74.4%	52%	150 bp	150 bp	10%	48.0
GSM6665164_SRR21999334_2				73.5%	52%	150 bp	150 bp	10%	48.0
GSM6665164_STAR		89.4%	42.9
GSM6665165	96.0%
GSM6665165_SRR21999335_1				55.8%	48%	150 bp	150 bp	10%	35.1
GSM6665165_SRR21999335_2				54.4%	48%	150 bp	150 bp	10%	35.1
GSM6665165_STAR		94.7%	33.2
GSM6665166	95.9%
GSM6665166_SRR21999336_1				61.6%	50%	150 bp	150 bp	10%	43.3
GSM6665166_SRR21999336_2				60.7%	50%	150 bp	150 bp	10%	43.3
GSM6665166_STAR		92.2%	39.9
GSM6665167	94.7%
GSM6665167_SRR21999337_1				53.1%	48%	150 bp	150 bp	10%	35.0
GSM6665167_SRR21999337_2				52.3%	48%	150 bp	150 bp	10%	35.0
GSM6665167_STAR		92.8%	32.5
GSM6665168	95.2%
GSM6665168_SRR21999338_1				55.5%	49%	150 bp	150 bp	10%	34.5
GSM6665168_SRR21999338_2				54.3%	49%	150 bp	150 bp	10%	34.5
GSM6665168_STAR		92.7%	32.0
GSM6665169	95.0%
GSM6665169_SRR21999339_1				52.3%	48%	150 bp	150 bp	10%	33.9
GSM6665169_SRR21999339_2				52.0%	48%	150 bp	150 bp	10%	33.9
GSM6665169_STAR		93.5%	31.7
GSM6665170	96.1%
GSM6665170_SRR21999340_1				60.0%	48%	150 bp	150 bp	10%	43.4
GSM6665170_SRR21999340_2				58.6%	48%	150 bp	150 bp	10%	43.4
GSM6665170_STAR		94.3%	40.9
GSM6665171	95.2%
GSM6665171_SRR21999341_1				52.4%	48%	150 bp	150 bp	10%	33.5
GSM6665171_SRR21999341_2				52.4%	48%	150 bp	150 bp	10%	33.5
GSM6665171_STAR		92.9%	31.1
GSM6665172	96.4%
GSM6665172_SRR21999342_1				60.5%	48%	150 bp	150 bp	10%	41.4
GSM6665172_SRR21999342_2				59.2%	48%	150 bp	150 bp	10%	41.4
GSM6665172_STAR		94.2%	39.0
GSM6665173	95.9%
GSM6665173_SRR21999343_1				56.3%	48%	150 bp	150 bp	10%	37.4
GSM6665173_SRR21999343_2				54.7%	48%	150 bp	150 bp	10%	37.4
GSM6665173_STAR		94.2%	35.3
GSM6665174	94.9%
GSM6665174_SRR21999344_1				58.0%	48%	150 bp	150 bp	10%	33.1
GSM6665174_SRR21999344_2				58.0%	48%	150 bp	150 bp	10%	33.1
GSM6665174_STAR		91.8%	30.4
GSM6665175	94.3%
GSM6665175_SRR21999345_1				56.2%	48%	150 bp	150 bp	10%	35.5
GSM6665175_SRR21999345_2				56.6%	48%	150 bp	150 bp	10%	35.5
GSM6665175_STAR		91.3%	32.5
GSM6665176	95.6%
GSM6665176_SRR21999346_1				57.1%	49%	150 bp	150 bp	10%	39.3
GSM6665176_SRR21999346_2				56.0%	49%	150 bp	150 bp	10%	39.3
GSM6665176_STAR		93.4%	36.7
GSM6665177	95.2%
GSM6665177_SRR21999347_1				53.2%	48%	150 bp	150 bp	10%	35.2
GSM6665177_SRR21999347_2				53.2%	48%	150 bp	150 bp	10%	35.2
GSM6665177_STAR		92.9%	32.7
GSM6665178	95.2%
GSM6665178_SRR21999348_1				53.9%	48%	150 bp	150 bp	10%	33.3
GSM6665178_SRR21999348_2				54.1%	48%	150 bp	150 bp	10%	33.3
GSM6665178_STAR		93.1%	31.0
GSM6665179	95.0%
GSM6665179_SRR21999349_1				51.8%	48%	150 bp	150 bp	10%	35.9
GSM6665179_SRR21999349_2				51.5%	48%	150 bp	150 bp	10%	35.9
GSM6665179_STAR		93.4%	33.5
GSM6665180	94.9%
GSM6665180_SRR21999350_1				53.7%	48%	150 bp	150 bp	10%	36.8
GSM6665180_SRR21999350_2				54.0%	48%	150 bp	150 bp	10%	36.8
GSM6665180_STAR		93.0%	34.2
GSM6665181	94.0%
GSM6665181_SRR21999351_1				55.8%	48%	150 bp	150 bp	10%	42.3
GSM6665181_SRR21999351_2				52.9%	48%	150 bp	150 bp	10%	42.3
GSM6665181_STAR		93.4%	39.5
GSM6665182	95.8%
GSM6665182_SRR21999352_1				81.2%	45%	150 bp	150 bp	20%	36.8
GSM6665182_SRR21999352_2				80.2%	45%	150 bp	150 bp	20%	36.8
GSM6665182_STAR		94.1%	34.6
GSM6665183	95.2%
GSM6665183_SRR21999353_1				58.3%	47%	150 bp	150 bp	10%	34.0
GSM6665183_SRR21999353_2				58.7%	47%	150 bp	150 bp	10%	34.0
GSM6665183_STAR		93.1%	31.7
GSM6665184	95.6%
GSM6665184_SRR21999354_1				61.7%	48%	150 bp	150 bp	10%	42.9
GSM6665184_SRR21999354_2				60.1%	48%	150 bp	150 bp	10%	42.9
GSM6665184_STAR		93.3%	40.1
GSM6665185	95.3%
GSM6665185_SRR21999355_1				53.9%	48%	150 bp	150 bp	10%	38.6
GSM6665185_SRR21999355_2				52.0%	48%	150 bp	150 bp	10%	38.6
GSM6665185_STAR		94.2%	36.4
GSM6665186	95.7%
GSM6665186_SRR21999356_1				59.5%	51%	150 bp	150 bp	10%	33.5
GSM6665186_SRR21999356_2				58.3%	51%	150 bp	150 bp	10%	33.5
GSM6665186_STAR		90.5%	30.3
GSM6665187	95.5%
GSM6665187_SRR21999357_1				58.9%	47%	150 bp	150 bp	10%	41.1
GSM6665187_SRR21999357_2				57.1%	47%	150 bp	150 bp	10%	41.1
GSM6665187_STAR		94.6%	38.9
GSM6665188	96.3%
GSM6665188_SRR21999358_1				61.9%	48%	150 bp	150 bp	10%	35.2
GSM6665188_SRR21999358_2				61.0%	48%	150 bp	150 bp	10%	35.2
GSM6665188_STAR		93.9%	33.1
GSM6665189	94.7%
GSM6665189_SRR21999359_1				65.0%	47%	150 bp	150 bp	10%	41.3
GSM6665189_SRR21999359_2				63.8%	47%	150 bp	150 bp	10%	41.3
GSM6665189_STAR		93.2%	38.5
GSM6665190	96.7%
GSM6665190_SRR21999360_1				62.4%	48%	150 bp	150 bp	10%	39.5
GSM6665190_SRR21999360_2				61.1%	48%	150 bp	150 bp	10%	39.5
GSM6665190_STAR		93.9%	37.1
GSM6665191	95.6%
GSM6665191_SRR21999361_1				61.2%	48%	150 bp	150 bp	10%	38.5
GSM6665191_SRR21999361_2				59.4%	48%	150 bp	150 bp	10%	38.5
GSM6665191_STAR		94.2%	36.3
GSM6665192	95.4%
GSM6665192_SRR21999362_1				56.5%	48%	150 bp	150 bp	10%	39.2
GSM6665192_SRR21999362_2				53.0%	48%	150 bp	150 bp	10%	39.2
GSM6665192_STAR		94.1%	36.9
GSM6665193	96.1%
GSM6665193_SRR21999363_1				56.9%	48%	150 bp	150 bp	10%	38.9
GSM6665193_SRR21999363_2				55.4%	48%	150 bp	150 bp	10%	38.9
GSM6665193_STAR		94.6%	36.8
GSM6665194	95.8%
GSM6665194_SRR21999364_1				56.5%	49%	150 bp	150 bp	10%	36.6
GSM6665194_SRR21999364_2				54.6%	49%	150 bp	150 bp	10%	36.6
GSM6665194_STAR		92.3%	33.8
GSM6665195	95.3%
GSM6665195_SRR21999365_1				54.9%	48%	150 bp	150 bp	10%	32.9
GSM6665195_SRR21999365_2				55.2%	48%	150 bp	150 bp	10%	32.9
GSM6665195_STAR		92.9%	30.6
GSM6665196	95.3%
GSM6665196_SRR21999366_1				71.5%	52%	150 bp	150 bp	10%	45.0
GSM6665196_SRR21999366_2				70.1%	53%	150 bp	150 bp	10%	45.0
GSM6665196_STAR		87.2%	39.3
GSM6665197	94.5%
GSM6665197_SRR21999367_1				50.8%	47%	150 bp	150 bp	10%	34.3
GSM6665197_SRR21999367_2				50.5%	47%	150 bp	150 bp	10%	34.3
GSM6665197_STAR		93.1%	31.9
GSM6665198	96.3%
GSM6665198_SRR21999368_1				72.6%	53%	150 bp	150 bp	10%	32.7
GSM6665198_SRR21999368_2				71.3%	53%	150 bp	150 bp	10%	32.7
GSM6665198_STAR		87.5%	28.6
GSM6665199	93.8%
GSM6665199_SRR21999369_1				50.8%	47%	150 bp	150 bp	10%	32.5
GSM6665199_SRR21999369_2				50.6%	47%	150 bp	150 bp	10%	32.5
GSM6665199_STAR		93.0%	30.2
GSM6665200	95.1%
GSM6665200_SRR21999370_1				74.2%	54%	150 bp	150 bp	30%	33.7
GSM6665200_SRR21999370_2				74.4%	54%	150 bp	150 bp	20%	33.7
GSM6665200_STAR		79.2%	26.7
GSM6665201	95.4%
GSM6665201_SRR21999371_1				52.6%	47%	150 bp	150 bp	10%	39.0
GSM6665201_SRR21999371_2				50.5%	47%	150 bp	150 bp	10%	39.0
GSM6665201_STAR		94.7%	36.9
GSM6665202	93.5%
GSM6665202_SRR21999372_1				64.7%	52%	150 bp	150 bp	30%	38.4
GSM6665202_SRR21999372_2				64.6%	52%	150 bp	150 bp	10%	38.4
GSM6665202_STAR		83.3%	32.0
GSM6665203	95.8%
GSM6665203_SRR21999373_1				57.7%	47%	150 bp	150 bp	10%	41.0
GSM6665203_SRR21999373_2				55.3%	48%	150 bp	150 bp	10%	41.0
GSM6665203_STAR		94.8%	38.9
GSM6665204	92.1%
GSM6665204_SRR21999374_1				54.7%	51%	150 bp	150 bp	10%	33.7
GSM6665204_SRR21999374_2				54.1%	51%	150 bp	150 bp	10%	33.7
GSM6665204_STAR		87.8%	29.6
GSM6665205	94.1%
GSM6665205_SRR21999375_1				51.6%	47%	150 bp	150 bp	10%	34.4
GSM6665205_SRR21999375_2				51.4%	47%	150 bp	150 bp	10%	34.4
GSM6665205_STAR		93.1%	32.0
GSM6665206	95.1%
GSM6665206_SRR21999376_1				65.3%	51%	150 bp	150 bp	10%	38.8
GSM6665206_SRR21999376_2				64.1%	51%	150 bp	150 bp	10%	38.8
GSM6665206_STAR		89.2%	34.6
GSM6665207	95.1%
GSM6665207_SRR21999377_1				51.0%	47%	150 bp	150 bp	10%	35.3
GSM6665207_SRR21999377_2				48.9%	47%	150 bp	150 bp	0%	35.3
GSM6665207_STAR		94.8%	33.5
GSM6665208	91.0%
GSM6665208_SRR21999378_1				68.7%	55%	150 bp	150 bp	10%	40.7
GSM6665208_SRR21999378_2				67.5%	55%	150 bp	150 bp	10%	40.7
GSM6665208_STAR		81.3%	33.1
GSM6665209	95.5%
GSM6665209_SRR21999379_1				52.4%	48%	150 bp	150 bp	10%	32.6
GSM6665209_SRR21999379_2				50.7%	48%	150 bp	150 bp	10%	32.6
GSM6665209_STAR		94.5%	30.8
GSM6665210	94.9%
GSM6665210_SRR21999380_1				61.6%	51%	150 bp	150 bp	10%	36.8
GSM6665210_SRR21999380_2				60.4%	51%	150 bp	150 bp	10%	36.8
GSM6665210_STAR		90.7%	33.4
GSM6665211	95.3%
GSM6665211_SRR21999381_1				55.2%	48%	150 bp	150 bp	10%	35.4
GSM6665211_SRR21999381_2				53.0%	48%	150 bp	150 bp	10%	35.4
GSM6665211_STAR		94.3%	33.3
GSM6665212	94.9%
GSM6665212_SRR21999382_1				59.4%	51%	150 bp	150 bp	10%	42.7
GSM6665212_SRR21999382_2				58.0%	51%	150 bp	150 bp	10%	42.7
GSM6665212_STAR		89.9%	38.4
GSM6665213	95.1%
GSM6665213_SRR21999383_1				52.7%	47%	150 bp	150 bp	10%	33.5
GSM6665213_SRR21999383_2				50.9%	47%	150 bp	150 bp	10%	33.5
GSM6665213_STAR		94.4%	31.6
GSM6665214	93.9%
GSM6665214_SRR21999384_1				71.1%	53%	150 bp	150 bp	30%	34.2
GSM6665214_SRR21999384_2				71.3%	54%	150 bp	150 bp	20%	34.2
GSM6665214_STAR		76.0%	26.0
GSM6665215	94.2%
GSM6665215_SRR21999385_1				58.3%	47%	150 bp	150 bp	10%	40.2
GSM6665215_SRR21999385_2				57.6%	47%	150 bp	150 bp	10%	40.2
GSM6665215_STAR		93.8%	37.7
GSM6665216	95.1%
GSM6665216_SRR21999386_1				71.6%	53%	150 bp	150 bp	20%	34.0
GSM6665216_SRR21999386_2				71.6%	53%	150 bp	150 bp	10%	34.0
GSM6665216_STAR		83.6%	28.4
GSM6665217	94.5%
GSM6665217_SRR21999387_1				51.6%	47%	150 bp	150 bp	10%	34.6
GSM6665217_SRR21999387_2				51.4%	47%	150 bp	150 bp	10%	34.6
GSM6665217_STAR		93.9%	32.5
GSM6665218	95.0%
GSM6665218_SRR21999388_1				69.4%	52%	150 bp	150 bp	10%	33.9
GSM6665218_SRR21999388_2				67.9%	52%	150 bp	150 bp	10%	33.9
GSM6665218_STAR		86.9%	29.5
GSM6665219	96.3%
GSM6665219_SRR21999389_1				59.2%	48%	150 bp	150 bp	10%	44.0
GSM6665219_SRR21999389_2				57.6%	48%	150 bp	150 bp	10%	44.0
GSM6665219_STAR		94.7%	41.6
GSM6665220	96.7%
GSM6665220_SRR21999390_1				74.1%	54%	150 bp	150 bp	10%	39.1
GSM6665220_SRR21999390_2				72.9%	54%	150 bp	150 bp	10%	39.1
GSM6665220_STAR		86.2%	33.7
GSM6665221	94.2%
GSM6665221_SRR21999391_1				52.0%	48%	150 bp	150 bp	10%	33.9
GSM6665221_SRR21999391_2				51.9%	48%	150 bp	150 bp	10%	33.9
GSM6665221_STAR		92.5%	31.3
GSM6665222	95.5%
GSM6665222_SRR21999392_1				57.0%	49%	150 bp	150 bp	10%	36.4
GSM6665222_SRR21999392_2				55.3%	49%	150 bp	150 bp	10%	36.4
GSM6665222_STAR		92.8%	33.8
GSM6665223	94.6%
GSM6665223_SRR21999393_1				57.1%	47%	150 bp	150 bp	10%	41.4
GSM6665223_SRR21999393_2				56.7%	48%	150 bp	150 bp	10%	41.4
GSM6665223_STAR		93.2%	38.6
GSM6665224	94.9%
GSM6665224_SRR21999394_1				62.8%	52%	150 bp	150 bp	10%	43.7
GSM6665224_SRR21999394_2				60.8%	52%	150 bp	150 bp	10%	43.7
GSM6665224_STAR		88.2%	38.5
GSM6665225	95.5%
GSM6665225_SRR21999395_1				56.9%	47%	150 bp	150 bp	10%	41.0
GSM6665225_SRR21999395_2				55.0%	47%	150 bp	150 bp	10%	41.0
GSM6665225_STAR		94.0%	38.6
GSM6665226	95.2%
GSM6665226_SRR21999396_1				59.0%	51%	150 bp	150 bp	10%	38.6
GSM6665226_SRR21999396_2				57.4%	51%	150 bp	150 bp	10%	38.6
GSM6665226_STAR		88.2%	34.1
GSM6665227	95.2%
GSM6665227_SRR21999397_1				52.6%	48%	150 bp	150 bp	10%	35.0
GSM6665227_SRR21999397_2				52.4%	48%	150 bp	150 bp	10%	35.0
GSM6665227_STAR		92.8%	32.5
GSM6665228	94.1%
GSM6665228_SRR21999398_1				60.4%	51%	150 bp	150 bp	10%	34.9
GSM6665228_SRR21999398_2				60.4%	51%	150 bp	150 bp	20%	34.9
GSM6665228_STAR		87.5%	30.5
GSM6665229	93.7%
GSM6665229_SRR21999399_1				61.3%	47%	150 bp	150 bp	20%	34.3
GSM6665229_SRR21999399_2				61.0%	47%	150 bp	150 bp	10%	34.3
GSM6665229_STAR		92.0%	31.6
GSM6665230	95.8%
GSM6665230_SRR21999400_1				68.4%	52%	150 bp	150 bp	10%	42.3
GSM6665230_SRR21999400_2				67.0%	52%	150 bp	150 bp	10%	42.3
GSM6665230_STAR		89.2%	37.7
GSM6665231	95.3%
GSM6665231_SRR21999401_1				62.2%	48%	150 bp	150 bp	10%	44.3
GSM6665231_SRR21999401_2				60.7%	48%	150 bp	150 bp	10%	44.3
GSM6665231_STAR		93.0%	41.2
GSM6665232	95.5%
GSM6665232_SRR21999402_1				75.6%	51%	150 bp	150 bp	10%	46.9
GSM6665232_SRR21999402_2				74.6%	51%	150 bp	150 bp	10%	46.9
GSM6665232_STAR		89.8%	42.1
GSM6665233	94.7%
GSM6665233_SRR21999403_1				51.7%	47%	150 bp	150 bp	10%	34.5
GSM6665233_SRR21999403_2				49.5%	47%	150 bp	150 bp	0%	34.5
GSM6665233_STAR		94.1%	32.5
GSM6665234	94.4%
GSM6665234_SRR21999404_1				67.8%	53%	150 bp	150 bp	30%	35.3
GSM6665234_SRR21999404_2				67.4%	54%	150 bp	150 bp	10%	35.3
GSM6665234_STAR		81.0%	28.6
GSM6665235	95.8%
GSM6665235_SRR21999405_1				57.9%	49%	150 bp	150 bp	10%	34.7
GSM6665235_SRR21999405_2				56.7%	49%	150 bp	150 bp	10%	34.7
GSM6665235_STAR		93.7%	32.6
GSM6665236	95.4%
GSM6665236_SRR21999406_1				64.0%	49%	150 bp	150 bp	10%	45.9
GSM6665236_SRR21999406_2				62.7%	49%	150 bp	150 bp	10%	45.9
GSM6665236_STAR		92.2%	42.3
GSM6665237	95.6%
GSM6665237_SRR21999407_1				61.3%	48%	150 bp	150 bp	10%	48.3
GSM6665237_SRR21999407_2				59.6%	48%	150 bp	150 bp	10%	48.3
GSM6665237_STAR		93.6%	45.3
GSM6665238	94.5%
GSM6665238_SRR21999408_1				63.6%	51%	150 bp	150 bp	10%	41.9
GSM6665238_SRR21999408_2				62.4%	51%	150 bp	150 bp	10%	41.9
GSM6665238_STAR		89.2%	37.4
GSM6665239	95.5%
GSM6665239_SRR21999409_1				58.0%	47%	150 bp	150 bp	10%	40.7
GSM6665239_SRR21999409_2				56.8%	47%	150 bp	150 bp	10%	40.7
GSM6665239_STAR		94.8%	38.6

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

All samples have sequences of a single length (150bp).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
CTCGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATC	78	9070504	0.1447%
CTTAATTCTTCCAGGGTTTGGAATTATTTCACATGTAGTTACCTATTACT	45	2930603	0.0468%
GTGGGCTTTTGCTCATGTGTCATTTAGGGTATAGCCTGAGAATAGTGGGA	40	2473456	0.0395%
CGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGG	24	2099195	0.0335%
CCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCA	18	1447181	0.0231%
CGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGATCGCT	18	1731078	0.0276%
CTCATCAATAGATAGAAACGTATAGGAATAGTCAAACTACATCTACGAAG	16	844419	0.0135%
GCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGAT	15	1210293	0.0193%
GCCCCCTACTGTGAATAAGAAGATAAACCCTAAGGCTCATAATATGGCGG	13	722800	0.0115%
CCTCATCAATAGATAGAAACGTATAGGAATAGTCAAACTACATCTACGAA	13	693979	0.0111%
GTGTAAGCATCTGGATAATCAGAGTAACGACGAGGTATCCCCGCTAATCC	12	622501	0.0099%
GGTTTATCTTCTTATTCACAGTAGGGGGCCTAACAGGGATCGTACTATCT	11	622131	0.0099%
TCTCGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGAT	10	793950	0.0127%
AATTATTTCACATGTAGTTACCTATTACTCTGGAAAAAAAGAACCCTTCG	9	541348	0.0086%
CAGGGATCGTACTATCTAACTCATCCCTTGACATTGTACTTCATGATACA	9	526128	0.0084%
GGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTT	8	525928	0.0084%
AGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGT	8	443672	0.0071%
CCCAGCTACTCGGGAGGCTGAGACAGGAGGATCGCTTGAGTCCAGGAGTT	7	500941	0.0080%
CCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATC	7	445322	0.0071%
TGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGA	7	449432	0.0072%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks