MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-29, 14:11 CDT based on data in: /scratch/g/akwitek/wdemos/GSE199986_A

General Statistics

Showing ⁴⁰²/₄₀₂ rows and ⁷/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GSM6001763	84.4%
GSM6001763_SRR18574038_1				87.6%	50%	101 bp	101 bp	40%	76.6
GSM6001763_SRR18574038_2				87.3%	50%	101 bp	101 bp	30%	76.6
GSM6001763_STAR		61.7%	47.3
GSM6001764	86.1%
GSM6001764_SRR18574039_1				86.8%	49%	101 bp	101 bp	30%	76.8
GSM6001764_SRR18574039_2				85.0%	49%	101 bp	101 bp	20%	76.8
GSM6001764_STAR		56.6%	43.4
GSM6001765	90.7%
GSM6001765_SRR18574040_1				92.5%	53%	101 bp	101 bp	40%	57.1
GSM6001765_SRR18574040_2				91.5%	53%	101 bp	101 bp	20%	57.1
GSM6001765_STAR		22.4%	12.8
GSM6001766	79.4%
GSM6001766_SRR18574041_1				83.6%	46%	100 bp	100 bp	30%	90.7
GSM6001766_SRR18574041_2				80.8%	46%	100 bp	100 bp	10%	90.7
GSM6001766_STAR		72.8%	66.0
GSM6001767	75.4%
GSM6001767_SRR18574042_1				88.3%	43%	100 bp	100 bp	30%	59.0
GSM6001767_SRR18574042_2				84.9%	43%	100 bp	100 bp	30%	59.0
GSM6001767_STAR		72.9%	43.0
GSM6001768	80.4%
GSM6001768_SRR18574043_1				83.4%	48%	101 bp	101 bp	40%	61.0
GSM6001768_SRR18574043_2				80.7%	49%	101 bp	101 bp	40%	61.0
GSM6001768_STAR		65.7%	40.1
GSM6001769	85.9%
GSM6001769_SRR18574044_1				78.2%	40%	100 bp	100 bp	20%	86.1
GSM6001769_SRR18574044_2				73.1%	40%	100 bp	100 bp	20%	86.1
GSM6001769_STAR		83.8%	72.1
GSM6001770	83.7%
GSM6001770_SRR18574045_1				82.8%	38%	100 bp	100 bp	20%	70.5
GSM6001770_SRR18574045_2				79.0%	38%	100 bp	100 bp	30%	70.5
GSM6001770_STAR		83.1%	58.6
GSM6001771	69.9%
GSM6001771_SRR18574046_1				92.6%	49%	101 bp	101 bp	40%	64.5
GSM6001771_SRR18574046_2				90.8%	49%	101 bp	101 bp	40%	64.5
GSM6001771_STAR		56.0%	36.1
GSM6001772	82.4%
GSM6001772_SRR18574047_1				80.3%	41%	100 bp	100 bp	20%	84.1
GSM6001772_SRR18574047_2				77.5%	41%	100 bp	100 bp	20%	84.1
GSM6001772_STAR		76.4%	64.3
GSM6001773	83.8%
GSM6001773_SRR18574048_1				88.1%	40%	100 bp	100 bp	20%	96.9
GSM6001773_SRR18574048_2				83.9%	40%	100 bp	100 bp	20%	96.9
GSM6001773_STAR		81.7%	79.2
GSM6001774	87.6%
GSM6001774_SRR18574049_1				87.5%	50%	101 bp	101 bp	30%	58.9
GSM6001774_SRR18574049_2				86.7%	50%	101 bp	101 bp	20%	58.9
GSM6001774_STAR		44.6%	26.3
GSM6001775	41.0%
GSM6001775_SRR18574050_1				73.8%	50%	151 bp	151 bp	50%	47.7
GSM6001775_SRR18574050_2				67.1%	49%	151 bp	151 bp	30%	47.7
GSM6001775_STAR		47.1%	22.5
GSM6001776	78.8%
GSM6001776_SRR18574051_1				77.3%	47%	100 bp	100 bp	30%	48.9
GSM6001776_SRR18574051_2				72.3%	47%	100 bp	100 bp	10%	48.9
GSM6001776_STAR		68.4%	33.5
GSM6001777	81.5%
GSM6001777_SRR18574052_1				81.4%	48%	100 bp	100 bp	20%	46.8
GSM6001777_SRR18574052_2				75.9%	48%	100 bp	100 bp	10%	46.8
GSM6001777_STAR		57.2%	26.8
GSM6001778	86.8%
GSM6001778_SRR18574053_1				81.4%	49%	101 bp	101 bp	20%	70.3
GSM6001778_SRR18574053_2				80.7%	49%	101 bp	101 bp	10%	70.3
GSM6001778_STAR		66.7%	46.9
GSM6001779	76.3%
GSM6001779_SRR18574054_1				87.0%	40%	100 bp	100 bp	30%	76.9
GSM6001779_SRR18574054_2				84.0%	40%	100 bp	100 bp	30%	76.9
GSM6001779_STAR		73.9%	56.9
GSM6001780	77.5%
GSM6001780_SRR18574055_1				87.3%	50%	101 bp	101 bp	40%	69.9
GSM6001780_SRR18574055_2				86.4%	50%	101 bp	101 bp	20%	69.9
GSM6001780_STAR		58.6%	41.0
GSM6001781	88.2%
GSM6001781_SRR18574056_1				83.0%	47%	101 bp	101 bp	20%	101.1
GSM6001781_SRR18574056_2				82.0%	47%	101 bp	101 bp	10%	101.1
GSM6001781_STAR		67.1%	67.9
GSM6001782	86.7%
GSM6001782_SRR18574057_1				77.5%	41%	100 bp	100 bp	20%	42.9
GSM6001782_SRR18574057_2				73.8%	41%	100 bp	100 bp	30%	42.9
GSM6001782_STAR		84.5%	36.2
GSM6001783	78.8%
GSM6001783_SRR18574058_1				91.0%	51%	101 bp	101 bp	40%	60.9
GSM6001783_SRR18574058_2				89.4%	51%	101 bp	101 bp	20%	60.9
GSM6001783_STAR		55.2%	33.6
GSM6001784	85.0%
GSM6001784_SRR18574059_1				78.5%	44%	101 bp	101 bp	20%	69.7
GSM6001784_SRR18574059_2				76.4%	44%	101 bp	101 bp	20%	69.7
GSM6001784_STAR		80.8%	56.4
GSM6001785	81.9%
GSM6001785_SRR18574060_1				80.4%	44%	100 bp	100 bp	20%	89.3
GSM6001785_SRR18574060_2				75.8%	44%	100 bp	100 bp	20%	89.3
GSM6001785_STAR		74.2%	66.2
GSM6001786	78.7%
GSM6001786_SRR18574061_1				91.0%	43%	100 bp	100 bp	20%	82.7
GSM6001786_SRR18574061_2				87.2%	43%	100 bp	100 bp	20%	82.7
GSM6001786_STAR		76.4%	63.2
GSM6001787	82.1%
GSM6001787_SRR18574062_1				81.4%	49%	101 bp	101 bp	20%	63.5
GSM6001787_SRR18574062_2				79.9%	49%	101 bp	101 bp	10%	63.5
GSM6001787_STAR		70.5%	44.7
GSM6001788	86.6%
GSM6001788_SRR18574063_1				76.2%	40%	100 bp	100 bp	20%	80.0
GSM6001788_SRR18574063_2				72.3%	40%	100 bp	100 bp	20%	80.0
GSM6001788_STAR		84.5%	67.6
GSM6001789	86.7%
GSM6001789_SRR18574064_1				81.9%	49%	101 bp	101 bp	20%	72.3
GSM6001789_SRR18574064_2				80.9%	49%	101 bp	101 bp	10%	72.3
GSM6001789_STAR		69.2%	50.0
GSM6001790	83.1%
GSM6001790_SRR18574065_1				87.6%	48%	101 bp	101 bp	30%	55.7
GSM6001790_SRR18574065_2				85.5%	47%	101 bp	101 bp	20%	55.7
GSM6001790_STAR		54.4%	30.3
GSM6001791	88.2%
GSM6001791_SRR18574066_1				78.4%	42%	100 bp	100 bp	20%	87.0
GSM6001791_SRR18574066_2				75.8%	42%	100 bp	100 bp	20%	87.0
GSM6001791_STAR		78.5%	68.3
GSM6001792	77.2%
GSM6001792_SRR18574067_1				87.1%	40%	100 bp	100 bp	30%	85.3
GSM6001792_SRR18574067_2				83.0%	40%	100 bp	100 bp	20%	85.3
GSM6001792_STAR		76.0%	64.8
GSM6001793	83.5%
GSM6001793_SRR18574068_1				82.6%	49%	101 bp	101 bp	20%	54.1
GSM6001793_SRR18574068_2				80.9%	49%	101 bp	101 bp	10%	54.1
GSM6001793_STAR		65.8%	35.6
GSM6001794	87.2%
GSM6001794_SRR18574069_1				78.2%	39%	100 bp	100 bp	20%	72.8
GSM6001794_SRR18574069_2				74.6%	39%	100 bp	100 bp	20%	72.8
GSM6001794_STAR		82.7%	60.2
GSM6001795	85.8%
GSM6001795_SRR18574070_1				77.8%	46%	100 bp	100 bp	20%	73.6
GSM6001795_SRR18574070_2				74.8%	46%	100 bp	100 bp	10%	73.6
GSM6001795_STAR		77.4%	56.9
GSM6001796	89.9%
GSM6001796_SRR18574071_1				76.9%	47%	101 bp	101 bp	20%	80.2
GSM6001796_SRR18574071_2				75.0%	47%	101 bp	101 bp	10%	80.2
GSM6001796_STAR		74.0%	59.4
GSM6001797	80.5%
GSM6001797_SRR18574072_1				80.6%	43%	100 bp	100 bp	20%	102.8
GSM6001797_SRR18574072_2				77.8%	43%	100 bp	100 bp	20%	102.8
GSM6001797_STAR		77.8%	80.0
GSM6001798	89.2%
GSM6001798_SRR18574073_1				83.6%	38%	100 bp	100 bp	30%	71.7
GSM6001798_SRR18574073_2				80.9%	39%	100 bp	100 bp	30%	71.7
GSM6001798_STAR		86.7%	62.2
GSM6001799	85.2%
GSM6001799_SRR18574074_1				84.2%	49%	101 bp	101 bp	20%	78.4
GSM6001799_SRR18574074_2				82.3%	49%	101 bp	101 bp	10%	78.4
GSM6001799_STAR		68.8%	53.9
GSM6001800	70.1%
GSM6001800_SRR18574075_1				88.4%	47%	101 bp	101 bp	40%	66.9
GSM6001800_SRR18574075_2				86.5%	47%	101 bp	101 bp	40%	66.9
GSM6001800_STAR		50.5%	33.8
GSM6001801	80.1%
GSM6001801_SRR18574076_1				91.4%	50%	101 bp	101 bp	40%	61.9
GSM6001801_SRR18574076_2				90.2%	50%	101 bp	101 bp	30%	61.9
GSM6001801_STAR		53.0%	32.8
GSM6001802	85.5%
GSM6001802_SRR18574077_1				90.8%	52%	101 bp	101 bp	40%	75.3
GSM6001802_SRR18574077_2				89.3%	52%	101 bp	101 bp	30%	75.3
GSM6001802_STAR		30.9%	23.3
GSM6001803	79.3%
GSM6001803_SRR18574079_1				90.4%	53%	101 bp	101 bp	50%	62.7
GSM6001803_SRR18574079_2				89.5%	54%	101 bp	101 bp	30%	62.7
GSM6001803_STAR		39.3%	24.6
GSM6001804	83.1%
GSM6001804_SRR18574080_1				91.7%	52%	101 bp	101 bp	40%	67.6
GSM6001804_SRR18574080_2				90.6%	52%	101 bp	101 bp	40%	67.6
GSM6001804_STAR		30.8%	20.8
GSM6001805	83.1%
GSM6001805_SRR18574081_1				97.6%	54%	101 bp	101 bp	40%	76.0
GSM6001805_SRR18574081_2				95.8%	54%	101 bp	101 bp	30%	76.0
GSM6001805_STAR		20.7%	15.8
GSM6001806	72.2%
GSM6001806_SRR18574082_1				89.2%	48%	101 bp	101 bp	40%	60.1
GSM6001806_SRR18574082_2				86.7%	48%	101 bp	101 bp	40%	60.1
GSM6001806_STAR		48.8%	29.3
GSM6001807	74.8%
GSM6001807_SRR18574083_1				91.6%	52%	101 bp	101 bp	40%	67.2
GSM6001807_SRR18574083_2				90.1%	53%	101 bp	101 bp	30%	67.2
GSM6001807_STAR		39.4%	26.5
GSM6001808	82.5%
GSM6001808_SRR18574084_1				90.3%	53%	101 bp	101 bp	40%	68.1
GSM6001808_SRR18574084_2				89.1%	53%	101 bp	101 bp	40%	68.1
GSM6001808_STAR		33.5%	22.8
GSM6001847	89.1%
GSM6001847_SRR18574124_1				81.8%	49%	101 bp	101 bp	20%	60.5
GSM6001847_SRR18574124_2				75.4%	49%	101 bp	101 bp	10%	60.5
GSM6001847_STAR		63.4%	38.3
GSM6001848	85.9%
GSM6001848_SRR18574125_1				77.4%	46%	101 bp	101 bp	20%	45.4
GSM6001848_SRR18574125_2				75.8%	46%	101 bp	101 bp	20%	45.4
GSM6001848_STAR		74.2%	33.7
GSM6001849	83.3%
GSM6001849_SRR18574126_1				82.7%	47%	100 bp	100 bp	30%	81.9
GSM6001849_SRR18574126_2				80.6%	48%	100 bp	100 bp	20%	81.9
GSM6001849_STAR		65.1%	53.3
GSM6001850	88.3%
GSM6001850_SRR18574127_1				76.1%	47%	101 bp	101 bp	20%	67.6
GSM6001850_SRR18574127_2				73.6%	47%	101 bp	101 bp	10%	67.6
GSM6001850_STAR		79.6%	53.8
GSM6001851	89.1%
GSM6001851_SRR18574128_1				71.7%	46%	101 bp	101 bp	20%	59.8
GSM6001851_SRR18574128_2				69.4%	46%	101 bp	101 bp	20%	59.8
GSM6001851_STAR		75.6%	45.2
GSM6001852	75.4%
GSM6001852_SRR18574129_1				80.8%	47%	100 bp	100 bp	30%	67.3
GSM6001852_SRR18574129_2				76.5%	47%	100 bp	100 bp	10%	67.3
GSM6001852_STAR		65.1%	43.8
GSM6001853	86.5%
GSM6001853_SRR18574130_1				83.4%	47%	101 bp	101 bp	20%	60.9
GSM6001853_SRR18574130_2				80.6%	47%	101 bp	101 bp	10%	60.9
GSM6001853_STAR		79.0%	48.1
GSM6001854	86.8%
GSM6001854_SRR18574131_1				72.4%	45%	101 bp	101 bp	30%	65.4
GSM6001854_SRR18574131_2				68.8%	45%	101 bp	101 bp	10%	65.4
GSM6001854_STAR		85.0%	55.6
GSM6001855	91.0%
GSM6001855_SRR18574132_1				77.9%	46%	101 bp	101 bp	20%	75.3
GSM6001855_SRR18574132_2				74.6%	46%	101 bp	101 bp	10%	75.3
GSM6001855_STAR		81.2%	61.2
GSM6001856	75.3%
GSM6001856_SRR18574133_1				75.6%	45%	101 bp	101 bp	30%	64.4
GSM6001856_SRR18574133_2				73.1%	45%	101 bp	101 bp	30%	64.4
GSM6001856_STAR		75.3%	48.5
GSM6001857	83.4%
GSM6001857_SRR18574134_1				76.5%	48%	100 bp	100 bp	20%	35.1
GSM6001857_SRR18574134_2				71.4%	48%	100 bp	100 bp	10%	35.1
GSM6001857_STAR		66.6%	23.4
GSM6001858	67.9%
GSM6001858_SRR18574135_1				89.5%	47%	101 bp	101 bp	40%	58.0
GSM6001858_SRR18574135_2				86.5%	47%	101 bp	101 bp	40%	58.0
GSM6001858_STAR		63.2%	36.7
GSM6001859	78.1%
GSM6001859_SRR18574136_1				66.8%	46%	100 bp	100 bp	20%	35.7
GSM6001859_SRR18574136_2				61.8%	46%	100 bp	100 bp	10%	35.7
GSM6001859_STAR		72.3%	25.8
GSM6001860	85.8%
GSM6001860_SRR18574137_1				80.6%	51%	100 bp	100 bp	20%	45.6
GSM6001860_SRR18574137_2				75.9%	51%	100 bp	100 bp	10%	45.6
GSM6001860_STAR		44.0%	20.1
GSM6001861	83.5%
GSM6001861_SRR18574138_1				82.3%	47%	101 bp	101 bp	30%	46.5
GSM6001861_SRR18574138_2				79.7%	47%	101 bp	101 bp	10%	46.5
GSM6001861_STAR		73.7%	34.3
GSM6001862	86.0%
GSM6001862_SRR18574139_1				77.4%	39%	100 bp	100 bp	20%	44.6
GSM6001862_SRR18574139_2				73.7%	39%	100 bp	100 bp	20%	44.6
GSM6001862_STAR		81.7%	36.4
GSM6001863	53.9%
GSM6001863_SRR18574140_1				86.0%	45%	101 bp	101 bp	30%	85.5
GSM6001863_SRR18574140_2				84.3%	45%	101 bp	101 bp	30%	85.5
GSM6001863_STAR		52.7%	45.0
GSM6001864	76.2%
GSM6001864_SRR18574141_1				84.9%	48%	101 bp	101 bp	40%	49.8
GSM6001864_SRR18574141_2				81.1%	48%	101 bp	101 bp	40%	49.8
GSM6001864_STAR		53.4%	26.6
GSM6001865	82.1%
GSM6001865_SRR18574142_1				75.7%	38%	100 bp	100 bp	20%	40.5
GSM6001865_SRR18574142_2				72.8%	38%	100 bp	100 bp	20%	40.5
GSM6001865_STAR		80.8%	32.7
GSM6001866	77.6%
GSM6001866_SRR18574143_1				80.2%	46%	100 bp	100 bp	30%	82.0
GSM6001866_SRR18574143_2				77.1%	46%	100 bp	100 bp	20%	82.0
GSM6001866_STAR		67.0%	54.9
GSM6001867	87.0%
GSM6001867_SRR18574144_1				74.4%	45%	101 bp	101 bp	20%	79.7
GSM6001867_SRR18574144_2				73.5%	45%	101 bp	101 bp	20%	79.7
GSM6001867_STAR		83.4%	66.5
GSM6001868	67.2%
GSM6001868_SRR18574145_1				81.2%	47%	101 bp	101 bp	40%	72.0
GSM6001868_SRR18574145_2				78.6%	47%	101 bp	101 bp	40%	72.0
GSM6001868_STAR		63.5%	45.7
GSM6001869	82.4%
GSM6001869_SRR18574146_1				78.4%	40%	100 bp	100 bp	20%	47.9
GSM6001869_SRR18574146_2				74.4%	39%	100 bp	100 bp	20%	47.9
GSM6001869_STAR		82.5%	39.6
GSM6001870	89.7%
GSM6001870_SRR18574147_1				76.4%	45%	100 bp	100 bp	20%	73.5
GSM6001870_SRR18574147_2				74.1%	45%	100 bp	100 bp	10%	73.5
GSM6001870_STAR		76.7%	56.4
GSM6001871	86.5%
GSM6001871_SRR18574148_1				75.1%	46%	101 bp	101 bp	20%	61.0
GSM6001871_SRR18574148_2				72.6%	46%	101 bp	101 bp	20%	61.0
GSM6001871_STAR		75.0%	45.7
GSM6001872	74.2%
GSM6001872_SRR18574149_1				84.2%	48%	101 bp	101 bp	40%	72.9
GSM6001872_SRR18574149_2				80.2%	49%	101 bp	101 bp	40%	72.9
GSM6001872_STAR		54.0%	39.4
GSM6001873	81.3%
GSM6001873_SRR18574150_1				75.3%	38%	100 bp	100 bp	20%	43.7
GSM6001873_SRR18574150_2				72.0%	38%	100 bp	100 bp	20%	43.7
GSM6001873_STAR		81.0%	35.4
GSM6001874	86.6%
GSM6001874_SRR18574151_1				74.7%	46%	101 bp	101 bp	20%	65.7
GSM6001874_SRR18574151_2				73.8%	46%	101 bp	101 bp	20%	65.7
GSM6001874_STAR		77.5%	50.9
GSM6001875	84.0%
GSM6001875_SRR18574152_1				76.9%	45%	101 bp	101 bp	20%	54.4
GSM6001875_SRR18574152_2				73.3%	45%	101 bp	101 bp	10%	54.4
GSM6001875_STAR		81.4%	44.3
GSM6001876	85.4%
GSM6001876_SRR18574153_1				77.5%	39%	100 bp	100 bp	20%	49.3
GSM6001876_SRR18574153_2				75.1%	39%	100 bp	100 bp	20%	49.3
GSM6001876_STAR		83.8%	41.3
GSM6001877	84.0%
GSM6001877_SRR18574154_1				84.3%	49%	101 bp	101 bp	20%	66.1
GSM6001877_SRR18574154_2				84.2%	49%	101 bp	101 bp	20%	66.1
GSM6001877_STAR		65.3%	43.2
GSM6001878	79.8%
GSM6001878_SRR18574155_1				82.9%	45%	101 bp	101 bp	30%	74.5
GSM6001878_SRR18574155_2				80.2%	45%	101 bp	101 bp	20%	74.5
GSM6001878_STAR		75.9%	56.6
GSM6001879	82.1%
GSM6001879_SRR18574156_1				91.3%	55%	100 bp	100 bp	30%	53.2
GSM6001879_SRR18574156_2				85.4%	55%	100 bp	100 bp	10%	53.2
GSM6001879_STAR		18.3%	9.7
GSM6001880	82.6%
GSM6001880_SRR18574157_1				77.9%	48%	100 bp	100 bp	20%	49.0
GSM6001880_SRR18574157_2				73.5%	48%	100 bp	100 bp	10%	49.0
GSM6001880_STAR		70.3%	34.5
GSM6001881	84.9%
GSM6001881_SRR18574158_1				81.8%	48%	101 bp	101 bp	20%	67.7
GSM6001881_SRR18574158_2				80.9%	48%	101 bp	101 bp	20%	67.7
GSM6001881_STAR		75.5%	51.1
GSM6001882	74.0%
GSM6001882_SRR18574159_1				80.8%	48%	150 bp	150 bp	40%	116.1
GSM6001882_SRR18574159_2				77.6%	48%	150 bp	150 bp	40%	116.1
GSM6001882_STAR		71.2%	82.6
GSM6001883	45.5%
GSM6001883_SRR18574160_1				92.0%	47%	150 bp	150 bp	40%	103.6
GSM6001883_SRR18574160_2				91.5%	47%	150 bp	150 bp	40%	103.6
GSM6001883_STAR		43.0%	44.6
GSM6001884	73.8%
GSM6001884_SRR18574161_1				92.9%	51%	151 bp	151 bp	50%	50.9
GSM6001884_SRR18574161_2				80.8%	49%	151 bp	151 bp	40%	50.9
GSM6001884_STAR		50.9%	25.9
GSM6001885	58.7%
GSM6001885_SRR18574162_1				94.6%	49%	150 bp	150 bp	50%	127.6
GSM6001885_SRR18574162_2				92.8%	49%	150 bp	150 bp	50%	127.6
GSM6001885_STAR		48.6%	62.0
GSM6001886	60.5%
GSM6001886_SRR18574163_1				90.6%	51%	151 bp	151 bp	50%	74.7
GSM6001886_SRR18574163_2				80.2%	50%	151 bp	151 bp	50%	74.7
GSM6001886_STAR		43.1%	32.2
GSM6001887	78.0%
GSM6001887_SRR18574164_1				84.7%	50%	101 bp	101 bp	40%	70.5
GSM6001887_SRR18574164_2				84.0%	50%	101 bp	101 bp	30%	70.5
GSM6001887_STAR		56.5%	39.8
GSM6001888	76.3%
GSM6001888_SRR18574165_1				89.1%	50%	101 bp	101 bp	50%	66.6
GSM6001888_SRR18574165_2				87.7%	50%	101 bp	101 bp	40%	66.6
GSM6001888_STAR		53.8%	35.8
GSM6001889	92.7%
GSM6001889_SRR18574166_1				96.3%	55%	101 bp	101 bp	40%	66.9
GSM6001889_SRR18574166_2				95.5%	55%	101 bp	101 bp	30%	66.9
GSM6001889_STAR		8.0%	5.4
GSM6001890	84.9%
GSM6001890_SRR18574167_1				92.2%	53%	101 bp	101 bp	40%	67.4
GSM6001890_SRR18574167_2				91.0%	53%	101 bp	101 bp	40%	67.4
GSM6001890_STAR		27.9%	18.8
GSM6001891	88.5%
GSM6001891_SRR18574168_1				92.7%	53%	101 bp	101 bp	50%	66.2
GSM6001891_SRR18574168_2				90.6%	53%	101 bp	101 bp	40%	66.2
GSM6001891_STAR		50.0%	33.1
GSM6001892	85.8%
GSM6001892_SRR18574169_1				95.0%	52%	100 bp	100 bp	50%	99.9
GSM6001892_SRR18574169_2				92.6%	52%	100 bp	100 bp	30%	99.9
GSM6001892_STAR		16.4%	16.4
GSM6001893	82.4%
GSM6001893_SRR18574170_1				96.2%	55%	100 bp	100 bp	50%	49.1
GSM6001893_SRR18574170_2				92.8%	55%	100 bp	100 bp	40%	49.1
GSM6001893_STAR		5.0%	2.5
GSM6001894	63.5%
GSM6001894_SRR18574171_1				64.2%	46%	151 bp	151 bp	36%	74.7
GSM6001894_SRR18574171_2				67.4%	46%	151 bp	151 bp	27%	74.7
GSM6001894_STAR		64.3%	48.0
GSM6001895	53.6%
GSM6001895_SRR18574172_1				88.8%	46%	150 bp	150 bp	40%	264.4
GSM6001895_SRR18574172_2				85.8%	46%	150 bp	150 bp	40%	264.4
GSM6001895_STAR		54.8%	144.9
GSM6001896	75.6%
GSM6001896_SRR18574173_1				82.0%	47%	151 bp	151 bp	40%	41.4
GSM6001896_SRR18574173_2				69.9%	45%	151 bp	151 bp	20%	41.4
GSM6001896_STAR		72.8%	30.1
GSM6001897	44.5%
GSM6001897_SRR18574174_1				73.4%	47%	151 bp	151 bp	30%	53.2
GSM6001897_SRR18574174_2				66.9%	46%	151 bp	151 bp	30%	53.2
GSM6001897_STAR		55.1%	29.3
GSM6001898	83.7%
GSM6001898_SRR18574175_1				80.0%	42%	100 bp	100 bp	30%	47.0
GSM6001898_SRR18574175_2				76.9%	42%	100 bp	100 bp	30%	47.0
GSM6001898_STAR		63.2%	29.7
GSM6001899	75.8%
GSM6001899_SRR18574176_1				77.8%	45%	100 bp	100 bp	30%	70.6
GSM6001899_SRR18574176_2				74.2%	45%	100 bp	100 bp	30%	70.6
GSM6001899_SRR18574177_1				78.8%	40%	100 bp	100 bp	20%	64.0
GSM6001899_SRR18574177_2				73.7%	40%	100 bp	100 bp	20%	64.0
GSM6001899_STAR		73.9%	99.5
GSM6001900	91.7%
GSM6001900_SRR18574178_1				85.6%	48%	101 bp	101 bp	30%	57.8
GSM6001900_SRR18574178_2				84.9%	48%	101 bp	101 bp	20%	57.8
GSM6001900_STAR		40.9%	23.7

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
CCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATG	78	41531854	0.2963%
CCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCA	76	36808326	0.2626%
CTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCC	75	22720896	0.1621%
GTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGG	73	20320836	0.1450%
CTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGT	73	28730251	0.2050%
CCCCAACCGAAATTTTTTAGTTCATATTTATTTTGTTTTAGCCCATTAGG	73	10768009	0.0768%
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT	71	26649679	0.1902%
CTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGA	71	23249092	0.1659%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	70	26608605	0.1899%
GTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTGA	69	18561679	0.1324%
CACCAGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCA	68	15538198	0.1109%
CTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATGC	68	19010203	0.1356%
CGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGG	66	35676759	0.2546%
CAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAG	65	15444516	0.1102%
CCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTG	65	19405832	0.1385%
CTTTAATCGTTGAACAAACGAACCATTAATAGCTTCTGCACCATTGGGAT	65	8599108	0.0614%
CAGGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCG	63	14926528	0.1065%
CTCCATTTCTCTTGTCCTTTCGTACTGGGAGAAATTGTAAATAGATAGAA	63	6922904	0.0494%
CCCAGCTACTCGGGAGGCTGAGACAGGAGGATCGCTTGAGTCCAGGAGTT	59	14822554	0.1058%
GCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGAT	59	11976255	0.0855%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks