MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-01, 13:26 CDT based on data in: /scratch/g/akwitek/wdemos/GSE199986_B

General Statistics

Showing ⁴⁰³/₄₀₃ rows and ⁷/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GSM6001809	88.7%
GSM6001809_SRR18574085_1				92.8%	52%	100 bp	100 bp	40%	66.3
GSM6001809_SRR18574085_2				90.4%	52%	100 bp	100 bp	10%	66.3
GSM6001809_STAR		23.5%	15.6
GSM6001810	80.7%
GSM6001810_SRR18574086_1				92.1%	53%	101 bp	101 bp	40%	62.3
GSM6001810_SRR18574086_2				90.9%	53%	101 bp	101 bp	40%	62.3
GSM6001810_STAR		32.2%	20.1
GSM6001811	83.3%
GSM6001811_SRR18574087_1				94.2%	52%	100 bp	100 bp	40%	92.0
GSM6001811_SRR18574087_2				92.1%	52%	100 bp	100 bp	30%	92.0
GSM6001811_STAR		20.1%	18.5
GSM6001812	58.1%
GSM6001812_SRR18574088_1				91.3%	53%	150 bp	150 bp	50%	134.8
GSM6001812_SRR18574088_2				90.9%	53%	150 bp	150 bp	40%	134.8
GSM6001812_STAR		38.0%	51.2
GSM6001813	37.5%
GSM6001813_SRR18574089_1				94.4%	52%	150 bp	150 bp	50%	107.5
GSM6001813_SRR18574089_2				93.4%	52%	150 bp	150 bp	50%	107.5
GSM6001813_STAR		21.1%	22.6
GSM6001814	68.0%
GSM6001814_SRR18574090_1				94.4%	56%	151 bp	151 bp	50%	69.1
GSM6001814_SRR18574090_2				81.3%	55%	151 bp	151 bp	50%	69.1
GSM6001814_STAR		27.9%	19.3
GSM6001815	35.9%
GSM6001815_SRR18574091_1				87.5%	54%	151 bp	151 bp	50%	10.0
GSM6001815_SRR18574091_2				84.6%	55%	151 bp	151 bp	50%	10.0
GSM6001815_SRR18574092_1				85.8%	54%	151 bp	151 bp	50%	9.3
GSM6001815_SRR18574092_2				83.0%	55%	151 bp	151 bp	50%	9.3
GSM6001815_STAR		16.3%	3.2
GSM6001816	72.6%
GSM6001816_SRR18574093_1				95.7%	56%	150 bp	150 bp	50%	107.9
GSM6001816_SRR18574093_2				94.6%	57%	150 bp	150 bp	50%	107.9
GSM6001816_STAR		21.6%	23.3
GSM6001817	58.5%
GSM6001817_SRR18574094_1				94.3%	56%	151 bp	151 bp	50%	82.5
GSM6001817_SRR18574094_2				81.4%	55%	151 bp	151 bp	50%	82.5
GSM6001817_STAR		22.9%	18.9
GSM6001818	82.2%
GSM6001818_SRR18574095_1				74.9%	43%	100 bp	100 bp	20%	42.9
GSM6001818_SRR18574095_2				72.8%	43%	100 bp	100 bp	20%	42.9
GSM6001818_STAR		78.2%	33.6
GSM6001819	56.4%
GSM6001819_SRR18574096_1				68.7%	48%	151 bp	151 bp	30%	133.4
GSM6001819_SRR18574096_2				63.8%	48%	151 bp	151 bp	30%	133.4
GSM6001819_STAR		60.4%	80.6
GSM6001820	79.1%
GSM6001820_SRR18574097_1				82.5%	47%	101 bp	101 bp	30%	81.7
GSM6001820_SRR18574097_2				81.5%	47%	101 bp	101 bp	30%	81.7
GSM6001820_STAR		72.3%	59.1
GSM6001821	35.4%
GSM6001821_SRR18574098_1				72.9%	48%	151 bp	151 bp	40%	54.1
GSM6001821_SRR18574098_2				66.4%	49%	151 bp	151 bp	30%	54.1
GSM6001821_STAR		44.1%	23.9
GSM6001822	79.1%
GSM6001822_SRR18574099_1				82.3%	49%	100 bp	100 bp	40%	89.8
GSM6001822_SRR18574099_2				79.5%	49%	100 bp	100 bp	20%	89.8
GSM6001822_STAR		60.3%	54.1
GSM6001823	87.2%
GSM6001823_SRR18574100_1				75.8%	46%	101 bp	101 bp	20%	72.3
GSM6001823_SRR18574100_2				74.9%	47%	101 bp	101 bp	20%	72.3
GSM6001823_STAR		80.7%	58.4
GSM6001824	87.5%
GSM6001824_SRR18574101_1				84.1%	49%	101 bp	101 bp	40%	86.2
GSM6001824_SRR18574101_2				80.9%	49%	101 bp	101 bp	30%	86.2
GSM6001824_STAR		39.0%	33.6
GSM6001825	75.6%
GSM6001825_SRR18574102_1				75.9%	47%	100 bp	100 bp	20%	50.2
GSM6001825_SRR18574102_2				68.5%	47%	100 bp	100 bp	10%	50.2
GSM6001825_STAR		65.6%	32.9
GSM6001826	80.1%
GSM6001826_SRR18574103_1				84.0%	50%	100 bp	100 bp	30%	45.5
GSM6001826_SRR18574103_2				78.3%	50%	100 bp	100 bp	20%	45.5
GSM6001826_STAR		41.6%	18.9
GSM6001827	86.3%
GSM6001827_SRR18574104_1				76.5%	47%	101 bp	101 bp	20%	72.1
GSM6001827_SRR18574104_2				75.9%	47%	101 bp	101 bp	20%	72.1
GSM6001827_STAR		80.3%	57.9
GSM6001828	89.3%
GSM6001828_SRR18574105_1				76.1%	40%	100 bp	100 bp	20%	53.6
GSM6001828_SRR18574105_2				73.3%	40%	100 bp	100 bp	20%	53.6
GSM6001828_STAR		85.8%	46.0
GSM6001829	84.7%
GSM6001829_SRR18574106_1				78.7%	48%	101 bp	101 bp	20%	71.0
GSM6001829_SRR18574106_2				78.6%	48%	101 bp	101 bp	20%	71.0
GSM6001829_STAR		77.2%	54.8
GSM6001830	85.3%
GSM6001830_SRR18574107_1				84.2%	47%	101 bp	101 bp	40%	65.3
GSM6001830_SRR18574107_2				80.8%	47%	101 bp	101 bp	30%	65.3
GSM6001830_STAR		47.8%	31.2
GSM6001831	75.4%
GSM6001831_SRR18574108_1				78.8%	47%	100 bp	100 bp	20%	46.6
GSM6001831_SRR18574108_2				73.0%	47%	100 bp	100 bp	10%	46.6
GSM6001831_STAR		65.1%	30.3
GSM6001832	77.9%
GSM6001832_SRR18574109_1				81.0%	49%	100 bp	100 bp	20%	37.7
GSM6001832_SRR18574109_2				72.6%	49%	100 bp	100 bp	10%	37.7
GSM6001832_STAR		62.9%	23.7
GSM6001833	88.3%
GSM6001833_SRR18574110_1				76.9%	47%	101 bp	101 bp	20%	81.1
GSM6001833_SRR18574110_2				74.7%	47%	101 bp	101 bp	10%	81.1
GSM6001833_STAR		73.5%	59.6
GSM6001834	80.5%
GSM6001834_SRR18574111_1				72.8%	40%	100 bp	100 bp	20%	38.6
GSM6001834_SRR18574111_2				69.1%	40%	100 bp	100 bp	20%	38.6
GSM6001834_STAR		79.7%	30.8
GSM6001835	89.7%
GSM6001835_SRR18574112_1				81.6%	46%	100 bp	100 bp	20%	89.2
GSM6001835_SRR18574112_2				79.8%	47%	100 bp	100 bp	10%	89.2
GSM6001835_STAR		73.0%	65.1
GSM6001836	86.9%
GSM6001836_SRR18574113_1				80.0%	48%	101 bp	101 bp	20%	69.0
GSM6001836_SRR18574113_2				75.8%	48%	101 bp	101 bp	10%	69.0
GSM6001836_STAR		68.1%	47.0
GSM6001837	86.7%
GSM6001837_SRR18574114_1				77.3%	47%	101 bp	101 bp	20%	56.0
GSM6001837_SRR18574114_2				75.2%	47%	101 bp	101 bp	20%	56.0
GSM6001837_STAR		59.2%	33.2
GSM6001838	82.8%
GSM6001838_SRR18574115_1				88.8%	53%	100 bp	100 bp	30%	40.4
GSM6001838_SRR18574115_2				83.1%	53%	100 bp	100 bp	10%	40.4
GSM6001838_STAR		27.0%	10.9
GSM6001839	71.5%
GSM6001839_SRR18574116_1				79.2%	48%	100 bp	100 bp	30%	41.7
GSM6001839_SRR18574116_2				72.2%	47%	100 bp	100 bp	10%	41.7
GSM6001839_STAR		64.6%	26.9
GSM6001840	35.8%
GSM6001840_SRR18574117_1				75.7%	48%	151 bp	151 bp	40%	154.8
GSM6001840_SRR18574117_2				73.2%	48%	151 bp	151 bp	40%	154.8
GSM6001840_STAR		48.4%	75.0
GSM6001841	47.9%
GSM6001841_SRR18574118_1				64.3%	46%	151 bp	151 bp	30%	45.5
GSM6001841_SRR18574118_2				58.1%	46%	151 bp	151 bp	20%	45.5
GSM6001841_STAR		59.8%	27.2
GSM6001842	75.6%
GSM6001842_SRR18574119_1				75.9%	39%	100 bp	100 bp	30%	53.7
GSM6001842_SRR18574119_2				71.6%	39%	100 bp	100 bp	30%	53.7
GSM6001842_STAR		77.0%	41.3
GSM6001843	87.4%
GSM6001843_SRR18574120_1				71.6%	46%	101 bp	101 bp	20%	58.3
GSM6001843_SRR18574120_2				67.1%	46%	101 bp	101 bp	10%	58.3
GSM6001843_STAR		82.0%	47.8
GSM6001844	83.8%
GSM6001844_SRR18574121_1				74.5%	46%	101 bp	101 bp	20%	62.9
GSM6001844_SRR18574121_2				72.2%	46%	101 bp	101 bp	20%	62.9
GSM6001844_STAR		74.6%	46.9
GSM6001845	42.1%
GSM6001845_SRR18574122_1				67.0%	46%	151 bp	151 bp	40%	63.4
GSM6001845_SRR18574122_2				61.1%	46%	151 bp	151 bp	30%	63.4
GSM6001845_STAR		55.8%	35.3
GSM6001846	71.8%
GSM6001846_SRR18574123_1				85.2%	37%	100 bp	100 bp	30%	46.1
GSM6001846_SRR18574123_2				82.0%	36%	100 bp	100 bp	30%	46.1
GSM6001846_STAR		71.3%	32.9
GSM6001901	86.3%
GSM6001901_SRR18574179_1				78.6%	47%	101 bp	101 bp	20%	60.9
GSM6001901_SRR18574179_2				76.9%	47%	101 bp	101 bp	10%	60.9
GSM6001901_STAR		73.1%	44.5
GSM6001902	78.8%
GSM6001902_SRR18574180_1				79.6%	47%	101 bp	101 bp	30%	43.9
GSM6001902_SRR18574180_2				75.2%	47%	101 bp	101 bp	30%	43.9
GSM6001902_STAR		66.0%	29.0
GSM6001903	77.2%
GSM6001903_SRR18574181_1				84.9%	46%	101 bp	101 bp	30%	69.9
GSM6001903_SRR18574181_2				82.8%	46%	101 bp	101 bp	20%	69.9
GSM6001903_STAR		60.7%	42.4
GSM6001904	75.0%
GSM6001904_SRR18574182_1				82.6%	50%	100 bp	100 bp	30%	50.0
GSM6001904_SRR18574182_2				78.2%	50%	100 bp	100 bp	20%	50.0
GSM6001904_STAR		50.7%	25.3
GSM6001905	64.6%
GSM6001905_SRR18574183_1				67.3%	47%	151 bp	151 bp	27%	20.9
GSM6001905_SRR18574183_2				56.6%	47%	151 bp	151 bp	27%	20.9
GSM6001905_STAR		65.2%	13.6
GSM6001906	77.2%
GSM6001906_SRR18574184_1				89.6%	52%	101 bp	101 bp	40%	72.7
GSM6001906_SRR18574184_2				89.0%	53%	101 bp	101 bp	30%	72.7
GSM6001906_STAR		43.3%	31.5
GSM6001907	72.5%
GSM6001907_SRR18574185_1				95.1%	54%	101 bp	101 bp	50%	54.0
GSM6001907_SRR18574185_2				92.8%	54%	101 bp	101 bp	40%	54.0
GSM6001907_STAR		29.1%	15.7
GSM6001908	90.3%
GSM6001908_SRR18574186_1				95.1%	54%	101 bp	101 bp	40%	75.0
GSM6001908_SRR18574186_2				93.9%	54%	101 bp	101 bp	20%	75.0
GSM6001908_STAR		11.3%	8.5
GSM6001909	87.9%
GSM6001909_SRR18574187_1				92.9%	52%	101 bp	101 bp	40%	65.6
GSM6001909_SRR18574187_2				91.4%	52%	101 bp	101 bp	20%	65.6
GSM6001909_STAR		26.3%	17.3
GSM6001910	84.7%
GSM6001910_SRR18574188_1				93.5%	53%	101 bp	101 bp	50%	70.9
GSM6001910_SRR18574188_2				92.1%	53%	101 bp	101 bp	30%	70.9
GSM6001910_STAR		21.1%	15.0
GSM6001911	87.6%
GSM6001911_SRR18574189_1				89.7%	51%	101 bp	101 bp	40%	75.1
GSM6001911_SRR18574189_2				88.4%	50%	101 bp	101 bp	30%	75.1
GSM6001911_STAR		44.8%	33.6
GSM6001912	80.5%
GSM6001912_SRR18574190_1				89.5%	53%	101 bp	101 bp	40%	60.8
GSM6001912_SRR18574190_2				88.7%	53%	101 bp	101 bp	30%	60.8
GSM6001912_STAR		45.8%	27.9
GSM6001913	87.5%
GSM6001913_SRR18574191_1				95.8%	55%	101 bp	101 bp	40%	94.0
GSM6001913_SRR18574191_2				94.9%	55%	101 bp	101 bp	30%	94.0
GSM6001913_STAR		12.7%	12.0
GSM6001914	87.0%
GSM6001914_SRR18574192_1				95.8%	52%	100 bp	100 bp	40%	87.7
GSM6001914_SRR18574192_2				93.3%	52%	100 bp	100 bp	20%	87.7
GSM6001914_STAR		17.1%	15.0
GSM6001915	78.4%
GSM6001915_SRR18574193_1				95.3%	53%	101 bp	101 bp	50%	68.3
GSM6001915_SRR18574193_2				94.1%	53%	101 bp	101 bp	50%	68.3
GSM6001915_STAR		19.3%	13.2
GSM6001916	83.1%
GSM6001916_SRR18574194_1				88.0%	51%	101 bp	101 bp	40%	70.1
GSM6001916_SRR18574194_2				87.6%	51%	101 bp	101 bp	40%	70.1
GSM6001916_STAR		58.2%	40.8
GSM6001917	53.7%
GSM6001917_SRR18574195_1				96.7%	48%	101 bp	101 bp	40%	56.8
GSM6001917_SRR18574195_2				93.2%	48%	101 bp	101 bp	30%	56.8
GSM6001917_STAR		44.1%	25.1
GSM6001918	79.0%
GSM6001918_SRR18574196_1				90.1%	53%	101 bp	101 bp	40%	76.3
GSM6001918_SRR18574196_2				88.3%	53%	101 bp	101 bp	40%	76.3
GSM6001918_STAR		38.8%	29.6
GSM7847877	49.3%
GSM7847877_SRR26424637_1				87.1%	51%	150 bp	150 bp	45%	125.8
GSM7847877_SRR26424637_2				38.5%	52%	150 bp	150 bp	18%	125.8
GSM7847877_STAR		46.8%	58.9
GSM7847878	38.9%
GSM7847878_SRR26424638_1				88.3%	49%	150 bp	150 bp	36%	160.3
GSM7847878_SRR26424638_2				82.2%	49%	150 bp	150 bp	27%	160.3
GSM7847878_STAR		42.5%	68.2
GSM7847879	40.2%
GSM7847879_SRR26424639_1				87.6%	47%	150 bp	150 bp	36%	85.7
GSM7847879_SRR26424639_2				77.5%	48%	150 bp	150 bp	36%	85.7
GSM7847879_STAR		44.3%	37.9
GSM7847880	49.8%
GSM7847880_SRR26424640_1				91.4%	47%	150 bp	150 bp	45%	128.1
GSM7847880_SRR26424640_2				93.4%	47%	150 bp	150 bp	36%	128.1
GSM7847880_STAR		59.6%	76.4
GSM7847881	38.0%
GSM7847881_SRR26424641_1				89.6%	53%	150 bp	150 bp	45%	128.6
GSM7847881_SRR26424641_2				52.7%	53%	150 bp	150 bp	27%	128.6
GSM7847881_STAR		25.5%	32.8
GSM7847882	44.1%
GSM7847882_SRR26424642_1				84.6%	46%	150 bp	150 bp	27%	167.9
GSM7847882_SRR26424642_2				73.9%	47%	150 bp	150 bp	27%	167.9
GSM7847882_STAR		53.9%	90.5
GSM7847883	43.4%
GSM7847883_SRR26424643_1				88.2%	49%	150 bp	150 bp	36%	128.6
GSM7847883_SRR26424643_2				37.5%	50%	150 bp	150 bp	27%	128.6
GSM7847883_STAR		48.8%	62.7
GSM7847884	54.6%
GSM7847884_SRR26424644_1				95.5%	45%	150 bp	150 bp	36%	147.9
GSM7847884_SRR26424644_2				92.5%	45%	150 bp	150 bp	36%	147.9
GSM7847884_STAR		60.3%	89.1
GSM7847885	45.2%
GSM7847885_SRR26424645_1				82.6%	47%	150 bp	150 bp	36%	123.7
GSM7847885_SRR26424645_2				82.0%	47%	150 bp	150 bp	36%	123.7
GSM7847885_STAR		56.7%	70.2
GSM7847886	49.0%
GSM7847886_SRR26424646_1				81.1%	48%	150 bp	150 bp	27%	143.2
GSM7847886_SRR26424646_2				81.5%	48%	150 bp	150 bp	18%	143.2
GSM7847886_STAR		56.2%	80.5
GSM7847887	46.8%
GSM7847887_SRR26424647_1				80.7%	47%	150 bp	150 bp	45%	128.9
GSM7847887_SRR26424647_2				80.6%	47%	150 bp	150 bp	45%	128.9
GSM7847887_STAR		57.6%	74.3
GSM7847888	43.9%
GSM7847888_SRR26424648_1				92.0%	49%	150 bp	150 bp	36%	104.5
GSM7847888_SRR26424648_2				51.6%	50%	150 bp	150 bp	27%	104.5
GSM7847888_STAR		46.4%	48.5
GSM7847889	51.8%
GSM7847889_SRR26424649_1				80.5%	47%	150 bp	150 bp	36%	136.3
GSM7847889_SRR26424649_2				79.5%	46%	150 bp	150 bp	36%	136.3
GSM7847889_STAR		60.3%	82.2
GSM7847890	48.9%
GSM7847890_SRR26424650_1				83.8%	46%	150 bp	150 bp	36%	122.4
GSM7847890_SRR26424650_2				82.4%	47%	150 bp	150 bp	36%	122.4
GSM7847890_STAR		57.5%	70.3
GSM7847891	44.7%
GSM7847891_SRR26424651_1				88.4%	51%	150 bp	150 bp	45%	122.9
GSM7847891_SRR26424651_2				51.7%	50%	150 bp	150 bp	27%	122.9
GSM7847891_STAR		40.8%	50.1
GSM7847892	49.4%
GSM7847892_SRR26424652_1				88.0%	50%	150 bp	150 bp	45%	111.6
GSM7847892_SRR26424652_2				50.7%	50%	150 bp	150 bp	27%	111.6
GSM7847892_STAR		46.9%	52.3
GSM7847893_SRR26424653_1				89.4%	48%	150 bp	150 bp	36%	201.6
GSM7847893_SRR26424653_2				81.7%	47%	150 bp	150 bp	36%	201.6
GSM7847893_STAR		38.4%	77.5
GSM7847894	51.0%
GSM7847894_SRR26424654_1				82.2%	48%	150 bp	150 bp	27%	117.2
GSM7847894_SRR26424654_2				76.3%	49%	150 bp	150 bp	18%	117.2
GSM7847894_STAR		55.3%	64.8
GSM7847895	83.5%
GSM7847895_SRR26424655_1				77.4%	37%	100 bp	100 bp	18%	48.5
GSM7847895_SRR26424655_2				73.2%	37%	100 bp	100 bp	18%	48.5
GSM7847895_STAR		83.3%	40.4
GSM7847896	48.1%
GSM7847896_SRR26424656_1				90.6%	47%	150 bp	150 bp	45%	132.3
GSM7847896_SRR26424656_2				92.0%	48%	150 bp	150 bp	36%	132.3
GSM7847896_STAR		55.4%	73.3
GSM7847897	48.2%
GSM7847897_SRR26424657_1				83.6%	46%	150 bp	150 bp	45%	133.2
GSM7847897_SRR26424657_2				85.1%	46%	150 bp	150 bp	36%	133.2
GSM7847897_STAR		60.4%	80.5
GSM7847898	32.5%
GSM7847898_SRR26424658_1				90.0%	49%	150 bp	150 bp	36%	115.1
GSM7847898_SRR26424658_2				44.5%	50%	150 bp	150 bp	27%	115.1
GSM7847898_STAR		40.7%	46.9
GSM7847899	52.3%
GSM7847899_SRR26424659_1				80.2%	46%	150 bp	150 bp	36%	133.1
GSM7847899_SRR26424659_2				79.9%	46%	150 bp	150 bp	36%	133.1
GSM7847899_STAR		61.2%	81.4
GSM7847900	43.1%
GSM7847900_SRR26424660_1				81.1%	47%	150 bp	150 bp	36%	114.2
GSM7847900_SRR26424660_2				80.9%	47%	150 bp	150 bp	36%	114.2
GSM7847900_STAR		53.5%	61.1
GSM7847901_SRR26424661_1				91.8%	50%	150 bp	150 bp	36%	95.4
GSM7847901_SRR26424661_2				51.5%	49%	150 bp	150 bp	36%	95.4
GSM7847901_STAR		30.5%	29.1
GSM7847902	41.5%
GSM7847902_SRR26424662_1				86.5%	47%	150 bp	150 bp	45%	110.0
GSM7847902_SRR26424662_2				76.0%	47%	150 bp	150 bp	36%	110.0
GSM7847902_STAR		51.3%	56.4
GSM7847903	48.1%
GSM7847903_SRR26424663_1				83.8%	47%	150 bp	150 bp	36%	116.0
GSM7847903_SRR26424663_2				40.5%	48%	150 bp	150 bp	18%	116.0
GSM7847903_STAR		49.7%	57.7
GSM7847904	40.6%
GSM7847904_SRR26424664_1				84.9%	49%	150 bp	150 bp	36%	91.8
GSM7847904_SRR26424664_2				79.8%	48%	150 bp	150 bp	27%	91.8
GSM7847904_STAR		46.5%	42.6
GSM7847905	50.0%
GSM7847905_SRR26424665_1				83.6%	46%	150 bp	150 bp	36%	133.5
GSM7847905_SRR26424665_2				75.1%	47%	150 bp	150 bp	36%	133.5
GSM7847905_STAR		58.9%	78.6
GSM7847906	37.3%
GSM7847906_SRR26424666_1				90.6%	49%	150 bp	150 bp	36%	116.2
GSM7847906_SRR26424666_2				63.6%	49%	150 bp	150 bp	36%	116.2
GSM7847906_STAR		41.3%	48.0
GSM7847907	47.2%
GSM7847907_SRR26424667_1				90.5%	50%	150 bp	150 bp	45%	124.5
GSM7847907_SRR26424667_2				62.9%	50%	150 bp	150 bp	45%	124.5
GSM7847907_STAR		41.6%	51.8
GSM7847908_SRR26424668_1				79.6%	47%	150 bp	150 bp	45%	102.5
GSM7847908_SRR26424668_2				73.3%	48%	150 bp	150 bp	36%	102.5
GSM7847908_STAR		44.1%	45.2
GSM7847909	45.0%
GSM7847909_SRR26424669_1				78.6%	47%	150 bp	150 bp	36%	111.5
GSM7847909_SRR26424669_2				71.6%	48%	150 bp	150 bp	18%	111.5
GSM7847909_STAR		54.4%	60.7
GSM7847910	45.2%
GSM7847910_SRR26424670_1				89.1%	51%	150 bp	150 bp	45%	106.4
GSM7847910_SRR26424670_2				50.7%	51%	150 bp	150 bp	27%	106.4
GSM7847910_STAR		39.2%	41.7
GSM7847911	42.4%
GSM7847911_SRR26424671_1				90.4%	50%	150 bp	150 bp	36%	126.0
GSM7847911_SRR26424671_2				55.6%	50%	150 bp	150 bp	27%	126.0
GSM7847911_STAR		46.2%	58.1
GSM7847912	44.8%
GSM7847912_SRR26424672_1				85.5%	48%	150 bp	150 bp	36%	110.2
GSM7847912_SRR26424672_2				80.2%	49%	150 bp	150 bp	27%	110.2
GSM7847912_STAR		52.0%	57.3
GSM7847913	38.5%
GSM7847913_SRR26424673_1				87.6%	47%	150 bp	150 bp	36%	190.0
GSM7847913_SRR26424673_2				79.4%	48%	150 bp	150 bp	27%	190.0
GSM7847913_STAR		47.9%	91.0
GSM7847914	48.7%
GSM7847914_SRR26424674_1				84.6%	47%	150 bp	150 bp	45%	144.9
GSM7847914_SRR26424674_2				73.5%	47%	150 bp	150 bp	45%	144.9
GSM7847914_STAR		58.2%	84.4
GSM7847915	78.2%
GSM7847915_SRR26424675_1				78.8%	40%	100 bp	100 bp	18%	64.0
GSM7847915_SRR26424675_2				73.7%	40%	100 bp	100 bp	27%	64.0
GSM7847915_STAR		78.2%	50.1
GSM7847916	49.2%
GSM7847916_SRR26424676_1				82.0%	46%	150 bp	150 bp	36%	121.9
GSM7847916_SRR26424676_2				73.9%	46%	150 bp	150 bp	36%	121.9
GSM7847916_STAR		59.6%	72.6
GSM7847917	45.5%
GSM7847917_SRR26424677_1				84.4%	48%	150 bp	150 bp	27%	122.4
GSM7847917_SRR26424677_2				39.6%	48%	150 bp	150 bp	9%	122.4
GSM7847917_STAR		55.2%	67.5
GSM7847918	36.3%
GSM7847918_SRR26424678_1				84.6%	48%	150 bp	150 bp	36%	132.5
GSM7847918_SRR26424678_2				78.2%	49%	150 bp	150 bp	27%	132.5
GSM7847918_STAR		45.0%	59.6
GSM7847919	53.5%
GSM7847919_SRR26424679_1				88.2%	46%	150 bp	150 bp	45%	122.6
GSM7847919_SRR26424679_2				89.9%	46%	150 bp	150 bp	36%	122.6
GSM7847919_STAR		61.5%	75.3
GSM7847920	41.0%
GSM7847920_SRR26424680_1				87.7%	50%	150 bp	150 bp	36%	121.4
GSM7847920_SRR26424680_2				40.0%	50%	150 bp	150 bp	27%	121.4
GSM7847920_STAR		45.8%	55.6
GSM7847921	48.0%
GSM7847921_SRR26424681_1				90.6%	48%	150 bp	150 bp	36%	108.2
GSM7847921_SRR26424681_2				55.7%	48%	150 bp	150 bp	36%	108.2
GSM7847921_STAR		53.9%	58.3

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

All samples have sequences of a single length (100bp , 101bp , 150bp , 151bp). See the General Statistics Table.

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
CCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATG	93	58903593	0.3150%
CTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGT	92	43469902	0.2324%
GTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGG	87	30249920	0.1617%
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT	87	46302660	0.2476%
CTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCC	86	33299822	0.1781%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	86	45466339	0.2431%
CCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCA	83	41354347	0.2211%
CTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGA	80	33096427	0.1770%
CCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTG	77	33255565	0.1778%
GTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTGA	77	25280644	0.1352%
GGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGA	75	23492320	0.1256%
GCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGG	74	21641520	0.1157%
CAGGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCG	69	21341862	0.1141%
CAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAG	67	18433294	0.0986%
CCCCAACCGAAATTTTTTAGTTCATATTTATTTTGTTTTAGCCCATTAGG	66	13479829	0.0721%
GCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGAT	64	18072838	0.0966%
CTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATGC	63	22980528	0.1229%
CCCAGCTACTCGGGAGGCTGAGACAGGAGGATCGCTTGAGTCCAGGAGTT	62	20070747	0.1073%
CGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGG	62	37868008	0.2025%
GCTAGGTTTATTTATTGTACATATATACTTTATTGAGATTTTTTTCATAA	61	7942802	0.0425%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks