60985BNBNBillingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b).<a href=http://www.criver.com/index.html>Charles River Laboratories</a>inbredCd36|Tnfrsf1a2301|62123710001AVN/OrlCtr de Selection et d'Elev d'Anim de Lab, Orleans, France.inbred60988LOU/MHistocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978).inbred60989BPStrain selected for resistance to Walker 256 tumour.inbred1598797WF.WKY-(<i>D10Got124-D10Rat187</i>)/UwmWKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL.Department of Oncology, University of Wisconsin, Madison Wisconsincongenic1598798BBDP/WorNDeveloped from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.NIH Autoimmune Rat Model Repository and Dev Ctr, <a href= http://www.rrrc.us/Strain/?x=92>Rat Resource and Research Center</a>inbredExtinct10002BBDP/RhwS. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle.inbred10003BBDR/RhwS. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 1 53 days of age after the first and 67 1 10 days of age after the 9th cycle.R. H. William Laboratory, University of Washington, Seattle, Washingtoninbred10004BC/CpbUObtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands.Central Laboratory Animal Institute of Utrecht University, The Netherlands.inbred10005BDIX/Hanunknownunknowninbred10006BDVII/CubDruckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype.Charles University, Department of Biology, Prague, inbred10008BN/SsNHsdObtained by HSD from nucleus colony at NIH<a href =http://www.harlan.com/models/brownnorway.asp> Harlan</a>inbred10009BP/CubCharles University, Department of Biology, Prague, inbred10010BUF/PitBuffaloinbred10012DA/PitNUnknown<a href=http://www.rrrc.us/Strain/?x=154>Rat Resource and Research Center</a>inbredextinct10013DON/Melbinbred10014F344/Pitinbred10015FHH/EurAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.Erasmus University-Rotterdaminbred10018IS/Kyoishibashi ratIshibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=5 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermOsteosis10019LE/MolLong EvansM & B A/S, Denmark.inbred10020LEW/PitLewisinbred10021LH/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, Franceinbred10025MHS/GibMilan Hypertensive StrainOutbred Wistar rats with brother x sister mating and selection for high systolic blood pressureDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, Italyinbred10027MNRA/NTo Harrington in 1965 at F25 (Harrington 1981).NIH Animal Genetic Resourceinbred10045WN/NInbred Wistar; W/NHeston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15.NIH Animal Genetic Resourceinbred10046WKY/OlaHsdHarlan Sprague Dawley, Inc.inbred10047WTC/KyoWTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=18 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; Sperm10023LOU/CHanLouvainunknownunknowninbred10026MNR/NMaudsely non-reactiveTo N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.NIH Animal Genetic Resource, <a href=http://www.rrrc.us/Strain/?x=174>Rat Resource and Research Center</a>inbredExtinct10029MR/PitAs for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).inbred10032ODU/NOsaka Dental UniversityFrom outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982).NIH Animal Genetic Resource, <a href=http://www.rrrc.us/Strain/?x=176>Rat Resource and Research Center</a>inbredExtinct10043WF/PitWistar Furthinbred10044WIST/NhgWistarFrom outbred Wistar stock in 1967.Gesellschaft f. Strahlen & Umweltforschung, Munich, Germany.inbredUgt1a1|Abcd23935|6924410040SR/JrSalt ResistantOriginated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b).Dr. John P. Rapp, Medical College of Ohio, USA, <a href=http://www.rrrc.us/Strain/?x=56>Rat Resource and Research Center</a>inbredEmbryo; Sperm734528OLETF.BN-(<i>D1Rat76-D1Rat459</i>)/GotFemale OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japancongenic734531OLETF.F344-(<i>D1Rat306-D1Rat461</i>)/GotFemale OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation.Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japancongenic60986BUF/NHeston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=150>Rat Resource and Research Center</a>inbredExtinct60987MHS/NMilan Hypertensive StrainMilan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy, <a href=http://www.rrrc.us/Strain/?x=169>Rat Resource and Research Center</a>inbredEmbryoAdd1|Add22041|204210028MNS/GibMilan Normotensive StrainOutbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italyinbred10031NP9From Wistarinbred10033OKA/WslProfessor Herve Bazin, Universite de Louvain, Franceinbred10034OM/ZtmOsborne-Mendelunknownunknowninbred10035P5Cinbred10036PVG/Pitinbred10037SD/RijFrom Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984).Harlan Rijswijkinbred10038SHR/OlaHsdSpontaneously Hypertensive RatHarlan Sprague Dawley, Inc.inbred10039SHRSP/RivSpontaneously Hypertensive Rat, Stroke Proneinbred10042WAG/RijKyoRij > Kyo (1979, F?, GF)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=14 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermNeurobiology60996DONDonryu ratR. Sato 1950 by inbreeding Japanese albino rats.xxinbred60998COPCurtiss 1921 at Columbia University Institute for Cancer Research.inbred61106SHR.BN-(<i>D8Mit5-D8Mgh6</i>)/IpcvA segment of chr. 8 is transferred from the normotensive BN-<i>Lx</i>/Cub rat to the SHR/Ola.Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republiccongenic628908SHR.BN-(<i>D1Mit3-Igf2</i>)/IpcvSegment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating.Czech Academy of Sciences, Prague, Czech RepubliccongenicSa|Scnn1b|Scnn1g3616|3640|3641628909SHR.BN-(<i>D13Arb5-Ren1</i>)/IpcvSegment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity.Czech Academy of Sciences, Prague, Czech RepubliccongenicRen3554629459ZUC-<i>Lepr<sup>faSteJrpz</sup></i>Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology.Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USAmutant629462ZUC-<I>Lepr</I><sup>faSte</sup>This mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size.University of California Davis, Davis, CAmutantLepr300161010SHRSPSpontaneously Hypertensive Rat, Stroke ProneThe A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rabbatu (1994).Iffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-Buchinbred61011BB/NBioBreeding ratMutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).Rat Resource & Research Centerinbred10017GK/KyoSweGoto KakizakiDeveloped from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975).Department of Molecular Medicine, Karolinska Hospital, Stockholm, Swedeninbred67958ASAlbino SurgeryUniversity of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973).National Institute for Medical Research, Mill Hill, UKinbred67959AS2Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968).inbred67960AUGDerived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England.inbred67962ANOutbred Wistar Imamichi strain.unknowninbred67965AXC A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976.recombinant_inbred67966B Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85.inbred67967B/1NNo further information.Rat Resource & Research CenterinbredExtinct67971BBZStrain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3inbred67974BDEZentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring.inbred67975BDIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbred60995DRYRecombinant inbred strain used as normotensive control in studies of hypertension.Sankyo Co., Ltd., Tokyo, Japaninbred60999LEWLewisDr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992)Harlan Sprague Dawley Inc. Indianapolis, United StatesinbredFgf2|Tnfrsf1a2609|62123767957APRDeveloped as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).inbred629463ZUC-<I>Lepr</I><sup>+Ste</sup>This mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These are recessive fatty animals.University of California Davis, Davis, CAmutantLepr3001629464ZUC-<I>Lepr</I><sup>fa</sup>When Lois and Theodore Zucker retired they gave the original Zucker rat colony to Dr. Roy Martin. When Dr. Martin was leaving University of Georgia he gave this colony to Dr. Johnny R. Porter at the Louisiana State University.Louisiana State University, Health Science Center, New Orleans, Louisianamutant629465SHR/NCrlCrljNIH derived strain maintained at the Charles River, Japan.Charles River Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=478> National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoCardio Hypertension629481SHR.WKY-(<i>D1Wox33-D1Got194</i>)This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background.Département de Physiologie et Pharmacologie Clinique, Faculté de Pharmacie, Francecongenic629482WKY.SHR-(<i>D1Wox19-D1Mit2</i>)/NjsFragment of the chromosome 1 derived from SHR and repeated backcross to WKYUniversity of Leicester, Leicester, UKcongenic61000SHRSpontaneously Hypertensive RatOkamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648).inbredAgtr1b|Cd36|Ephx22071|2301|62073260990LH/MavRrrcLyon HypertensiveLyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).<a href=http://www.rrrc.us/Strain/?x=57>Rat Resource and Research Center</a>inbredEmbryo; Sperm60991LELong EvansDr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984).inbred60992MNSMilan normotensive strainOutbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974).Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italyinbred631607SS.WKY-(<i>D2N35-Mme</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/JrMedical College of Ohio, Toledo, Ohio, USAcongenic728389WF.COP-(<i>D2Mit29-D2Rat201</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.University of Wisconsin, Madison, Wisconsin, USAcongenic631601WKY.SHRSP-(<i>Asgr1-Vamp2</i>)/BbbBoth the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and AokiMax-Delbruck Center for Molecular Medicine, Germanycongenic724572SS.LEW-(<i>D10Wox51-D10Rat27</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic631588SS.MNS-(<i>D10Mit11-Vamp2</i>)/McoFragment of the chromosome 10 derived from MNS and repeated backcross to SS/JrMedical College of Ohio, Toledo, Ohio, USAcongenic728391WF.COP-(<i>D2Rat253-D2Uwm17</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.University of Wisconsin, Madison, Wisconsin, USAcongenic728392RHA/N-<I>di</I>Roman high avoidance-<i>di</i> mutationBrattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic60997DADADeveloped from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case.inbredEdnrb|Tnfrsf1a2536|621237728393SS.LEW-(<i>D10Got125-D10Rat120</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic60984GHUniversity of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973).inbred631600WKY.SHRSP-(<i>Mt1pa-D1Rat200</i>)/BbbFragment of the chromosome 1 derived from SHRSP and repeated backcross to WKYMax-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany.congenic68097MSUBL Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977).inbred68098MWMunich WistarMunich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS.unknowninbred68099MWFFrom outbred Wistar rats selected for large numbers of superficial glomeruli.inbred68100NBL Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990).inbred68103NERnoda epileptic ratFrom Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has.inbred68104NIG-III/HokFrom a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=73 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; Sperm68106NSD/NNIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=175>Rat Resource and Research Center</a>inbredExtinct68107NZRSubline of AS2 separated at F32.inbred68109ODUSAs for ODU, but maintained at Osaka Dental University.inbred68113OXYR/NovDeveloped in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain.Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russiainbred61001NEDHInbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.inbred61002BDIXDruckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. See entry for BDI origin.inbred61003BCHagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973.inbred61004WIST/ZihkFrom Wistar outbred stock in 1978.inbred61005OM/NOsborne-MendelHeston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=177>Rat Resource and Research Center</a>inbredExtinct60993FHHFawn Hooded HypertensiveAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.University of Colorado Health Science Center, Denver, Coloradoinbred67934WOKAOutbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed bybrother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.inbred67935WOKWOutbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed bybrother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germanyinbred67936WR Sykora, Rosice (Stark et al 1968b). No further infromation.inbred67937WST Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986).inbred67938Y59 Strain developed in Zagreb, Jugoslavia.inbred67939YA/NNo further information.<a href=http://www.rrrc.us/Strain/?x=191>Rat Resource and Research Center</a>inbredExtinct67940YO Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992)inbred67941Z61Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours.inbred67942ZI A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989).inbred67943SHE/N-cpReference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94.unknowninbred67945ISfrom a cross between a wild male and a Wistar female, with sib mating since 1968.unknowninbred67948JC LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984).inbred67976BDIIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbred67977BDIIIsee BDI.inbred67978BDIVsee BDI.inbred1556748F344/SnkMedicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, JapanMedicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japaninbred1558660SHRSP/TkyoSubstrain of SHRSP rats maintained at International Medical Center of Japan, TokyoDepartment of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japaninbred61006PVGPVGKings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994).inbred68079LOU Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978).Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, Franceinbred68082LUDWLudwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU.inbred68083LXB Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover)recombinant_inbred68084M14 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum.inbred68085M17AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum.inbred61007WFWistar FurthJ Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995).inbred61008WAGAL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984).inbred61009AVN Unknown. Keil University from O Stark, Charles University, Prague.inbred10024M520/NTo N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49.NIH Animal Genetic Resource, <a href=http://www.rrrc.us/Strain/?x=168>Rat Resource and Research Center</a>inbredEmbryo61013E3Krvning, Gvttingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968.inbred61014OLETFOtsuka Long-Evans Tokushima fattyDeveloped by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1983.Otsuka Research Institute, Tokushima, Japaninbred61015LN/MavRrrclyon normotensive(taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).<a href=http://www.rrrc.us/Strain/?x=58>Rat Resource and Research Center</a>inbredEmbryo; Sperm61096SHR/NCrukSpontaneously Hypertensive RatNIH derived strain maintained at the Charles River, United Kingdom.<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UKinbred61098BXH/IpcvThese recombinant inbred strains are derived from the (BN-<i>Lx</i>/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech RepublicInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republicrecombinant_inbred61100SHR/OlaStrain originated from an inbred SHR strain from Harlan UK Ltd.Czech Academy of Sciences, Prague, Czech Republicinbred61103WKYThis strain was maintained at Medical College of Ohio, Toledo, OhioMedical College of Ohio, Toledo, OhioinbredCd36|Nos32301|318661104LEW/NCrlSubstrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34.<a href=http://www.geneticmodels.com/RM/rats/rats_a_c.html>Charles River Laboratories USA </a>inbred61105WKY/NHsdThese animals were bought from Harlan Indianapolis, Indiana U.S.A.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/wistar_kyoto_inbred_rat.hl> Harlan</a>inbred6111213MThis is a Leprfa/Leprfa substrain derived from the Zucker rat.Laboratory of Human Behavior and Metabolism, Rockefeller Universityinbred61113BN-<I>Lx</I>These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.unknownmutant68122RCS/NDeveloped before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline.<a href=http://www.rrrc.us/Strain/?x=180>Rat Resource and Research Center</a>inbredExtinct728195SHR/N-<i>cp</i>Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.<a href=http://www.rrrc.us/Strain/?x=231>Rat Resource and Research Center</a>congenicEmbryo68123RHA/NRoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=181>Rat Resource and Research Center</a>inbredExtinct68124RII/1 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991).inbred68187WKHT/NFrom a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992).<a href=http://www.rrrc.us/Strain/?x=189>Rat Resource and Research Center</a>inbredExtinct68188WKS National Institute of Genetics, Mishima, Japan.inbred68189HTX/HcjD. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30.Department of Pharmacology, University of Florida, Gainesville.inbred728200ACI/N-<I>di</I>Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic728358SBThis outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear.R. Kalman, Authority for Animal Facilitiesoutbred728383UPL/CasUpjohn Pharmaceuticals LimitedIn 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=472 > National BioResource Project for the Rat in Japan</a>inbred728384SS.LEW-(<i>D10Rat24-Igfbp4</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic724575SS.LEW-(<i>D10Rat17-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic728385WF.COP-(<i>D2Rat2-D2M13Mit286</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.University of Wisconsin, Madison, Wisconsin, USAcongenic728386SS.LEW-(<i>D10Rat119-D10Rat133</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic728387WF.COP-(<i>D2Mit29-D2Uwm13</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.University of Wisconsin, Madison, Wisconsin, USAcongenic728388SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic10000ACI/NA X C 9935, IrishCurtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR)<a href= http://www.rrrc.us/Strain/?x=142>Rat Resource and Research Center</a>inbredEmbryoTnfrsf1a62123770424AGANakic, Zagreb (Stark et al 1968b). Used for immunological studies.inbred70425AGUSGerm-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26.inbred70426ALB/NAlbanyWolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbred70427AMTorres, Rio de Janeiro, from outbred stock.inbred70428AMDILTorres, Rio de Janeiro, from outbred stockinbred68028DSS/3NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).<a href=http://www.rrrc.us/Strain/?x=157>Rat Resource and Research Center</a>inbredExtinct68125RII/2 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991).inbred68126RLA/NBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains.inbred68127RP Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991).inbred68128S5B Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating.inbred68129SBHSabra hypertensiveSabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics).Barzilai Medical Center, Ashkelon, Israelinbred68130SBN As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984).inbred68131SC Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360)inbred68133SDJ/HokTakeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=74 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermSlc2a2370568071LER/NOriginally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology.<a href=http://www.rrrc.us/Strain/?x=164>Rat Resource and Research Center</a>inbredExtinct68072LET from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1inbred68042GEPR Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a).inbred68044GHA The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973).inbred68046HCSHarvard to Liverpool, UK in 1960.inbred68047HMTOutbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor".inbred68048HS Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus.inbred68049HXB-1-43/IpcvSet of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs.Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlandsrecombinant_inbred68050IIMSet of nine strains bred as parallel strains from a single outbred colony in 1948. All strains were selected for large body weight and high fertility. One strain designated IIM\'a7 becomes obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987).inbred68051INR/NHarrington 1962 from a stock selected by CS Hall for low open field defaecation.<a href=http://www.rrrc.us/Strain/?x=160>Rat Resource and Research Center</a>inbredExtinct68052IRHarrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981).inbred68057K Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973).inbred68058KGH/PitNKunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).<a href=http://www.rrrc.us/Strain/?x=162>Rat Resource and Research Center</a>inbredExtinct68059KIRBY-B From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980).inbred68060KX developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977)inbred68061KYN/HokMakino, Hokkaido University 1960 from stock the carrying the<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=69 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; Sperm68062LA/Nfrom a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=163>Rat Resource and Research Center</a>inbredExtinct68063LA/N-<i>cp</i>from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic68065LEA Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993)inbred68067LEJ/HokHok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=72 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; Sperm68066LEC Misima, Japan 1956 from a cross between a wild rat and Castle's black rat. To Hok in 1975 at F32 (Sasaki, personal communication).inbred68068LEM Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980).inbredCkb235768069LEO from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980).inbred68070LEP Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984)inbred68114OXYS/NovDeveloped in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats.Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russiainbred68115P77PMCWistar rats from Beijing Medical College in 1977.inbred68116PA King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction.inbred68117PETH/NRoyal College of Surgeons, RCS Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbred68073LETL A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japaninbred68077LL/MavRrrcLyon hypotensiveLyon Low-Tensive. See LH<a href=http://www.rrrc.us/Strain/?x=59>Rat Resource and Research Center</a>inbredEmbryo; Sperm68086M520Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992).inbred68087MAXXFrom a cross of BNxLEW with subsequent inbreeding.inbred68088MFDeveloped as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).inbred68091MLCSMilan low-calpastatin strainFrom a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity.Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italyrecombinant_inbred68185WKAM King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA.inbred68186WKHA/NFrom a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure.<a href=http://www.rrrc.us/Strain/?x=188>Rat Resource and Research Center</a>inbredExtinct61119WKY/NCrlCrljOutbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974.<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=477> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo61097WKY/NCrukNIH derived strain maintained at the Charles River, United Kingdom.<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UKinbred61117BN-<i>Lx</i>/CubBrown Norway with polydactyly-luxateArose in a colony of random bred Wistar-derived rats.Charles University, Department of Biology, Praguemutant61118BUF/MnaStrain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=458 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermCancer; UrologyBsis222161498BN/NHsdMcwiInbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115)<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=BN&ratCategory=BN>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=531>Rat Resource & Research Center</a>inbredLive Animals; Cryopreserved61517FHL/EurFawn Hooded Low blood pressureAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damageErasmus University-Rotterdaminbred68036FH Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see FHH and FHL, below), which may have different characteristics.inbredRab38<sup>ru</sup>160031168038FHLsee FHH.inbred68039FHR An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbred68040FNLFice Normolipidemic strain. Developed as a control strain for FCH (see FCH).inbred68041G Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977)inbred67993BIL/2University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.NIH Autoimmune Rat Model Repositoryinbred68118PKDPKDOutbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991.Central Institute for Laboratory Animal Breeding, Hanover, Germanyinbred68119PSDO/NReserved symbol for strain in development now at F6 (NIH 1989).<a href=http://www.rrrc.us/Strain/?x=178>Rat Resource and Research Center</a>inbredExtinct68121RMuhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R.inbred68000BIRMBsame as BIRMA.inbred68001BLK/NThis strain has an agouti mutationRat Resource & Research CenterinbredAsip200368007BROFO Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions.inbred68008BS University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966).inbred68011CNo further information.inbred68012CAP Polish Academy of Sciences, Krakow (Stark et al 1968a).inbred68013CAR/NHunt-Hoppert caries resistant; CA/RHunt 1937, developed for resistance to dental caries (Hunt et al 1955).<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbred68014CASHunt 1937, developed for high incidence of dental caries.inbred68015CBHWoodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded).inbred68018CPB-WEWistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands.inbred68019CRDHCohen Rosenthal Diabetic Hypertensive As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995).Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelinbred68020CWSR Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open.inbred68022DBNo further information.inbred68023DEBR Dr. Roy F. Oliver, Dept. of Biological Sciences, University of Dundee. A possible animal model for human alopecia areata, with hair loss associated with marked peri-and intra-bulbar lymphocytic infiltrate (Michie et al 1991, Sainsbury et al, 1991, Oliver et al, 1991).inbred68026DSS/1NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N).<a href=http://www.rrrc.us/Strain/?x=155>Rat Resource and Research Center</a>inbredExtinct68027DSS/2NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).<a href=http://www.rrrc.us/Strain/?x=156>Rat Resource and Research Center</a>inbredExtinct629513SS-Chr 4<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-4BN%2FMcwi&ratCategory=SS-4BN%2FMcwi>PhysGen</a>consomicSperm629514SS-Chr 6<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-6BN%2FMcwi&ratCategory=SS-6BN%2FMcwi>PhysGen</a>consomicLive Animals; Sperm629515SS-Chr 7<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-7BN%2FMcwi&ratCategory=SS-7BN%2FMcwi>PhysGen</a>consomicSperm629516SS-Chr 8<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/>PhysGen</a>consomicSperm629517SS-Chr Y<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-YBN%2FMcwi&ratCategory=SS-YBN%2FMcwi/>PhysGen</a>consomicSperm629518SS-Chr 9<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-9BN%2FMcwi&ratCategory=SS-9BN%2FMcwi>PhysGen</a>consomicSperm629519SS.BN-(<i>D13Mgh13-D13Mit4</i>)/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SSBN13ab&ratCategory=SS.BN-%28D13Mgh13-D13Mit4%29%2FMcwi>PhysGen</a>congenic629520FHH-Chr 1<sup>BN</sup>/McwiA cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-1BN%2FMcwi&ratCategory=FHH-1BN%2FMcwi>PhysGen</a>consomicLive Animals; Sperm629521SS-Chr 11<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-11BN%2FMcwi&ratCategory=SS-11BN%2FMcwi>PhysGen</a>consomicSperm69638BN/KaBrown Norway Katholiek (kininogen or kinin deficient)Kitasato University, Kanagawa, Japan.Kitasato University, Kanagawa, Japan.inbred70410AAAlko-acceptingWistar rats were outbreed and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After pubity the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. As fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight so alcohol intake was kept as a phenotypic measure.Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finlandinbred70411ANAAlko-nonacceptingWistar rats were outbreed and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After pubity the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. As fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight so alcohol intake was kept as a phenotypic measure.Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finlandinbred70413WBBinbred68029DXE -1-?Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover)recombinant_inbred68031ET WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).Taisho Pharmaceutical Co. Ltdinbred68032EXBHHannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990)inbred68034F6RMutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985).inbred68035FCHFice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol.inbred68134SDNKSprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan.inbred68136SELDunning 1948. Probably extinct.inbred68140SPRD/HsdOriginated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/sprague_dawley_outbred_rat.hl>Harlan</a>outbred68143TAOutbred Wistar Imamichi.inbred68144TEOutbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987).inbred68145TFFrom outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988).inbred68146THA Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990).inbred68147THE/UtpTsukuba high-emotional ratWistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=516 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermBehavior68148TLE/UtpTsukuba low-emotional ratWistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=515 > National BioResource Project for the Rat in Japan</a>inbredEmbryoBehavior68149TMTester Moriyama rat Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication).Institute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, Japaninbred68150TMB PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbred68151TMD PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbred68152TO/HokTokyo ratA breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=75 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; Sperm68154TOM Toma Institute, Japan (Ikadai, personal communication, 1991)inbred68155TS WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).inbred68156TS1 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbred68157TS3/NHarrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).<a href=http://www.rrrc.us/Strain/?x=185>Rat Resource and Research Center</a>inbredExtinct68158TT outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991).inbred68160TU From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991)inbred68161TW Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985).inbred728135SS.LEW-(<I>D5Uwm14-D5Uwm31</I>)/JrS.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strainDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenic631275WKY/CfdWKY/CfdSubstrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA)Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CAinbred728137SS.LEW-(<I>D10Rat141-D10Mgh1</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentResearch Centre-CHUM, Montreal, Quebec, Canadacongenic728138SS.MNS-(<I>Mme-Gca</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitiveResearch Centre-CHUM, Montreal, Quebec, CanadacongenicAtp1a12167629501SD-Tg(Ren2)27This is a hypertensive rat strain, the mouse Ren2 renin gene along with its 5and 3 flanking sequence is microinjected into fertilized eggs from Hannover Sprague-Dawley (SD) background. Center for Genome Research, University of Edinburgh, UKtransgenicAgtr1b|Ace2071|2493629502SHR.BN-(<i>Il6-Npy</i>)This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotesMRC Clinical Centre, London, UKcongenic629503SHR.BN-(<i>D19Rat57-D19Mit7</i>)/IpcvThe segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating.Czech Academy of Sciences, Prague, Czech RepubliccongenicAgt20692299122F344-Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantTasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup>229910170429AOFrom ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995).inbred70440BIRMAAM Mandl 1952 from Albino rats purchased from Birmingham market.inbred68074LETOA rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan.inbred70446LH/LacLiverpool Hooded"Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981).unknowninbred70447MNRMaudsely non-reactivePL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982).unknowninbred70448MNRASubstrain of MNR. To Harrington in 1965 at F25 (Harrington 1981).inbred70449MR/NMaudsely reactiveOrigin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbred70450NBRPoiley 1966 from heterogeneous stockinbred70451OKAFrom faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days.inbred68162TX From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991)inbred68163U Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990).inbred68164UChA Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.University of Chile, Casilla, Chileinbred68165UChB Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.University of Chile, Casilla, Chileinbred68166W/Hok Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977).inbred68167W/Nhg Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany.inbred68168WA St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983.inbred68169WAB Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977).inbred68171WBB/1NNo further information<a href=http://www.rrrc.us/Strain/?x=186>Rat Resource and Research Center</a>inbredExtinct68172WBB/2NNo further information.<a href=http://www.rrrc.us/Strain/?x=187>Rat Resource and Research Center</a>inbredExtinct68173WBN Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived.inbred68174WCF R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot.inbred68175WDFIkeda et al (1981) by backcrossing the fatty gene (\i fa\i0 ) to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus.inbred68176WEC Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).inbred68177WEK Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).inbred68178WELSOutbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984)inbred68180WINWI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986).inbred68183WKA King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992)inbred68184WKAH/HokWistar-King Aptekman HokkaidoKing 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=76 > National BioResource Project for the Rat in Japan</a>inbredEmbryo724570LEW/RkbThe LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany.Freie Universitdt Berlin, Berlin, Germanyinbred69369SSRapp from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in dientifying the loci responsible for salt-induced hypertension.Brookhaven National Laboratories, Upton, New Yorkinbred69643F344/DuCrlCrljThis strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976.<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=537> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsNeurobiology; Cardio Hypertension67981BDVsee BDIinbred67983BDVIsee BDI.inbred67984BDVIISee BDI, Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976)inbred67986BDVIIIsee BDI.inbred67987BDXsee BDIinbredLypd36905367988BEGfrom a cross between SC and TE.inbred67989BH D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973.inbred67990BI Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992)inbred67991BIL/1University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.NIH Autoimmune Rat Model Repositoryinbred631592WKY.SHR-(<i>D1Rat236-D1M7Mit206</i>)/NjsCongenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>D1Wox19-D1Mit2</i>) to WKYDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenic631593LEW/RjStrain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).Hopital Purpan, Toulouse Cedex, Franceinbred631596LEW.1AV1.DA-(<i>D10Rat92-D10Wox17</i>)/UbcCongenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2.Biomedical Center in Uppsala, Swedencongenic631597LEW.1AV1.DA-(<i>D10Wox17-D10Rat135</i>)/UbcCongenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2Biomedical Center in Uppsala, Swedencongenic631598LEW.1AV1.DA-(<i>D10Got154-D10Rat135</i>)/UbcCongenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2Biomedical Center in Uppsala, Swedencongenic631599SHRSP/IzmStrain has been maintained at Kyoto University.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=409 > National BioResource Project for the Rat in Japan</a>inbredLiving AnimalsCardio Hypertension; Neurobiology631602BN/ElhThese rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony.Department of Surgery and Biochemistry, University of Otagoinbred631603WKY/SnkThe original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japaninbred631604SHR/SnkThe original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japaninbred631605SS.LEW-(<i>D10Arb9-D10Got101</i>)/JrCongenic strain originated from an inbred SS/Jr strain.Medical College of Ohio, Toledocongenic631606SS.MNS-(<i>D10Rat13-D10Mit11</i>)/JrCongenic strain originated from an inbred SS/Jr strain.Medical College of Ohio, Toledocongenic631610SS.LEW-(<i>D1Rat39-D1Rat131</i>)/JrSegment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.Medical College of Ohio, Toledo, Ohio, USAcongenic631691SHRSP/A3IzmSubstrain originates from the SHRSP/Izm strain.Research Institute, International Medical Center of Japaninbred631693WKY.SHRSP-(<i>Shbg-Atp1b2</i>)/BbbThis strain has the blood pressure locus from chr 10Max-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic631696SHR/FubRkbStrain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin.Freie Universitat Berlininbred631699BB.SHR-(<i>D6Rat184-D6Rat101</i>)/KCongenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females.University of Greifswald, Germanycongenic631703SS.LEW-(<i>D10Rat207-D10Mgh1</i>)/AydCongenic strain originated from an inbred SS strainResearch Centre-CHUMcongenic631844HAD1high-alcohol-drinkingThese high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption.Department of Medicine, Indiana University School of Medicine, Indianapolis, Indianainbred631845LAD1low-alcohol-drinkingThese low-alcohol-drinking were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption.Department of Medicine, Indiana University School of Medicine, Indianapolis, Indianainbred631847F344.GK-(<i>D1Mit7-D1Mgh25</i>)/SweCongenic strain originated from an inbred F344 strainKarolinska Institutecongenic728190RCS-<I>rdy-c</I>Albino retinal dystrophyThis congenic strain is obtained from pink-eyed, tan-hooded RCS rats<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic728191LOU/CNTo N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045)<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=166>Rat Resource and Research Center</a>inbredExtinct728192RCS-rdy-pThis congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic728193N:SDSprague-DawleyTo N 1945 from Sprague Dawley, Inc. Colony closed since then.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=239>Rat Resource and Research Center</a>outbredExtinct629522SS-Chr 20<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-20BN%2FMcwi&ratCategory=SS-20BN%2FMcwi>PhysGen</a>consomicSperm629523SS-Chr 13<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-13BN%2FMcwi&ratCategory=SS-13BN%2FMcwi>PhysGen</a>consomicLive Animals; Embryo; Sperm629524SS-Chr 16<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-16BN%2FMcwi&ratCategory=SS-16BN%2FMcwi>PhysGen</a>consomicLive Animals; Sperm629525SS-Chr 18<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-18BN%2FMcwi&ratCategory=SS-18BN%2FMcwi>PhysGen</a>consomicSperm61499SS/JrHsdMcwiInbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115).<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS&ratCategory=SS>PhysGen</a>inbredLive Animals; Cryopreserved629509FHH/EurMcwiAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH&ratCategory=FHH>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=293>Rat Resource and Research Center</a>inbredLive Animals; Cryopreserved629510SS.BN-(<i>D12Arb13-D12Rat79</i>)/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SSBN12aa&ratCategory=SS.BN-%28D12arb13-D12rat79%29%2FMcwi>PhysGen</a>congenicLive Animals629511SS-Chr 2<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-2BN%2FMcwi&ratCategory=SS-2BN%2FMcwi>PhysGen</a>consomicSperm629512FHH-Chr 12<sup>BN</sup>/McwiA cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-12BN%2FMcwi&ratCategory=FHH-12BN%2FMcwi>PhysGen</a>consomicSperm728155BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/1RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.Department of Medicine, University of Washington, Seattle, Washingtoncongenic737858DA.PVG.1AV1-(<i>D4Rat155-Spr</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic737859DA.PVG.1AV1-(<i>D4Mgh17-D4Rat56</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic737862SHRSP.WKY-(<i>D2Rat14-D2Mit5</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.University of Glasgow, Glasgow, UKcongenic737863SHRSP.WKY-(<i>D2Wox9-D2Mgh12</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSPUniversity of Glasgow, Glasgow, UKcongenicGstm12755737864SS.SR-(<i>D13Mit9-D13Mit1</i>)/JrCongenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain.J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USAcongenic737866WKY.SHRSP-(<I>D2Rat14-D2Mit5</I>)A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKYUniversity of Glasgow, Glasgow, UKcongenic737867SS.SR-(<I>D13N1-D13Mit1</I>)/JrCongenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient strainMedical College of Ohio, Toledo, Ohio, USAcongenic737868SS.SR-(<I>Syt2-D13Mit1</I>)/JrCongenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient strainMedical College of Ohio, Toledo, Ohio, USAcongenic737869OLETF.BN-(<I>D1Rat461-D1Rat459</I>)/GotFemale OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study.Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japancongenic737873DA.E3-(<i>D6Wox5-D6Rat90</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.Section for Medical Inflammation Research, Lund University, Lund, Sweden.congenic737889LEW/IpcvThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlandsunknowninbred737891Crl:SDSprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory.Charles River Laboratories, Inc., Wilmington, MAoutbred737893F344/ZtmSubstrain of Fischer rats maintained by Dr. H.J. Hedrich, HannoverZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737895WKY/ZtmSubstrain of WKY rats maintained by Dr. H.J. Hedrich, HannoverZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737896BN/MaasSubstrain of BN rats, maintained by Dr. Alex Maas, The NetherlandsErasmus MC, DR Rotterdam, The Netherlandsinbred737901LH/ZtuA substrain of LHunknowninbred737907SS.SR-<i>Inha</i>/JrA chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strainJ.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USAcongenic737911BUF/ZtmSubstrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, GermanyZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737912SS/JrIpcvstrain originated from Dr. John P. Rapp, Medical College of Ohio, USACzech Academy of Sciencesinbred737913E3/ZtmSubstrain of E3, from Dr. H.J. Hedrich, Hannover, GermanyZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737917WF/MolSubstrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, DenmarkMollegaard Breeding Centre Ltd., Denmarkinbred737918BN/OrlSubstrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, FranceInstitut de Transgenose, Orleans, Franceinbred634367BN/CrlCrlj1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced.<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>,<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=777> National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoOphthalmology; Immunology634374E3/ZtmRhdE3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.Section for Medical Inflammation Research, Biomedical Center, Lund University, Swedeninbred634376LEA/NcuThese rats were established from a closed colony of Long-Evans.Nagoya City University Medical School, Nagoya, Aichi, Japaninbred634377BN/SeaBN/SeaThis inbred strain was obtained from Sea life SupplySea Life Supply, Sand City, CA <a href=http://www.sealifesupply.com> Sea Life Supply </a>inbred10022LN/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, Franceinbred724569MWF/FubRkbMunich Wistar FromterThe MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm).Freie Universitdt Berlin, Berlin, Germanyinbred724571MITE/MnaThis strain was established from captured Japanese wild rats.Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japaninbred724573SS/JrMcoDahl salt-sensitive (SS/Jr) ratsIn the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet.Medical College of Ohio, Toledo, Ohio, USAinbred724576KDP/TkyKomeda diabetes-prone ratThis is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=15 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoDiabetes Obesity; ImmunologyCblb620535728133BN-<I>RT1<SUP>n</SUP></I>/RjThis coisogenic strain was produced by selecting BN rats with the <I>RT1<SUP>n</SUP></I> allele.The Center dElevage R. Janvier, France.coisogenic728134SS.LEW-(<I>D1Rat35-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.Medical College of Ohio, Toledo, Ohio, USAcongenic728148SS.LEW-(<I>D16Uia2-D16Rat12</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentResearch Centre-CHUM, Montreal, Quebec, Canadacongenic728151UPL/NccThe UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony.Hiroshima University, School of Medicine, Hiroshima, Japaninbred728152SS.LEW-(<I>D1Rat196-D1Mgh7</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.Medical College of Ohio, Toledo, Ohio, USAcongenic728153SS.LEW-(<I>D1Rat196-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.Medical College of Ohio, Toledo, Ohio, USAcongenic628486NER/KyoNoda epileptic rat, GMSOriginated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=26 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermNeurobiology628525Ni/HinFound in the Sprague-Dawley in Japan. In these the Tsc2 gene is not mutated.Clea Japan Inc. Shigainbred628907SHR.BN-RT1<sup>n</sup>This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR.congenic629484LEW-<i>tl</i>The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N.Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MDcongenicCsf1621063629485LE/StmThe LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=265 > National BioResource Project for the Rat in Japan</a>inbredLiving Animals; SpermDiabetes Obesity; Cancer629486PVG/OlaHsdblack hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/pvg_inbred_rat.hl> Harlan</a>inbred629487SHR.WKY-(<i>D1Wox19-D1Wox34</i>)/NjsFragment of the chromosome 1 derived from WKY and repeated backcross to SHRUniversity of Leicester, Leicester, UKcongenic629488SI-Tg(Ednrb)1Ywatransgenic spotting lethalA 5.8 kb fragment of the dopamine-beta-hydroxylase (DbH) promoter used directs Endrb expression in the transgenic Sl/+ animals.University of Texas Southwestern Medical Center, Dallas, Texastransgenic629489Eker-Tg(Tsc2)5HinWild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, JapantransgenicTsc23908629490DA.F344-Aia1/1genomic segments with region of interest from chr 20 were inserted to DA strainNational Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Marylandcongenic629491DA.F344-Aia1/2genomic segments with region of interest from chr 4 were inserted to DA strainNational Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Marylandcongenic629492SlNatural mutation in the progeny of a Wistar-Imamichi female and a wild rat.Institute of Animal Reproduction, Omiya, JapanmutantEdnrb2536629493DA.F344-Aia1/3genomic segments with region of interest from chr 4 were inserted to DA strainNational Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Marylandcongenic629494DA.F344-Aia1/4genomic segments with region of interest from chr 10 were inserted to DA strainNational Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Marylandcongenic629495WKY.SHRSP-(<i>Mt1pa-D1Rat57</i>)/BbbFragment of the chromosome 1 derived from SHRSP and repeated backcross to WKYFreie Universitdt Berlin, Berlin, Germanycongenic629496W-<I>Aspa</I><sup>tmKyo</sup>Strain originated spontaneously in July 1985 from a colony of W/Crj rats.Kyoto University, JapanmutantAspa621693629497SDT/CrljJclSD rats were purchased from Charles River Japan and then bred at Torii Pharmaceutical company Japan. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997.CLEA Japan Inc. Japaninbred629499BXS/IpcvThese recombinant inbred strains are obtained by crossing normotensive BN-<i>Lx</i>/Cub with hypertensive SHR/Ola progenitor strains.Czechoslovak Academy of Sciences, Praguerecombinant_inbred629500LEXF/StmRecombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating.Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japanrecombinant_inbred631163LE/BluGillThis inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock.University of Illinois at Urbana-Champaigninbred631182DA/BklArbNThis is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding.NIH, Arthritis and Rheumatism Branch, Bethesda MD, <a href=http://www.rrrc.us/Strain/?x=91>Rat Resource and Research Center</a>inbredExtinct631220SS.LEW-(<i>D10Mco1-D10Mco31</i>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentResearch Centre-CHUM, Montreal, Quebec, Canadacongenic629504WKY.SHR-(<i>D1Mit3-D1Rat57</i>)/IwaiFragment of the chromosome 1 derived from SHR and repeated backcross to WKYShiga University of Medical Science, Otsu, Japancongenic629505SS.MNS-(<i>D10Mit11-D10M11Mit119</i>)/Mcofragment of the chromosome 10 derived from MNS and repeated backcross to SS/JrMedical College of Ohio, Toledo, Ohio, USAcongenic629506LEW-<i>tl</i>.BN-(<i>D2Arb16-D2Wox8</i>)LEW.<i>tl</i> carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2.Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MDcongenicCsf1621063728162SS.LEW-(<I>D1Mco87-D1Rat71</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.Medical College of Ohio, Toledo, Ohio, USAcongenic728163SS.LEW-(<I>D1Uia2-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.Medical College of Ohio, Toledo, Ohio, USAcongenic728165SS.LEW-(<I>D1Rat196-D1Mco36</I>)/JrSegment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.Medical College of Ohio, Toledo, Ohio, USAcongenic728166WKY.SHRSP-(<I>D1Rat112-D1Wox29</I>)/IzmA segment from SHRSP/Izm was transferred on a WKY/Izm backgroundShimane Medical University, Izumo, Japancongenic728167SS.LEW-(<I>Nos2-D10M11Mit119</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentResearch Centre-CHUM, Montreal, Quebec, Canadacongenic728168WOKThe inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, GermanyDiabetes Research Center, Karlsberg, Germanyinbred728170SS.MNS-(<I>Mme-D2Mit14</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strainResearch Centre-CHUM, Montreal, Quebec, CanadacongenicAtp1a12167728171LEW-<I>RT1<SUP>1</SUP></I>/RjThis coisogenic strain was produced by selecting LEW rats with the <I>RT1<SUP>1</SUP></I> allele.The Center dElevage R. Janvier, France.coisogenic728172SS.MNS-(<I>D2Mit6-Adh1</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNSResearch Centre-CHUM, Montreal, Quebec, CanadacongenicAgtr1b|Atp1a12071|2167728183WF/NTo N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbred728185N:NIHDeveloped in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony.<a href=http://www.rrrc.us/Strain/?x=237>Rat Resource and Research Center</a>outbredExtinct728186LEW/SsNTo N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=165>Rat Resource and Research Center</a>inbredExtinct728189SHR/N-<I>di</I>Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic70416ACHCurtiss and Dunning 1926 at Columbia University Institute for Cancer Research.inbred70417A28807/NCurtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982).NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research CenterinbredExtinct70418A35322Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990.inbred70419A7322Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus.inbred70420A990Curtiss 1921 at Columbia University Institute for Cancer Research.inbred70421AAWAtomic Energy Commission, Melbourne (Adams et al 1984).inbred70422ABHYamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan.Nishimura, Hammatsu University School of Medicine, Japan.inbred70423ACPDunning to National Cancer Institute 1967 at F54.inbred625624Eker-Tsc2/HinEker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo.Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo JapanmutantTsc23908625659DRH/SeacEstablished by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=111 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermCancer628372ACI.FHH-(<i>D1Mit34-D1Rat156</i>)The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI.Animal Research Center of the Erasmus University, Rotterdam, The Netherlandscongenic631278SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/GcrcCongenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background.University of Glasgow, Western Infirmary, Glasgow, UKcongenicGstm1|Vcam1|S1pr12755|3952|61958631285IER/IhrA mutant rat strain which is a useful model for human cataract.Institute of Experimental Animals of Shiga University, Medical Science, Ohtsu, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=732> National BioResource Project for the Rat in Japan</a>inbredLiving AnimalsNeurobiology; Ophthalmology631161DXE3/ZtmIs a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.Zentralinstitut Fur Versuchstierzucht, Hannover, Germanyrecombinant_inbred1357172WF.BBDR-(<i>D4Arb29-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1357173SS.MNS-(<i>Vamp2-D10M11Mit84</i>)/McoThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.Medical College of Ohio, Toledo, Ohio, USAcongenic70452OMOsborne-MendelHeston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>outbred68137SHHF JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile.inbredAdrbk1|Adrbk22062|206370453SRRapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen.inbred1299874OLETF.F344-(<i>D1Rat166-D1Rat90</i>)/TjFemale OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol.Laboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, Japan <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=94 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity1299875DA.F344-(<i>D7Rat22-D7Mit2</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous stateThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland, <a href=http://www.rrrc.us/Strain/?x=634>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies1299876SS.LEW-(<I>D5Rat54-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strainMedical College of Ohio, Toledo, Ohio, USAcongenic631590SHR.WKY-(<i>D1Wox34-Sah</i>)/NjsCongenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHRDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenic1299877DA.F344-(<I>D10Rat204-D10Arb22</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic1299878DA.F344-(<I>D4Arb30-D4Arb4</I>)/ArbThe DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague DawleyThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic1299879SS.SR-(<I>D7Mco7-D7Wox19</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentMedical College of Ohio, Toledo, Ohio, USAcongenic1299880F344.DA-(<I>D20Arb2-D20Arb8</I>)/ArbRegion of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses.The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic631589SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/NjsCongenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHRDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenic1299881SS.LEW-(<I>D5Wox3-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strainMedical College of Ohio, Toledo, Ohio, USAcongenic1300432HAA/FDSCHatano High AvoidanceIn 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation.Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=496 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermBehavior734758DA/HamDark-agoutiOriginal DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).Shizuoka Laboratory Animal Center Hamamatsu, Japaninbred734759SHRSP/GcrcSpontaneously hypertensive rat, stroke proneSHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIHUniversity of Glasgow, Western Infirmary, Glasgow, UKinbred631573SBN/YglSabra hypertension resistantBred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.Ben Gurion University Barzilai Medical Center, Ashkelon, Israelinbred734760WKY/GcrcWistar-KyotoWKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIHUniversity of Glasgow, Western Infirmary, Glasgow, UKinbred734761WF/KgaWistar-FurthObtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan).Kagoshima University Dental School, Kagoshima, Japaninbred631280WKY.SHRSP-(<I>D2Mit5-D2Mgh12</I>)/GcrcCongenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.University of Glasgow, Western Infirmary, Glasgow, UKcongenic631572SBH/YglSabra hypertension proneBred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.Ben Gurion University Barzilai Medical Center, Ashkelon, Israelinbred70454WKY/NNational Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain.<a href=http://dvrnet.ors.od.nih.gov/ratcenter/index.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.nrrrc.missouri.edu/StrainInfo.asp?appn=190>Rat Resource and Research Center</a>inbredEmbryo70455WKYO/KyoInbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=17 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; Sperm70456WMWistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Misima in 1951.inbred70457WMSMunich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWFinbred70459ZDFVancouver diabetic fatty Zucker"Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b).Animal Model Core Facility, University of California at Davisinbred70508SDSprague-DawleyThis strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain probably Wistar) and subsequently to his white female offsprings for 7 generations. All the current colonies are from this original stock.Harlan Sprague Dawley Inc. United StatesoutbredAqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f12141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|72889270509F344/NRrrcCurtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=158>Rat Resource and Research Center</a>inbredSpermCdkn2a|Gfap|Tnfrsf1a2323|2679|621237728139WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>)/BbbThis double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(<I>Shbg-Atp1b2</I>) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(<I>Shbg-Atp1b2</I>) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLsMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic728140SS.LEW-(<I>D10Rat11-D10Mgh1</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentResearch Centre-CHUM, Montreal, Quebec, Canadacongenic728142BN.SHR-(<i>Il6-Cd36</i>)/CubThis congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR.Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republiccongenic728143SS.LEW-(<I>D1Mco38-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.Medical College of Ohio, Toledo, Ohio, USAcongenic728144BN.PD-(<I>D8Rat39-D8Rat35</I>)/CubThis congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM.Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republiccongenic728145SS.LEW-(<I>D5Rat130-D5Rat108</I>)/JrS.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strainDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenic728146F344.BN-(<I>D3Mgh13-D3Mgh7</I>)/DlwThis congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USADepartment of Biological Sciences, Oakland University, Rochester, MIcongenic631276WKHA/CfdWKHA/CfdOriginated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM)Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CAinbred728147BN.PD-(<I>D8Rat39-D8Rat35</I>),SHR-(<I>D4Mgh2-Cd36</I>),SHR-(<I>D20Wox3-D20Mgh5</I>)/CubThis is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM.Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republiccongenic1302676NER/Slcnoda epileptic ratStrain is from Japan SLC, Inc. Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=382 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsNeurobiology737905LEW/MaasStrain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers.University of Limburg, Netherlandsinbred1302677NIG-III/TjStrain is from the University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=502 > National BioResource Project for the Rat in Japan</a>inbredEmbryo1302678NAR/Slcnon albumin ratStrain originated from Japan SLC, Inc, Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=375 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsHematology737921BDIV/lfzSubstrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971)unknowninbred737924WAG/RijSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979Harlan Sprague Dawley, Indianapolis, INinbred737925BN/GroSubstrain of BN, from Billingham and Silvers 1958, to U of GroningenCenter for Biology Kerklaan, University of Groningen, The Netherlandsinbred737870DA.E3-(<i>D20Wox3-D20Mgh4</i>)/RhdA fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA.Section for Medical Inflammation Research, Lund University, Lund, Sweden.congenic737871DA.E3-(<i>D12Got46-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.Section for Medical Inflammation Research, Lund University, Lund, Sweden.congenic737872DA.E3-(<i>D4Mit16-D4Mgh11</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.Section for Medical Inflammation Research, Lund University, Lund, Sweden.congenic737927ALC/ColleSubstrain of ALCunknowninbred737931GC/Kuninbred737933SD/ASprague-Dawley stock initiated by R. Dawley in 1925The Netherlands Cancer Institute, Amsterdam, The Netherlandsinbred737934BN/RijKunSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic UniversityCentral Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlandsinbred737935LEW/NhgSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, GermanyGesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, Germanyinbred737937SDH/Ztuunknownunknowninbred737939BBWB/MolunknownMollegaard Breeding Centre Ltd., Denmarkinbred737940PAR/WslunknownExperimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgiuminbred737861DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic737944BN/RijNSubstrain of BN, from Billingham and Silvers 1958, from Harlan RijnswijkHarlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN, Rat Resource & Research CenterinbredExtinct737949A2/ColleunknownDr. RL Collins, The Jackson Laboratory, Bar Harbor, MEinbred737950DA/ZtmSubstrain of DA/OlaHsd, to Hannover after 1965Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737951CAP/KuvunknownDr. HU Wottge, Universitat Kiel, Kiel, Germanyinbred737952ACI/ZtmunknownZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737955Hooded/ColleunknownDr. RL Collins, The Jackson Laboratory, Bar Harbor, MEinbred737857DA.PVG.1AV1-(<i>D4Rat155-D4Rat84</i>)Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic737959RNU/MolunknownMollegaard Breeding Centre Ltd., Denmarkinbred737964BN/OlaHsdSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/brown_norway_inbred_rat/bnssnolahsd.hl> Harlan </a>inbred737966LEW/KuvSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in GermanyUniversitat Kiel, Kiel, Germanyinbred737969NAR/SaUnon-albumin ratSubstrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to UtrechtDept of Laboratory Animal Science, University of Utrecht, The Netherlandsinbred737970AMORAT/WslunknownExperimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, Belgiuminbred737972BN/CrlSilvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976.<a href=http://www.criver.com/>Charles River Laboratories </a>inbred738120LEW-Tg(HLA-B*2705m1,B2M)133-1TrgThis strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating.<a href=http://www.rrrc.us/Strain/?x=43>Rat Resource and Research Center</a>transgenicEmbryo; Sperm728156SS.LEW-(<I>D5Mco34-D5Mco10</I>)/JrSS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strainDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenic728157SS.LEW-(<I>D5Rat130-D5Mit19</I>)/JrSS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strainDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenic728158SS.LEW-(<I>D5Uia4-D5Mco10</I>)/JrSS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strainDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenic728159SS.LEW-(<I>D1Mco36-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.Medical College of Ohio, Toledo, Ohio, USAcongenic728161PD/CubpolydactylousStrain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the dolydactyly-luxate syndrome.Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republicinbred728194SHR/NTo N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=182>Rat Resource and Research Center</a>inbredExtinct728197RCS-rdy-+This congenic strain is obtained from pink-eyed, tan-hooded RCS rats<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic61115BN/SsNTo N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony.NIH Autoimmune Rat Model Repository and Development Center,inbred728198BHE/NBureau of Home EconomicsTo N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=247>Rat Resource and Research Center</a>inbred631576LEW/CrlCrljDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34.Charles River, Atsugi, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=776> National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoImmunology; Osteosis728394SS.LEW-(<i>D10Rat55-D10Rat13</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic631694WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)/BbbThis single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)Max-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic728395SS.LEW-(<i>D10Rat55-D10Rat120</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic724577SS.LEW-(<i>D10Rat27-Igfbp4</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic728396SS.LEW-(<i>D10Mco15-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Centre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic731186SHR/FubSpontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, GermanyCharite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germanyinbred731191SHRSP.WKY-(<i>D2Rat14-D2Mgh12</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.University of Glasgow, Glasgow, UKcongenic731193DA.PVG-(<i>D4Rat141-D4Mgh11</i>)PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies.Department of Medicine, Karolinska Institutet, Stockholm, Swedencongenic731194SS.LEW-(<i>D3Chm64-D3Rat17</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, Canadacongenic631281WKY.SHRSP-(<I>Fst-Pklr</I>)/GcrcCongenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.University of Glasgow, Western Infirmary, Glasgow, UKcongenic1299870SS.LEW-(<I>D5Uia8-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strainMedical College of Ohio, Toledo, Ohio, USAcongenic1299871DA.F344-(<I>D20Arb2-D20Arb8</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic1299872DA.F344-(<I>D8Arb15-D8Arb22</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic629548SHR.BN-(<i>D1Mit3-Igf2</i>)/1lpcvSHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv.Czech Academy of Sciences, Prague, Czech Republiccongenic629578SS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generationsDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio.congenic631158DXE1/ZtmDXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.Zentralinstitut Fur Versuchstierzucht, Hannover, Germanyrecombinant_inbred631160DXE2/ZtmIs a recombinant inbred strain produced from a cross between DA/Han and E3/Han ratsZentralinstitut Fur Versuchstierzucht, Hannover, Germanyrecombinant_inbred631695SS/JrRkbThis inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat BerlinBenjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany.inbred631846F344.GK-(<i>D1Mgh10-D1Rat90</i>)/SweCongenic strain originated from an inbred F344/Mcwi strainKarolinska Institutecongenic631574Wild/KWild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany.Department of Laboratory Animal Science, Greifswald, Karlsburg, Germanywild631700BB.SHR-(<i>Gnal-D18Mit9</i>)/KDiabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long.Department of Laboratory Animal Science, University Greifswald, Karlsburg, Germanycongenic631294F344.GK-(<I>D1Arb42a-D1Rat90</I>)/SweThis congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 backgroundDepartment of Medical Cell Biology, Uppsala University, Uppsala, Swedencongenic631587SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.Medical College of Ohio, ToledocongenicAce2493731188LAD2low-alcohol-drinkingThese were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings.Department of Medicine, Indiana University School of Medicine, Indianapolis, Indianainbred634380Palcohol-preferringThese were developed at Indiana University for high-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats.Department of Medicine, Indiana University School of Medicine, Indianapolis, IndianainbredNpy3197634381NPalcohol-nonpreferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats.Department of Medicine, Indiana University School of Medicine, Indianapolis, IndianainbredNpy3197631697BBDP/HriThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977.Hagedorn Research Institute, Gentofte, Denmarkinbred631594BN/RjStrain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).Hopital Purpan, Toulouse Cedex, France; Centre D'Elevage R. Janvier, Route des Chenes-Secs Le Genest-St-Isle, Franceinbred1302669HAAHatano High AvoidanceStrain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan.Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japaninbred1302691ALB/HokAlbanyAlbany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=64 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoDentistry1302692WKY.SHRSP-(<I>D1Wox18-D1Rat44</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=323 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302693KZ-<I>Lepr</I><sup>faTky</sup>A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=32 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Embryo; SpermDiabetes Obesity; MetabolismLepr30011302694WKA/SeacWistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=112 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermImmunology1302696FH/HamSlcfawn hooded ratStrain originated at Japan SLC, Inc., Shizuoka , Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=384 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsCardio Hypertension1302697KND/Tkykomeda non-diabetic ratKomeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=16 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoDiabetes Obesity1302698SDR/SlcSpontaneous dwarf ratStrain is from Japan SLC, Inc., Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=373 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=66>Rat Resource and Research Center</a>mutantEmbryo; SpermMetabolism1302699LEXF8D/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=234 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer728187ACI/N-jStrain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=210>Rat Resource and Research Center</a>congenicExtinct737892ACI/SegHsdThis substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/aci_inbred_rat.hl> Harlan</a>inbred731185MWF/FubMunich Wistar FromterMunich Wistar Fromter rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, GermanyCharite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germanyinbred737897ACI/KunSubstrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The NetherlandsCentral Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlandsinbred1331814BN.GK-(<i>D8Got302-D8Got130</i>)/OxThis congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenic634373DA/ZtmRhdDA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.Section for Medical Inflammation Research, Biomedical Center, Lund University, Swedeninbred1331815LEW/MolLEW/MolThis inbred strain originated from a LEW strain bred at the Mollegaard Breeding Center Ltd., DenmarkMollegaard Breeding Center Ltd., DenmarkinbredNcf161307737899BN/CubRecombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The NetherlandsDept of Biology, Charles University, Prague, Czech Republicinbred1331816DA.ACI-(<i>D10Rat2-D10Rat29</i>)/Kini(DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA.Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1117> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology; Immunology1331817BN.LEW-(<i>D10Rat32-D10Mgh4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737909R/ASubstrain of R, from Wistar stock in 1947, to The Netherlands Cancer InstituteThe Netherlands Cancer Institute, Amsterdam, The Netherlandsinbred737910ARISTORAT/WslSubstrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, BelgiumExperimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgiuminbred737922LEW/SsNHsdSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to National Institutes of Health<a href =http://www.harlan.com/strain%20details/rats/lewis.html> Harlan</a>inbred737926F344/NCrlDerived from NIH stock in 1992 by SASCO. To Charles River in 1996.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbred1300433LAA/FDSCHatano Low AvoidanceIn 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation.Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=497 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermBehavior738122SD-Tg(GFP)1BalRrrcThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals.<a href=http://www.rrrc.us/Strain/?x=52>Rat Resource and Research Center</a>transgenicEmbryo; Sperm1299873SS.LEW-(<I>D5Mco34-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strainMedical College of Ohio, Toledo, Ohio, USAcongenic1304487BBDR/WorThese are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM.BRM, Worcester MAinbred737886BDX/CubRecombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The NetherlandsDept of Biology, Charles University, Prague, Czech Republicinbred1331811LEW.BN-(<i>D10Rat32-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1331812LEW.BN-(<i>D10Rat83-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic631595LEW.1AV1.DA-(<i>D10Rat92-D10Rat135</i>)/UbcLEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain.Biomedical Center in Uppsala, Swedencongenic737904U/ASubstrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer InstituteThe Netherlands Cancer Institute, Amsterdam, The Netherlandsinbred737902BDIX/OrlSubstrain of BDIX, now maintained in Orleans, FranceInstitut de Transgenose, Orleans, Franceinbred737908WF/NHsdSubstrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/wistar_furth_inbred_rat.hl> Harlan</a>inbred634363LEW/NIcoCrlfA substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.Charles River, Franceinbred737947BDII/ZtmSubstrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971)Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737953LEW/GutSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germanyunknown sourceinbred737958CHOC/CubunknownInstitute of Physiology, Czech Academy of Sciences, Charles University, Pragueinbred1331813BN.GK-(<i>D8Rat29-D8Got130</i>)/OxThis congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenic634364SHR/NIcoCrlfA substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.Charles River, Franceinbred1302795HTGPrague hypertriglyceridemicThese were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding.Institute of Physiology, Academy of Sciences Prague, Czech Republicinbred1558662SHR/TkyoSubstrain of SHR rats maintained at International Medical Center of Japan, TokyoDepartment of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japaninbred737962SPRD/ZtmSubstrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred1331832BN.LEW-(<i>D10Rat72-D10Arb4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1302620SHR/Kyospontaneously hypertension ratOkamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=9 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermCardio Hypertension1302621LEXF10A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=236 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302700HOB/Snkhobble ratHOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=154 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermNeurobiologyUnc5c7351091302701LEW/SsNSlcStrain is from Japan SLC, Inc.,Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=372 > National BioResource Project for the Rat in Japan</a>inbredLiving AnimalsImmunology634372GHSSD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain.Department of Medicine and Physiology, University of Rochester, Rochester, New Yorkinbred1302703WKY.SHRSP-(<I>D1Wox29-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=315 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension634369WBN/KobSlcwistar bonn/koboriThis strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=378 > National BioResource Project for the Rat in Japan</a>inbredLiving AnimalsDiabetes Obesity; Ophthalmology1302670ACI/NSlcStrain is from Japan SLC, Inc., Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=381 > National BioResource Project for the Rat in Japan</a>inbredLiving Animals1302671WM/TjStrain is from the University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=503 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; Sperm1302672W/KyoHok>Hkm>Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=13 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; Sperm1302673FXLE15/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=253 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302674VF/Kyovacuole formation ratDerived by a spontanious mutation from TRM (F26). Trm deletion was subsequently replaced by inbreeeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=21 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermNeurobiology1302675WKY.SHRSP-(<I>D1Smu13-D1Smu11</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=319 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302653LEXF8A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=233 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302726ZI/KyoZitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=23 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermNeurobiologyAtrn690631302727SHRSR/TaStrain is from Takeda Chemical Industries, Ltd., Osaka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=416 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermCardio Hypertension1302728MES/SlcMatsumoto Eosinophilia ShinshuDerived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=383> National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsHematology634366SR/HsdThis strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.Harlan, Indianapolis, Indianainbred1302729LEA/TjFound in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=79 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoCancer734480SS.LEW-(<i>D10Mit10-D10Mgh1</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.Medical College of Ohio, Toledo, Ohio, USAcongenic734481SS.LEW-(<i>D1Mco2-D1Mco35</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background.Medical College of Ohio, Toledo, Ohio, USAcongenicSa3616734482SS.LEW-(<i>D1Rat45-D1Mco41</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.Medical College of Ohio, Toledo, Ohio, USAcongenicSa3616734483SS.LEW-(<i>D1Rat42-D1Wox10</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.Medical College of Ohio, Toledo, Ohio, USAcongenic734526OLETF/GotOtsuka Long Evans TokushimaLong Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating.Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japaninbred734527OLETF.F344-(<i>D1Rat169-D1Rat459</i>)/GotFemale OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japancongenic1300439SD-Tg(GFP)2BalRrrcThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21.<a href=http://www.rrrc.us/Strain/?x=65>Rat Resource and Research Center</a>transgenicLive Animals; Embryo; Sperm1302654F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=81 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity631577SHR/IzmStrain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=411 > National BioResource Project for the Rat in Japan</a>, Funabashi Farm, Chiba, JapaninbredLiving AnimalsCardio Hypertension1302655TO/HkmStrain originated from the Graduate School of Medicine, Hokkaido University, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=493 > National BioResource Project for the Rat in Japan</a>inbredEmbryo1302656LEA/HokLong Evans AgoutiLong Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes). Kobe university?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975?Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=70 > National BioResource Project for the Rat in Japan</a>inbredEmbryo1302657DOP/Nemdilute-opisthotonus (dop)Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=151 > National BioResource Project for the Rat in Japan</a>segregating_inbredEmbryo; SpermNeurobiologyMyo5a31431302658LEJ/HkmStrain originated at the Graduate School of Medicine, Hokkaido University, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=494 > National BioResource Project for the Rat in Japan</a>inbredLive Animals1302659CXH5/TjStrain originated at the University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=508 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoMetabolism; Immunology1302660RCS/Kyoroyal college of surgeons ratFrom Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=27 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermOphthalmologyMertk692831302661F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=87 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity1302662CXH2/TjStrain originated at the University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=509 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoMetabolism; Immunology1302664WNA/NshmNagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=149> National BioResource Project for the Rat in Japan</a>inbredEmbryo; Sperm1302665FXLE13/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=251 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302666LEXF1C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=221 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302668IS-<I>Tlk</I>/Kyotail anomaly lethal kyotoSpontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=25 > National BioResource Project for the Rat in Japan</a>coisogenicEmbryo; SpermOsteosis61114DA/BklCommercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls.Bantin and Kingman, Fremont, Californiainbred631585SS.LEW-(<I>D16Mit2-D16Rat12</I>)/AydThis congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr backgroundResearch Centre-CHUM, Montreal, Quebec, Canadacongenic631219SDT/JclEstablished from an outbred colony of Sprague-Dawley in Torii Pharmaceutical Co. Ltd.This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating.Torii Pharmaceutical Co. Ltd., Tokyo, Japaninbred61107BB/OKBioBreeding ratThis colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada.Central Institute for Diabetes, Karlsburg, Germany, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=512> National BioResource Project for the Rat in Japan</a>inbredSpermDiabetes Obesity; ImmunologyAsns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk52162|2280|2332|2481|2794|3082|3726|3807|69430|70514631283DA.F344-(<I>D10Arb21-D10Arb22</I>)/ArbThis congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA, <a href=http://www.rrrc.us/Strain/?x=125>Rat Resource and Research Center</a>congenic631848SHR/OlaIpcvThese are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years.Czech Academy of Sciences, Prague, Czech Republicinbred631282DA.F344-(<I>D10Arb20-D10Arb22</I>)/ArbThis speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background.Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA, <a href=http://www.rrrc.us/Strain/?x=124>Rat Resource and Research Center</a>congenic634359WF.WKY-(<i>D5Pas1-D5Uwm37</i>)/UwmWKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region.University of Wisconsin-Madisoncongenic631579LEW/OlaHsdObtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/lewis_inbred_rat/lewssnhsd.hl> Harlan France </a>inbred1302679TRMR/Kyotremor resistantTremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=12 > National BioResource Project for the Rat in Japan</a>segregating_inbredAspa6216931302680SHR/TaStrain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=418 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermCardio Hypertension1302681WKY.SHRSP-(<I>D1Smu11-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=325 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302683FXLE22/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=260 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLiving AnimalsDiabetes Obesity; Cancer1357183SS.MNS-(<i>D10Mco10-Aldoc</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.Medical College of Ohio, Toledocongenic1302684F344/NHokDwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=68 > National BioResource Project for the Rat in Japan</a>inbred1302685F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/TjMicrosatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=99 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity1302686F344/StmDerived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=266 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermDiabetes Obesity; Cancer1302687WKAH/HkmSlcWistar King A, HokkaidoStrain originated from Japan SLC, Inc., Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=376 > National BioResource Project for the Rat in Japan</a>inbredLiving Animals1302688ACI/NMnaThis strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=461 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; Sperm634365SS/HsdThis strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.Harlan, Indianapolis, Indianainbred1302689WKY.SHRSP-(<I>Ntrk3-D1Smu13</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=320 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302377SPRD-<i>Anks6</i>/RrrcFrom outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002.<a href=http://www.rrrc.us/Strain/?x=46>Rat Resource and Research Center</a>mutantEmbryo; SpermAnks63334631591WKY.SHR-(<i>D1Rat56-D1M7Mit206</i>)/NjsCongenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>DWox19-D1Mit2</i>) to WKYDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenic1299868SS.SR-(<I>D7Uia1-D7Mco7</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentMedical College of Ohio, Toledo, Ohio, USAcongenic1299869SS.SR-(<I>Cyp11b1</I>)/JrCongenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strainMedical College of Ohio, Toledo, Ohio, USAcongenic1357191CDS/YglCohen diabetic-sensitive ratCohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelinbred1357192WF.BBDR-(<i>D4Got39-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1357193WF.BBDR-(<i>D4Got51-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic737960Hsd:WIWistarThese are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/wistar_outbred_rat.hl> Harlan</a>outbred1303393LEC/NcuThese rats were established from a closed colony of Long-Evans.Nagoya City University Medical School, Nagoya, Aichi, Japaninbred737968BN/GutSubstrain of BN, from Billingham and Silvers 1958unknowninbred737971SHRSP/RivmunknownNational Institute of Public Health and Environmental Protection, The Netherlandsinbred737888LEW/NHsdCpbThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The NetherlandsHarlan Sprague Dawley, Inc., Indianapolis, INinbred631286WKY/IzmWistar-KyotoWKY strain from the Izumo colony<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=412 > National BioResource Project for the Rat in Japan</a>inbredLiving Animals631279SHRSP.WKY-(<I>D2Rat13-D2Mit5</I>)/GcrcCongenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.University of Glasgow, Western Infirmary, Glasgow, UKcongenic737658PVG.1AV1Piebald-Viral-GlaxoOriginally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany<a href=http://guide.labanimal.com/guide/companyd.jsp?b=8835> Harlan UK, Blackthorn, Bicester, UK</a>congenic737690F344/CrliThese animals were from Charles River Italia, Calco, LC, ItalyCharles River, Calco, Italyinbred737691BN/CrliThese animals were from Charles River Italia, Calco, LC, Italy<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> Italyinbred737703LEW-Tg(HLA-B*0702,B2M)120-4TrgLewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity.<a href=http://www.rrrc.us/Strain/?x=42>Rat Resource and Research Center</a>transgenicEmbryo; Sperm734471SS.LEW-(<i>D1Mgh7-D1Mco41</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background.Medical College of Ohio, Toledo, Ohio, USAcongenic734472SS.LEW-(<i>D1Mco2-D1Wox6</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background.Medical College of Ohio, Toledo, Ohio, USAcongenic734473SS.LEW-(<i>D17Mco3-D17Mco10</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.Medical College of Ohio, Toledo, Ohio, USAcongenic734474SS.LEW-(<i>D5Mit9-D5Mco10</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.Medical College of Ohio, Toledo, Ohio, USAcongenic734475DA/OlaHsdOdell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965.<a href =http://www.harlan.com/strain%20details/rats/da.html> Harlan</a>inbred734476Crl:CD(SD)Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system.Charles River Laboratories International, Inc.outbred734478F344/DuCrlThis colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960.<a href=http://www.criver.com> Charles River Laboratories</a>inbred734479SS.LEW-(<i>D1Mco2-D1Rat49</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background.Medical College of Ohio, Toledo, Ohio, USAcongenic737865WKY.SHRSP-(<i>D2Rat14-D2Mgh12</i>)A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY.University of Glasgow, Glasgow, UKcongenic631578SHR.BN-(<I>D2Rat171-D2Arb24</I>)/IpcvThis congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv backgroundInstitute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic.congenic731187HAD2high-alcohol-drinkingThese were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings.Department of Medicine, Indiana University School of Medicine, Indianapolis, Indianainbred1302601FXLE23/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=261 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302603FXLE25/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=263 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302604LEXF4/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=226 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302605LEXF2A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=222 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLiving AnimalsDiabetes Obesity; Cancer1302606SHRSP/TaThis strain originated from Takeda Chemical Industries, Ltd., Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=414 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermCardio Hypertension1302608CXH6/TjStrain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=506 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoMetabolism; Immunology1302610KMI/Tkyminiature rat ishikawaMiniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=29 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Embryo; SpermOsteosisPrkg234011302611FXLE24/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=262 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302612LEXF10C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=238 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302372SDDIO/RrrcThis strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet.<a href=http://www.rrrc.us/Strain/?x=44>Rat Resource and Research Center</a>inbredEmbryo; Sperm1302373SDDR/RrrcThis strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet.<a href=http://www.rrrc.us/Strain/?x=45>Rat Resource and Research Center</a>inbredEmbryo; Sperm1302613BN/fMaiHokKyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=65 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo1302614WKY/NMnaInbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=460 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; Sperm1302615FXLE14/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=252 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302616LEXF10B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=237 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302617LEXF6B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=228 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302618LEXF9/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=235 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLive Animals; EmbryoDiabetes Obesity; Cancer1302619FXLE16/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=254 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLiving AnimalsDiabetes Obesity; Cancer1358304SD-Tg(S334ter)5LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1358305SD-Tg(S334ter)7LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1358306SD-Tg(S334ter)9LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1547865FHH-Chr 3<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 3 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-3BN%2FMcwi&ratCategory=FHH-3BN%2FMcwi>PhysGen</a>consomicLive Animals; Embryo; Sperm1547866F344/JclInbred strain originated from F344CLEA Japan, Inc.,1-2-7, Higashiyama, Meguro-ku Tokyo 153-8533inbred1547867FHH-Chr 4<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 4 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-4BN%2FMcwi&ratCategory=FHH-4BN%2FMcwi>PhysGen</a>consomicSperm1547868FHH-Chr 2<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 2 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-2BN%2FMcwi&ratCategory=FHH-2BN%2FMcwi>PhysGen</a>consomicSperm1547869ACI/EurAugust x Copenhagen IrishCurtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIHDepartment of Pediatric Surery, Erasmus Medical Center, Rotterdam, Netherlandsinbred1547870FHH-Chr 14<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 14 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-14BN%2FMcwi&ratCategory=FHH-14BN%2FMcwi>PhysGen</a>consomicLive Animals1547871ACI.FHH-(<i>D1Rat324-D1Rat156</i>)/EurCongenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic1547872FHH-Chr X<sup>BN</sup>/McwiFHH-Chr X<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome X introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-XBN%2FMcwi&ratCategory=FHH-XBN%2FMcwi> PhysGen</a>consomicSperm1547873FHH-Chr 15<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 15 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-15BN%2FMcwi&ratCategory=FHH-15BN%2FMcwi>PhysGen</a>consomicSperm1547874FHH-Chr Y<sup>BN</sup>/McwiFHH-Chr Y<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome Y introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-YBN%2FMcwi&ratCategory=FHH-YBN%2FMcwi> PhysGen</a>consomicSperm737920BH/ZtmSubstrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred61116SHRSP/A3Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness.Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, Japaninbred1331826LEW.BN-(<i>D10Mgh7-D10Rat27</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic61099HXB/IpcvDerived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published.Institute of Physiology, Czech Academy of Sciences, Charles University, Praguerecombinant_inbred1331827DA.ACI-(<i>D10Rat10-D10Rat142</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Swedencongenic1331828DA.ACI-(<i>D10Rat12-D10Rat144</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Swedencongenic737930LEW/ZtmLEW/ZtmThis inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, GermanyTierlaboratorium der Medizinischen Hochschule Hannover, GermanyinbredNcf161307634382SHR.BN-(<i>D5Wox12-D5Wox20</i>)/IpcvThis congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv backgroundInstitute of Physiology, Czech Academy of Sciences, Prague, Czech Republiccongenic1302622WF/KopInbred originated from Kagoshima University, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=510 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermCancer1302623TM/Kyotester moriyama ratTester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 .<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=10 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermHematologyRab38<sup>ru</sup>16003111302624RICO/NgsStrain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=479 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio Hypertension; Ophthalmology1302626BN.UPL-(<I>D2Rat134-D2Rat2</I>)/CasStrain originated from Hiroshima University, Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=473 > National BioResource Project for the Rat in Japan</a>congenicSpermOphthalmology1302627F344/NSlcStrain originated from Japan SLC, Inc, Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=379 > National BioResource Project for the Rat in Japan</a>inbredLiving Animals1302629WKY.SHRSP-(<I>D1Rat49-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=314 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302630F344.OLETF-(<I>D10Wox7-D10Wox6</I>)/TjMicrosatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=77 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity1302631BN/SsNSlcStrain originated from Japan SLC, Inc, Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=371 > National BioResource Project for the Rat in Japan</a>inbredSpermImmunology1302632WKY.SHRSP-(<I>D1Smu11-D1Arb21</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=313 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302633FXLE20/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=258 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302634BB/WorTkyBioBreeding ratMutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=30 > National BioResource Project for the Rat in Japan</a>inbredEmbryoDiabetes Obesity; Immunology1302635F344.OLETF-(<i>D12Rat8-D12Rat16</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=98 > National BioResource Project for the Rat in Japan</a>congenic1302636WKY.SHRSP-(<I>D1Wox29-D1Arb21</I>)/IzmThis congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=318 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302637LAAHatano Low AvoidanceStrain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, JapanHatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japaninbred1302638LEXF11/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=239 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302639KHR/Kyokaken hairless ratKaken hairless rat were detected by Kimura from Gunn<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=4 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermDermatologyOca223184121302640ACI/TjStrain originated from The University of Tokushima, Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=501 > National BioResource Project for the Rat in Japan</a>inbredEmbryo1302641LEXF1A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=219 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302642LEA/HkmStrain originated at the University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=495 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo1302643ACI/NKyoaugust copenhagen irishNIH (1988, F143) > Kyo (F43)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=6 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermReproduction1302644CXA5/TjStrain originated at the University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=505 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoMetabolism; Immunology1302645DMY/Kyodemyelination ratFrom a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=8 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermNeurobiology1302646LEXF2C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=224 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302647F344.OLETF-(<i>D5Rat166-D5Rat90</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japancongenic1302648LEC/HokLong Evans CinnamonKobe university?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975?Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F20<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=71 > National BioResource Project for the Rat in Japan</a>mutantEmbryoCancer; ImmunologyAtp7b21801302649LEXF7B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=231 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302650F344.OLETF-(<i>D9Mgh8-D9Rat15</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=96 > National BioResource Project for the Rat in Japan</a>congenic1302651CXA1/TjStrain originated from the The University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=504 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoMetabolism; Immunology1302652LEXF7A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=230 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer10016GH/OmrGenetically HypertensiveThis colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations.University of Otago Wellcome Med. Res. Inst, New Zealand.inbred1357417SD-Tg(Npy)400Mcwi14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene.Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1358112WKY/NCrlOutbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11<a href=http://www.criver.com> Charles River Laboratories</a>inbred1358918W-<i>Plp1</i><sup>mdNya</sup>W-<i>Plp1</i><sup>md</sup>Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders.Division of Laboratories and Research, New York State Department of Health, Albany, New YorkmutantPlp133541358919F344/SeacInbred strain originated from F344 ratsSEAC Yoshitomi Co., Fukuoka, Japaninbred737948BDE/ZtmSubstrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color.Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred1331833DA.ACI-(<i>D10Rat15-D10Rat29</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Swedencongenic1331834BN.LEW-(<i>D10Rat100-D10Rat126</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737954AS/ZtmunknownZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred738038HEPhigh ethanol preferringHigh ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USAInstitut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, Franceinbred1331836WKY/EerWKY/EerInbred strain originated from animals purchased from Harlan Industries, Indianapolis, IndianaDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinoisinbred1354669BN/OrlIcoCrlfStrain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991.<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> Franceinbred1354670F344/IcoCrlfThese are inbred rats that were bought from Charles River, Les Oncins near Lyon, France.<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> Franceinbred1357174BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>)/RhwThe lymphopenia locus from diabetic proned BBDP rat was transferred onto the genome of diabetic-resistant BB rat by marker-assisted selection in nine cycles of cross-intercross breedingDepartment of Medicine University of Washington, Seattle, Washingtoncongenic1357175F344.DR-(<i>D4Mit6-D4Mit24</i>)-Tg(Gimap5)McwiWild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(<i>D4Mit6-D4Mit24</i>)Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsintransgenic1357176WF.BBDR-(<i>D4Arb29-D4Rat96</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1357177F344.DR(DP)-(<i>D4Mit6-D4Mit24</i>)/RhwThe lymphopenia locus from BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding.Department of Medicine University of Washington, Seattle, Washington, <a href=http://www.rrrc.us/Strain/?x=82>Rat Resource & Research Center</a>congenicEmbryo1357178CDCohen diabetic ratOriginally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism.Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelinbred1357179SS.WKY-(<i>D2N35-Mme</i>),MNS-(<i>D10Mit11-D10M11Mit119</i>)/McoSS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F<sub>1</sub> were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister matingMedical College of Ohio, Toledo, Ohio, USAcongenic1558661WKY/TkyoSubstrain of WKY rats maintained at International Medical Center of Japan, TokyoDepartment of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japaninbred731189SHRSP.WKY-(<i>Klk1-D1Rat116</i>)/IzmA segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method.Department of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, Japancongenic1357180SS.LEW-(<I>D8Chm14-D8Rat16</I>)/AydCongenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, CanadaResearch Centre-CHUM, Montreal, Quebec, Canadacongenic1357181CDR/YglCohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, Israelinbred1357182Eker-Tg(Tsc2)28HinWild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, JapantransgenicTsc23908631586SS.MNS-(<I>D10Mco14-D10Mit11</I>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.Medical College of Ohio, Toledocongenic1357184Crl:ZUC-<I>Lepr</I><sup>fa</sup>Zucker ratsThe obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred1357185RHA.Gunn-<i>Ugt1a1</i><sup>j</sup>/NRHA/N rats were crossed with Gunn rats. F<sub>1</sub> hybrids were intercrossed for 12 cycles while selecting for jaundice loci.Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USAcongenic1357186Gunn-<i>Ugt1a1</i><sup>jBluHsd</sup>Gunn ratThis mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.<a href=http://www.harlan.com/strain%20details/rats/gunn.html>Harlan </a>mutant1357187WF.BBDR-(<i>D4Rat16-D4Got39</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1357189SS.LEW-(<I>D8Rat56-D8Rat51</I>)/AydCongenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, CanadaResearch Centre-CHUM, Montreal, Quebec, Canadacongenic1357190SS.MNS-(<I>Adh1-D2Mit5</I>)/McoThis congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr backgroundMedical College of Ohio, Toledo, Ohio, USAcongenic1331818LEW.BN-(<i>D10Rat43-D10Mco4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737932LEW/CrlLewisDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbred737936SR/JrIpcvSubstrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962)Baylor College of Medicine, Houston, TXinbred737941LEP/CubSubstrain of LEP, from Charles University cross of outbred animalsDr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech Republicinbred737942LE/ZtmSubstrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737943R/AEurRijSubstrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986Dr. Adam Goedde, Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, INinbred737961SR/JrMolSubstrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to MollegaardMollegaard Breeding Centre Ltd., Denmarkinbred737965AGUS/OlaHsdSubstrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968<a href =http://www.harlan.com/> Harlan</a>inbred1331819F344/EerF344/EerInbred strain originated from animals purchased from Harlan Industries, Indianapolis, IndianaDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinoisinbred1331820LEW.BN-(<i>D10Got9-D10Rat2</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737885RHA/KunRoman high avoidanceRoman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The NetherlandsDept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlandsinbred737898WOKA/KSubstrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, GermanyZentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germanyinbred1331821LEW.BN-(<i>D10Wox26-D10Arb4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737903Hsd:SDSprague DawleyOriginated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratoriesâ¿¿ colonies are direct descendants of this original colony.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/sprague_dawley_outbred_rat.hl> Harlan</a>outbred1331822DA.ACI-(<i>D10Rat2-D10Rat6</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Swedencongenic1331823LEW.BN-(<i>D10Rat43-D10Rat27</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737906MWF/HsdMunich Wistar FromterSubstrain of Munich Wistar stock, inbred by Harlan Sprague Dawley<a href =http://www.harlan.com/products_and_services/research_models_and_services/eliminated_stocks_and_strains.hl> Harlan</a>inbredEliminated1331824DA.ACI-(<i>D10Rat219-D10Rat29</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Swedencongenic737914SDL/IpcvSubstrain of SDLunknowninbred631571SS.LEW-(<i>D1Uia8-D1Mco38</i>)/JrSegment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic61110SHR/MolSpontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes.Mollegaard Breeding Centre Ltd., Denmarkinbred737919LEW/HanSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, GermanyZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred1357994SHR/NCrlTo Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.<a href=http://www.criver.com> Charles River Laboratories</a>inbredLive Animals1302359SD/HsdFcenThese animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentinaoutbred1302360W/HsdFcenThese animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentinaoutbred1302416ACI.DA-(<i>D10Rat2-D10Rat19</i>)/ArbA fragment from DA/OlaHsd rats is transferred to ACI/SegHsd.Center for Genomics and Human Genetics, Manhasset, New Yorkcongenic1302597LEXF7C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=232 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer634370F344.GK-(<i>D1Mgh10-D1Rat119</i>)/SweGK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain.Karolinska Institutecongenic1302598FXLE26/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=264 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLiving Animals: EmbryoDiabetes Obesity; Cancer1302599WKY/TaThis strain originated from Takeda Chemical Industries, Ltd., Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=419 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; Sperm1302600HTX/Kyohydrocephalus texas1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=3 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermNeurobiology1357978SS.MNS-(<i>D2Mit6-D2Rat303</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strainCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1357979SS.MNS-(<i>Mme-D2Rat131</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strainCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic634743BILUniversity of Pittsburgh from a mutation in a colony of unknown background held by the NIH.NIH Autoimmune Rat Model Repositoryinbred1357980BB.SHR-(<i>D4Got41-Tacr1</i>)/KCongenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997.Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=514 > National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Metabolism731192SS.LEW-(<i>D3Rat52-D3Rat130</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, Canadacongenic10030NEDH/KInbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.Central Institute for Diabetes, Karlsburg, Germany.inbred1357981SS.LEW-(<i>D3Mco21-D3Rat17</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, Canadacongenic1357982SS.LEW-(<i>D3Rat52-D3Chm63</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, Canadacongenic1357983SS.LEW-(<i>D1Mco75-D1Rat18</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic1357984SS.MNS-(<i>D2Mit6-D2Rat166</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strainCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1357985LOU/Insoriginated from Universite Catholique de Louvain.INSERM, C.H.U. Bichat-Claude Bernard, Paris, Franceinbred1357986SS.LEW-(<i>D1Uia8-D1Rat211</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic1357987SS.LEW-(<i>D1Uia8-D1Rat18</i>)/McoA 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic731195DA.E3-(<i>D14Wox8-D14Rat64</i>)/RhdThe fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain.Medical Inflammation Research, BMC, University of Lund, Lund, Swedencongenic1357988SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydA segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Research Centre-CHUM, Montreal, Quebec, Canadacongenic731190SS.LEW-(<i>D1Rat211-D1Rat18</i>)/McoA segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic1358174SS-Chr 19<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 19 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-19BN%2FMcwi&ratCategory=SS-19BN%2FMcwi>PhysGen</a>consomicSperm1358632MR/HarMaudsely reactiveOriginally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvaniainbred1559046SHR-Chr Y<sup>W</sup>/KConsomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=518 > National BioResource Project for the Rat in Japan</a>consomic1559047SHRSP/EzoSubstrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=357 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermNeurobiology; Cardio Hypertension1559048SHR.ODS-<i>Gulo<sup>od</sup></i>/ShiA congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous oens were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=114 > National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCardio Hypertension; OsteosisGulo6207011578697BN.LEW-(<i>D10Rat32-D10Rat31</i>)/CimlCongenic strain was bred from BN.LEW-(<i>D10Rat32-D10Rat221</i>)/Ciml backcrossed to BN/Rj.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578698LAS2Low Alcohol Sensitive strain 2Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred<a href=http://www.rrrc.us/Strain/?x=81>Rat Resource and Research Center</a>inbredEmbryo; Sperm1578699BGanemic BelgradeThese are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY.<a href=http://www.rrrc.us/Strain/?x=72>Rat Resource and Research Center</a>inbredEmbyro; Sperm1578700HAS1High Alcohol Sensitive strain 1Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred<a href=http://www.rrrc.us/Strain/?x=77>Rat Resource and Research Center</a>inbredEmbryo; Sperm1578701HAS2High Alcohol Sensitive strain 2Selectively bred for high ethanol sensitivity for 24 generations, then inbred.<a href=http://www.rrrc.us/Strain/?x=79>Rat Resource and Research Center</a>inbredEmbryo; Sperm1578702LEW.BN-(<i>D10Rat32-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578703SLA/BruRrrcSyracuse Low AvoidanceSelective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats.<a href=http://www.rrrc.us/Strain/?x=69>Rat Resource and Research Center</a>inbredEmbryo; Sperm1357194WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1358298SD-Tg(P23H)1LavThis transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1358299SD-Tg(P23H)2LavThis transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1358300SD-Tg(P23H)3LavThis transgenic strain carries a copy of mouse opsin gene with a proline to histidine substitution at codon 23.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1358302SD-Tg(S334ter)3LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1358303SD-Tg(S334ter)4LavThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>transgenic1566448FHH-Chr 9<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 9 introgressed.<a href=http://pga.mcw.edu/>PhysGen</a>consomicSperm2303784SHR-Chr 4<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=606> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension1566453SD-Tg(HIV-LacZ)AngRrrcFertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid.<a href=http://www.rrrc.us/Strain/?x=49>Rat Resource and Research Center</a>transgenicEmbryo; Sperm1566454BDIV/ZteBDIV/Ztederived from Berlin-Druckrey strain BDIVInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germanyinbred1566455HTX/HcjRrrcAvailable at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30.<a href=http://www.rrrc.us/Strain/?x=50>Rat Resource and Research Center</a>inbredEmbryo; Sperm1566456BDIX/Ztederived from Berlin-Druckrey strain BDIXInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germanyinbred1566457SPRDSprague-DawleyFrom outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990).unknowninbred1566458F344-Tg(ROSA26-hPAP)EpsRrrcF344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP).<a href=http://www.rrrc.us/Strain/?x=48>Rat Resource and Research Center</a>transgenicSperm1566459F344-Tg(ROSA26-EGFP)EpsF344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP).Department of Pathobiological Sciences, University of Wisconsin-Madison, Madison, Wisconsintransgenic1566460SD-Tg(ICAM2-DAF)AngRrrcEmbryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter.<a href=http://www.rrrc.us/Strain/?x=51>Rat Resource and Research Center</a>transgenicEmbryo; Sperm1578692BN.LEW-(<i>D10Rat32-D10Rat116</i>)/CimlCongenic strain was bred from BN.LEW-(<i>D10Mco17-D10Mco14</i>)/Ciml backcrossed to BN/Rj.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578693LEW.BN-(<i>D10Mco17-D10Rat221</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578694ATAlcohol-TolerantThe parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.<a href=http://www.rrrc.us/Strain/?x=76>Rat Resource and Research Center</a>inbredEmbryo; Sperm1578695SHA/BruRrrcSyracuse High AvoidanceSelective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats.<a href=http://www.rrrc.us/Strain/?x=68>Rat Resource and Research Center</a>inbredEmbryo; Sperm1302921F344-Tg(DTR)C354WighDTR cDNA was inserted at the 3' of the 2.5 kb human podocin promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs.Division of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, Michigantransgenic737957WOKW/KSubstrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany; <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=513 > National BioResource Project for the Rat in Japan</a>inbredDiabetes Obesity; Metabolism10041SS/JrSalt SensitiveStrain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982)Dr. John P. Rapp, Medical College of Ohio, USA, <a href=http://www.rrrc.us/Strain/?x=55>Rat Resource and Research Center</a>inbredEmbryo; SpermHmox128061359008F344.HTX-(<i>D11Rat4-D11Arb4</i>)(<i>D17Rat23-D17Rat154</i>)/HcjDouble congenic strain originated from a cross between single congenic strains F344.HTX-(<i>D11Rat4-D11Arb4</i>)/Hcj and F344.HTX-(<i>D17Rat23-D17Rat154</i>)/Hcj.Department of Pharmacology, University of Florida, Gainesvillecongenic1358633MNRA/HarOriginally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvaniainbred1358989WKY.SHR-(<I>D2Rat174-D2Rat28</I>),(<I>D2Rat161-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1358990DA.F344-(<i>D10Mit9-D10Rat24</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/HsdNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030congenic1358991F344.HTX-(<i>D11Rat4-D11Arb4</i>)/HcjCongenic strain originated from F344/NHsd parental strain bred to HTX/HcjDepartment of Pharmacology, University of Florida, Gainesvillecongenic1358992SHR.WKY-(<I>D2Rat40-D2Rat50</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markersDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1358993WKY.SHR-(<I>D2Rat161-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1358994SHR.WKY-(<I>D2Rat161-D2Rat241</I>)This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) congenic strain to the parental strain SHR/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1358995F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/TjCongenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=93> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity1358996SHR.WKY-(<I>D2Rat10-D2Mgh13</I>)This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl backgroundDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1358997WKY.SHR-(<I>D2Rat241-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1358998BUF/NHsdHeston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan.<a href =http://www.harlan.com/> Harlan</a>inbred1358999WKY.SHR-(<I>D2Rat174-D2Rat28</i>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1359000DA.F344-(<i>D10Arb27-D10Rat6</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/HsdNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030congenic1302663F344.OLETF-(<i>D11Rat4-D11Rat1</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=91 > National BioResource Project for the Rat in Japan</a>congenic1566445ACI.BN-(<I>D5Mgh17-D5Rat205</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, NebraskacongenicExtinct1566447GK/MolTacGoto-KakizakiOriginating at Tohoku University, Sendai, Japan in 1975, the Goto-Kakizaki rat was obtained by Aarhus University Hospital, Denmark in 1994. Received from Aarhus by M&B A/S in 1997.<a href=http://www.taconic.com/anmodels/GK.htm>Taconic</a>inbred1302708FXLE17/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=255 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302709WKY/HcmStrain is from the Hyogo College of Medicine, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=442 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio Hypertension1302710LEXF2B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=223 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302711EHC/SeacIsolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=115 > National BioResource Project for the Rat in Japan</a>inbred1302712ZIMY/KyoZitter Masao YamadaZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=24 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermNeurobiologyAtrn690631302715WKY.SHRSP-(<I>D1Wox18-D1Wox29</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=324 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302716OM/NSlcOsborne-Mendel ratThe Instutite of Medical Science, The University of Tokyo to Slc (1985)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=385 > National BioResource Project for the Rat in Japan</a>inbredLiving Animals1302717ACI/NHokNIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=62 > National BioResource Project for the Rat in Japan</a>inbredEmbryoCardio Hypertension61109F344/NHsdF344/NHsdStrain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.<a href =http://www.harlan.com/strain%20details/rats/fischer.html> Harlan</a>inbred1302718HWY/Slchairless wistar yagiStrain is from Japan SLC, Inc., Shizuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=374 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsDermatology1302719DON/KyoDonryu ratJapanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; Sperm1302720CXH10/TjStrain is from the University of Tokushima, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=507 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoMetabolism; Immunology1302721LEC/TjFound in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=80 > National BioResource Project for the Rat in Japan</a>mutantEmbryoCancerAtp7b21801302722PVG/SeacPiebald Virol GlaxoStrain is from Seac Yoshitomi, LTD., Fukuoka, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=113 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermImmunology1302723LEXF5/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=227 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo; SpermDiabetes Obesity; Cancer1302724SHR/HcmStrain is from the Hyogo College of Medicine, Japan.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=441 > National BioResource Project for the Rat in Japan</a>mutantEmbryoCardio Hypertension1357345DA/KDark Agouti/KarlsburgDark agouti rats which were bred adn housed in Dept. of Laboratory Animal Science, Karlsburg, GermanyDept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germanyinbred1357346BB.SHR-(<i>D4Mit6-Spr</i>)/KBB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected.Department of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, GermanycongenicNpy|Spr3197|37531358158FHH-Chr 16<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 16 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-16BN%2FMcwi&ratCategory=FHH-16BN%2FMcwi>PhysGen</a>consomicSperm1358159FHH-Chr 6<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 6 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-6BN%2FMcwi&ratCategory=FHH-6BN%2FMcwi>PhysGen</a>consomicSperm1358160SS.BN-(<i>D8Rat163-D8Rat81</i>)/McwiA SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SSBN8ab&ratCategory=SS.BN-%28D8rat163-D8rat81%29%2FMcwi>PhysGen</a>congenic728199RHARoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965).<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenic1358161SS.LEW-(<i>D16Rat38-D16Chm66</i>)/AydThis congenic strain originated from a SS/Jr parental strain.Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canadacongenic1358162SS-Chr 12<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 12 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-12BN%2FMcwi&ratCategory=SS-12BN%2FMcwi>PhysGen</a>consomicLive Animals1358163SS-Chr 15<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 15 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-15BN%2FMcwi&ratCategory=SS-15BN%2FMcwi> PhysGen</a>consomicLive Animals; Embryo; Sperm1358164FHH-Chr 17<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 17 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-17BN%2FMcwi&ratCategory=FHH-17BN%2FMcwi>PhysGen</a>consomicSperm1358165SS.MNS-(<i>D2Chm51-D2Rat341</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain.Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1358166SS.LEW-(<i>D16Mit3-D16Rat112</i>)/AydThis congenic strain originated from a SS/Jr parental strain.Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canadacongenic1358167SS.MNS-(<i>D2Wox27-Adh1</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1358168SS.LEW-(<i>D16Mit2-D16Chm23</i>)/AydThis congenic strain originated from a SS/Jr parental strain.Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canadacongenic1358169SS.MNS-(<i>D2Chm25-D2Rat131</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Chm90-D2Wox37</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1358170FHH-Chr 5<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 5 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-5BN%2FMcwi&ratCategory=FHH-5BN%2FMcwi>PhysGen</a>consomicSperm1358171SS-Chr 17<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 17 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-17BN%2FMcwi&ratCategory=SS-17BN%2FMcwi>PhysGen</a>consomicSperm1358172SS.MNS-(<i>D2Chm25-Fgg</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1358173FHH-Chr 11<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 11 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-11BN%2FMcwi&ratCategory=FHH-11BN%2FMcwi>PhysGen</a>consomicSperm1357974BB.SHR-(<i>D4Got41-Gimap5</i>)/KOriginated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic1357975SS.LEW-(<i>D1Mco4-D1Rat18</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic1357976BB.SHR-(<i>D4Got41-D4Rat171</i>)/KOriginated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.Department of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic1358921WF.DA-(<i>D19Mit1-D19Mit6</i>)/KopCongenic strain originated from a parental DA/Slc strain.kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=521> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancerNqo125031358922BB.WOKW-(<i>D4Got41-Fabp1</i>)/KCongenic strain originated from a BB/OK parental strain.Dept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, Germanycongenic1358923LE-<i>Mbp</i><sup>md</sup>10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks.Department of Pathology and Molecular Medicine, McMaster University, Hamilton, CanadamutantMbp30541359001WKY.SHR-(<I>D2Rat42-D2Rat139</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markersDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic631582SS.WKY-(<i>Mme-D2Wox18</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/JrMedical College of Ohio, Toledo, Ohio, USAcongenic1549808SS.LEW-(<i>Prlr-D2Rat143</i>)/AydCongenic strain was created from a SS/Jr parental strainResearch Centre Hospitalier de l'Universite de Montreal, Quebec, Canadacongenic1549809BN/KtsSlcKitasato University School of Medicine to Slc (2002)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=388 > National BioResource Project for the Rat in Japan</a>inbredLiving AnimalsImmunology1549810AI/Msikamelogenesis imperfecta ratThis strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=443 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermDentistry1549811ACI/NJclACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan.Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=546> National BioResource Project for the Rat in Japan</a>inbred1549813F344.ACI-<i>Lmx1a<sup>qc</sup></i>/KyoCongenic strain created by backcrosses between ACI/Pas and F344/NSlc strains.Institute of Laboratory Animals at Kyoto University, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=2&StrainsDir=Asc&StrainsPageSize=20> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermLmx1a13047841559039ODS/JclOsteogenic disorder ShionogiThe osteogenic disorder Shionogi (ODS) rat is a mutant Wistar rat that is subject to scurvy, because it lacks L-gulono-gamma-lactone oxidase, a key enzyme in L-ascorbic acid biosynthesis.CLEA Japan, Inc. Tokyo Japanmutant1559040MD/Tamamyelin deficient ratX-linked mutant of the Wistar rat.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=248 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsNeurobiology; Development1302628ACIS/HokSpontaneous mutation from ACI/Hok in 1981.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=63 > National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Embryo; Sperm1559041SHRSP/NgskSubstrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=303 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermNeurobiology; Cardio Hypertension; Osteosis1559042SHR/NigOriginated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=286 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio Hypertension; Pharmacology1559043MV/Opumyelin vacuolation ratThe myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=187 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermNeurobiologyAtrn690631559044SS.SR-(<i>D3Mco19-D3Mco5</i>)/JrA region of chr 3 which contains the Edn3 gene was introgressed into the SS ratsMedical College of Ohio, Toledo, Ohio, USAcongenicEdn325341559045LEW/CrlcLEW substrain obtained from Charles River Laboratories, La Salle, Quebec, CanadaCharles River Laboratories, La Salle, Quebec, Canadainbred737938AUG/OlaHsdSubstrain of AUG, derived from US August substrains in 1951Harlan Sprague Dawley, Inc., Indianapolis, INinbred737945BN/HanSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973.Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737946WAG/OlaHsdSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague DawleyHarlan Sprague Dawley, Inc., Indianapolis, INinbred1331829BN.LEW-(<i>D9Got8-D9Got200</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737956WF/Gutsubstrain of Wistar Furth stock, from J Furth in 1945unknowninbred737963LEW/CubSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in PragueInstitute of Physiology, Czech Academy of Sciences, Charles University, Pragueinbred737967BS/ZtmSubstrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred1331830F344.BN-(<i>D5Rat1-D5Mit5</i>)/DlwThis congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USADepartment of Biological Sciences, Oakland University, Rochester, MIcongenic1298093LEW/NHsdObtained from Harlan-Sprague Dawley (Indianapolis, Indiana) at 35-45 days of age.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/lewis_inbred_rat.hl> Harlan</a>inbred737887AO/OlaHsdThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/ao_inbred_rat.hl> Harlan</a>inbredCryopreserved737894LEW/OrlSubstrain of Lewis rats, maintained in Orleans, FranceInstitut de Transgenose, Orleans, Franceinbred737900WF/ZtmRecombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, GermanyZentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred737915R/AWaSubstrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986Dept of Genetics, Agricultural University, Wageningen, The Netherlandsinbred737916DZB/GroSubstrain of DZB, to Dr. G.A. van Oortmerssen at University of GroningenCenter for Biology Kerklaan, University of Groningen, The Netherlandsinbred1331831LEW.BN-(<i>D10Rat173-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic737923SHR/MaasSubstrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The NetherlandsErasmus MC, DR Rotterdam, The Netherlandsinbred737928BN/NHsdCpbSubstrain of BN, from Billingham and Silvers 1958Harlan CPB, Harlan Sprague Dawley, Inc., Indianapolis, INinbred737929Crl:WIWistar ratsTo Scientific Products Farm, Ltd.[predecessor of Charles River United<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbred631698BN/MolThis strain is maintained at the Mollegaard breeding center.Mollegaard Breeding Centre Ltd., Denmarkinbred1302704WKY.SHRSP-(<I>D1Wox29-D1Rat199</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=321 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302705WKY.SHRSP-(<I>D1Wox29-D1Smu13</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=322 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1302706F344.OLETF-(<i>D5Rat32-D5Rat26</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=92 > National BioResource Project for the Rat in Japan</a>congenic1302707LEXF3/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=225 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1357977SS.LEW-(<i>D1Mco8-D1Rat213</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic1358179FHH-Chr 13<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 13 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-13BN%2FMcwi&ratCategory=FHH-13BN%2FMcwi>PhysGen</a>consomicSperm1358180FHH-Chr 19<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 19 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-19BN%2FMcwi&ratCategory=FHH-19BN%2FMcwi>PhysGen</a>consomicSperm1358258RCS/LavRrrcroyal college of surgeons ratDeveloped before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=314>Rat Resource and Research Center</a>inbredEmbryo; Sperm1358259RCS-<i>p</i><sup>+</sup>/LavRrrcDeveloped by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=315>Rat Resource and Research Center</a>congenicEmbryo; Sperm1358277RCS-<I>rdy</I><sup>+</sup>/LavRrrcDeveloped by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=317>Rat Resource and Research Center</a>congenicEmbryo; Sperm1358278RCS-<i>rdy</I><sup>+</sup><I> p</I><sup>+</sup>/LavRrrcDeveloped by crossing a pink-eyed control(RCS-rdy<sup>+</sup>/Lav x black-eyed dystrophic(RCS-p<sup>+</sup>/Lav) The F12 progeny was backcrossed to RCS-rdy<sup>+</sup>/Lav.<a href=http://www.ucsfeye.net/mlavailRDratmodels.shtml> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=316>Rat Resource and Research Center</a>congenicEmbryo; Sperm1547875ACI.FHH-(<i>D17Rat117-D17Arb5</i>)(<i>D17Rat180-D17Rat51</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic1547876FHH-Chr 10<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 10 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-10BN%2FMcwi&ratCategory=FHH-10BN%2FMcwi>PhysGen</a>consomicSperm1549794SS.LEW-(<i>D2Rat199-D2Mco17</i>)/AydCongenic strain was created from a SS/Jr parental strainResearch Centre Hospitalier de l'Universite de Montreal, Quebec, Canadacongenic1549795SS.LEW-(<i>D2Rat199-D2Rat143</i>)/AydCongenic strain was created from a SS/Jr parental strainResearch Centre Hospitalier de l'Universite de Montreal, Quebec, Canadacongenic1549796BN/2HokTransferred from Hokkaido University, Chromosome Research Unit, 1987 F16<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=67 > National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Embryo1358114SS-Chr 5<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-5BN%2FMcwi&ratCategory=SS-5BN%2FMcwi>PhysGen</a>consomicLive Animals; Sperm1359002NTac:WKYThe Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony.<a href=http://www.taconic.com/anmodels/wky.htm>Taconic</a>outbred1359003LEW/JrThis strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA.Medical College of Ohio, Toledo, Ohio, USAinbred1359004DA.F344-(<i>D10Mit9-D10Rat11</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/HsdNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030congenic1359005SHR.WKY-(<I>D2Rat15-D2Rat50</I>)This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) to parental strain SHR/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1359006WKY.SHR-(<I>D2Rat27-D2Rat243</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1359007WKY.SHR-(<I>D2Rat174-D2Rat62</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic728184SHRSP/A3NTo N in 1975 from Yamori at F36. SHR was isolated from Wis- tar-Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517)<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=183>Rat Resource and Research Center</a>inbredExtinct1599674BBDP.WF-(<i>D8Rat59-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadacongenic1599675BBDP.WF-(<i>D13Rat124-D13Mgh5</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicPtprc34511599755F344.BN-(<i>D16Mit5-D16Rat75</i>)BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segmentDepartment of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, Italycongenic1599756BN-<i>Has2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantHas2<i><sup>m1Mcwi</i></sup>15995661599757BN-<i>Adora2a<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PhysGen </a>mutantAdora2a<i><sup>m2Mcwi</i></sup>15995611599758SS-<i>Sod3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PhysGen </a>, <a href=http://www.rrrc.us/Strain/?x=415>Rat Resource and Research Center</a>mutantSpermSod3<i><sup>m1Mcwi</i></sup>15995671599759GRY/Idrgroggy ratGroggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=498&StrainsDir=Asc&s_Strainname=GRY> National BioResource Project for the Rat in Japan</a>, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto JapaninbredLive Animals; Embryo; SpermNeurobiology1579690FHH-<i>Slc27a5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantSlc27a5<i><sup>m1Mcwi</i></sup>15787991579691SS.SHR-(<i>D11Mgh3-D11Rat31</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.Medical College of Ohio, Toledo, Ohiocongenic1302667F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=95 > National BioResource Project for the Rat in Japan</a>congenic1554301WKHA/BordStrain was originated from WHHA/Edh at the University of Vermont College of MedicineUniversite Victor Segalen Bordeaux 2, Bordeaux cedex, Franceinbred1554302HOB-<I>Unc5c</I><sup>+Snk</sup>hobble ratHomozygous hobble rats that were taken from the inbred hobble rat colony.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=545 > National BioResource Project for the Rat in Japan</a>mutantUnc5c7351091554303CVD/OpuCerebellar vermis defect ratOriginated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates.Department of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, JapanmutantUnc5c7351091359009WKY.SHR-(<I>D2Rat174-D2Rat185</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markersDept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenic1359010WF.BBDR-ART2<SUP>a</SUP>/WorWistar FurthCongenic strain created by backcrossing WF strain to BBDR strain which are RT1 <SUP>u/u</SUP> , ART2<SUP>a</SUP>.University of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605congenic1549797BUF.ACI-(<i>D16Rat31-D16Arb1</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr16 was developed by speed congenic method.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=171 > National BioResource Project for the Rat in Japan</a>congenic1549798BB.PVG-<i>RT1</i><sup>u/a</sup>/TkyA congenic strain with the genetic background of the BB/WorTky strain (RT1.B<sup>u</sup>,D<sup>u</sup> ) onto which the MHC locus of PVG.R23 strain (RT1.B<a>,D<a>) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=31 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Immunology1549799BB.SHR-<i>(D6Rat184-D6Rat3)</i>/KCongenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=517 > National BioResource Project for the Rat in Japan</a>congenicSpermMetabolism1549800BN/KunKtsSlcKitasato University School of Medicine to Slc (2001)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=387 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsMetabolism1549801BN/SeacSeac Yoshitomi, LTD, Fukuoka, JapanSeac Yoshitomi, LTD, Fukuoka, Japan,<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=421> National BioResource Project for the Rat in Japan</a>inbredSpermBehavior; Ophthalmology1549802BN/1HokTransferred from Hokkaido University, Chromosome Research Unit, 1987 F15<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=66 > National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Embryo; Sperm1549803ACI-<i>Lyst</i><sup>bg-Kyo</sup>/KyoSpontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=7 > National BioResource Project for the Rat in Japan</a>coisogenicEmbryo; SpermHematology1549804BUF/NacJclCLEA Japan, Inc., Tokyo JapanCarcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japaninbred1549805BUF.Cg-<i>Foxn1</i><sup>rnu</sup>/MnaBUF/Mna, NN1H-Rnu/Rnu<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=459 > National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermUrology1549806BUF.ACI-(<i>D3Rat56-D3Rat83</i>)/NccThis strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strainCarcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=167> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer631583SS.WKY-(<i>D2Mgh8-D2Mgh9</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/JrMedical College of Ohio, Toledo, Ohio, USAcongenic1357953WAG/RijHfrSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Harlan France.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/wag_inbred_rat.hl> Harlan France </a>inbred1357954F344/NHfrStrain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/fischer_344_inbred_rat/f344ncrhsd.hl> Harlan France </a>inbred1357955WF/NHfrWistar-FurthSubstrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/wistar_furth_inbred_rat.hl> Harlan France </a>inbred1357957LEW/HanHfrSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany. Supplied by Harlan, France.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/lewis_inbred_rat/lewhanhsd.hl> Harlan France </a>inbred1357958BN/RijHfrSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/brown_norway_inbred_rat/bnrijhsd.hl> Harlan France </a>inbred1357959FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/McwiThe Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH.Department of Physiology, Medical College of Wisconsin, Milwaukee WisconsincongenicLive AnimalsCtsc|Grm5|Nox4|Rab38|Tyr2445|2746|620600|628752|1589755631581LEW.1FOriginally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1<sup>f</sup> haplotype into the LEW stockZentralinstitut fur versuchstierzucht, Hannover, Germanyinbred1357960LE/CpbHfrSubstrain of LE which was bred at Harlan CPB now at Harlan France.<a href=http://www.harlan.com/products_and_services/research_models_and_services/research_models/le_inbred_rat.hl> Harlan France </a>inbred61111DA/Slcdark agoutiThese were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=380 > National BioResource Project for the Rat in Japan</a>inbredLiving Animals1358150SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydThis congenic strain originated from a SS/Jr parental strain.Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canadacongenic1358151FHH-Chr 8<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 8 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-8BN%2FMcwi&ratCategory=FHH-8BN%2FMcwi>PhysGen</a>consomicSperm1358152SS-Chr 14<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 14 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-14BN%2FMcwi&ratCategory=SS-14BN%2FMcwi>PhysGen</a>consomicSperm1358153COP/CrCrlInbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998.<a href=http://www.criver.com> Charles River Laboratories</a>inbred1358154SS-Chr 3<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 3 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-3BN%2FMcwi&ratCategory=SS-3BN%2FMcwi>PhysGen</a>consomicLive Animals; Sperm1358155SS.LEW-(<i>D10Rat119-D10Mgh1</i>)(<i>D16Rat21-D16Rat112</i>)/AydThis double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (<i>D10Rat119-D10Mgh1</i>)and (<i>D16Rat21-D16Rat112</i>) from the LEW strainResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canadacongenic1358156SS.MNS-(<i>D2Rat183-D2Chm113</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1358157FHH-Chr 7<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 7 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-7BN%2FMcwi&ratCategory=FHH-7BN%2FMcwi>PhysGen</a>consomicSperm1579708FHH-<i>Des<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantDes<i><sup>m1Mcwi</i></sup>15788011579709Wild/McwiWildThese rats were caught wild in Milwaukee, used for experiments and then sacrificed.Caught in Milwaukeewild1579710GK/FarGoto-KakizakiGenerated by selective brother x sister breding of 18 non-diabetic Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai JapanJames A. Haley Veterans Hospital, Tampa Floridainbred1579711FHH-<i>Adipoq<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHeh&ratCategory=FHeh>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=406>Rat Resource and Research Center</a>mutantSpermAdipoq<i><sup>m1Mcwi</i></sup>15787871579712FHH-<i>Klf6<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantKlf6<i><sup>m1Mcwi</i></sup>15787891578696LAS1Low Alcohol Sensitive strain 1Selectively bred for 24 generations for low sensitivity to ethanol then inbred.<a href=http://www.rrrc.us/Strain/?x=80>Rat Resource and Research Center</a>inbredEmbryo; Sperm1579677FHH-<i>Madd<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantMadd<i><sup>m1Mcwi</i></sup>15787961579678ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicLive Animals; Sperm1579680Wild/TkuWildThese rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed.Caught in Tokyowild1579681BN-<i>Birc3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga-bin/strain_profile.cgi> PhysGen </a>mutantBirc3<i><sup>m1Mcwi</i></sup>15787881579682FHH-<i>Tlr4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHen&ratCategory=FHen>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=411>Rat Resource and Research Center</a>mutantSpermTlr4<i><sup>m1Mcwi</i></sup>15787851579683FHH-<i>Ghsr<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHed&ratCategory=FHed>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=405>Rat Resource and Research Center</a>mutantSpermGhsr<i><sup>m1Mcwi</i></sup>15787941579684FHH-<i>Slc8a2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHec&ratCategory=FHec>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=404>Rat Resource and Research Center</a>mutantSpermSlc8a2<i><sup>m1Mcwi</i></sup>15787861579685FHH-<i>Tgfbr2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHdv&ratCategory=FHdv>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=400>Rat Resource and Research Center</a>mutantSpermTgfbr2<i><sup>m2Mcwi</i></sup>15787821579686GH/OmrMcwiThis colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=GH&ratCategory=GH>PhysGen</a>inbredLive Animals; Embryo1579687FHH-<i>Proc<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHem&ratCategory=FHem>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=410>Rat Resource and Research Center</a>mutantSpermProc<i><sup>m1Mcwi</i></sup>15787901302625F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=101 > National BioResource Project for the Rat in Japan</a>congenic1302607FXLE21/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=259 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1559030LEC-Tg(ATP7B)TohmA 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=457 > National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermCancer1302695SER/Kyospontaneously epileptic ratSpontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=28 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Embryo; SpermNeurobiologyAtrn|Aspa69063|621693724574SHR/NHsdSHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN)<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/spontaneously_hypertensive_inbred_rat.hl> Harlan</a>inbred1559031NE/MaveThe control strain of GAERS, free of any spontaneous spike and wave discharges.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=558 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo; SpermNeurobiology1559032SS.LEW-(<I>D17Rat65-D17Chm2</I>)/AydThis congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentResearch Centre, Centre Hosp Univ Montreal, Quebec, Canadacongenic1559033SS.LEW-(<I>D17Rat65-Prl</I>)/AydThis congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strainResearch Centre, Centre Hosp Univ Montreal, Quebec, Canadacongenic1559034SS.LEW-(<I>D17Chm14-D17Rat97</I>)/AydThis congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentResearch Centre, Centre Hosp Univ Montreal, Quebec, Canadacongenic1302702TRM/Kyotremor ratTremor Rat 1980 was found in a colony of outbred Wistar/Kyo while establishing inbred strains from Wistar/Kyo by spontanious mutation. After F18, a control line WTC was separated.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=11 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Embryo; SpermNeurobiologyAspa6216931559035SS.LEW-(<I>D17Chm14-D17Rat181</I>)/AydThis congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strainResearch Centre, Centre Hosp Univ Montreal, Quebec, Canadacongenic1559036LEW/JmsLewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.nrrrc.missouri.edu/StrainInfo.asp?appn=54>Rat Resource and Research Center</a>inbredEmbryo; Sperm1559037SS.LEW-(<I>D17Chm9-D17Rat97</I>)/AydThis congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentResearch Centre, Centre Hosp Univ Montreal, Quebec, Canadacongenic1578704WLPWarsaw Low PreferingThese were bred from albino stock of Wistar rats as lines that had low ethanol preference.Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Polandinbred1578705LEW.BN-(<i>D10Arb4-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578706LEW.BN-(<i>D10Mco17-D10Mco14</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1302602FXLE12/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=250 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302682FXLE18/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=256 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1302690FXLE19/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=257 > National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryoDiabetes Obesity; Cancer1578708LEW.BN-(<i>D10Mgh7-D10Rat221</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578709IAincisor absentThese rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption.<a href=http://www.rrrc.us/Strain/?x=64>Rat Resource and Research Center</a>inbredEmbryo; Sperm1578710LEW.1AR1-<I>iddm</I>/Ztmarose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup>) in the intra-MHC recombinant inbred strain LEW.1AR1 ; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain sinceInstitute for Laboratory Animal Science, Hannover Medical School, Hanover, Germanycoisogenic1578711LEW.BN-(<i>D10Mco17-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578712BN.LEW-(<i>D10Mco17-D10Mco14</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578713BN/Ztmsubstrain of BNInstitute for Laboratory Animal Science, Hannover Medical School, Hanover, Germanyinbred1578714BN.LEW-(<i>D10Mco17-D10Rat80</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic1578715ANTAlcohol-NontolerantThe parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.<a href=http://www.rrrc.us/Strain/?x=78>Rat Resource and Research Center</a>inbredEmbryo; SpermGabra6618611578716LEW.1AR1/ZtmLewis strain containing MHC haplotype <i>RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup></i>Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germanycongenic1578717WHPWarsaw High PreferingThese were bred from albino stock of Wistar rats as lines that had ethanol preference.Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Polandinbred1579688BN-<i>Tgfbr2<sup>m1</i>Mcwi</sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=BNeb&ratCategory=BNeb>PhysGen</a>mutantTgfbr2<i><sup>m1Mcwi</i></sup>15788001579689FHH-<i>F10<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=401>Rat Resource and Research Center</a>mutantSpermF10<i><sup>m1Mcwi</i></sup>15787831581639HAn/Humdhigh autotomy newMales and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbred1581640HA/Humdhigh autotomyHigh Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbred10011COP/OlaHsdThese are derived from the original colony which was developed by Dr. W.F. Dunning.<a href =http://www.harlan.com/strain%20details/rats/copenhagen.html> Harlan</a>inbred1357195SS.MNS-(<i>Aldoc-D10Mco1</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.Medical College of Ohio, Toledo, Ohio, USAcongenicNos231851357196WF.BBDR-(<i>D4Arb29-D4Rat265</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1358175FHH-Chr 20<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 20 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-20BN%2FMcwi&ratCategory=FHH-20BN%2FMcwi>PhysGen</a>consomicSperm1358176FHH-Chr 18<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 18 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH-18BN%2FMcwi&ratCategory=FHH-18BN%2FMcwi>PhysGen</a>consomicSperm1358177SS.MNS-(<i>D2Chm25-D2Mit14</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canadacongenic1566434NTac:SHRTaconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony.<a href=http://www.taconic.com/anmodels/sponthyp.htm>Taconic</a>outbred1358178SS-Chr 10<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 10 introgressed.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-10BN%2FMcwi&ratCategory=SS-10BN%2FMcwi>PhysGen</a>consomicSperm737657LEW.1AV1Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1<sup>av1</sup> haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region.National Veterinary Institute, Uppsala, Sweden, <a href=http://www.rrrc.us/Strain/?x=201>Rat Resource and Research Center</a>congenicExtinct728196RHA/N-<i>j</i>Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=229>Rat Resource and Research Center</a>congenicExtinct1598799ACI.FHH-(<i>D1Rat384-D1Rat452</i>)(<i>D17Rat61-D1Arb5</i>)(<i>D17Rat51</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic1598800ACI.FHH-(<i>D1Rat384-D1Rat156</i>)/EurCongenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic1598801ACI.FHH-(<i>D1Mit18-D1Mit8</i>)(<i>D14Mit11-D14Hmgc14b</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic1598802BBDR/WorNDeveloped from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generationNIH Autoimmune Rat Model Repository and Dev Ctr, <a href=http://www.rrrc.us/Strain/?x=94>Rat Resource & Research Center</a>inbredExtinct1598803BBNB/WorNDeveloped from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.NIH Autoimmune Rat Model Repository and Dev Ctr, <a href=http://www.rrrc.us/Strain/?x=93>Rat Resource & Research Center</a>inbredExtinct1598804WKY.GHS-(<i>D1Rat32-D1Mit32</i>)GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTLDepartment of Medicine and Physiology, University of Rochester, Rochester New Yorkcongenic1600337F344.GK-(<i>D1Mgh14-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.Karolinska Institutet, Stockholm, Swedencongenic1580542PCK/CrljCrl-<i>Pkhd1<sup>pck</i></sup>/CrlThis model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Katsuyama and associates in 2000. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD). To Charles River in 2006.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>coisogenic1581616DA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background strainCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Swedencongenic1581617SD-Tg(Ubc-eGFP/ Dazl-shRNA)16-13GarThis transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)University of Texas Southwestern Medical Center, Dallas Texastransgenic1581618SHRSP/BbbThis SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by srict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany.Max - Delbruck - Center for Molecular Medicine, Germanyinbred1599767SS-<i>Htr1a<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantHtr1a<i><sup>m2Mcwi</i></sup>15995621599768SS-<i>Klf4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantKlf4<i><sup>m1Mcwi</i></sup>15995691599769COP.DA-(<I>D3Rat233-D3Mgh14</I>)/McoMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.University of Toledo College of Medicine, Toledo, Ohiocongenic1600338SHR.F344-(<i>D12Mgh5-D12Mgh6</i>)/SnkSegment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic techniqueMedicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japancongenic1600339BN.GK-(<i>D1Wox18-D1Got254</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenic1600340DA/BklArbNsiOriginally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI.Feinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NY, <a href=http://www.rrrc.us/Strain/?x=653>Rat Resource and Research Center</a>inbredEmbryo; Sperm1600341LEW-Tg(Ren2)27This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl ratsWake Forest University School of Medicine, Winston-Salem, North Carolinatransgenic1600342F344.GK-(<i>D1Got250-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.Karolinska Institutet, Stockholm, Swedencongenic1600343SHRSP.WKY-(<I>D1Wox29-D1Arb21</I>)/IzmThis congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=480> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension1600344F344.GK-(<i>D1Rat175-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.Karolinska Institutet, Stockholm, Swedencongenic1581641WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).University of Wisconsin School of Medicine, Madison, Wisconsincongenic1581642FHH-<i>Ccr4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantCcr4<i><sup>m1Mcwi</i></sup>15814921581643LAn/Humdlow autotomy newMales and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbred1581644FHH-<i>Htr1a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHer&ratCategory=FHer>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=413>Rat Resource and Research Center</a>mutantSpermHtr1a<i><sup>m1Mcwi</i></sup>15814961581645LL/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain.Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, Franceinbred1579898SS.LEW-(<i>D10Chm128-D10Chm121</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic1579899SS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.Department of Physiology, Medical College of Wisconsin, Milwaukeecongenic1579900SS.SR-(<i>D9Rat89-Resp18</i>)/McoCongenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strainMedical College of Ohio, Toledo, OhiocongenicResp1835551579901SS.LEW-(<i>D10Chm224-D10Chm6</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic1579902SS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.Department of Physiology, Medical College of Wisconsin, Milwaukeecongenic1579903SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic1579904SS.SR-(<i>D9Mgh11-D9Mco33</i>)/McoA congenic strain derived from the progenitor strains SS and SR.Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohiocongenic1579905SS.SR-(<i>D9Rat89-D9Mco27</i>)/McoCongenic strain derived from parental strains SS and SR.Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohiocongenic1579906FHH-<i>Adipoq<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=414>Rat Resource and Research Center</a>mutantSpermAdipoq<i><sup>m3Mcwi</i></sup>15798871579907SS.LEW-(<i>D10Chm128-D10Chm169</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic1579908SS.SR-(<i>D9Mco95-Resp18</i>)/McoA congenic strain derived from the progenitor strains SS and SR.Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohiocongenic1579909FHH-<i>Fgl2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantFgl2<i><sup>m1Mcwi</i></sup>15798851579910FHH-<i>Ccr2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=399>Rat Resource and Research Center</a>mutantSpermCcr2<i><sup>m1Mcwi</i></sup>15798881579911SS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiSS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background.Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukeecongenic1579912FHH-<i>F10<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=412>Rat Resource and Research Center</a>mutantSpermF10<i><sup>m2Mcwi</i></sup>15798861581619BN.PD-(<i>D8Rat39-D8Rat35</i>),SHR-(<i>D2Mit4-D2Rat28</i>),SHR-(<i>D2Rat103-D2Rat107</i>)/CubThis triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-<i>Lx</i>.Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republiccongenic1581620SS.SR-(<i>D9Mco61-D9Mco27</i>)/McoA congenic strain derived from the progenitor strains SS and SR.Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohiocongenic1581621DA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background strainCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Swedencongenic1581622SD-Tg(Ubc-eGFP/ Dazl-shRNA)17-9GarRrrcDazl shRNA (17-9)This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)University of Texas Southwestern Medical Center, Dallas, Texas; <a href=http://www.rrrc.us/Strain/?x=318>Rat Resource and Research Center</a>transgenicEmbryo1581623LA/Humdlow autotomyLow Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbred1581624FHH-<i>Lipe<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantLipe<i><sup>m1Mcwi</i></sup>15814951581625BN-<i>Hand1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga-bin/strain_profile.cgi> PGA </a>mutantHand1<i><sup>m1Mcwi</i></sup>15814931581626FHL/EurMcwiFawn Hooded Low blood pressureThe low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage.<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=FHH&ratCategory=FHH> PGA </a>inbred1581627WF.WKY-(<i>D5Uwm66-D5Uwm67</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).University of Wisconsin School of Medicine, Madison, Wisconsincongenic1581628DA.ACI-(<i>D15Rat6-D15Rat13</i>)/KiniDA.ACI-(<i>D15Rat 6-D15Rat13</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background strainCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Swedencongenic1581629WF.WKY-(<i>D5Wox8-D5Uwm62</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).University of Wisconsin School of Medicine, Madison, Wisconsincongenic1581630WF.WKY-(<i>D5Uwm63-D5Uwm64</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).University of Wisconsin School of Medicine, Madison, Wisconsincongenic1579894SS.LEW-(<i>D10Rat204-D10Rat9</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic1579895FHH-<i>Bdkrb2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantBdkrb2<i><sup>m1Mcwi</i></sup>15798891579896SS.LEW-(<i>D2Rat18-D2Chm277</i>)/AydCongenic strain was created from a SS/Jr parental strainResearch Centre Hospitalier de l'Universite de Montreal, Quebec, Canadacongenic1579897SS.SR-(<i>D9Rat69-D9Mco14</i>)/McoA congenic strain derived from the progenitor strains SS and SR.Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohiocongenic1566437SS-Chr X<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-XBN%2FMcwi&ratCategory=SS-XBN%2FMcwi>PhysGen</a>consomicSperm1566438DA/MolTacDeveloped at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004.<a href=http://www.taconic.com/anmodels/DA.htm>Taconic</a>inbred1566439F344/NTacAxenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH.<a href=http://www.taconic.com/anmodels/F344.htm>Taconic</a>inbred1566440NTac:SDTaconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies.<a href=http://www.taconic.com/anmodels/spragued.htm>Taconic</a>outbred1566443LEW/MolTacLewisScripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived.<a href=http://www.taconic.com/anmodels/Lewis_rat.htm>Taconic</a>inbred1566444MolTac:SDThe SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993.<a href=http://www.taconic.com/anmodels/SDMOL_rat.htm>Taconic</a>outbred1579692FHH-<i>Lcat<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHdx&ratCategory=FHdx>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=402>Rat Resource and Research Center</a>mutantSpermLcat<i><sup>m1Mcwi</i></sup>15787931579693T2DN/McwiGenerated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained.Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsininbred1579694FHH-<i>Egln3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=409>Rat Resource and Research Center</a>mutantSpermEgln3<i><sup>m1Mcwi</i></sup>15787811579695ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic1579696SS.SHR-(<i>D6Wox13-D6Rat84</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.Medical College of Ohio, Toledo, Ohiocongenic1579697SS.SHR-(<i>D13Rat63-D13Mit1</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.Medical College of Ohio, Toledo, Ohiocongenic1579698FHH-<i>Adra1a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHej&ratCategory=FHej>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=408>Rat Resource and Research Center</a>mutantSpermAdra1a<i><sup>m1Mcwi</i></sup>15787921579699WKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdWKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdThis congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain backgroundExperimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CAcongenic1579700ACI.FHH-(<i>D1Rat475-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)/EurDouble congenic strain from backcross of ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eur and ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/Eur.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic1579701BN-<i>Nos1<sup>m1</i>Mcwi</sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantNos1<i><sup>m1Mcwi</i></sup>15787951579702SS.SHR-(<i>D9Wox16-D9Rat64</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.Medical College of Ohio, Toledo, Ohiocongenic1579703SS.SHR-(<i>D2Rat61-D2Mco18</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.Medical College of Ohio, Toledo, Ohiocongenic1579704FHH-<i>Agtr1b<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHdi&ratCategory=FHdi>PhysGen</a>, Rat Resource & Research CentermutantExtinctAgtr1b<i><sup>m1Mcwi</i></sup>15787841579705FHH-<i>Nr0b2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHdz&ratCategory=FHdz>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=403>Rat Resource and Research Center</a>mutantSpermNr0b2<i><sup>m1Mcwi</i></sup>15787981579706FHH-<i>Nr4a1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHdj&ratCategory=FHdj>PhysGen</a>mutantSpermNr4a1<i><sup>m1Mcwi</i></sup>15787911579707FHH-<i>Adipoq<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=DisplayENUStrProfile&rat_strain=FHei&ratCategory=FHei>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=407>Rat Resource and Research Center</a>mutantSpermAdipoq<i><sup>m2Mcwi</i></sup>15787971582195FHH.FHH.1<sup>BN</sup>-(<i>D1Rat173F6B-D1Rat84</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.Medical College of Wisconsin, Milwaukee, Wisconsincongenic1582196FHH.FHH.1<sup>BN</sup>-(<i>D1Rat234-D1Rat265</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.Medical College of Wisconsin, Milwaukee, Wisconsincongenic728188LOU/MNTo N in 1975 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. (045)<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=167>Rat Resource and Research Center</a>inbredExtinct1581631WF.WKY-(<i>D5Uwm61-D5Uwm37</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).University of Wisconsin School of Medicine, Madison, Wisconsincongenic1581632WF.WKY-(<i>D5Uwm65-D5Uwm60</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37).University of Wisconsin School of Medicine, Madison, Wisconsincongenic1581633DA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background strainCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Swedencongenic1581634BN-<i>Adora2a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga-bin/strain_profile.cgi> PhysGen </a>mutantAdora2a<i><sup>m1Mcwi</i></sup>15814761581635WKY/BbbThis WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany.Max - Delbruck - Center for Molecular Medicine, Germanyinbred1581636BN-<i>Cebpe<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga-bin/strain_profile.cgi> PGA </a>mutantCebpe<i><sup>m1Mcwi</i></sup>15814941581637FHH-<i>Has1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/pga2/?module=content&func=ENUStrainProfile>PhysGen</a>mutantHas1<i><sup>m1Mcwi</i></sup>15814771581638DA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background strainCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Swedencongenic1599760SPRD.WKY-(<i>D18Wox8-D18Rat44</i>)/IbmmSPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgiumcongenic1599761BN-<i>Lcat<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantLcat<i><sup>m2Mcwi</i></sup>15995701599762SS-<i>Bdkrb2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantBdkrb2<i><sup>m2Mcwi</i></sup>15995681599763SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/IbmmSPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgiumcongenic1599764COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.University of Toledo College of Medicine, Toledo, Ohiocongenic1599765SS-<i>Klf4<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantKlf4<i><sup>m2Mcwi</i></sup>15995591599766SS-<i>Hps6<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantHps6<i><sup>m1Mcwi</i></sup>15995641554304GAERS/MaveGenetic Absence Epilepsy Rats from Strasbourg30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=557 > National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermNeurobiology1554305DA-Tg(CAG-lacZ)30JmsklacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=531 > National BioResource Project for the Rat in Japan</a>transgenicEmbryoDevelopment1554306GK/SlcGoto Kakizaki RatSpontaneous mutant GK rat which were obtained from Japan SLC, Inc.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=377 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsDiabetes Obesity1554307W-Tg(LAC3)YsThese transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase.YS New Technology Institute, Tochigi, Japantransgenic1302713F344.OLETF-(<i>D8Rat58-D8Mgh17</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=90 > National BioResource Project for the Rat in Japan</a>congenic1554308Gunn-<i>Ugt1a1<sup>j</i></sup>/SlcGunnSegregated inbred Gunn rat which were obtained from Japan SLC, Inc.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=370 > National BioResource Project for the Rat in Japan</a>segregating_inbredLiving AnimalsNeurobiology; Metabolism1302714KZC/TkyKomeda Zucker Creeping ratKomeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=20 > National BioResource Project for the Rat in Japan</a>segregating_inbredEmbryo; SpermNeurobiologyReln35531554309W-Tg(CAG-GFP)184YsThese transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=525 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=259>Rat Resource and Research Center</a>transgenicEmbryo; SpermDevelopment1554310DA-Tg(CAG-lacZ)19JmsklacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=530 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=294>Rat Resource and Research Center</a>transgenicEmbryo; SpermDevelopment1566430SimTac:LETaconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock.<a href=http://www.taconic.com/anmodels/longev.htm>Taconic</a>outbred1566431BN/MolTacThe BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003.<a href=http://www.taconic.com/anmodels/BN.htm>Taconic</a>inbred1566432WKY/NMolTacWistar KyotoThe inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit.<a href=http://www.taconic.com/anmodels/wkyn1.htm>Taconic</a>inbred1566433HanTac:WHIn 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000.<a href=http://www.taconic.com/anmodels/whgalas.htm>Taconic</a>outbred1641876BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadacongenic1641877NP.P-(<i>D4Rat119-D4Rat55</i>)/IusmMale P and female NP rats were backcrossed to get F1 animals which were further backcrossed to NP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectionDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianacongenicAkr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap12092|3197|3729|68368|735049|1307836|1308501|1310949|13114181641878WF.BBDR-(<i>Clcn1-D4Rat228</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1641879SS-Chr 19<sup>SHR</sup>/RkbSS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germanyconsomic1641880SD-<i>Brca1<sup>m1Uwm</i></sup>9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screenedUniversity of Wisconsin-Madison, Madison, Wisconsin, <a href=http://www.rrrc.us/Strain/?x=285>Rat Resource and Research Center</a>mutantEmbryo; SpermBrca1|Brca1<i><sup>m1Uwm</i></sup>2218|7282981642017BBDR/WorBrmThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester.<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>inbred1642018BBDP/WorBrmThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester.<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>inbred1642269SS-<i>Birc3<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ >PhysGen</a>mutantBirc3<i><sup>m2Mcwi</i></sup>16421781642270BN-Lcat<i><sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PGA </a>, <a href=http://www.rrrc.us/Strain/?x=397>Rat Resource & Research Center</a>mutantExtinct; SpermLcat<i><sup>m3Mcwi</i></sup>16421751642271SS-<i>Klf4<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>, <a href=http://www.rrrc.us/Strain/?x=417>Rat Resource and Research Center</a>mutantSpermKlf4<i><sup>m3Mcwi</i></sup>16421791642272SS.LEW-(<i>D10Mco84-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642273SS-<i>Thbd<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>mutantThbd<i><sup>m1Mcwi</i></sup>16421821642274SS-<i>Has1<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ >PhysGen </a>mutantHas1<i><sup>m2Mcwi</i></sup>16421711642275SS.LEW-(<i>D10Rat29-D10Mco88</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642989SS-Tg(CAG-eGFP)1McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.Medical College of Wisconsin, Milwaukee, WisconsintransgenicSperm1643007DA.ACI-(<i>D12Wox12-D12Rat53</i>)/ArbACI/SegHsd and DA/OlaHsd were crossed to get F<sub>2</sub> animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsdThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic1642971SS.LEW-(<i>D10Mco84-D10Mco129</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642972SS.LEW-(<i>D10Mco84-D10Mco143</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1643010F344.OLETF-(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/Tjdouble congenic strain generated by intercrossing F344.OLETF-(<i>D7Rat18-D7Mit2</i>)/Tj and F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj and F<sub>2</sub> rats screened for homozygosityUniversity of Tokushima Graduate School, Kuramato-cho, Tokushima, Japancongenic1642990SD-Tg(CAG-eGFP)63McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1642991SS-Tg(CAG-eGFP)18McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1642992SS-Tg(CAG-eGFP)28McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1642993SD-Tg(CAG-eGFP)97McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1642994SS-Tg(CAG-eGFP)43McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1642995SS-Tg(CAG-eGFP)10McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1642996SS-Tg(CAG-eGFP)2McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1626210BN-<i>Lipe<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantLipe<i><sup>m2Mcwi</i></sup>16421691641849SS.LEW-(<i>D10Mit1-D10Mgh1</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641850SHR.WKY-(<i>D1Got158-D1Got161</i>)/NjsThis is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant regionDepartment of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UKcongenicSpon16199181641851SHR.PD-(<I>D8Rat42-D8Arb23</I>)/CubA differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-<i>Lx</i> strainInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicZbtb167279211641852WF.BBDR-(<i>D4Got48-D4Got43</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenic1641853SS.LEW-(<i>D10Mco38-D10Mgh1</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641854HAS.LAS-(<i>D5Rat70-D5Rat37</i>)F1 generation males were backcrossed to HAS females and the offsprings were genotypedDepartment of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Coloradocongenic1641855BBDP.WF-(<i>D8Rat73-D8Rat20</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadacongenic1641856P.NP-(<i>D4Rat119-D4Rat55</i>)/IusmP and NP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectionDepartment of Medicine, Indiana University School of Medicine, Indianapolis, Indianacongenic1641857BBDP.WF-(<i>D8Rat16-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadacongenic1641858SHR.WKY-(<i>D1Rat420-D1Rat278</i>)/NjsThis is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant regionDepartment of Cardiovascular Sciences, University of Leicester, Glenfield Hospital, UKcongenic1641859SS.MNS-(<i>D10Bra1-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641860SS.MNS-(<i>D10Mco62-D10Mit1</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641861HAS.LAS-(<i>D2Rat38-D2Rat69</i>)F1 generation males were backcrossed to HAS females and the offsprings were genotypedDepartment of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Coloradocongenic1641862F344-<i>Apc<sup>Pirc</i>Uwm</sup>Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screenedUniversity of Wisconsin-Madison, Madison, Wisconsinmutant1642276SS-<i>Kcna5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>, <a href=http://www.rrrc.us/Strain/?x=418>Rat Resource and Research Center</a>mutantSpermKcna5<i><sup>m1Mcwi</i></sup>16421771642277SS-<i>Cpt2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>, <a href=http://www.rrrc.us/Strain/?x=416>Rat Resource and Research Center</a>mutantSpermCpt2<i><sup>m1Mcwi</i></sup>16421741642278SS-<i>Ghsr<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ >PhysGen </a>mutantGhsr<i><sup>m2Mcwi</i></sup>16421801642279SS.LEW-(<i>D10Arb9-D10Rat161</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642281SS-<i>Podxl<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ >PhysGen </a>mutantPodxl<i><sup>m1Mcwi</i></sup>16421761642282SS-<i>Cacna1g<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PGA </a>mutantCacna1g<i><sup>m1Mcwi</i></sup>16421681642283SS.LEW-(<i>D10Rat29-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642284SS-<i>Fgl2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PGA </a>mutantFgl2<i><sup>m2Mcwi</i></sup>16421811642285SS.LEW-(<i>D10Arb9-D10Rat57</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642287SS.LEW-(<i>D10Arb9-D10Mco84</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642288SS.LEW-(<i>D10Mco89-D10Got101</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1579913SS.LEW-(<i>D10Chm224-D10Chm222</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic1579914SS.LEW-(<i>D10Mco30-D10Got92</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic1582184SR/JrHsdDahl Salt-ResistantSubstrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/dahl_saltsensitiveresistant_rapp_inbred_rat/srjrhsd.hl> Harlan</a>inbred1582185SS.SR-(<i>D3Mco36-D3Got166</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomeMedical College of Ohio, Toledo, Ohio, USAcongenic1582186FHH.FHH.1<sup>BN</sup>-(<i>D1Rat183-D1Rat76</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.Medical College of Wisconsin, Milwaukee, Wisconsincongenic1582187SS.SR-(<i>D3Mco24-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomeMedical College of Ohio, Toledo, Ohio, USAcongenic1582188SS.SR-(<i>D3Mco36-D3Mco46</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomeMedical College of Ohio, Toledo, Ohio, USA, <a href=http://www.rrrc.us/Strain/?x=617>Rat Resource and Research Center</a>,congenicSperm1582189SS.SR-(<i>D3Mco39-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomeMedical College of Ohio, Toledo, Ohio, USAcongenic1582190SS/JrHsdDahl Salt-SensitiveSubstrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/dahl_saltsensitiveresistant_rapp_inbred_rat/ssjrhsd.hl> Harlan</a>inbred1582191FHH.FHH.1<sup>BN</sup>-(<i>D1Rat287-D1Rat84</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.Medical College of Wisconsin, Milwaukee, Wisconsincongenic1582192SS.SR-(<i>D3Mco36-D3Got159</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomeMedical College of Ohio, Toledo, Ohio, USAcongenic1582193FHH.FHH.1<sup>BN</sup>-(<i>D1Mgh13-D1Rat89</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.Medical College of Wisconsin, Milwaukee, Wisconsincongenic1582194SS.SR-(<i>D3Mco78-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomeMedical College of Ohio, Toledo, Ohio, USAcongenic1600345F344.GK-(<i>D1Rat83-D1Rat376</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.Karolinska Institutet, Stockholm, Swedencongenic1600346F344.GK-(<i>D1Swe4-D1Rat85</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.Karolinska Institutet, Stockholm, Swedencongenic1600490SS-Chr 1<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-1BN%2FMcwi&ratCategory=SS-1BN%2FMcwi>PhysGen</a>consomicLive Animals; Embryo; Sperm1625284Wild1/HubrThis rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolationHubrecht Laboratory, Utrecht, The Netherlandswild2291840F344-<i>RGD1311344<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, Rat Resource & Research CentermutantExtinctRGD1311344<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup>22918391641831MWF-Chr 6<sup>SHR</sup>/RkbMWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germanyconsomic1642036SHR/OlaIpcv-mt<sup>BN/Crl</sup>Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic backgroundInstitute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republicconplastic1642289SS-<i>Serpina5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PGA </a>mutantSerpina5<i><sup>m1Mcwi</i></sup>16421671642362SS-<i>Has1<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PGA </a>mutantHas1<i><sup>m3Mcwi</i></sup>16423591642363BN-<i>Fgl2<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PGA </a>mutantFgl2<i><sup>m3Mcwi</i></sup>16423551642364SS-<i>Ghsr<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>, <a href=http://www.rrrc.us/Strain/?x=421>Rat Resource and Research Center</a>mutantSpermGhsr<i><sup>m3Mcwi</i></sup>16423571642365SS-<i>Fgl2<sup>m4Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>, <a href=http://www.rrrc.us/Strain/?x=420>Rat Resource and Research Center</a>mutantSpermFgl2<i><sup>m4Mcwi</i></sup>16423541642366SS-<i>Lcat<sup>m4Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>, Rat Resource & Research CentermutantLcat<i><sup>m4Mcwi</i></sup>16423581642367BN-<i>Ccr2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>mutantCcr2<i><sup>m2Mcwi</i></sup>16423561642439SS-<i>Lcat<sup>m5Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/ > PhysGen </a>, <a href=http://www.rrrc.us/Strain/?x=419>Rat Resource and Research Center</a>mutantSpermLcat<i><sup>m5Mcwi</i></sup>16424381642689BN.OLETF-(<i>D1Rat169-D1Rat90</i>)/GotOLETF/Got females were crossed with BN/Crlj to produce F<sub>1</sub> which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotypedOtsuka Pharmacuetical Company, Tokushima, JapancongenicPrlhr710371642690LA/NJcr-<i>cp</i>JCR:LA-corpulent ratOriginated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta.Department of Surgery, University of Alberta, Edmonton, Canadacongenic1642968SS.LEW-(<i>D10Mco84-D10Rat58</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642969SS.LEW-(<i>D10Mco84-D10Mco134</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1642970SS.LEW-(<i>D10Mco113-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1626207BN-<i>Adora2a<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=<a href=http://pga.mcw.edu/pga-bin/strain_profile.cgi>PhysGen </a>mutantAdora2a<i><sup>m3Mcwi</i></sup>16420701626213BN-<i>Oxtr<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantOxtr<i><sup>m1Mcwi</i></sup>16421731626214BN-<i>Slc27a5<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.<a href=http://pga.mcw.edu/?module=content&func=ENUStrainProfile> PGA </a>mutantSlc27a5<i><sup>m2Mcwi</i></sup>16421701641863SHR.PD-(<I>D8Mgh9-D8Rat149</I>)/CubA differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv.Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicZbtb167279211641864WF/CrCrliJ. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute.<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> Italyinbred1641865SD-<i>Brca2<sup>m1Uwm</i></sup>9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screenedUniversity of Wisconsin-Madison, Madison, Wisconsin, <a href=http://www.rrrc.us/Strain/?x=286>Rat Resource and Research Center</a>mutantEmbryo; SpermBrca2|Brca2<i><sup>m1Uwm</i></sup>2219|7283261641866SS.LEW-(<i>D10Mit10-D10Rat24</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641867P/Iusmalcohol-preferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains.Department of Medicine, Indiana University School of Medicine, Indianapolis, IndianainbredSnca37291641868WF.BBDR-(<i>D4Rat93-D4Rat228</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.University of Massachusetts Medical School, Worcerster, MAcongenicTcrb38341641869SS.MNS-(<i>D10Mco31-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641870BBDP.WF-(<i>D8Rat73-D8Rat121</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadacongenic1641871SS.MNS-(<i>D10Mco62-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641872SS.LEW-(<i>D10Mco38-D10Mco41</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic1641873NP/Iusmalcohol-nonpreferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains.Department of Medicine, Indiana University School of Medicine, Indianapolis, IndianainbredSnca37291641874BBDP.WF-(<i>D8Rat73-D8Rat90</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadacongenic1641875SHR-Chr Y<sup>BN</sup>/CubBN-<i>Lx</i>/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generationsCzech Academy of Sciences, Prague, Czech Republicconsomic2289917SS.MNS-(<i>D10Mco70-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledocongenic2290056F344-<i>Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=423>Rat Resource & Research Center</a>mutantSpermElmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup>22900552290057F344-Tg(T2/Bart3)1CebThe Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.<a href=http://pga.mcw.edu> PGA </a>transgenicSperm2290064F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=344>Rat Resource and Research Center</a>mutantSpermTrpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup>22900602290065F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantCA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup>22900592290066F344-<i>Nell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantNell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup>22900612290067F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantBI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup>22900622290273SHRSP.WKY-<i>(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)</i>/IzmTkyoThe desired fragment is transferred from WKY to SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=785> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermDiabetes Obesity; Cardio Hypertension2290274SHRSP.WKY-<i>(D15Rat2-D15Rat94)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=795> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2290275SHRSP.WKY-<i>(D3Tkyo7-D3Rat1)</i>/TkyoThe desired fragment is transferred from WKY to SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=786&StrainsPage=20&StrainsDir=Asc>National Bio Resource Project</a> JapancongenicSpermDiabetes Obesity; Cardio Hypertension2290276SHRSP.WKY-<i>(D3Mgh16-D3Mgh15)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=787> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2290277SHRSP.WKY-<i>(D3Rat227-D3Rat166)</i>/TkyoThe desired fragment is transferred from WKY to SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=783> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2290278SR/JrNgsstrain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=799> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio Hypertension2290279SHRSP.WKY-<i>(D15Rat68-D15Rat106)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=796> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2290280SHRSP.WKY-<i>(D3Mgh16-D3Rat110)</i>/TkyoThe desired fragment is transferred from WKY to SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=780> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2290281SHRSP.WKY-<i>(D3Rat227-D3Rat1)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=794> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2290282SHRSP.WKY-<i>(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)</i>/IzmTkyoThe desired fragment is transferred from WKY to SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=784> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermDiabetes Obesity; Cardio Hypertension2290311SD-Tg(SOD1*G93A)26DwcSD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutationLudwig Institute of Cancer Research, University of California at San Diego, La Jolla, Californiatransgenic2289913SS.MNS-(<i>D10Rat13-D10Rat12</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledocongenic2290100F344-<i>Entpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantEntpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup>22900862290101F344-<i>CB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantCB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup>22900922290102F344-<i>Klhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantKlhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup>22900852290103F344-<i>Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=343>Rat Resource and Research Center</a>mutantSpermNrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup>22900902290104F344-<i>Cadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantCadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup>22900882290105F344-<i>Sptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantSptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup>22900972290106F344-<i>BQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantBQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup>22900702290107F344-<i>Cyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantCyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup>22900952290108F344-<i>LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=338>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermLOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup>22900892290109F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantCA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup>22900872290110F344-<i>Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=362>Rat Resource & Research Center</a>mutantSpermLims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup>22900962290111F344-<i>Cst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantCst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup>22900932290112F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantCA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup>22900942290113F344-<i>Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=387>Rat Resource & Research Center</a>mutantSpermFam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup>22900982290114F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantSlc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup>22900912290171F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantLOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup>22901192290078F344-<i>Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=385>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermMyo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup>22900682290079F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantBI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup>22900692290080F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantBI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup>22900742290081F344-<i>BI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.rrrc.us/Strain/?x=367>Rat Resource & Research Center</a>mutantSpermBI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup>22900722290082F344-<i>Fam5c<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen </a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=425>Rat Resource & Research Center</a>mutantSpermFam5c<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup>22900712290083F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantSlc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup>22900732290186SD-Tg(SOD1*G93A)39SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutationDepartment of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japantransgenic2290187SD-Tg(SOD1*H46R)4SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutationDepartment of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japantransgenic2290135F344-<i>Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=337>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermChsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup>22901232290136F344-<i>Slc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantSlc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup>22901272290137F344-<i>BF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.rrrc.us/Strain/?x=361>Rat Resource & Research Center</a>mutantSpermBF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup>22901262290138F344-<i>Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.rrrc.us/Strain/?x=332>Rat Resource & Research Center</a>mutantExtinctGlis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup>22901282290139F344-<i>AW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantAW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup>22901222290140F344-<i>BI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantBI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup>22901152290141F344-<i>Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=381>Rat Resource & Research Center</a>mutantSpermAbat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup>22901212290142F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantLOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup>22901182290143F344-<i>Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=335>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermNapb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup>22901162290144F344-<i>Lphn3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=334>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermLphn3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup>22901292290145F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantBI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup>22901202290146F344-<i>Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=380>Rat Resource and Research Center</a>mutantSpermPlce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup>22901252290147F344-<i>Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=331>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermSptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup>22901242290148F344-<i>Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.rrrc.us/Strain/?x=333>Rat Resource and Research Center</a>mutantExtinctMap2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup>22901172290159F344-<i>Spetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantSpetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup>22901502290160F344-<i>Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=326>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermRph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup>22901542290161F344-<i>Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.rrrc.us/Strain/?x=328>Rat Resource and Research Center</a>mutantExtinctTmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup>22901562290162F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=379>Rat Resource & Research Center</a>mutantSpermInpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup>22901491642997SS-Tg(CAG-eGFP)23McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.Medical College of Wisconsin, Milwaukee, Wisconsintransgenic1643001FH/UncFawn-hoodedA substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel HillDepartment of Psychiatry, University of North Carolina, Chapel Hill, North Carolinainbred1643002SHR.WKY-(<i>D1Rat420-D1Got161</i>)/NjsFragment of the chromosome 1 derived from WKY and repeated backcross to SHRDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenicSpon16199182290163F344-Tg(T2/Bart3)2CebThe Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.<a href=http://pga.mcw.edu> PGA </a>transgenic2290164F344-<i>Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=325>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermSyne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup>22901532290165F344-<i>Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.rrrc.us/Strain/?x=327>Rat Resource & Research Center</a>mutantSpermNtm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup>22901572290166F344-<i>Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=424>Rat Resource and Research Center</a>mutantSpermPlcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup>22901552290167F344-<i>Dlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>mutantDlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup>22901522290168F344-<i>Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PGA </a>, <a href=http://www.rrrc.us/Strain/?x=330>Rat Resource and Research Center</a>mutantExtinctPde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup>22901512290169F344-Tg(PGK2-SB11)CebSB11 cDNA linked to human PGK2 promoter was used.<a href=http://pga.mcw.edu> PGA </a>transgenic2290170F344-<i>Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=329>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermCd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup>22901582290272SS/JrNgsstrain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=798> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio Hypertension2290298SHR-Tg(Thy1-MAPT)318SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391Axon-Neuroscience GmbH, Vienna, Austriatransgenic2290299SHR-Tg(Thy1-MAPT)72SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391Axon-Neuroscience GmbH, Vienna, Austriatransgenic2290386SD-Tg(Wld<sup>s</sup>)23ColeSD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changesUniversity of Cologne, Cologne, Germanytransgenic2290387SD-Tg(UbC-APPswe)6590SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutationKarolinska Institutet, Stockholm, Swedentransgenic2290391SD-Tg(Wld<sup>s</sup>)79ColeSD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changesUniversity of Cologne, Cologne, Germanytransgenic2290429SS-Tg(ApoC3-CETP)53OpazSS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoterWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, <a href=http://www.rrrc.us/Strain/?x=310>Rat Resource and Research Center</a>, <a href=http://www.rrrc.us/Strain/?x=607>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2292168ISIAHInherited stress-induced arterial hypertensionSelected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stressInstitute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russiainbred2292384SS.LEW-(<i>D10Chm167-D10Chm257</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic2292385SS.LEW-(<i>D10Mco30-D10Got107</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic2292386SS.LEW-(<i>D10Chm155-D10Chm127</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic2292387SS.LEW-(<i>D10Chm224-D10Chm259</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic2292388SS.LEW-(<i>D10Chm246-D10Chm257</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic2292389SS.LEW-(<i>D10Chm10-D10Chm14</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat13-D10Rat11</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic2292390SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic2292451F344-<i>Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen </a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=386>Rat Resource and Research Center</a>mutantSpermStxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup>22924502292452F344-<i>Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen </a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=342>Rat Resource and Research Center</a>mutantSpermSyndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup>22924492292453F344-<i>BE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen </a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=345>Rat Resource & Research Center</a>mutantSpermBE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup>22924482292454F344-<i>RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen </a>mutantRGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup>22924472292459WF.LEW-<i>RVFV</i>Congenic Wistar Furth strain carrying genetic resistant to rift valley fever virus from the resistant Lewis rat strain<a href=http://www.rrrc.us/Strain/?x=208>Rat Resource and Research Center</a>congenicEmbryo; Sperm2292564ACI.COP-(<i>D6Rat80-D6Rat146</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraskacongenic2293354LEW.WKY-(<i>D16Rat88-D16Rat40</i>)/Tjasegment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsdImperial College, London, UKcongenic2293355WKY.LEW-(<i>D16Rat88-D16Rat40</i>)/Tja22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrlImperial College, London, UKcongenic2293729SHR-<i>Gja8</i><sup>m1Cub</sup>This strain is derived from SHR where a mutation is observed in the NH<sub>2</sub>-terminal cytosolic domain of Cx50, L7QDepartment of Biology, Charles University in Prague, Prague, Czech RepublicmutantGja86288902293761LH-Chr 17<sup>BN</sup>/MavChr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedLaboratoire de Physiologie, Lyon Cedex , Franceconsomic2293770SHHF/BbbInitial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breedingMax-Delbruck-Center for Molecular Medicine, Berlin, Germanyinbred2293832LOU.BN-(<i>D6Rat128-D6Rat115</i>)/Inssegment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercrossINSERM, Paris, Francecongenic2298494Kini:DA,PVG-G10Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG.1AV1 females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couplesCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedenadvanced_intercross_line2298498W/GaoxGenerated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine UniversityDepartment of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, Chinainbred2298772WF<sup>fzHsd</sup>Fuzzy ratSparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987)<a href=http://www.rrrc.us/Strain/?x=340>Rat Resource and Research Center</a>mutantEmbryo; Sperm2292565ACI.COP-(<i>D3Mgh16-D3Rat119</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraskacongenic2292566ACI.COP-(<i>D3Rat130-D3Rat114</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraskacongenic2292567ACI.COP-(<i>D10Mgh20-D10Rat4</i>)/ShulFemale COP/Crl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraskacongenic2292647SS.LEW-(<I>D1Mco36-D1Rat106</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2292648SS.LEW-(<I>D1Mco36-D1Mco77</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2292649SS.LEW-(<I>D1Mco36-D1Rat131</I>)/1McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2292650SS.LEW-(<I>D1Mco36-D1Rat131</I>)/2McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2292651SS.LEW-(<I>D1Mco99-D1Rat49</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2292652SS.LEW-(<I>D1Mco85-D1Rat49</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2292653SS.LEW-(<i>D1Mco36-D1Mco101</i>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2293012ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5<i>)/Sunn2 BBDP regions were introgressed into the ACI/SegHsd backgroundSunnybrook Research Institute, Toronto, Ontario, Canadacongenic2293120LOU.BN-(<i>D10Mgh1-D10Mgh14</i>)/Inssegment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOUCardiovascular Physiopathology, INSERM, Montpellier, FrancecongenicAce24932293143SS.BN-(<i>D13Rat20-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, WisconsincongenicRen35542292526SS-Tg(R-alpha1NK)48OpazSS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5<a href=http://www.rrrc.us/Strain/?x=281>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2292527SS-Tg(RA1V9)64OpazDahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal.<a href=http://www.rrrc.us/Strain/?x=308>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2292528F344-Tg(APPswe)OpazF344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter<a href=http://www.rrrc.us/Strain/?x=283>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2292529LEW-Tg(Gt(ROSA)26Sor-luc)11JmskLEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site<a href=http://www.rrrc.us/Strain/?x=299>Rat Resource and Research Center</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=649> National BioResource Project for the Rat in Japan</a>transgenicSpermDevelopment2292530SD-Tg(Pou5f1-Dsred)This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells.<a href=http://www.rrrc.us/Strain/?x=320>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2292531SD-Tg(Pou5f1-EGFP)This transgenic strain carries a random insertion of a construct containing mouse<a href=http://www.rrrc.us/Strain/?x=319>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2292532F344-Tg(betaCTF-l45F)F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein<a href=http://www.rrrc.us/Strain/?x=277>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2293144SS.BN-(<i>D13Rat91-D13Rat179</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2293145SS.BN-(<i>D13Rat123-D13Rat101</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, WisconsincongenicRen35542293146SS.BN-(<i>D13Rat20-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2289819SS.MNS-(<i>D10Mco62-D10Got99</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289820SS.MNS-(<i>D10Mco30-D10Got91</i>)/1McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289821SS.MNS-(<i>D10Mco30-D10Got91</i>)/3McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289822SS.MNS-(<i>D10Mco30-D10Got112</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289823SS.MNS-(<i>D10Mco62-D10Mco30</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289824SS.MNS-(<i>D10Mco30-D10Got101</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289825SS.MNS-(<i>D10Rat24-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289826SS.MNS-(<i>D10Mco30-D10Got91</i>)/2McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289827SS.MNS-(<i>D10Mco30-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohio, USAcongenic2289916SS.MNS-(<i>D10Mco15-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledocongenic2301367SHRSP.WKY-(<I>D2Mit5-D2Rat133</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenic2301368SHRSP.WKY-(<I>D2Wox15-D2Rat133</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenic2301369SHRSP.WKY-(<I>D2Rat132-D2Rat53</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenic2301370SHRSP.WKY-(<I>D2Wox9-D2Rat231</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenic2301371SHRSP.WKY-(<I>D2Mit21-D2Rat157</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicGstm1|Vcam1|S1pr12755|3952|619582301700F344-<i>Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=373>Rat Resource and Research Center</a>mutantSpermSpata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup>23016972301701F344-<i>Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>,<a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=370>Rat Resource and Research Center</a>mutantSpermPtpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup>23016982301702F344-<i>Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=371>Rat Resource and Research Center</a>mutantSpermSf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup>23016962301989BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsincongenic2302132SHRSP-Tg(Tagln-ACE2)6918BdrTrangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryosMax-Delbruck-Center for Molecular Medicine, Berlin-Buch, GermanytransgenicTagln|ACE23723|13471742302651F344-<i>Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=431>Rat Resource & Research Center</a>mutantSpermKlra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup>23026382302652F344-<i>Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=436>Rat Resource and Research Center</a>mutantSpermPde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup>23026442302653F344-<i>Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=377>Rat Resource and Research Center</a>mutantSpermMov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup>23026472302654F344-<i>Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=390>Rat Resource & Research Center</a>mutantSpermCsmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup>23026372302655F344-<i>Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=376>Rat Resource and Research Center</a>mutantSpermTmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup>23026462302656F344-<i>Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantCasp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup>23026422302657F344-<i>Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=375>Rat Resource and Research Center</a>mutantSpermOrc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup>23026482302658F344-<i>Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=428>Rat Resource & Research Center</a>mutantSpermBbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup>23026402301079F344-<i>Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=360>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermLrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup>23010782301080F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=359>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermLrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup>23010762301081F344-<i>Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=358>Rat Resource and Research Center</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantSpermMmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup>23010772301937BN.GH-(<i>D18Rat41-D18Mgh4</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationsHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsincongenic2301938BN.GH-(<i>D6Mit12-D6Rat15</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationsHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsincongenic2301939BN.GH-(<i>D2Rat22-D2Mgh11</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationsHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsincongenic2302080Rhd:F344,GK-G21GK/Swe and F344/Swe were bred to create F<sub>1</sub> generation, couples of F<sub>1</sub> with GK/Swe and F344/Swe females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding random couples which were intercrossed to get further generationsSection for Medical Inflammation Research, Biomedical Center, Lund University, Swedenadvanced_intercross_line2302081DA.E3-(<i>D11Got79-D11Wox5</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markersSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenic2302082DA.E3-(<i>D11Got79-D11Rat50</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markersSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenic2302141F344-Tg(Cyp1a1-Ren2)10JmulGenerated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expressionUniversity of Edinburgh Medical School, Edinburgh, UKtransgenicCyp1a1|Ren22458|16223752302659F344-<i>Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=374>Rat Resource and Research Center</a>mutantSpermSnx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup>23026362302660F344-<i>Pvrl1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=378>Rat Resource and Research Center</a>mutantSpermPvrl1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup>23026392302661F344-<i>Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=389>Rat Resource & Research Center</a>mutantSpermGramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup>23026352302662F344-<i>Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=372>Rat Resource and Research Center</a>mutantSpermSlc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup>23026432303006SS.BN-(<i>D13Rat101-D13Rat46</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303007SS.BN-(<i>D13Rat127-D13Rat46</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2299123F344-<i>AW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantAW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup>22991082299124F344-<i>Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=350>Rat Resource and Research Center</a>mutantSpermUbqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup>22991092299125F344-<i>Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=356>Rat Resource & Research Center</a>mutantSpermCcdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup>22991132299126F344-<i>Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=348>Rat Resource & Research Center</a>mutantSpermKcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup>22991002299127F344-<i>Fam176a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantFam176a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup>22990942299128F344-<i>Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=432>Rat Resource & Research Center</a>mutantSpermLama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup>22991032299129F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantLrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup>22991072299130F344-<i>Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=426>Rat Resource & Research Center</a>mutantSpermAda<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup>22990932299131F344-<i>Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=388>Rat Resource & Research Center</a>mutantSpermGrk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup>22991152299132F344-<i>Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantCadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup>22991162299133F344-<i>Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=357>Rat Resource and Research Center</a>mutantSpermRap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup>22990982299134F344-<i>Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=347>Rat Resource and Research Center</a>mutantSpermPpapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup>22991052299135F344-<i>Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=354>Rat Resource and Research Center</a>mutantSpermMgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup>22991062299136F344-<i>Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantSnph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup>22991172299137F344-<i>Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=383>Rat Resource & Research Center</a>mutantSpermErbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup>22991102299138F344-<i>Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=449>Rat Resource and Research Center</a>mutantSpermNrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup>22991182299139F344-<i>Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantDnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup>22991142299140F344-<i>Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=384>Rat Resource & Research Center</a>mutantSpermDcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup>22989382299141F344-<i>Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</amutantPpp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup>22991042299142F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantInpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup>22990952299143F344-<i>Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=346>Rat Resource & Research Center</a>mutantSpermKif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup>22991112299144F344-<i>Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=368>Rat Resource and Research Center</a>mutantSpermTrdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup>22990992299145F344-<i>Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantRprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup>22990962299146F344-<i>Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantPtpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup>22990972299147F344-<i>Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=349>Rat Resource and Research Center</a>mutantSpermPrr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup>22991122299148F344-<i>Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=355>Rat Resource & Research Center</a>mutantSpermImmp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup>22991022300215SHR.BN-(<i>D10Mgh3-D10Rat85</i>)/IpcvCongenic substrain derived from SHR.BN-(<i>D10Mgh3-Srebf1</i>)/IpcvInstitute of Physiology, Czech Academy of Sciences, Prague, Czech Republiccongenic2300216SHR-Tg(PEPCK-SREBF1)1IpcvSHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signalInstitute of Physiology, Czech Academy of Sciences, Prague, Czech RepublictransgenicSREBF1694732300217SHR.BN-(<i>D10Mgh3-Srebf1</i>)/Ipcv53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv backgroundInstitute of Physiology, Czech Academy of Sciences, Prague, Czech Republiccongenic2301330KHDevelped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, OklahomaInternational Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, Oklahomainbred2302108SHRSP.WKY-(<I>D1Mgh5-D1Wox29</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=446> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2302109SHRSP.WKY-(<I>D1Mgh5-D1Rat44</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=444> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2302110SHRSP.WKY-(<I>Apbb1-D1Arb21</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=488> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2302148SHR-Tg(Ef1a-Cd36)10IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectorCzech Academy of Sciences, Prague, Czech RepublictransgenicCd3623012302149SHR-Tg(Ef1a-Cd36)19IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectorCzech Academy of Sciences, Prague, Czech RepublictransgenicCd3623012302150SHR-Tg(Ef1a-Cd36)93IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectorCzech Academy of Sciences, Prague, Czech RepublictransgenicCd3623012302151SHR-Tg(Ef1a-Cd36)106IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectorCzech Academy of Sciences, Prague, Czech RepublictransgenicCd3623012300018SHRSP.ZUC-(<i>D5Rat4-D5Rat36</i>)/IzmDmcrSelective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/IzmMukogawa Women's University, Nishinomiya, Hyogo Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=735> National BioResource Project for the Rat in Japan</a>congenicLive AnimalsDiabetes Obesity; Cardio Hypertension2302067F344/DuCrlSweSubstrain of Fischer rats maintained at Malmo, SwedenSection for Medical Inflammation Research, Biomedical Center, Lund University, Swedeninbred2302279F344.SDT-(<i>D3Wox9-D3Arb20</i>)/KbeFemale F344/NSlc were crossed with male SDT/CrljJcl, then female F<sub>1</sub> were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markersKobe University School of Medicine, Chuo-ku, Kobe, Japancongenic2302387DA.ACI-(<i>D2Mit12-D2Mgh29</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=622>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies2302666Scr:sPSardinian alcohol-preferring ratssP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding.The Scripps Research Institute, LaJolla, Californiaoutbred2302984SS.BN-(<i>D13Rat151-D13Rat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2302985SS.BN-(<i>D13Rat111-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2302987SS.BN-(<i>D13Rat7-D13Rat60</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2302989SS.BN-(<i>D13Rat57-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303009SS.BN-(<i>D13Rat183-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303010SS.BN-(<i>D13Got51-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303011SS.BN-(<i>D13Got51-D13Rat57</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303099F344-<i>Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=430>Rat Resource & Research Center</a>mutantSpermKcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup>23030952303100F344-<i>Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=438>Rat Resource and Research Center</a>mutantSpermSlc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup>23030972303101F344-<i>Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=471>Rat Resource & Research Center</a>mutantSpermKcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup>23030942303102F344-<i>Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=429>Rat Resource & Research Center</a>mutantSpermDnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup>23030982303103F344-<i>Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=455>Rat Resource and Research Center</a>mutantSpermPebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup>23030962300195EHC.BN-(<i>D14Rat43-D14Rat132</i>)/KyuEHC/Seac and BN/Seac were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenicsKyushu University, Fukuoka, Japancongenic2302106SHRSP.WKY-(<I>D1Rat44-D1Arb21</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=485> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2302994SS.BN-(<i>D13Rat127-D13Rat61</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2302996SS.BN-(<i>D13Rat7-D13Rat88</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2302997SS.BN-(<i>D13Rat91-D13Got45</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2302999SS.BN-(<i>D13Rat178-D13Got45</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303001SS.BN-(<i>D13Rat111-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303002SS.BN-(<i>D13Rat123-D13Rat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303003SS.BN-(<i>D13Rat7-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303004SS.BN-(<i>D13Rat115-D13Rat61</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303005SS.BN-(<i>D13Rat127-D13Rat77</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303008SS.BN-(<i>D13Rat61-D13GRat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic2303116SPRD.WKY-(<i>D10Rat91-D10Rat135</i>)/IbmmSPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgiumcongenic2313209WF.ART2/Wordeveloped at the Universtiy of Massachusetts, Medical SchoolUniverstiy of Massachusetts, Worcester, MAcongenic2313231LEWBNF1/CrlThis hybrid rat is a cross between a LEW female and a BN male rat.<a href=http://www.criver.com/>Charles River Laboratories </a>hybrid2301246SS.LEW-(<i>D3Rat61-D3Wox1</i>)/AydA segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Research Centre-CHUM, Montreal, Quebec, Canadacongenic2301247SS.LEW-(<i>D16Got3-D16Rat112</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Mit2-D16Chm23</i>)/AydResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301248SS.LEW-(<i>D3Got33-D3Chm68</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301249SS.LEW-(<i>D18Rat30-D18Chm29</i>)/AydA segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.Research Centre-CHUM, Montreal, Quebec, Canadacongenic2301315LE/OrlLong-Evans/CryptorchidObtained from Centre Nationale de la Researche Scientifique, Orleans, France; then bred at A.I. duPont Hospital for Children Life Science Center, Wilmington, DelawareCentre Nationale de la Researche Scientifique, Orleans, Franceinbred2301381SS.LEW-(<I>D18Chm41-D18Rat92</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301382SS.LEW-(<I>D18Chm91-D18Rat67</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301383SS.LEW-(<I>D18Chm31-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301384SS.LEW-(<I>D18Chm41-D18Rat45</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301385SS.LEW-(<I>D18Rat29-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301386SS.LEW-(<I>D18Rat61-D18Rat45</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301387SS.LEW-(<I>D18Rat67-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301388SS.LEW-(<I>D18Chm56-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2301986BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsincongenic2301987BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)/Mcwidesired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsincongenic2301988BN.GH-(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsincongenic2302649F344-<i>Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=435>Rat Resource and Research Center</a>mutantSpermNsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup>23026452302650F344-<i>Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=470>Rat Resource & Research Center</a>mutantSpermEnox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup>23026412303761SD-Tg(CAG-EGFP)4OsbGreen ratThis transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=559> National BioResource Project for the Rat in Japan</a>transgenicLiving Animals2304041SD-Tg(CAG-Rgn)SlcTransgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and Rgn gene<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=389> National BioResource Project for the Rat in Japan</a>transgenicLiving AnimalsOsteosisRgn35602304063KDP-Tg(H2Kd-Cblb)2NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=451> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304064KDP-Tg(H2Kd-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=450> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304065KDP-Tg(INS-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=452> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304066KDP-Tg(CAG-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=453> National BioResource Project for the Rat in Japan</a>transgenicCblb6205352304093SHRSP.WKY-(<i>D1Rat106-D1Arb21</i>)/IzmDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=484 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304094SHRSP.WKY-(<i>D1Smu12-D1Rat44</i>)/IzmThis is a congenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=447 > National BioResource Project for the Rat in Japan</a>congenicCardio Hypertension2304095W-Tg(Plcb2-WGA,-EGFP)F1AbekThis is a transgenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=455 > National BioResource Project for the Rat in Japan</a>transgenicEmbryo2304096SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/1IzmDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=486 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304097SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/2IzmThis is a congenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=448> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304098SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/IzmDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=487 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304099SHRSP.WKY-(<i>D1Smu12-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=482 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304100SHRSP.WKY-(<i>D1Rat39-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=481 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304101SHRSP.WKY-(<i>D1Rat43-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=483 > National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304102SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmThis is a congenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=445> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2304241F344-Tg(CXCR4)1HikTransgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=560> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermInfectiousCXCR47321762303739RDW/UmeSlcFrom Tohoku University to Slc (1999)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=386 > National BioResource Project for the Rat in Japan</a>mutantLiving AnimalsMetabolism2304200W-Tg(CAG-ABO*A)32JmskThis transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=535 > National BioResource Project for the Rat in Japan</a>transgenicEmbryoHematologyGbgt16286092304201F344-<i>Galntl6<sup>Tn(sb-T2/Bart3)2.311McwiRrrc</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=450>Rat Resource & Research Center</a>mutantSpermGalntl6<sup>Tn(sb-T2/Bart3)2.311Mcwi</sup>23041942304202F344-<i>RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=437>Rat Resource and Research Center</a>mutantSpermRGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup>23041932304203W-Tg(CAG-DsRed2/GFP)1JmskDsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=532> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDevelopment2304204W-Tg(CAG-ABO*B)13JmskThis transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=527> National BioResource Project for the Rat in Japan</a>transgenicEmbryoHematologyGbgt16286092304205W-Tg(Alb-DsRed2)34JmskThis transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=528> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermDevelopment2304206W-Tg(CAG-DsRed2/GFP)15JmskDsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=533> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=300>Rat Resource and Research Center</a>transgenicEmbryo; SpermDevelopment2304207F344-<i>Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=434>Rat Resource and Research Center</a>mutantSpermLzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup>23041962304208F344-<i>Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=479>Rat Resource and Research Center</a>mutantSpermRapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup>23041972304209F344-<i>Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantRorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup>23041992304210W-Tg(Alb-DsRed2)42JmskThis transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=529> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=260>Rat Resource and Research Center</a>transgenicEmbryo; SpermDevelopment2304211W-Tg(CAG-cre)81JmskThis strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=534> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=301>Rat Resource and Research Center</a>transgenicEmbryoDevelopment2304212F344-<i>RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=453>Rat Resource and Research Center</a>mutantSpermRGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup>23041982304213F344-<i>Leprel2<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=433>Rat Resource & Research Center</a>mutantSpermLeprel2<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup>23041952304214W-Tg(CAG-ABO*B)2JmskThis transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=526 > National BioResource Project for the Rat in Japan</a>transgenicEmbryoHematologyGbgt16286092304215F344-Tg(XPO1)1HikF344/DuCrj Tg rat inoculated with human crm1 genome (BAC)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=575> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermCancer; Infectious2303640WAG/RijCmcrSubstrain of WAG/Rij, separated from the Rijswijk colony in about 1975, now maintained at Medical College of WisconsinCenter for Medical Countermeasures Against Radiological Terrorism, Medical College of Wisconsininbred2303785SHRSP-Chr 3<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=605> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2304074WKY.BUF-<i>Tsr1d</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=465> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2304075ACI.BUF-<i>Pur1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=467> National BioResource Project for the Rat in Japan</a>congenicEmbryoUrology2304076WKY.BUF-<i>Ten1 Ten2</i>/MnaThis double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) and Ten2 (on chr. 13) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=464> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2304077WKY.BUF-<i>Pur1s</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=462> National BioResource Project for the Rat in Japan</a>congenicEmbryoUrology2304078ACI.BUF-<i>Ten1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=468> National BioResource Project for the Rat in Japan</a>congenicEmbryo2304079WKY.BUF-<i>Ten1</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=471> National BioResource Project for the Rat in Japan</a>congenicEmbryo2304080ACI.BUF-<i>Aftm1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=469> National BioResource Project for the Rat in Japan</a>congenicEmbryo; Sperm2304081WKY.BUF-<i>Pur1w</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=463> National BioResource Project for the Rat in Japan</a>congenicEmbryoUrology2304082WKY.BUF-<i>Ten2</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=466> National BioResource Project for the Rat in Japan</a>congenicEmbryoUrology2304083ACI.BUF-<i>Ten2</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=470> National BioResource Project for the Rat in Japan</a>congenicEmbryo2304221WTC-<i>swh</i>/KyoThe rat showed abnormal hair texture and mammary gland hypoplasia was occurred in the WTC.ZI-<i>Atrn<sup>zi</sup></i> colony at the National Cancer Center Research Institute in 1998. After elimination of <i>zi</i> allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=539> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Embryo; SpermDermatology2304222WIAR/IarWistar-ImamichiStrain developed by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=536> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermMetabolism; Development2303779OLETF-Chr 14<sup>F344</sup>/TjChromosome 14 from F344 is introgressed in OLETF background<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=500 > National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity2303971OLETF.F344-(<i>D7Mgh16-D7Mgh20</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=82> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303972BN-Chr 13<sup>SS</sup>/McwiA cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed<a href=http://pga.mcw.edu/pga2-bin/strain_profile.cgi>PhysGen</a>consomic2303973OLETF.F344-(<i>D10Wox7-D10Wox6</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=78> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303976F344-<i>Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen </a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=472>Rat Resource & Research Center</a>mutantSpermCyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup>23039742303977F344-<i>Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen </a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=477>Rat Resource & Research Center</a>mutantSpermAno3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup>23039752304016BUF.ACI-(<i>D4Rat192-D4Rat66</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=165> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2304017F344.CVD-<i>Unc5c<sup>cvd</sup></i>/KyoSpontanious mutation from LEW inbred at Osaka Prefecture University in 1992. A congenic strain was produced by backcrosses to F344/NSlc strain at Kyoto University.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=153> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermNeurobiology2304018BUF.ACI-(<i>D4Rat226-D4Rat109</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=166> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2304019BUF.ACI-(<i>D15Rat68-D15Rat29</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=168> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2304020ACI.BUF-(<i>D15Rat97-D15Rat29</i>)/NccThis congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=169> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2304045F344.ZUC-<i>Lepr<sup>fa</sup></i>(<i>D14Rat23-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=392> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304046F344.ZUC-<i>Lepr<sup>fa</sup></i>(<i>D7Rat16-D7Mgh20</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=391> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304047F344.ZUC-<i>Lepr<sup>fa</sup></i>/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=390> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermDiabetes ObesityLepr30012304050F344.OLETF-(<i>D14Rat23-D14Rat55</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=396 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303148SS.SHR-(<i>D9Wox16-D9Rat76</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic2303149SS.SHR-(<i>D9Wox16-D9Mco73</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region.Medical College of Ohio, Toledo, Ohiocongenic2303150SS.SHR-(<i>D9Mco74-D9Rat64</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic2303151SS.SHR-(<i>D9Wox16-D9Mco77</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic2303152SS.SHR-(<i>D9Mco72-D9Mco93</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic2303153SS.SHR-(<i>D9Rat7-D9Mco93</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic2303154SS.SHR-(<i>D9Wox16-D9Mco85</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic2304051F344.OLETF-(<i>D14Rat8-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=399 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304052F344.OLETF-(<i>D14Rat55-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=400 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304053F344.OLETF-(<i>D14Rat23-D14Rat5</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=394 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304054F344.OLETF-(<i>D14Rat23-D14Rat10</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=397 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304055F344.OLETF-(<i>D14Wox1-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=404> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304056F344.OLETF-(<i>D14Rat23-D14Wox14</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=395 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304057F344.OLETF-(<i>D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=398 > National BioResource Project for the Rat in Japan</acongenicEmbryoDiabetes Obesity2303117SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)(<i>D18Rat102-D18Rat44</i>)/IbmmDouble congenic strain generated by intercrossing SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/Ibmm and SPRD.WKY-(<i>D18Rat102-D18Rat44</i>)/Ibmm; F<sub>1</sub> animals were intercrossed and F<sub>2</sub> screened for heterozygousity by markersUniversite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgiumcongenic2303504LEW/JmsNgscongenital hydrocephalus ratLewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</ainbredLive Animals; Embryo; SpermNeurobiology; Ophthalmology2303978F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=83> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304058F344.OLETF-(<i>D14Rat143-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=402> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304059F344.OLETF-(<i>D14Rat5-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=403> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304060F344.OLETF-(<i>D14Wox14-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=401> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304061F344.OLETF-(<i>D14Rat23</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=393 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304104W-Tg(Plcb2-WGA,-EGFP)M1AbekThis is a transgenic strain developed by the depositor.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=456> National BioResource Project for the Rat in Japan</a>transgenicEmbryo2304120SHRSP/2TaKyo > Ta (1972)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=417> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio Hypertension2304121DA.WF-(<i>D1Mit1-D1Mit3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WF<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=522> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2304122DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WF<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=523> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2304123DA.WF-(<i>D4Mit11-Nos3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WF<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=524> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2304124DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)(<i>D1Mit1-D1Mit3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WF<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=520> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2304125DRH.F344-(<i>D1Mgh8-D1Mgh12</i>)/Shigmdesired fragment from F344 was introgressed into DRH background<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=492> National BioResource Project for the Rat in Japan</a>, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, JapancongenicEmbryo; SpermDiabetes Obesity; Cancer2303610SD/HsdCwrderived from SD/Hsd by cousin-cousin mating for more than 20 generationsCase Western Reserve University School of Medicine, Cleveland, Ohioinbred2303611BN/HsdMcwiCwrderived from BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister matingCase Western Reserve University School of Medicine, Cleveland, Ohioinbred2303979F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=84> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303986WKAH.LEC-<i>Atp7b<sup>hts</sup></i>/TjA congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=106> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2303987F344.OLETF-(<i>D17Mgh4-Edn1</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=104> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303988F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D8Rat54-D8Mgh17</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=88> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303989F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=96> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303990F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=92> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303991F344.OLETF-(<i>D7Rat31-D7Rat35</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=103 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303992F344.OLETF-(<i>D5Mgh29-D5Mgh22</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=102 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303993OLETF.F344-(<i>D9Mgh8-D9Mit2</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=97 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303994F344.OLETF-(<i>D5Mgh4-D5Rat21</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=95> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303995F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=90> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303996F344.Cg-<i>Foxn1<sup>rnu</sup></i>/KyoThis congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=541> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Embryo; SpermImmunology; CancerFoxn139702303792WTC.ZI-<i>Atrn<sup>zi</sup></i>/KyoZitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=22> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Embryo; SpermNeurobiology2303793WTC.DMY-<i>dmy</i>/KyoCongenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=19> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Embryo; SpermNeurobiology2303997F344.OLETF-(<i>D7Mgh8-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=86> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2303998WKAH.LEC-<i>Ptprk<sup>thid</sup></i>/TjA congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=107> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2303999F344.OLETF-(<i>D14Rat8-D14Rat26</i>)(<i>D14Rat18-D14Rat22</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=100> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304000F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=98 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304001F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=89> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304002F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=91> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304003F344.OLETF-(<i>D16Rat19-D16Rat13</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=101 > National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304004F344.OLETF-(<i>D7Mit2-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=85> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304037DDI/Ddiadokkyo diabetes insipidus ratStrain developed at Dokkyo University, School of Medicine, Tochigi, Japan<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=282> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermMetabolism; Urology2304038OP/JttOpacitasMaintained in sib mating between opacitas rats (heterozygoutes) and normal rats.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=181> National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermOphthalmology2304039WIC-Tg<i><sup>rdw</i>Kts</sup>Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=193> National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermMetabolism2304040F344.OP-<i>Op</i>/JttOpacitas rats (heterozygtes) are backcorssed with F344/DuCrj.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=182> National BioResource Project for the Rat in Japan</a>congenicSpermOphthalmology2307077HXB4/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307078HXB27/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307079HXB3/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307080HXB20/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307081HXB31/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307082HXB18/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307083HXB10/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307084HXB24/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307085HXB17/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307086HXB7/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307087SHR.BN-(<i>D18Rat32-D18Rat12</i>)/IpcvA segment of chr 18 from BN was introgressed into the SHR backgroundCzech Academy of Sciences, Prague, Czech Republiccongenic2307088HXB22/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307089HXB29/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307090SHR.BN10/IpcvA segment of chr 10 from BN was introgressed into the SHR backgroundCzech Academy of Sciences, Prague, Czech Republiccongenic2307091HXB13/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307092HXB14/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307093HXB23/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307094HXB1/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307095HXB15/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307096HXB2/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307097HXB21/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307098HXB25/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2307099HXB5/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/CubCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbred2313588SD-Tg(Ins2-IAPP)SoelCrl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoterPfizer, Inc, Groton, Connecticuttransgenic2308816Crl:WI(Han)Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL. Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbred2306717BBDP/WorSunnThese originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada.Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadainbred2306823SS.SR-(<i>D3Arb14-D3Mco36</i>)(<i>D7Mco19-D7Mco7</i>)/McoSS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco were crossed with SS.SR-(<i>D7Mco19-D7Mco7</i>)/Jr and then F<sub>1</sub> rats were backcrossed with SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bredMedical College of Ohio, Toledo, Ohio, USAcongenic2307156DA/ZtmKiniSubstrain of DA, to Hannover after 1965, now at Stockholm, Sweden.Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Swedeninbred2307157PVG.1AV1/KiniOriginally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden.Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Swedencongenic2314009NMcwi:HSHeterogeneous stock25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generation; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. We use a rotational delay of 1, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc.Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsinoutbred2312504Crlj:WIWistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981)<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2313922F344.LEW-(<i>D10Rat142-D10Rat15</i>)/JmulF344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females and then fixed by brother-sister mating to generate this congenic strain, confirmed by microsatellite markersMolecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UKcongenic2313923LEW.F344-(<i>D10Rat99-D10Rat11</i>)/JmulF344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females and then fixed by brother-sister mating to generate this congenic strain, confirmed by microsatellite markersMolecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UKcongenic2313924LEW-Chr Y<sup>F344</sup>/JmulF344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markersMolecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UKconsomic2308851Crl:OP(CD)Obese Prone RatsDeveloped from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD).<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbred2308852Crl:LELong-Evans RatsOriginated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2308853Crl:OR(CD)Obese Resistant RatsDeveloped from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbred2314375LE.AR-<i>Ednrb<sup>Sl</i></sup>/OkkmAR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=823> National BioResource Project for the Rat in Japan</a>congenicEmbryoInternal OrganEdnrb25362314376KFRS4/KyoA male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=919> National BioResource Project for the Rat in Japan</a>mutantLive AnimalsOphthalmology; Dermatology2314377KFRS3B/KyoA male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=918> National BioResource Project for the Rat in Japan</a>mutantSpermOphthalmology; Dermatology2314378AR-<i>Ednrb<sup>Sl</i>Okkm</sup>Aganglionosis ratCongenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=822> National BioResource Project for the Rat in Japan</a>mutantEmbryoInternal OrganEdnrb25362314379KFRS6/KyoA male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=921> National BioResource Project for the Rat in Japan</a>mutantLive AnimalsDermatology2314380SD-Tg(CAG-lacZ)541HtsuDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=903> National BioResource Project for the Rat in Japan</a>transgenicSperm2314381KFRS5A/KyoA male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=920> National BioResource Project for the Rat in Japan</a>mutantSpermDermatology2314382SD-Tg(CAG-HRAS*G12V)250HtsuThis transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=790> National BioResource Project for the Rat in Japan</a>transgenicSpermCancerHRAS7308812314383KFRS3A/KyoA male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=917> National BioResource Project for the Rat in Japan</a>mutantSpermOphthalmology; Dermatology2305987F344.OLETF-(<i>D7Mgh16-D7Wox46</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=844> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305988(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=841> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305989(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Z-Lepr<sup><i>fa</i></sup>/Tj</i>)F1Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=842> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305990F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=836> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305991(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/Tj X F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=839> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305992F344.OLETF-(<i>D7Mit16-D7Mgh20</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=820> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305993F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=834> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305994F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/1TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=835> National BioResource Project for the Rat in Japan</a>congenicDiabetes Obesity2305995F344.OLETF-(<i>D7Got130-D7Mgh20</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=837> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305996F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=843> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305997(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/2Tj x F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=840> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305998F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D8Rat54-D8Mgh17</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=809> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305999F344.OLETF-(<i>D7Mgh16-D7Rat70</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=830> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306000F344.OLETF-(<i>D7Rat70-D7Mgh20</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=831> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306001F344.OLETF-(<i>D7Rat176-D7Mgh20</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=832> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306041F344-<i>Scn1a<sup>m2Kyo</sup></i>Established by ENU mutagenesis. A point mutation in Scn1a gene.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=715> National BioResource Project for the Rat in Japan</a>mutantSpermNeurobiologyScn1a693642306042F344-<i>Scn1a<sup>m1Kyo</sup></i>Established by ENU mutagenesis. A point mutation in Scn1a gene.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=716> National BioResource Project for the Rat in Japan</a>mutantLive Animals; SpermNeurobiologyScn1a693642306043SHR/4DmcrDeveloped by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=566> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd3623012306044SHRSP/3DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, A4 line<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=567> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd3623012306045SHR/2DmcrDeveloped by the DEPOSITOR, one of the SHR substrains from B2 line<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=564> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd3623012306046W-Tg(CAG-EGFP)3YsThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=741> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Embryo2306047W-Tg(Gnrh1-EGFP)NphyThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=704> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Embryo; SpermGnrh127202306048SHR/3DmcrDeveloped by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=565> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd3623012306049SHRSP/4DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=736> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd3623012306050SHRSP/5DmcrDeveloped by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=737> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd3623012306051SHRSP/2DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=563> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd3623012306002F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/1TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=833> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306003F344.OLETF-(<i>D7Wox46-D7Mgh20</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=845> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306004F344.OLETF-(<i>D7Mgh16-D7Mit16</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=821> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2312498WAG/RijCrlWAG RatsA.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993.<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2312499Crl:NIH-<i>Foxn1</i><sup>rnu</sup>Nude RatsThe NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2312644DA.WOKW-(<i>D3Mit10-D3Rat189</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K backgroundDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic2312645DA.WOKW-(<i>D16Rat88-D16Wox7</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K backgroundDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic2312646DA.WOKW-(<i>D5Mgh6-D5Mit5</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K backgroundDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic2312647DA.WOKW-(<i>D3Mgh5-D3Rat1</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K backgroundDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic2312648DA.WOKW-(<i>D10Mgh2-D10Rat4</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K backgroundDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic2314414LEW-Tg(FH1t(Insr)UTG)87HrjbLEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoterDepartment of Cellular and Molecular Immunology, University of Gottingen, Gottingen, GermanytransgenicInsr29172314415LEW-Tg(FH1t(Insr)UTG)4HrjbLEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoterDepartment of Cellular and Molecular Immunology, University of Gottingen, Gottingen, GermanytransgenicInsr29172306070WIC-Tg(Wap-GH1)1MniDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=789> National BioResource Project for the Rat in Japan</a>transgenicSpermDiabetes Obesity; Metabolism2306071F344-Tg(CAG-EGFP)NccoTransgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=576> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Embryo; SpermDiabetes Obesity; Cancer; Metabolism2306072ACI.F344-(<i>D16Nkg74</i>)/NkgA sub congenic strain of ACI/N.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=768> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2306073WIC-Tg(Wap-GH1)2MniDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=788> National BioResource Project for the Rat in Japan</a>transgenicSpermDiabetes Obesity; Metabolism2306076ACI.F344-(<i>D16Nkg9-D16Nkg38</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=793> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2306077ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=791> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2306078KFRS4A/KyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=801> National BioResource Project for the Rat in Japan</a>mutantSpermNeurobiology; Behavior2306079ACI.F344-(<i>D16Nkg87-D16Nkg105</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=792> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2312577SHR.BN-(<i>D18Rat99-D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosityCzech Academy of Sciences, Prague, Czech Republiccongenic2312578SHR.BN-(<i>D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosityCzech Academy of Sciences, Prague, Czech Republiccongenic2312579SHR.BN-(<i>D18Rat40-D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosityCzech Academy of Sciences, Prague, Czech Republiccongenic2312580SHR.BN-(<i>D18Rat113-D18Rat82</i>)/IpcvSHR/OlaIpcv were crossed with BN/Crl, F<sub>1</sub> animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotesCzech Academy of Sciences, Prague, Czech Republiccongenic2305939SHRSP.WKY-(<i>D9Mit6-D9Rat83</i>)/TkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=690> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2305940SHRSP-Chr 7<sup>WKY</sup>/TkyoChromosome 7 from WKY is introgressed into the genomic background of SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=688> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305941SHR-Chr 15<sup>WKY</sup>/TkyoChromosome 15 from WKY is introgressed into the genomic background of SHR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=695> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305942SHR-Chr 3<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=694> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305943SHRSP-Chr 15<sup>WKY</sup>/TkyoChromosome 15 from WKY is introgressed into the genomic background of SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=692> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305944SHRSP-Chr 4<sup>WKY</sup>/TkyoChromosome 4 from WKY is introgressed into the genomic background of SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=687> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305945SHRSP-Chr 13<sup>WKY</sup>/TkyoChromosome 13 from WKY is introgressed into the genomic background of SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=691> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305946SHR-Chr 1<sup>WKY</sup>/TkyoChromosome 1 from WKY is introgressed into the genomic background of SHR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=693> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305947SHR-Chr 19<sup>WKY</sup>/TkyoChromosome 19 from WKY is introgressed into the genomic background of SHR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=696> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2305948SHRSP.WKY-(<i>D8Rat77-D8Rat16</i>)(<i>D8Tkyo10</i>)/TkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=689> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2305949SHRSP-Chr 1<sup>WKY</sup>/TkyoChromosome 1 from WKY is introgressed into the genomic background of SHRSP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=686> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2306013F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=853> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306014F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=848> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306015F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=852> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306016F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=849> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306017(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D14Rat23-D14Rat12</i>))F1Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=856> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306018F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=851> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306019F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=850> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2307159SHRSR.SHRSP-(<i>Klk1-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic2312609MWF-Chr 8<sup>SHR</sup>/RkbMWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossingDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germanyconsomic2314368F344-<i>Trdk</i>/KyoTremor dominant KyotoMutant rat that showed tremor was found in the G1 rats that established by ENU mutagenesis (phenotype driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=898> National BioResource Project for the Rat in Japan</a>mutantSpermNeurobiology2306089ACI.BUF-(<i>D7Wox16-D7Rat69</i>)/MnaThe thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=803> National BioResource Project for the Rat in Japan</a>congenicSpermCancer2306020(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>))F1Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=857> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306021SHR-Chr 2<sup>WKY</sup>/TkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=713> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity; Cardio Hypertension2306022KCI/KyoRats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=630> National BioResource Project for the Rat in Japan</a>mutantSpermNeurobiologyPcdh1515909692306023F344-Tg(CCNT1)1HikDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=712> National BioResource Project for the Rat in Japan</a>transgenicSpermInfectiousCCNT113224572306024FOK/NcuFuruyama ratThese are resistant to hot environment.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=759> National BioResource Project for the Rat in Japan</a>inbredEmbryo; Sperm2306025WMN/NrsDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=675> National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoCancer; Metabolism2306026F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=854> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306027WM/NrsDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=676> National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoCancer; Metabolism2306028F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=847> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306029(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=855> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306030F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=846> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306085TCR/IbuToyoda Circling RatA male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=800> National BioResource Project for the Rat in Japan</a>mutantSpermNeurobiology; Behavior2306098ACI.F344-(<i>D16Nkg30-D16Mgh6</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=828> National BioResource Project for the Rat in Japan</a>congenicSperm2306099SHR.WKY-(<i>D15Tkyo3-D15Rat68</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=807> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2306100SHR.WKY-(<i>D3Tkyo7-D3Rat1</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=815> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2306101LEC.BN-(<i>D4Mgh16-D4Rat233</i>)/HkvDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=875> National BioResource Project for the Rat in Japan</a>congenicSperm2306102BN.LEC-(<i>D4Rat128-D4Rat106</i>)/HkvDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=879> National BioResource Project for the Rat in Japan</a>congenicSperm2305966SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=864> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicSpermDiabetes Obesity2305967SHR.SHRSP-(<i>D18Rat73-D18Rat11</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=866> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicSpermDiabetes Obesity2305968SHRSP.WKY-(<i>D1Wox18-D1Rat39</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=862> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity2305969SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=861> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity2305970DA-Tg(Alb-TTR*V30M)7JmskThis is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=703> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDevelopment2305971SHRSP.SHR-(<i>D18Rat73-D18Rat11</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=865> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicSpermDiabetes Obesity2305972WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)(<i>Bcl2-D13Mgh7</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=838> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305973SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=863> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicSpermDiabetes Obesity2305974WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=858> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2305975SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=860> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity2305976DA-Tg(Alb-TTR*V30M)9JmskThis is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=705> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=339>Rat Resource & Research Center</a>transgenicEmbryoDevelopment2305977ACI.F344-(<i>D16Rat12-D16Mco2</i>)/NkgF344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=702> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCancer2305978LEW-Tg(Gt(ROSA)26Sor-DsRed*)7JmskThis strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=706> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDevelopment2305979WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>Bcl2-D13Mgh7</i>)/IzmDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=859> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2306103SHRSP/SumsDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=873> National BioResource Project for the Rat in Japan</a>inbredEmbryo2306104BN.LEC-(<i>D4Rat184-D4Rat238</i>)/HkvDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=878> National BioResource Project for the Rat in Japan</a>congenicSperm2306105BN.LEC-(<i>D4Rat128-D4Rat238</i>)/HkvDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=877> National BioResource Project for the Rat in Japan</a>congenicSperm2306106CLX/TaCircling behavior linked to the X-chromosome (CLX)Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=813> National BioResource Project for the Rat in Japan</a>mutantEmbryoBehavior2306815SS.SR-(<I>D7Rat67-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedMedical College of Ohio, Toledo, Ohio, USAcongenic2306816SS.SR-(<I>D7Mco19-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedMedical College of Ohio, Toledo, Ohio, USAcongenic2306817SS.SR-(<I>D7Uia1-D7Mco19</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedMedical College of Ohio, Toledo, Ohio, USAcongenic2306818SS.SR-(<I>D7Rat131-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedMedical College of Ohio, Toledo, Ohio, USAcongenic2306819SS.SR-(<I>D7Uia1-D7Rat131</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedMedical College of Ohio, Toledo, Ohio, USAcongenic2306820SS.SR-(<i>D3Arb14-D3Mco36</i>)/McoSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomeMedical College of Ohio, Toledo, Ohio, USAcongenic2313734SD-Tg(Insr-shRNA)29BdrFertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoterMax-Delbruck Center for Molecular Medicine, Berlin, Germanytransgenic2313735SD-Tg(Insr-shRNA)14BdrFertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoterMax-Delbruck Center for Molecular Medicine, Berlin, Germanytransgenic2314904WAG-F8<i><sup>m1Ycb</i></sup>Natural mutation found in the WAG/RijYcb<a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>mutantF8<i><sup>m1Ycb</i></sup>23149032306033SHR.Cg-<i>Lepr<sup>cp</sup></i>/NDmcrNonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=734> National BioResource Project for the Rat in Japan</a>congenicLive AnimalsDiabetes Obesity; Cardio Hypertension2306034NER.F344-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Rat100-D5Rat234</i>)/KyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=729> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology2306035F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)/KyoThis double congenic strain was established by crossing F344.NER-(<i>D1Mgh6-D1Rat73</i>)/Kyo and F344.NER-(<i>D5Mgh4-D5Rat36</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=727> National BioResource Project for the Rat in Japan</a>congenicLive AnimalsNeurobiology2306036F344-<i>Apc<sup>m1</i>Kyo</sup>F344/NSlc rats that have an induced mutation in the Apc gene; Established by ENU mutagenesis (gene-driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=714> National BioResource Project for the Rat in Japan</a>mutantLive Animals; SpermCancerApc21232306037F344-Tg(CD4)1HikDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=700> National BioResource Project for the Rat in Japan</a>transgenicSpermInfectious2306107SD-Tg(Sp6)58TjThe transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=868> National BioResource Project for the Rat in Japan</a>transgenicSpermDentistry; DevelopmentSp613067682306108SHR.WKY-(<i>D3Mit9-D3Wox16</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=814> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2306109SHR.WKY-(<i>D3Mgh6-D3Rat1</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=817> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2306110IER/SumsDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=870> National BioResource Project for the Rat in Japan</a>inbredEmbryoNeurobiology2306111LEC.BN-(<i>D4Mgh16-D4Rat233</i>)(<i>D4Rat271-D4Rat238</i>)/HkvDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=876> National BioResource Project for the Rat in Japan</a>congenicSperm2306112ZDF-<i>Lepr<sup>fa</i>CrlCrlj</sup>Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=778> National BioResource Project for the Rat in Japan</a>mutantLive Animals; EmbryoDiabetes ObesityLepr30012306113SD-Tg(Sp6)6TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=867> National BioResource Project for the Rat in Japan</a>transgenicSpermDentistry; DevelopmentSp613067682306114SHR.WKY-(<i>D3Mgh16-D3Rat110</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=806> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2306115SHR.WKY-(<i>D3Mgh16-D3Rat166</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=816> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2306116SD-Tg(Sp6)5TjThe transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=819> National BioResource Project for the Rat in Japan</a>transgenicSpermDentistry; DevelopmentSp613067682306117ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=827> National BioResource Project for the Rat in Japan</a>congenicSperm2306118SHR.WKY-(<i>D15Rat95-D15Rat106</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=808> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2307441F344-<i>Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=452>Rat Resource & Research Center</a>mutantSpermCyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup>23074402307442F344-<i>Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a><a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=451>Rat Resource and Research Center</a>mutantSpermRobo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup>23074392306119F344-Tg(CD4,CCNT1)1HikDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=805> National BioResource Project for the Rat in Japan</a>transgenicSpermInfectious2306120SHR.WKY-(<i>D4Wox27-D4Rat15</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=818> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity; Cardio Hypertension2306784Kini:DA,PVG-G12Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1<sup>a</sup> MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG/OlaHsd females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couplesCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedenadvanced_intercross_line2306874F344-<i>Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=441>Rat Resource & Research Center</a>mutantSpermIntu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup>23068732306875F344-<i>Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantFaslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup>23068722306961RLA/VerhRoman low avoidanceBignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, BelgiumLaboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgiuminbred2306962RHA/VerhRoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, BelgiumLaboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgiuminbred2307160SHRSR.SHRSP-(<i>Klk1-D1Mit3</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic2312466Crl:LISLister Hooded RatThese rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2312518Crlj:ZUC-<i>Lepr</i><sup>fa</sup>Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000)<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2313181LEW.1WR1/WorBrmObtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc.<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>congenic2313232WFF344F1/CrlThis hybrid rat is a cross between a WF female and a F344 male rat.<a href=http://www.criver.com/>Charles River Laboratories </a>hybrid2314530SS.SHR-(<i>D8Uia1-D8Rat90</i>)/McoSS/Jr females were bred with SHR/NHsd males and their female F<sub>1</sub> were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markersMedical College of Ohio, Toledo, Ohiocongenic2314531SHR.SS-(<i>D13Rat1-D13Mgh6</i>)/McoSS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markersMedical College of Ohio, Toledo, Ohiocongenic2314532SHR.SS-(<i>D8Uia1-D8Rat90</i>)/McoSS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markersMedical College of Ohio, Toledo, Ohiocongenic2307317MHSMilan Hypertensive StrainOutbred Wistar rats with brother x sister mating and selection for high systolic blood pressureDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, Italyoutbred2307318BDIX/Ifzderived from Berlin-Druckrey strain BDIXDuisburg-Essen University Medical School, Essen, Germanyinbred2307319MNS/NMilan normotensive strainWistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.<a href=http://www.rrrc.us/Strain/?x=171>Rat Resource and Research Center</a>inbredEmbryo2311082SS-Chr 13<sup>BN</sup>/McwiCrlDeveloped at the Medical College of Wisconsin. To Charles River in 2003.<a href=http://www.criver.com/>Charles River Laboratories </a>consomic2307115BXH5/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307116PXO3-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307117PXO5-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307118PXO9/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307119PXO7-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307120PXO7-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307121BXH2/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307122PXO8-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307123BXH13/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307124BXH10/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307125PXO6-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307126BXH8/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307127BXH11/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307128PXO5-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307129BXH9/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307130PXO6-3/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307131PXO8-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307132PXO10/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307133BXH12-2/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307134BXH3/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307135PXO4/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307136BXH6/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307137PXO6-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307138PXO1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307139BXH12-1/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307355PXO3-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307155SHR/1NCrlTo Charles River from NIH in 1973 at F32.MRC Clinical Sciences Centre, College School of Medicine, London, UKinbred2314934WST.F344-<i>Ker</i>/KyoWistar/ST-BooThis congenic strain was established by backcrossing F344-<i>Ker</i>/Kyo (NBRP No.0458) onto Slc:WST<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=755> National BioResource Project for the Rat in Japan</a>congenicSperm2314935WST.F344-<i>Kmch</i>/KyoWistar/ST-KomachiThis congenic strain was established by backcrossing F344-<i>Kmch</i>/Kyo (NBRP No.0458) onto Slc:WST.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=756> National BioResource Project for the Rat in Japan</a>congenicSperm2314936WI-Tg(WSCD2)TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=874> National BioResource Project for the Rat in Japan</a>transgenicSperm2314937F344.OLETF-(<i>D5Mgh20-D5Mgh22</i>)/TjDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=915> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2304242WTC-Kcnq1<i><sup>dfk</i>Kyo</sup>Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-<i>Kcnq1<sup>dfk</sup></i>/Kyo rat is a mutant for circling behavior. although the Atrn<sup>zi</sup> allele of WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic rats was eliminated, the circling behavior remained.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=548> National BioResource Project for the Rat in Japan</a>mutantSpermOtorhinology; Internal OrganKcnq16215032307356PXO2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.Charles University, Department of Biology, Prague, Czech Republicrecombinant_inbred2307357BDV/ZtmDeveloped from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles.Zentralinstitut fur Versuchstierzucht, Hannover, Germanyinbred2307358LUDW/OlaHsdLudwigWistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979.<a href =http://www.harlan.com/products_and_services/research_models_and_services/eliminated_stocks_and_strains.hl> Harlan</a>inbredCryopreserved2307359BUF/SimRijHsdDeveloped by Heston in 1946 from a BuffaloHarlan Sprague Dawley, Inc., Indianapolis, INinbred2307360DA.BI.RT1i-(<i>D20Rat42-D20Rat31</i>)/RhdRT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han.Section for Medical Inflammation Research, Lund University, Lund, Sweden.congenic2314861WAG/RijYcbSubstrain of WAG/Rij; from Netherlands to Yale University.<a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>inbred2314928Slc:WSTInstitute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain.<a href=http://www.labanimal.co.kr/product/slc03.html> SLC, Japan</a>outbred2313693SHR-Tg(PEPCK-SREBF1)2IpcvSHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signalInstitute of Physiology, Czech Academy of Sciences, Prague, Czech Republictransgenic2306709BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/3RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.Department of Medicine, University of Washington, Seattle, Washingtoncongenic2306710F344-<i>Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=447>Rat Resource & Research Center</a>mutantSpermLmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup>23067012306711F344-<i>FM117003<sup>Tn(sb-T2/Bart3)2.321McwiRrrc</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=475>Rat Resource & Research Center</a>mutantSpermFM117003<sup>Tn(sb-T2/Bart3)2.321Mcwi</sup>23067032306712BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/2RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.Department of Medicine, University of Washington, Seattle, Washingtoncongenic2307166SHRSP.SHRSR-(<i>Klk1-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic2307167SHRSP.SHRSR-(<i>Klk1-D1Mit3</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic2307168SHRSR/BbbSpontaneously Hypertensive Rat, Stroke ResistantThis SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany.Max-Delbruck-Center for Molecular Medicine, Berlin, Germanyinbred2307169SHRSP.SHRSR-(<i>D1Rat134-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic2308885GK/CskCrljCrlThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbred2308886SS/HsdMcwiCrlInbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbred2312352LEW.1NThese congenic rats carry the RTl<sup>n</sup> haplotype on the LEW strain genetic background.Zentralinstitut fur Versuchstierzucht, Hannover, Germanycongenic2314477LEW-<i>RT1<sup>DA</i></sup>/RrrcSprague-Dawley RT1<sup>u</sup> haplotype backcrossed onto Lewis inbred strain.<a href=http://www.rrrc.us/Strain/?x=391>Rat Resource and Research Center</a>congenicEmbryo; Sperm2314478LEW-<i>RT1.B<sup>m1Trg</i></sup>/RrrcRT1.BENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain.<a href=http://www.rrrc.us/Strain/?x=392>Rat Resource and Research Center</a>mutantEmbryo; Sperm2314492SBN.SBH-(<i>D1Rat148-D1Rat89</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314493SBH.SBN-(<i>D1Mgh2-D1Rat74</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314494SBH.SBN-(<i>D1Rat137-D1Rat123</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314495SBN.SBH-(<i>D1Rat27-D1Mit7</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314496SBH.SBN-(<i>D1Mgh2-D1Mgh11</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314497SBN.SBH-(<i>D1Rat101-D1Rat74</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314498SBH.SBN-(<i>D1Rat137-D1Rat83</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314499SBN.SBH-(<i>D1Mgh17-D1Mgh14</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314500SBH.SBN-(<i>D1Mgh2-D1Rat101</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314501SBH.SBN-(<i>D1Wox11-D1Rat137</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/YglBen Gurion University Barzilai Medical Center, Ashkelon, Israelcongenic2314339F344-<i>Inadl<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=480>Rat Resource & Research Center</a>mutantSpermInadl<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup>23143352314340F344-<i>Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantAcoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup>23143372314341F344-<i>Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantAuts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup>23143382314342F344-<i>Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>mutantPalld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup>23143362306276F344-<i>Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=456>Rat Resource & Research Center</a>mutantSpermExoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup>23062732306277F344-<i>Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=454>Rat Resource & Research Center</a>mutantSpermGng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup>23062742306278F344-AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=448>Rat Resource & Research Center</a>mutantSpermAW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>23062722306279F344-<i>Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=446>Rat Resource & Research Center</a>mutantSpermDiaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup>23062752314161F344-<i>Kuru1</i>/KyoKuru1A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=720> National BioResource Project for the Rat in Japan</a>mutantSperm2314162F344-<i>Oune</i>/KyoOuneA mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=718> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Sperm2314163F344-<i>Adms</i>/KyoADMS (autosomal dominant myokymia and seizures) ratThis strain was established by phenotype-driven ENU mutagenesis.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=724> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Sperm2314164F344-<i>Kuru2</i>/KyoKuru2A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=721> National BioResource Project for the Rat in Japan</a>mutantSperm2314165ACI-<i>Chib</i>/KyoChibiThis strain was established by phenotype-driven ENU mutagenesis.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=717> National BioResource Project for the Rat in Japan</a>mutantSpermDermatology2314166F344-<i>Tbr2</i>/KyoTsubura2A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=723> National BioResource Project for the Rat in Japan</a>mutantSperm2314167F344-<i>Kmch</i>/KyoKomachiThis strain was established by phenotype-driven ENU mutagenesis.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=719> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Sperm2314168F344-<i>Tbr1</i>/KyoTsubura1A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=722> National BioResource Project for the Rat in Japan</a>mutantSperm2314169WTC.F344-<i>Scn1a<sup>m1Kyo</sup></i>/KyoThis congenic strain was established by backcrossing F344-<i>Scn1a<sup>m1Kyo</sup></i> onto WTC/Kyo.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=754> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Sperm2314170F344-<i>Egr<sup>m1Kyo</i></sup>EGR (Excessive Grooming Rat), Kaikai, Kyo1897This strain was established by phenotype-driven ENU mutagenesis.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=725> National BioResource Project for the Rat in Japan</a>mutantSperm2314360ACI.F344-(<i>D16Mit5-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=871> National BioResource Project for the Rat in Japan</a>congenicSpermCancer2314361W-Tg(Slc32a1-YFP*)1YyanThis transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=905> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; SpermNeurobiology; Development2314362F344-<i>Hrdk</i>/KyoHairless dominant KyotoHairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=899> National BioResource Project for the Rat in Japan</a>mutantSperm2314363W-Tg(Slc32a1-YFP*)2YyanThis transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=908> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; SpermNeurobiology; Development2311070BUF/CrCrlHeston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2311071ZDF-<i>Lepr<sup>fa</sup></i>/CrlA mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001.<a href=http://www.criver.com/>Charles River Laboratories </a>coisogenic2311072FHH/EurMcwiCrlAn outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001.<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2311073NBL/CrCrlBogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998.<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2311074BDIX/CrCrlDruckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2314027SDT.ZDF-<i>Lepr<sup>fa</sup></i>/JttSDT fatty<i>Lepr<sup>fa</sup></i> allele from ZDF was introgressed into SDT rats using the speed congenic methodJapan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, Japancongenic2306532BBDR.F344-(<i>D4Rat27-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNADepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306533BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/2RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306534BBDR.F344-(<i>D4Rat102-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306535BBDR.F344-(<i>D4Rat253-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306536BBDR.F344-(<i>D4Arb11-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains generated by intercrossing male BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw and female BBDR/RhwDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306537BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/1RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306538BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutationDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306539BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/3RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNADepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306540BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNADepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306541BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwBBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressedDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306542BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNADepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2306543BBDR.F344-(<i>D4Got59-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwBBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressedDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2304277SHRSP.WKY-(<i>D1Rat36-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=619> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304278DA-Tg(Alb-HSVtk)5JmskThis strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in this transgenic rats causes hepatitis.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=651> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDevelopment2304279W-Tg(MT2A-Myc)1YsThis transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=699> National BioResource Project for the Rat in Japan</a>transgenicEmbryoReproduction; DevelopmentMyc31302304280SHR/ShiDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=666> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio Hypertension2304281SERC/KyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=657> National BioResource Project for the Rat in Japan</a>mutantSpermNeurobiology2304282IEW/Ihrmutant of Ihara epileptic rat.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=733> National BioResource Project for the Rat in Japan</a>inbredLive Animals; EmbryoNeurobiology; Ophthalmology2304283SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=614> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304284SHRSP.WKY-(<i>D1Mgh5-D1Rat116</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=609> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304285BDIX/NemOdaDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=579> National BioResource Project for the Rat in Japan</a>inbredCancer2304286DMYC/KyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=624> National BioResource Project for the Rat in Japan</a>coisogenicSperm2304287ACI.F344-(<i>D16Rat17-D16Rat15</i>)/NkgF344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=621> National BioResource Project for the Rat in Japan</a>congenicEmbryoCancer2304288ACI.BUF-(<i>D20Img2-D20Rat5</i>)/NccDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=595> National BioResource Project for the Rat in Japan</a>congenicCancer2304289SHRSP.WKY-(<i>D1Mgh5-D1Rat349</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=617> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304290BUF.ACI-(<i>D20Img2-D20Rat5</i>)/NccDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=594> National BioResource Project for the Rat in Japan</a>congenicCancer2304291LEW-Tg(CAG-EGFP)1YsThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=647> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Embryo; SpermDevelopment2304292LEW-Tg(Gt(ROSA)26Sor-luc)21JmskThis strain expresses luciferase ubiquitously driven by the gene trap ROSA 26 promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=650> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDevelopment2304293F344.LEC-<i>xhs1</i>/1NrsLEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=592> National BioResource Project for the Rat in Japan</a>congenicSperm2304294MPOD/KyoMyeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=622> National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermCancer; Immunology2304295SHRSP.WKY-(<i>Igf1r-D1Rat36</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=616> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2305934F344-<i>Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=439>Rat Resource and Research Center</a>mutantSpermSpta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup>23059322305935F344-<i>Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu> PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=476>Rat Resource and Research Center</a>mutantSpermRtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup>23059332306090EXHC/TaExogenously hypercholesterolemic ratDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=804> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsMetabolism2306544BBDR.F344-(<i>D4Rat26-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNADepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2312511WF/IcoCrlWistar RatsFurth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970.<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2312512ZSF1-<i>Lepr<sup>fa</sup></i> <i>Lepr<sup>cp</sup></i>/CrlThis hybrid rat is a cross between a ZDF female and a SHHF male rat. This model was developed at Genetic Models International, Indianapolis.<a href=http://www.criver.com/>Charles River Laboratories </a>hybrid2312513Crlj:DONDr. Sato(1952) to Nippon Rat to CRLJ(1990)<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2312514Crlj:LECHokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991).<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2313342BN-Chr 17<sup>LH</sup>/MavChr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedLaboratoire de Physiologie, Lyon Cedex , Franceconsomic2313343LH-Chr 13<sup>BN</sup>/MavChr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedLaboratoire de Physiologie, Lyon Cedex , Franceconsomic2314224F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/2TjCongenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=910> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2314225F344-Chr 15<sup>OLETF</sup>/TjDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=914> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity2314226WI-Tg(WSCD2)3TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=881> National BioResource Project for the Rat in Japan</a>transgenicSpermWSCD216057102314227WI-Tg(WSCD2)4TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=882> National BioResource Project for the Rat in Japan</a>transgenicSpermWSCD216057102314228WI-Tg(WSCD2)5TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=883> National BioResource Project for the Rat in Japan</a>transgenicSpermWSCD216057102314229F344.OLETF-(<i>D7Uwm22-D7Mgh20</i>)/TjDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=916> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2314230F344-<i>Hr<sup>Krh</i></sup>/KyoHairless Kyoto, HanakoA mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=757> National BioResource Project for the Rat in Japan</a>mutantSpermDermatology; Urology2304296KB/OdaMaintained by crossing heterozygotes of the albino locus (segregating inbred strain).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=581> National BioResource Project for the Rat in Japan</a>segregating_inbredEmbryo2304297TM.KDP-<i>Cblb</i>/NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=608> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; ImmunologyCblb6205352304298SD-Tg(Tuba1a-EYFP)OknThis strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=603> National BioResource Project for the Rat in Japan</a>transgenic2304299LEW-Tg(Alb-GFP)6JmskThis strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=652> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDevelopment2304300W-Tg(S100b-EGFP)ScellDeveloped by microinjecting the transgene into Wistar rats<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=673> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermNeurobiology; Metabolism2304301SHRSP.WKY-(<i>Slco3a1-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=618> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304302SHRSP.WKY-(<i>D1Rat44-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=612> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304303W-Tg(MT2A-Myc)2YsThis transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=698> National BioResource Project for the Rat in Japan</a>transgenicEmbryoReproduction; DevelopmentMyc31302304304SHRSP.WKY-(<i>D1Rat209-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=613> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304305DOB/OdaThis strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=582> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Embryo2304306BUF.ACI-(<i>D20Img2-Cdkn1a</i>)/NccDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=599> National BioResource Project for the Rat in Japan</a>congenicCancer2304307ACI.BUF-(<i>D20Img2-Cdkn1a</i>)/NccDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=598> National BioResource Project for the Rat in Japan</a>congenicCancer2304308ICR/IhrA new strain of rat with an inherited cataract<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=731> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsNeurobiology; Ophthalmology2304309SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=611> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304310SD-Tg(Nes/Hspa1b-EGFP)OknThis strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=602> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermNeurobiology2304311LEW-Tg(Gt(ROSA)26Sor-lacZ)44JmskRrrcThis strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=648> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=298>Rat Resource and Research Center</a>transgenicEmbryoDevelopment2304312SHRSP.WKY-(<i>D1Mgh5-D1Rat36</i>)(<i>D1Rat44-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=610> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304313SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=615> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2306840E3.DA-(<i>D4Wox22-D4Got132</i>)(<i>D12Wox5-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markersSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenic2306841E3.DA-(<i>D12Wox5-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markersSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenic2306842E3.DA-(<i>D20Rat45-D20Rat47</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markersSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenic2312471Crl:ZUC(Orl)-<i>Lepr</i><sup>fa</sup>The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2312472Crl:WI(WU)Wistar Wu RatSelection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2312473BDIX/OrlCrlBDIX RatsRats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991.<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2312474Crl:OFA(SD)The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2314231F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/2TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=911> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity2314232WI-Tg(WSCD2)1TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=880> National BioResource Project for the Rat in Japan</a>transgenicSpermWSCD216057102314313NER.F344-(<i>D5Rat100-D5Rat234</i>)/KyoThe Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=893> National BioResource Project for the Rat in Japan</a>congenicNeurobiology2314314NER.F344-(<i>D1Mgh6-D1Rat132</i>)/KyoThe Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=892> National BioResource Project for the Rat in Japan</a>congenicNeurobiology2314315F344.NER-(<i>D5Mgh4-D5Rat36</i>)/KyoThe Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=891> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology2314316F344.NER-(<i>D1Mgh6-D1Rat73</i>)/KyoThe Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=890> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology2314317WTC.GRY-<i>Cacna1a<sup>gry</i></sup>/KyoDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=894> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiologyCacna1a22442304315SHRSP.WKY-(<i>Calca-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=620> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes Obesity; Cardio Hypertension2304316F344.LEC-<i>xhs1</i>/2NrsLEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=593> National BioResource Project for the Rat in Japan</a>congenicSperm2306058LEC.W-Tg(CAG-Zfml)30Ncms/NcmsDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=782> National BioResource Project for the Rat in Japan</a>congenicSperm2306059DA.Cg-<i>Foxn1<sup>rnu</sup> Lyst<sup>bg</sup></i>/SlcDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=760> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermImmunology; HematologyFoxn1|Lyst3970|6218372306060LEC.W-Tg(CAG-Zfml)26Ncms/NcmsDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=781> National BioResource Project for the Rat in Japan</a>congenicSperm2306061ACI.BUF-<i>Pur1 Ten2</i>/MnaThe proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=739> National BioResource Project for the Rat in Japan</a>congenicMetabolism2306062W-Tg(Per1-luc)1OaDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=740> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=273>Rat Resource and Research Center</a>transgenicEmbryo; Sperm2306063LEC.W-Tg(CAG-Zfml)21Ncms/NcmsDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=738> National BioResource Project for the Rat in Japan</a>congenicSperm2306064MPR/IarDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=745> National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermMetabolism; OsteosisArsb21582311692F344-<i>Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=478>Rat Resource and Research Center</a>mutantSpermMyo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup>23116912311693F344-<i>Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantTmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup>23116892311694F344-<i>Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.rrrc.us/Strain/?x=502>Rat Resource & Research Center</a>mutantSpermFam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup>23116872312447SD-Tg(Pmp22)KanThis transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid libraryMax Planck Institute for Experimental Medicine, Gottingen, GermanytransgenicPmp22111252312733BN-Chr 13<sup>SS</sup> Chr 18<sup>SS</sup>/McwiA cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed<a href=http://pga.mcw.edu/pga2-bin/consomic_analysis.cgi?rat_strain=SS-13BN%2FMcwi&ratCategory=SS-13BN%2FMcwi>PhysGen</a>consomicSperm2313384Wild/NovThese are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, RussiaInstitute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russiawild2314243SHR.WKY-(<i>D1Mgh2-D1Wox10</i>)/IzmTkyoDeveloped by the depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=907> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermCardio Hypertension2314244BCR/NnIn the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=887> National BioResource Project for the Rat in Japan</a>mutantSpermNeurobiology2314245WI-Tg(WSCD2)6TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=884> National BioResource Project for the Rat in Japan</a>transgenicSpermWSCD216057102306529BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwParental strain BBDR.BBDP-(<I>D4Rhw17-ss99306861</i>)(<I>D4Rhw11-D4Rhw10</I>)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenicDepartment of Medicine, University of Washington, Seattle, Washingtoncongenic2311049SHROB/KolGmiCrl-<i>Lepr<sup>cp</i></sup>/CrlThis mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>coisogenic2311078Crl:CD-<i>Hr<sup>hr</i></sup>CD hairless ratsThis spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic.<a href=http://www.criver.com/>Charles River Laboratories </a>outbred2311079WF/CrCrlJ. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).<a href=http://www.criver.com/>Charles River Laboratories </a>inbred2313221SHHF-<i>Lepr<sup>cp</i></sup>/CrlDeveloped by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>congenic2313222BN/HsdMcwiCrlBN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbred2314364ACI.F344-(<i>D16Nkg112-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=902> National BioResource Project for the Rat in Japan</a>congenicSpermCancer2314365KFRS2/KyoA male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=901> National BioResource Project for the Rat in Japan</a>mutantSpermOphthalmology; DermatologyTyr15897552304314BDIX.Cg-<i>Tal</i>/NemOdaMating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=607> National BioResource Project for the Rat in Japan</a>congenicSpermOsteosis2304329WKY/EzoDeposited by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=568> National BioResource Project for the Rat in Japan</a>inbredEmbryoCardio Hypertension2304330SD-Tg(HRAS)128NcuThis strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=668> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermCancer2304331F344-Tg(CCR5)1HikDeposited by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=674> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; SpermInfectious2304332HER/WkmtDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=697> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsNeurobiology2314246SHRSP.WKY-(<i>D1Rat117-D1Rat90</i>)/IzmTkyoDeveloped by the Depositor<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=906> National BioResource Project for the Rat in Japan</a>congenicEmbryoCardio Hypertension2314247WI-Tg(Prl-EGFP)YampA transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=904> National BioResource Project for the Rat in Japan</a>transgenicSpermMetabolism; Development2314396LCR/McoLow-capacity runnersArtificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill.Medical College of Ohio, Toledo, Ohio, USAinbred2314397HCR/McoHigh-capacity runnersArtificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill.Medical College of Ohio, Toledo, Ohio, USAinbred2314655HsdBlu:BRAT-<i>Avp<sup>di</i></sup>BrattleboroHereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988.<a href =http://www.harlan.com/products_and_services/research_models_and_services/eliminated_stocks_and_strains.hl> Harlan</a>, <a href=http://www.rrrc.us/Strain/?x=445>Rat Resource and Research Center</a>mutantEmbryo; SpermAvp21842306892SHR.BN-(<i>D2Rat114-D2Rat123</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalsHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. <a href=http://genetica.incor.usp.br>Genetica</a>congenic2306893SHR.BN-(<i>D16Rat87-D16Mgh1</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalsHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. <a href=http://genetica.incor.usp.br>Genetica</a>congenic2306894SHR.BN-(<i>D4Rat33-D4Rat54</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalsHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. <a href=http://genetica.incor.usp.br>Genetica</a>congenic2306895SHR.BN-(<i>D2Rat226-D2Rat294</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalsHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. <a href=http://genetica.incor.usp.br>Genetica</a>congenic2307298BN/HanKiniSubstrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany)Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedeninbred2307299ACI/ZtmKinisubstrain of ACI derived from ACI/ZtmCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedeninbred2307300LEW.1AV1/KiniSubstrain of LEW.1AV1Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic2307301DA.LEW.RT1f-(<i>D20Wox15-D20Wox13</i>)/RhdRT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markersSection for Medical Inflammation Research, Biomedical Center, Lund University, Swedencongenic2311051SHRSP/A3NCrlStroke Prone RatsThe SHRSP was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002.<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbred2314001N:HSHeterogeneous stockOriginated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of WisconsinDept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, Spainoutbred2307161SHRSR.SHRSP-(<i>D1Rat134-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic2313463F344-<i>Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=474>Rat Resource and Research Center</a>mutantSpermPpfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup>23134592313464F344-<i>Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>mutantLarge<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup>23134602313465F344-<i>Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>,<a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=503>Rat Resource and Research Center</a>mutantSpermPld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup>23134622313466F344-<i>Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb<a href=http://pga.mcw.edu>PhysGen</a>, <a href=http://www.transposagenbio.com/ratModelSummary.php>Transposagen</a>, <a href=http://www.rrrc.us/Strain/?x=473>Rat Resource & Research Center</a>mutantSpermAgbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup>23134612317196DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>)Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interestDepartment of Clinical Neuroscience, Karolinska Institutet, Stockholm, Swedencongenic2317197DA.PVG.1AV1-(<i>D8Rat41-D8Rat24</i>)Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interestDepartment of Clinical Neuroscience, Karolinska Institutet, Stockholm, Swedencongenic2317201DA.PVG.1AV1-(<i>D8Rat24-D8Got145</i>)DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locusDepartment of Clinical Neuroscience, Karolinska Institutet, Stockholm, Swedencongenic2316653SS.LEW-(<i>D1Mco102-D1Got46</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Uia8-D1Rat18<i>)/Mco contributing to the introgressed LEW alleleDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic2316654SS.LEW-(<i>D1Mco102-D1Mco129</i>)/1McoA sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic2316655SS.LEW-(<i>D1Mco102-D1Mco129</i>)/2McoA sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic2317278Taiep/DunThese mutants were found in Sprague-Dawley rats at University of Puebla in 1989Dept of Medical Sciences, University of Wisconsin-Madison, Madison, Wisconsinmutant2316928SHR.BN-(<i>D3Rat159-D3Rat1</i>)(<i>D6Rat40-D6Rat170</i>)/Mcothis double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN alleleMedical College of Ohio, Toledo, Ohio, USAcongenic2317590DA.PVG.1AV1-(<i>D4Rat23-D4Rat108</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic2317595DA.PVG.1AV1-(<i>D4Rat23-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic2317596DA.PVG.1AV1-(<i>D4Rat103-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic2317598DA.PVG.1AV1-(<i>D4Rat231-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic2317599DA.PVG.1AV1-(<i>D4Got211-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic2316631F344.GK-(<i>D1Swe8-D1Gpam-1</i>)/SweThis sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/SweKarolinska Institutet, Stockholm, SwedencongenicAdra2a|Pdcd4|Shoc22056|620816|13081462316632NEDH/KSimNew England Deaconess HospitalInbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman<a href=http://www.simlab.com/>Simonsen Laboratories</a>inbred2316633F344.GK-(<i>D1Got251-D1Gpam-1</i>)/SweThis sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/SweKarolinska Institutet, Stockholm, Swedencongenic2316925SHR.BN-(<i>D3Rat159-D3Rat1</i>)/Mco50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsdMedical College of Ohio, Toledo, Ohio, USAcongenic2316927SHR.BN-(<i>D6Rat40-D6Rat170</i>)/Mco45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsdMedical College of Ohio, Toledo, Ohio, USAcongenic2325796SS.LEW-(<i>D3Rat52-D3Chm57</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat130</i>)/AydResearch Centre-CHUM, Montreal, Quebec, Canadacongenic2325798SS.LEW-(<i>D10Got112-Igfbp4</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic2325801SS.LEW-(<i>D16Chm36-D16Mit2</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canadacongenic2325803SS.LEW-(<i>D16Rat112-D16Chm60</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canadacongenic4140469F344-<i>Kmch</i>/NSlcKomachifrom NBRP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=726> National BioResource Project for the Rat in Japan</a>mutant4139872SS-<i>Nckap5<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNckap5<sup>em2Mcwi</sup>41398624139873SS-<i>Rag1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermRag1<sup>em2Mcwi</sup>41398664139874SS-<i>Ets1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermEts1<sup>em1Mcwi</sup>41398564139875FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermSorcs1<sup>em1Mcwi</sup>41398644139876SS-<i>Mmp2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantMmp2<sup>em1Mcwi</sup>41398604139877FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermRab38<sup>em1Mcwi</sup>41398674139878SS-<i>Mmp2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctMmp2<sup>em2Mcwi</sup>41398694139879SS-<i>Nckap5<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctNckap5<sup>em1Mcwi</sup>41398594139880SS-<i>Ren<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermRen<sup>em1Mcwi</sup>41398634139881SS-<i>Nckap5<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNckap5<sup>em3Mcwi</sup>41398614139882SS-<i>Nppa<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermNppa<sup>em4Mcwi</sup>41398574139883SS-<i>Nox4<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermNox4<sup>em2Mcwi</sup>41398684139884SS-<i>Rag1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermRag1<sup>em1Mcwi</sup>41398654139885SS-<i>Sh2b3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermSh2b3<sup>em1Mcwi</sup>41398582317812AT.ANT-(<i>D1Rat234-D1Rat228</i>)/RarF<sub>2</sub> males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were testedUniversity of Colorado Denver, Coloradocongenic2317813AT.ANT-(<i>D1Rat234-D1Rat47</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317814AT.ANT-(<i>D1Rat273-D1Rat158</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317815AT.ANT-(<i>D1Rat35-D1Rat47</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317816AT.ANT-(<i>D1Rat234-D1Rat158</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317817AT.ANT-(<i>D1Rat183-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317818AT.ANT-(<i>D1Rat273-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317819AT.ANT-(<i>D1Rat35-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic4139889BHD/DspeBirt-Hogg-Dube ratA rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony in the Dainippon Pharmaceutical Co., Ltd. and named Nihon rat. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=927> National BioResource Project for the Rat in Japan</a>inbredEmbryoFlcn7350884139890TT/SgnRats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=928> National BioResource Project for the Rat in Japan</a>mutantSpermFkbp613089264139891F344-Chr 3<sup>SDT</sup>/NyoThis consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=896> National BioResource Project for the Rat in Japan</a>consomicEmbryoDiabetes Obesity4139892ALD/Hyoacid lipase deficiency ratIn a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=926> National BioResource Project for the Rat in Japan</a>inbredEmbryoMetabolismLipa30084140402W-Tg(Gh1as)NibsThe construct which contains of rat growth hormone (<i>Gh1</i>) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat <i>Gh1</i> cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=956> National BioResource Project for the Rat in Japan</a>transgenicSperm4140403SD-Tg(Eno2-ATXN3*64Q)29KakizBackground strain is Slc:SD.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=949> National BioResource Project for the Rat in Japan</a>transgenicSpermNeurobiology4140404ODS/ShiJclOsteogenic disorder Shionagi ratscurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.CLEA Japan, Inc. Tokyo JapaninbredGulo6207014140405LEXF6A/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=960> National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo4140406SHRSP.WKY-(<i>D1Wox29-D1Arb21</i>)/IzmDmcrTo establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=964> National BioResource Project for the Rat in Japan</a>congenicEmbryo4142540SHR.WKY-(<i>D4Rat10-D4Rat15</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=941> National BioResource Project for the Rat in Japan</a>congenicSpermCardio Hypertension4142541W-Tg(Tek-GFP)1SohThis transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=943> National BioResource Project for the Rat in Japan</a>transgenicEmbryo; Sperm4142542BN.SDT-<i>Gluco14</i>/NyoThe Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=945> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermDiabetes Obesity4142543BN.SDT-<i>Gluco13</i>/NyoThe Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=944> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermDiabetes Obesity4142544WKY/KihaA WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=930> National BioResource Project for the Rat in Japan</a>mutantEmbryo4142545SHR.WKY-(<i>D3Rat108-D3Rat166</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=937> National BioResource Project for the Rat in Japan</a>congenicSpermCardio Hypertension4142546AMI/TjRats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=929> National BioResource Project for the Rat in Japan</a>mutantEmbryoDentistry4142547SHR.WKY-(<i>D4Wox27-D4Rat11</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=940> National BioResource Project for the Rat in Japan</a>congenicSpermCardio Hypertension4142548SHR.WKY-(<i>D4Wox27-D4Rat10</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=939> National BioResource Project for the Rat in Japan</a>congenicSpermCardio Hypertension4142549SHR.WKY-(<i>D4Wox27-D4Rat4</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=938> National BioResource Project for the Rat in Japan</a>congenicSpermCardio Hypertension4142550SHR.WKY-(<i>D4Rat101-D4Rat15</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=942> National BioResource Project for the Rat in Japan</a>congenicSpermCardio Hypertension4140407SDT.BN-<i>Gluco13</i>/NyoThe <i>Gluco13</i> (<i>Gisdt1</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-<i>Gluco14</i>/Nyo (NBRP No. 0602).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=958> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermDiabetes Obesity4140408LEXF8C/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=959> National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo4140409COP-Chr 16<sup>DA</sup>/McoRrrcTransfer of the DA-rat chromosome 16 (RNO16) into the COP-rat backgroundUniversity of Toledo College of Medicine, Toledo, Ohioconsomic4140410SD-Tg(Eno2-ATXN3*64Q)16KakizBackground strain is Slc:SD.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=950> National BioResource Project for the Rat in Japan</a>transgenicSpermNeurobiology4140411SDT.BN-<i>Gluco14</i>/NyoThe <i>Gluco14</i> (<i>Gisdt2</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN-<i> Gluco13</i>/Nyo (NBRP No. 0601).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=957> National BioResource Project for the Rat in Japan</a>congenicEmbryo; SpermDiabetes Obesity4140412LEXF1D/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=961> National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo4140413LEXF1B/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=962> National BioResource Project for the Rat in Japan</a>recombinant_inbredEmbryo4140414WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)/IzmDmcrTo establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=965> National BioResource Project for the Rat in Japan</a>congenic4140415TRMRC/KyoThe coisogenic control strain for the TRMR strain (NBRP No.0016).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=963> National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Sperm4140416SD-Tg(Eno2-Vcp)16KakizThis transgenic strain was generated by microinjection into Slc:SD fertilized eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=948> National BioResource Project for the Rat in Japan</a>transgenicSpermNeurobiology2325724PVG.LEW-(<i>D1Rat270-D1Rat68</i>)/Kini63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic4143456BN.GK-(<i>D2Wox30-D2Wox68</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenic4143457BN.GK-(<i>D2Rat40-D2Wox35</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenic4143458BN.GK-(<i>D2Wox49-D2Rat70</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenic4143459BN.GK-(<i>D2Rat40-D2Got149</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenic2317891SHR-Chr 6<sup>MWF</sup>/RkbSHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germanyconsomic2324631DA.E3-(<i>D4Wox49-D4Got136</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.Medical Inflammation Research, Karolinska Institutet, Stockholm, Sweden.congenicClec4a313595284891048SS.LEW-(<i>D7Rat73-D7Rat128</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|7278864891051LEW.SS-(<i>D7Rat73-D7Rat128</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|7278864891103WMI/EerWKY most immobile3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated.Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinoisinbred4891107WLI/EerWKY least immobile3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated.Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinoisinbred4891165Wig/YmaswigglingThese are congenic wiggling rats established by transferring the gene from LEC to Wistar King-Aptekman/Hokkaido (WKAH) strainHuman Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, Japancongenic4891380SS.SR-(<i>D9Mco95-D9Mco98</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891383SS.SR-(<i>D9Mco98-Resp18</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891386SS.SR-(<i>D9Mco98-Resp18</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891388SS.SR-(<i>D9Mco95-D9Mco100</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891390SS.SR-(<i>D9Mco95-D9Mco100</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891392SS.SR-(<i>D9Mco95-D9Mco102</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891394SS.SR-(<i>D9Mco101-Resp18</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891396SS.SR-(<i>D9Mco72-Resp18</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891400SS.SR-(<i>D9Mco14-Resp18</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic2325773WKY.LEW-(<i>D13Arb15-D13Rat58</i>)/TjaSegment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrlImperial College, London, UKcongenic2325774WKY.LEW-(<i>D13Arb10-D13Arb15</i>)(<i>D16Rat88-D16Rat40</i>)/TjaWKY.LEW-(<i>D13Arb10-D13Arb15</i>) were crossed with WKY.LEW-(<i>D16Rat88-D16Rat40</i>), the F<sub>1</sub> were backcrossed to WKY.LEW-(<i>D13Arb10-D13Arb15</i>) and then the offsprings were intercrossedImperial College, London, UKcongenic4889499CDS-Chr 4<sup>CDR</sup>/YglHomozygous male CDS/Ygl were bred with CDR/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4891402SS.SR-(<i>D9Mco14-Resp18</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4891404SS.SR-(<i>D9Mco14-Resp18</i>)/3McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regionMedical College of Ohio, Toledo, Ohiocongenic4107048SS.SR-(<I>D7Rat16-D7Rat189</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentMedical College of Ohio, Toledo, Ohio, USAcongenic4107052SS.SR-(<I>D7Rat16-D7Mgh5</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentMedical College of Ohio, Toledo, Ohio, USAcongenic4107055SS.SR-(<I>D7Rat16-D7Rat176</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentMedical College of Ohio, Toledo, Ohio, USAcongenic4107057SS.SR-(<I>D7Mco7-D7Rat81</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentMedical College of Ohio, Toledo, Ohio, USAcongenic4107063SS.LEW-(<i>D1Uia8-D1Rat124</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW alleleDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic4107065SS.LEW-(<i>D1Uia8-D1Rat213</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW alleleDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohiocongenic2325202SS/JrSeacDahl Salt-SensitiveSubstrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1041> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio- Hypertension2325206LEW/SeacSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD JapanSeac Yoshitomi, LTD Japaninbred2325209SHRSP/HosSubstrain of SHRSP purchased from Sankyo Lab Service, Japan.Sankyo Lab Service, Japan.inbred2325754SD-<i>Pax6<sup>Sey</sup></i>Autosomal dominant mutation that arose spontaneously in SD ratsDepartment of Ophthalmology, Okayama University Medical School, Okayama, JapanmutantPax632584889450DA.PVG.1AV1-(<i>D1Rat248-D1Rat10</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb)Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic4143165SD-Tg(Aqp5-GFP)ZboroRrrcAqp5EGFPThis rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained.<a href=http://www.rrrc.us/Strain/?x=427>Rat Resource and Research Center</a>transgenicEmbryo; SpermAqp521444889464GK/OxOriginal breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UKThe Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKinbred2317791DA.PVG.1AV1-(<i>D4Got60-D4Kini1</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic4142799LEW.SS-(<i>D2Uia5-D2Rat143</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic4142800LEW.SS-(<i>D18Chm31-D18Mit8</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic4145374ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Rat98-D14Hmgc18</i>)/McwiCongenic strain developed by crossing ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/Eur (Rf-1a) males to ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi (Rf-1a+4) double congenic femalesMedical College of Wisconsin, Milwaukee, Wisconsincongenic2317820AT.ANT-(<i>D1Rat158-D1Rat228</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317822AT.ANT-(<i>D1Rat35-D1Rat38</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317825AT.ANT-(<i>D1Rat234-D1Rat35</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic2317827AT.ANT-(<i>D1Rat234-D1Rat38</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATUniversity of Colorado Denver, Coloradocongenic4145088SS.BN-(<i>D6Rat119-D6Arb3</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic4145089SS.BN-(<i>D6Rat149-D6Rat18</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic4145090SS.BN-(<i>D6Rat149-D6Got171</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic4145091SS.BN-(<i>D6Rat149-D6Arb3</i>)/McwiSS/JrHsdMcwi were crossed with SS-6<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strainMedical College of Wisconsin, Milwaukee, Wisconsincongenic4889411SHRSP.WKY-(<i>D1Smu13-D1Wox33</i>)/IzmAbout 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strainDepartment of Functional Pathology, Shimane University School of Medicine, Izumo, Japancongenic4889414WKY.SHRSP-(<i>D1Rat171-D1Wox33</i>)/IzmAbout 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(<i>D1Smu13-D1Smu11</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strainDepartment of Functional Pathology, Shimane University School of Medicine, Izumo, Japancongenic4889817SBN-Chr 1<sup>SBH</sup>/YglHomozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4889820SBH-Chr 1<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4889822SBN-Chr 17<sup>SBH</sup>/YglHomozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4889875SBH-Chr 2<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4889877SBH-Chr 20<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4889879SBH-Chr X<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4889882SBH-Chr 17<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israelconsomic4889890DA.PVG.1AV1-(<i>D17Rat8-D17Rat37</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1096> National BioResource Project for the Rat in Japan</a>congenicSpermImmunology2325143SHR/NHsdMcoSpontaneously Hypertensive RatSHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbred2325145LEW/CrlMcoLewisThese were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbred2325146MNS/NMcoMilan normotensive strainThese were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbred5130721HXB1/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131920SS-<i>Apoe<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctApoe<sup>em8Mcwi</sup>51319155131921SS-<i>Apoe<sup>em7Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctApoe<sup>em7Mcwi</sup>51319185131922SS-<i>Cdh13<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermCdh13<sup>em1Mcwi</sup>51319195144101SS-<i>Kcnq1<sup>em14Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermKcnq1<sup>em14Mcwi</sup>51440835144102ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi-<i>Asip<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat33)(D14Mit11-D14Rat33/D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAsip<sup>em1Mcwi</sup>51440995144103SS-<i>Ldlr<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermLdlr<sup>em1Mcwi</sup>51440905144104SS-<i>Ncf2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermNcf2<sup>em1Mcwi</sup>51440895144105SS-<i>Hexim2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermHexim2<sup>em4Mcwi</sup>51440955144106SS-<i>Kcnq1<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermKcnq1<sup>em9Mcwi</sup>51440765144107SS-<i>Itga9<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCGGAGCCTTCCTGTCCgacagcGTGGTTCTCCTCAGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermItga9<sup>em1Mcwi</sup>51440775144108SS-<i>Ldlr<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermLdlr<sup>em4Mcwi</sup>51440755131094BN-<i>Lx</i>/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiamutant5131095BXH13/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131097BXH12/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131099BXH11/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131101BXH10/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131104BXH9/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131106BXH8/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131108BXH6/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131110BXH5/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131113HXB31/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131115HXB29/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131118HXB27/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131120HXB26/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131122HXB25/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131124HXB23/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131126HXB20/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131128HXB17/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131130HXB15/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131963SS-<i>Nox4<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNox4<sup>em1Mcwi</sup>51314285131964SS-<i>Mstn<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMstn<sup>em3Mcwi</sup>51319625131965SS-<i>Mthfr<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermMthfr<sup>em1Mcwi</sup>51319615131966SS-<i>Plod1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermPlod1<sup>em1Mcwi</sup>51319605131132HXB13/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131134HXB10/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131136HXB7/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131138HXB4/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131140HXB3/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131142HXB2/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5131144HXB18/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.Dept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbred5143940ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/EurCongenic substrain that originated from ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic5143941ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwiTriple congenic ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur from Erasmus Medical Center, Rotterdam, Netherlands now bred and housed at Medical College of WisconsinMedical College of Wisconsin, Milwaukee, Wisconsincongenic5143942ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic5143943ACI.FHH-(<i>D14Mit11-D14Rat82</i>)/EurCongenic strain generated by using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf4 QTL region of chr 14 is introgressed in this strain.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicSperm5131932SS-<i>Cyp1a1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermCyp1a1<sup>em1Mcwi</sup>51319285131933SS-<i>Cyba<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermCyba<sup>em1Mcwi</sup>51319305131934SS-<i>Cyp1a1<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantCyp1a1<sup>em5Mcwi</sup>51319295135472ACI.BN-(<I>D5Uwm70-D5Rat32</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5135473ACI.BN-(<I>D5Uwm70-D5Got42</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5135475ACI.BN-(<I>D5Rat60-D5Rat115</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5135477ACI.BN-(<I>D5Uwm70-D5Mgh15</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5135479ACI.BN-(<I>D5Rat113-D5Rat36</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5135481ACI.BN-(<I>D5Mgh17-D5Rat98</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5144110ACI.BN-(<i>D5Mgh17-D5Mgh15</i>)/ShulThis congenic strain is developed by further genotyping ACI.BN-(<i>D5Mgh17-D5Rat205</i>)/Shul.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic4892563WF.WKY-(<i>D5Rat26-D5Uwm42</i>)/UwmWKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region.University of Wisconsin-Madisoncongenic5143984SS-<i>Plekha7<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPlekha7<sup>em1Mcwi</sup>51439785143985SS-<i>Mstn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation deletes part of exon 2 and its splice acceptor.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMstn<sup>em1Mcwi</sup>51439645143986SS-<i>Ulk3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermUlk3<sup>em1Mcwi</sup>51439685143987SS-<i>Gpr183<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermGpr183<sup>em3Mcwi</sup>51439615143988SS-<i>Gpr183<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermGpr183<sup>em2Mcwi</sup>51439555143989SS-<i>Agtrap<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermAgtrap<sup>em4Mcwi</sup>51439635143990SS-<i>Ulk3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 88-bp frameshift deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermUlk3<sup>em4Mcwi</sup>51439715143991SS-<i>Gpr183<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermGpr183<sup>em1Mcwi</sup>51439575143992SS-<i>Rasgrp3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 20-bp frameshift deletion in exon 12.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermRasgrp3<sup>em3Mcwi</sup>51439465143993SS-<i>Plcd3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPlcd3<sup>em4Mcwi</sup>51439545143994SS-<i>Plcd3<sup>em7Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPlcd3<sup>em7Mcwi</sup>51439765143995SS-<i>Plekha7<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermPlekha7<sup>em4Mcwi</sup>51439795143996SS-<i>Agtrap<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermAgtrap<sup>em8Mcwi</sup>51439705131950SS-<i>Msra<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMsra<sup>em3Mcwi</sup>51319455131951SS-<i>Prokr1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 126-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermProkr1<sup>em2Mcwi</sup>51319475131952SS-<i>Mas1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermMas1<sup>em1Mcwi</sup>51319465131953SS-<i>Prokr1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermProkr1<sup>em1Mcwi</sup>51319485131954SS-<i>Mstn<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantMstn<sup>em2Mcwi</sup>51319495134951WF.COP-(<i>D7Rat39-D7Uwm12</i>)/1UwmChromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic backgroundUniversity of Wisconsin, Madison, Wisconsin, USAcongenic5134953WF.COP-(<i>D7Rat39-D7Uwm12</i>)/2UwmChromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic backgroundUniversity of Wisconsin, Madison, Wisconsin, USAcongenic5131987SS-<i>Tgfb1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantTgfb1<sup>em1Mcwi</sup>51319865131988SS-<i>Wdr72<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 5-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermWdr72<sup>em2Mcwi</sup>51319785131989SS-<i>Tgfb1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermTgfb1<sup>em3Mcwi</sup>51319805131990SS-<i>Slc30a8<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSlc30a8<sup>em2Mcwi</sup>51319815131991SS-<i>Slc30a8<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSlc30a8<sup>em1Mcwi</sup>51319795135031BN.MES-<i>Cyba</i>/Snamutant Cyba gene from the MES/Slc strain is introduced into the background of BN/SsNSlc by standard procedures with seven backcrosses to BN/SsNSlcDepartment of Aging Biology, Institute on Aging and Adaptation, Shinshu University, Matsumoto, Japancongenic5131910SS-<i>Acad10<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAcad10<sup>em2Mcwi</sup>51319055131911SS-<i>Alms1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAlms1<sup>em1Mcwi</sup>51319065131912SS-<i>Aldh2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAldh2<sup>em2Mcwi</sup>51319075131974SS-<i>Rasgrp3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermRasgrp3<sup>em1Mcwi</sup>51319685131975SS-<i>Ptpn11<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPtpn11<sup>em1Mcwi</sup>51319705131976SS-<i>Ptpn11<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPtpn11<sup>em4Mcwi</sup>51319695134683WF.WKY-(<i>D7Rat171-D7Rat128</i>)/1UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundUniversity of Wisconsin, Madison, Wisconsin, USAcongenic5134685WF.WKY-(<i>D7Rat171-D7Rat128</i>)/2UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundUniversity of Wisconsin, Madison, Wisconsin, USAcongenic5134687WF.WKY-(<i>D7Rat51-D7Rat128</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundUniversity of Wisconsin, Madison, Wisconsin, USAcongenic5134689WF.WKY-(<i>D7Uwm25-D7Rat128</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundUniversity of Wisconsin, Madison, Wisconsin, USAcongenic5134692WF.WKY-(<i>D7Rat171-D7Rat45</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundUniversity of Wisconsin, Madison, Wisconsin, USAcongenic5685369SS-<i>Agtr1a<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermAgtr1a<sup>em1Mcwi</sup>55083315686300SS-<i>Adra2a<sup>em1Mcwi-/-</sup></i>SS-<i>Adra2a<sup>em1Mcwi-</sup>/Adra2a<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686302SS-<i>Adra2a<sup>em1Mcwi+/+</sup></i>SS-<i>Adra2a<sup>em1Mcwi+</sup>/Adra2a<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686304SS-<i>Agtrap<sup>em4Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em4Mcwi-</sup>/Agtrap<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686306SS-<i>Agtrap<sup>em4Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em4Mcwi+</sup>/Agtrap<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686652SS-<i>Agtr1a<sup>em1Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em1Mcwi-</sup>/Agtr1a<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688090FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+/+</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+</sup>/Rab38<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688092SS-<i>Rag1<sup>em1Mcwi-/-</sup></i>SS-<i>Rag1<sup>em1Mcwi-</sup>/Rag1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688094SS-<i>Rag1<sup>em1Mcwi+/+</sup></i>SS-<i>Rag1<sup>em1Mcwi+</sup>/Rag1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688096SS-<i>Rag1<sup>em2Mcwi-/-</sup></i>SS-<i>Rag1<sup>em2Mcwi-</sup>/Rag1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5509988SS-<i>Nppb<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermNppb<sup>em4Mcwi</sup>55099795509989SS-<i>Msra<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 1-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMsra<sup>em4Mcwi</sup>55099775509990SS-<i>Cyp1a1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 188-bp deletion encompassing exon 4<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermCyp1a1<sup>em2Mcwi</sup>55099765509991SS-<i>Mylip<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMylip<sup>em2Mcwi</sup>55083335509992SS-<i>Ube2q2<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermUbe2q2<sup>em3Mcwi</sup>55099875509993SS-<i>Tcf7l2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGAAGCCTCCAGAGCagacaaGCCCTCAAGGATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 169-bp deletion of exon5 and intron 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermTcf7l2<sup>em1Mcwi</sup>55099815509994SS-<i>Sh2b3<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermSh2b3<sup>em2Mcwi</sup>55099825509995SS-<i>Adra2a<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAdra2a<sup>em1Mcwi</sup>55099865509996SS-<i>Stk39<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctStk39<sup>em2Mcwi</sup>55099785509997SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctNckap5<sup>em4Mcwi</sup>55099755686764SS-<i>Plod1<sup>em1Mcwi+/+</sup></i>SS-<i>Plod1<sup>em1Mcwi+</sup>/Plod1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686766SS-<i>Sh2b3<sup>em2Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em2Mcwi-</sup>/Sh2b3<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686768SS-<i>Slc30a8<sup>em1Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em1Mcwi-</sup>/Slc30a8<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686770SS-<i>Slc30a8<sup>em1Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em1Mcwi+</sup>/Slc30a8<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686772SS-<i>Slc30a8<sup>em2Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em2Mcwi-</sup>/Slc30a8<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5490515FHH.BN(<i>D1Rat265-D1Rat76</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicExtinct5490516FHH.BN(<i>D14Rat80-D14Hmgc4</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicLive Animals; Sperm5490517FHH.BN(<i>D14Rat78-D14Hmgc4</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicLive Animals; Sperm5687974SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctCyp4a2<sup>em1Mcwi</sup>56877245688098SS-<i>Rag1<sup>em2Mcwi+/+</sup></i>SS-<i>Rag1<sup>em2Mcwi+</sup>/Rag1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant6478791F344-Tg(UBC-EGFP)F455RrrcThis transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. Animals that exhibited fluorescence of tails were mated. Offspring were bred with Lewis wild-type mates to map transgene location. Animals were backcrossed 10 generations onto F344.<a href=http://www.rrrc.us/Strain/?x=307>Rat Resource and Research Center</a>transgenicLive Animals; Embryo; Sperm6480190NAft:HSHeterogeneous stockFrom Dr. Eva Redei, Center for Comparative Medicine, Northwestern University to Dr. Alberto Fernandez-Teruel, BarcelonaPsychiatry and Forensic Medicine, Institute of Neurosciences, School of Medicine, Autonomous University of Barcelona, Barcelona, Spainoutbred6480205MWF-Chr 6<sup>SHR</sup> Chr 8<sup>SHR</sup>/RkbChr 8 and chr 6 were introgressed from albuminuria-resistant SHR/FubRkb into the sensitive isogenic background of MWF/FubRkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germanyconsomic6480210SHR-Chr 8<sup>MWF</sup>/RkbSHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germanyconsomic6480218AR-<i>Ednrb<sup>Sl</i>Hkv</sup>Aganglionosis ratCongenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR), provided to Dr. Takashi Agui by Dr. Ozaki, National Institute for Physiological Sciences, Okazaki, JapanDepartment of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, JapanmutantEdnrb25366480220LE-<i>Ednrb<sup>Sl</i>Hkv</sup>Aganglionosis rat<i>Ednrb<sup>Sl</sup></i> mutation from Aganglionosis Rat (AR) was introgressed into a closed colony of Long-Evans ratsDepartment of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, JapancongenicEdnrb25366480223F344-<i>Ednrb<sup>Sl</i>Hkv</sup>Aganglionosis ratgenerated by backcrossing original aganglionosis rats to F344 from SLC (Hamamatsu, Japan) for more than 10 generationsDepartment of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, JapancongenicEdnrb25366480863BBDR/RhwRrrcBBDR/Rhw from R. H. William Laboratory, University of Washington, Seattle, Washington to Rat Resource & Research Center<a href=http://www.rrrc.us/Strain/?x=463>Rat Resource & Research Center</a>inbredEmbryo; Sperm6480866BN-Chr 13<sup>LH</sup>/MavRrrcChr 13 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedLaboratoire de Physiologie, Lyon Cedex , France, <a href=http://www.rrrc.us/Strain/?x=395>Rat Resource & Research Center</a>consomicEmbryo; Sperm6480868BN-Chr 2<sup>LH</sup>/MavRrrcChr 2 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedLaboratoire de Physiologie, Lyon Cedex , France, <a href=http://www.rrrc.us/Strain/?x=396>Rat Resource & Research Center</a>consomicEmbryo; Sperm6480874COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoRrrcMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. Transferred from Medical College of Toledo to Rat Resource & Research Center<a href=http://www.rrrc.us/Strain/?x=444>Rat Resource & Research Center</a>congenicEmbryo; Sperm5686776SS-<i>Slc30a8<sup>em2Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em2Mcwi+</sup>/Slc30a8<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686778SS-<i>Stk39<sup>em2Mcwi-/-</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686780SS-<i>Stk39<sup>em2Mcwi+/+</sup></i>SS-<i>Stk39<sup>em2Mcwi+</sup>/Stk39<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686782SS-<i>Stk39<sup>em2Mcwi-/+</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686784SS-<i>Tcf7l2<sup>em1Mcwi-/-</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686786SS-<i>Tcf7l2<sup>em1Mcwi+/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi+</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686788SS-<i>Tcf7l2<sup>em1Mcwi-/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686790SS-<i>Ulk3<sup>em1Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686792SS-<i>Ulk3<sup>em1Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi+</sup>/Ulk3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686794SS-<i>Ulk3<sup>em1Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686797SS-<i>Wdr72<sup>em1Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em1Mcwi-</sup>/Wdr72<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686799SS-<i>Wdr72<sup>em1Mcwi+/+</sup></i>SS-<i>Wdr72<sup>em1Mcwi+</sup>/Wdr72<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant6482243WI-<i>Cit<sup>fh</i></sup>JjloRrrcflathead ratFlathead rat was discovered at University of in an inbred colony of Wistar ratsDepartment of Physiology and Neurobiology, University of Connecticut, <a href=http://www.rrrc.us/Strain/?x=322>Rat Resource and Research Center</a>mutantEmbryo; Sperm6482244SS-Tg(APOA1)116OpazRrrcSS/JrHsd embryos were microinjected with human APOA1 C3 promoterWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, <a href=http://www.rrrc.us/Strain/?x=282>Rat Resource and Research Center</a>transgenicEmbryo; Sperm6482245SS-Tg(alpha1NK)24OpazRrrcSS/JrHsd embryos were microinjected with rat alpha1 Na,K-ATPase promoter (-1288 5 flanking regulatory region isolated from Sprague Dawley genomic library)Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, <a href=http://www.rrrc.us/Strain/?x=280>Rat Resource and Research Center</a>transgenicEmbryo; Sperm6482247FDIO/RrrcCross between F344 (lean phenotype) and SDDIO (diet-induced obese phenotype) then inbred for 6 generations with maintenance of obese phenotype.<a href=http://www.rrrc.us/Strain/?x=60>Rat Resource and Research Center</a>inbredEmbryo; Sperm6482252F344-Tg(Pgk1-EGFP)/RrrcMultiple random integration of EGFP gene under the control of the PGK promoter.<a href=http://www.rrrc.us/Strain/?x=53>Rat Resource and Research Center</a>transgenicEmbryo; Sperm6482254Gunn-<i>Ugt1a1</i><sup>jBluHsdRrrc</sup>Gunn ratThis mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.<a href=http://www.harlan.com/strain%20details/rats/gunn.html>Harlan </a>, <a href=http://www.rrrc.us/Strain/?x=341>Rat Resource and Research Center</a>mutantLive Animals; Embryo; Sperm6482256HS/RrrcHigh Self-AdministrationDeveloped from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.<a href=http://www.rrrc.us/Strain/?x=523>Rat Resource and Research Center</a>inbredCryopreserved6482259LS/RrrcLow Self-AdministrationDeveloped from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.<a href=http://www.rrrc.us/Strain/?x=522>Rat Resource and Research Center</a>inbredCryopreserved6482268RrrcHsdBlu:BRAT-<i>Avp<sup>di</i></sup>BrattleboroBrattleboro rats transferred to the RRRC in 2009.<a href=http://www.rrrc.us/Strain/?x=445>Rat Resource and Research Center</a>mutantLive Animals; Embryo; Sperm6482271LEW.Cg-<i>Foxn1</i><sup>rnu</sup>/NRrrcThe NIH nude rat was developed in 1979-1980 at the NIH through a series of matings involving the following inbred rat strains: BN/SsN, MR/N, BUF/N, WN/N, ACI/N, WKY/N, M520/N, and F344/N. Received from the National Institute of Health by NCI in 1983. The nude mutation was subsequently backcrossed 17 generations to the Lewis inbred strain.<a href=http://www.rrrc.us/Strain/?x=363>Rat Resource and Research Center</a>congenicEmbryo; Sperm6482282LEW-Tg(EGFP)463-5RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promoter<a href=http://www.rrrc.us/Strain/?x=83>Rat Resource and Research Center</a>transgenicSperm6482284LEW-Tg(EGFP)456-9RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promoter<a href=http://www.rrrc.us/Strain/?x=84>Rat Resource and Research Center</a>transgenicSperm6482286LEW-Tg(EGFP)458-7RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promoter<a href=http://www.rrrc.us/Strain/?x=86>Rat Resource and Research Center</a>transgenicEmbryo; Sperm6482288LEW-Tg(EGFP)463-1RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promoter<a href=http://www.rrrc.us/Strain/?x=85>Rat Resource and Research Center</a>transgenicSperm6482290LEW-Tg(EGFP)455RrrcLewis- GFP transgenicThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos.<a href=http://www.rrrc.us/Strain/?x=62>Rat Resource and Research Center</a>transgenicEmbryo; Sperm6482292LEW-Tg(Gt(ROSA)26Sor-lacZ)15JmskThis strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.<a href=http://www.rrrc.us/Strain/?x=297>Rat Resource and Research Center</a>transgenicEmbryo6482294LH-Chr 13<sup>BN</sup>/MavRrrcChr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped<a href=http://www.rrrc.us/Strain/?x=393>Rat Resource and Research Center</a>consomicEmbryo; Sperm6482296LH-Chr 17<sup>BN</sup>/MavRrrcChr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped<a href=http://www.rrrc.us/Strain/?x=394>Rat Resource and Research Center</a>consomicEmbryo; Sperm5687969ACI.BN-(<i>D2Rat251-D2Mgh3</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5687971ACI.BN-(<i>D2Rat10-D2Rat202</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5687973ACI.BN-(<i>D18Rat30-D18Rat89</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 18 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5687975SS-<i>Prex1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGTACTTCCGCTTCcatgcgGACGAGGAGATGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 16.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPrex1<sup>em2Mcwi</sup>56877195688396ACI.BN-(<i>D3Rat80-D3Rat3</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 3 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5688400ACI.BN-(<i>D4Rat5-D4Got131</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 4 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5688402ACI.BN-(<i>D6Rat148-D6Rat109</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 6 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5688405ACI.COP-(<i>D5Rat12-D5Rat205</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5688407ACI.COP-(<i>D5Rat28-D5Rat205</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5688409ACI.COP-(<i>D5Rat28-D5Rat36</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic6218997SHR/NCrlAnraThese were originally from Harvard University, Boston MA, then at UNESP, Botucatu, SP, Brazil, now maintained at Behavior Genetics Laboratory, SC, BrazilBehavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, Brazilinbred6219002LEW/HsdUnibAnraLEW rats originally from Harlan Sprague Dawley, IN then bred at UNICAMP (Campinas, SP Brazil) now maintained at Behavior Genetics Laboratory, SC, BrazilBehavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, Brazilinbred6478788STOCK-<i>Tp53<sup>tm1(EGFP-Pac)</sup>QlyRrrc</i>p53 knockout ratThis strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5 prime and 1.6- kb 3 prime homology arms and a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting F344 blastocysts. Founder animals were mated with SD rats.<a href=http://www.rrrc.us/Strain/?x=521>Rat Resource and Research Center</a>mutantEmbryo; SpermTp5338896482298MWF/ZtmRrrcMunich Wistar FromterFrom outbred Wistar rats selected for large numbers of superficial glomeruli.<a href=http://www.rrrc.us/Strain/?x=504>Rat Resource and Research Center</a>inbredEmbryo; Sperm5688100SS-<i>Ren<sup>em1Mcwi+/+</sup></i>SS-<i>Ren<sup>em1Mcwi+</sup>/Ren<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688102SS-<i>Ren<sup>em1Mcwi-/-</sup></i>SS-<i>Ren<sup>em1Mcwi-</sup>/Ren<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant6482643WIN/RhwRrrcSubmitted to Rat Resource & Research Center<a href=http://www.rrrc.us/Strain/?x=481>Rat Resource and Research Center</a>inbredEmbryo; Sperm6482645SD-Tg(S334ter)3LavRrrcThis transgenic strain carries a mouse opsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Submitted to Rat Resource & Research Center<a href=http://www.rrrc.us/Strain/?x=525>Rat Resource and Research Center</a>transgenicLive Animals; Embryo; Sperm6482654ACI.BN-(<i>D7Rat36-D7Rat11</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic6482674HIS/NdkRrrcHigh-Saccharin-Consuming (HiS) RatThe Occidental HiS (high-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that voluntarily consumed high levels of saccharin.This male was mated to several Holtzman Sprague-Dawley females and offspring displaying high saccharin consumption were selected. Selective breeding was continued in which offspring with high saccharin consumption were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.<a href=http://www.rrrc.us/Strain/?x=366>Rat Resource and Research Center</a>inbredEmbryo; Sperm6482676LOS/NdkRrrcLow-Saccharin-Consuming (HiS) RatThe Occidental LoS (low-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that did not voluntarily consume saccharin. This male was mated to several Holtzman Sprague-Dawley females and offspring displaying low saccharin consumption were selected. Selective breeding was continued in which offspring with low saccharin consumption (see phenotyping protocol) were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.<a href=http://www.rrrc.us/Strain/?x=440>Rat Resource and Research Center</a>inbredEmbryo; Sperm6482680SD-Tg(MMTV-Esrrb)1UwmRrrcHsd:SD background carrying a transgene which produces over-expression of the rat Esrbb proto-oncogene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat.<a href=http://www.rrrc.us/Strain/?x=365>Rat Resource and Research Center</a>transgenicEmbryo; Sperm6483453SS-<i>Dguok<sup>em2Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)Medical College of Wisconsin, Milwaukee WImutantLive Animals; SpermDguok<sup>em2Mcwi</sup>55083546483454SS-<i>Dguok<sup>em1Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105)Medical College of Wisconsin, Milwaukee WImutantLive AnimalsDguok<sup>em1Mcwi</sup>55083456483455SS-<i>Dguok<sup>em3Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc)Medical College of Wisconsin, Milwaukee WImutantSpermDguok<sup>em3Mcwi</sup>55083252303759WT/Jttwhitish teeth ratIn 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=476 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermDentistry6484519SS-<i>Rosa26<sup>em1(SB11)Mcwi</sup></i>This strain was produced by ZFN-stimulated knockin in the rat Rosa26 locus. ZFNs targeting the sequence CCTTCCCCCTTCTTCcctcgtGATCTGCAACTGGAGTCT were injected into SS/JrHsdMcwi rat embryos along with a plasmid template incorporating the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA, and SV40 polyadenylation signal to integrate the transgene by homologous recombination. The resulting animal was confirmed by sequencing both junctions to harbor the SB11 gene knocked into the rat locus and expresses SB11 transposase in every cell by immunohistochemistry.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantRosa26<sup>em1(SB11)Mcwi</sup>64845186484559SS-<i>Slc34a1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGTGCTCAGCTCTGCCTTccaactGGCCGGAGGTAGGGCCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSlc34a1<sup>em1Mcwi</sup>56876995508356SS-<i>Gucy1a3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctGucy1a3<sup>em1Mcwi</sup>55083515508357SS-<i>Tfdp2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermTfdp2<sup>em2Mcwi</sup>55083325508358SS-<i>Wdr72<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 3 and intron 3<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermWdr72<sup>em1Mcwi</sup>55083275508359SS-<i>Prune<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPrune<sup>em3Mcwi</sup>55083485508360SS-<i>Dguok<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCGGTTCCTTCTGCgtagacTCCGAGCGTCTTTCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermDguok<sup>em4Mcwi</sup>55083235508361SS-<i>Bcas3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCTGTACTCACttcgtACGGGGGAGATGGTCAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 9.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermBcas3<sup>em4Mcwi</sup>55083295508362SS-<i>Ncf2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNcf2<sup>em4Mcwi</sup>55083425508363SS-<i>Sorcs2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACATCAGCTTCCGCTCTgactggGAGCTGGTCAAGGTGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 15.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSorcs2<sup>em4Mcwi</sup>55083265508364SS-<i>Prune<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPrune<sup>em1Mcwi</sup>55083415508365SS-<i>Agtr1a<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAgtr1a<sup>em5Mcwi</sup>55083185508366SS-<i>Tfdp2<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctTfdp2<sup>em5Mcwi</sup>55083345508367SS-<i>Ulk4<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACCTTGTAGCTACccaggtGAGGCTGTCTGATGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 15 and intron 15<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermUlk4<sup>em3Mcwi</sup>55083405508368SS-<i>Trafd1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTGGTGCCCGGACagagcTGTGTGGCAGCTGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermTrafd1<sup>em1Mcwi</sup>55083525508369SS-<i>Myadml2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMyadml2<sup>em1Mcwi</sup>55083175508370SS-<i>Nppb<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNppb<sup>em2Mcwi</sup>55083245508371SS-<i>Mylip<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctMylip<sup>em3Mcwi</sup>55083365688087FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-/-</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-</sup>/Rab38<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant6483846HsdFcen:WIWistarDescendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan and now maintained at School of Science, Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, ArgentinaBuenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, Argentinaoutbred6484560SS-<i>Pdc<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPdc<sup>em2Mcwi</sup>56876956484561SS-<i>Comt<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTTCCAGGTCACCATCctcaatGGGGCATCCCAGGATCTT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermComt<sup>em1Mcwi</sup>56877256484562SS-<i>Fgf5<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermFgf5<sup>em1Mcwi</sup>56877206484563SS-<i>Cst3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermCst3<sup>em3Mcwi</sup>56877386484564SS-<i>Cd247<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermCd247<sup>em3Mcwi</sup>56877306484565SS-<i>Ldlr<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLdlr<sup>em3Mcwi</sup>51440826484566SS-<i>Slc6a12<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTCCCTCTCCAGTatggacAGAAAGGTTACAGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion overlapping exon 2<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSlc6a12<sup>em1Mcwi</sup>56877366484567FHH-Chr 1<sup>BN</sup>-<i>Sorcs3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCCCGCTCCATTGAcatcagtTCCCTGGTCGTCCAGGAT into FHH-Chr 1BN/Mcwi rat embryos. The resulting mutation is a 33-bp insertion in exon 7<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSorcs3<sup>em1Mcwi</sup>56877316484568SS-<i>Cd247<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctCd247<sup>em5Mcwi</sup>56877136484569SS-<i>Adora2b<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 114-bp deletion in exon 1<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAdora2b<sup>em1Mcwi</sup>56877296484570SS-<i>Stc1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGCTGCCCAATCACttctccAACAGGTATCCTGAGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermStc1<sup>em2Mcwi</sup>56877226484571SS-<i>Myadml2<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMyadml2<sup>em5Mcwi</sup>56877266484572SS-<i>Fgf5<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermFgf5<sup>em5Mcwi</sup>56877276484573SS-<i>Clcn6<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermClcn6<sup>em2Mcwi</sup>56877405683886SS-Chr 12<sup>BN</sup>.SS-(<i>D12Arb13-D12Mit2</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.Medical College of Wisconsin, Milwaukee, Wisconsincongenic5683888SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Rat79</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.Medical College of Wisconsin, Milwaukee, Wisconsincongenic5683890SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.Medical College of Wisconsin, Milwaukee, Wisconsincongenic5686826ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1, Rf-3 QTL region of chr 3, and Rf4 QTL region of chr 14 are introgressed in this strain.Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlandscongenic5686829ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat6-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.Medical College of Wisconsin, Milwaukee, Wisconsincongenic5686832ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Got102-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.Medical College of Wisconsin, Milwaukee, Wisconsincongenic5687977SS-<i>Acad10<sup>em2Mcwi+/+</sup></i>SS-<i>Acad10<sup>em2Mcwi+</sup>/Acad10<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5687979SS-<i>Acad10<sup>em2Mcwi-/-</sup></i>SS-<i>Acad10<sup>em2Mcwi-</sup>/Acad10<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5687981SS-<i>Alms1<sup>em1Mcwi-/-</sup></i>SS-<i>Alms1<sup>em1Mcwi-</sup>/Alms1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5687983SS-<i>Alms1<sup>em1Mcwi+/+</sup></i>SS-<i>Alms1<sup>em1Mcwi+</sup>/Alms1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5687985SS-<i>Apoe<sup>em7Mcwi+/+</sup></i>SS-<i>Apoe<sup>em7Mcwi+</sup>/Apoe<sup>em7Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinct5687987SS-<i>Apoe<sup>em7Mcwi-/-</sup></i>SS-<i>Apoe<sup>em7Mcwi-</sup>/Apoe<sup>em7Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinct5508380SS-Tg(T2ONC)2McwiThese rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>transgenicSperm5508381SS-Tg(T2ONC)1McwiThese rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>transgenicSperm5686670SS-<i>Cdh13<sup>em1Mcwi+/+</sup></i>SS-<i>Cdh13<sup>em1Mcwi+</sup>/Cdh13<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686672SS-<i>Cyp1a1<sup>em1Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi-</sup>/Cyp1a1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686676SS-<i>Cyp1a1<sup>em1Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi+</sup>/Cyp1a1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686678SS-<i>Cyp1a1<sup>em2Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi-</sup>/Cyp1a1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686680SS-<i>Cyp1a1<sup>em2Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi+</sup>/Cyp1a1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686684SS-<i>Cyp1a1<sup>em5Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi-</sup>/Cyp1a1<sup>em5Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686687SS-<i>Cyp1a1<sup>em5Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi+</sup>/Cyp1a1<sup>em5Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686689SS-<i>Prokr1<sup>em1Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em1Mcwi-</sup>/Prokr1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686692SS-<i>Prokr1<sup>em1Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em1Mcwi+</sup>/Prokr1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686695SS-<i>Prokr1<sup>em2Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em2Mcwi-</sup>/Prokr1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686697SS-<i>Prokr1<sup>em2Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em2Mcwi+</sup>/Prokr1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5687989SS-<i>Apoe<sup>em8Mcwi-/-</sup></i>SS-<i>Apoe<sup>em8Mcwi-</sup>/Apoe<sup>em8Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinct5687992SS-<i>Apoe<sup>em8Mcwi+/+</sup></i>SS-<i>Apoe<sup>em8Mcwi+</sup>/Apoe<sup>em8Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinct5687994SS-<i>Bcas3<sup>em4Mcwi+/+</sup></i>SS-<i>Bcas3<sup>em4Mcwi+</sup>/Bcas3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5687996SS-<i>Bcas3<sup>em4Mcwi-/-</sup></i>SS-<i>Bcas3<sup>em4Mcwi-</sup>/Bcas3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5687998SS-<i>Cyba<sup>em1Mcwi-/-</sup></i>SS-<i>Cyba<sup>em1Mcwi-</sup>/Cyba<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688000SS-<i>Cyba<sup>em1Mcwi+/+</sup></i>SS-<i>Cyba<sup>em1Mcwi+</sup>/Cyba<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688002SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinct5688004SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/-</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinct5688006SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinct5688008SS-<i>Ets1<sup>em1Mcwi+/+</sup></i>SS-<i>Ets1<sup>em1Mcwi+</sup>/Ets1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688010SS-<i>Ets1<sup>em1Mcwi-/+</sup></i>SS-<i>Ets1<sup>em1Mcwi-</sup>/Ets1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686700SS-<i>Kcnq1<sup>em14Mcwi-/-</sup></i>SS-<i>Kcnq1<sup>em14Mcwi-</sup>/Kcnq1<sup>em14Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686702SS-<i>Kcnq1<sup>em14Mcwi+/+</sup></i>SS-<i>Kcnq1<sup>em14Mcwi+</sup>/Kcnq1<sup>em14Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686704SS-<i>Msra<sup>em3Mcwi-/-</sup></i>SS-<i>Msra<sup>em3Mcwi-</sup>/Msra<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686706SS-<i>Msra<sup>em3Mcwi+/+</sup></i>SS-<i>Msra<sup>em3Mcwi+</sup>/Msra<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686708SS-<i>Msra<sup>em4Mcwi-/-</sup></i>SS-<i>Msra<sup>em4Mcwi-</sup>/Msra<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686710SS-<i>Msra<sup>em4Mcwi+/+</sup></i>SS-<i>Msra<sup>em4Mcwi+</sup>/Msra<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686713SS-<i>Mstn<sup>em1Mcwi-/-</sup></i>SS-<i>Mstn<sup>em1Mcwi-</sup>/Mstn<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686715SS-<i>Mstn<sup>em1Mcwi+/+</sup></i>SS-<i>Mstn<sup>em1Mcwi+</sup>/Mstn<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686718SS-<i>Mstn<sup>em3Mcwi-/-</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686721SS-<i>Mstn<sup>em3Mcwi+/+</sup></i>SS-<i>Mstn<sup>em3Mcwi+</sup>/Mstn<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686723SS-<i>Mstn<sup>em3Mcwi-/+</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686725SS-<i>Nppa<sup>em4Mcwi-/-</sup></i>SS-<i>Nppa<sup>em4Mcwi-</sup>/Nppa<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688012SS-<i>Gpr183<sup>em1Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em1Mcwi-</sup>/Gpr183<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688014SS-<i>Gpr183<sup>em1Mcwi+/+</sup>SS-<i>Gpr183<sup>em1Mcwi+</sup>/Gpr183<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688016SS-<i>Gpr183<sup>em2Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em2Mcwi-</sup>/Gpr183<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688018SS-<i>Gpr183<sup>em2Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em2Mcwi+</sup>/Gpr183<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688020SS-<i>Gpr183<sup>em3Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em3Mcwi-</sup>/Gpr183<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688022SS-<i>Gpr183<sup>em3Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em3Mcwi+</sup>/Gpr183<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688024SS-<i>Itga9<sup>em1Mcwi+/+</sup></i>SS-<i>Itga9<sup>em1Mcwi+</sup>/Itga9<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688026SS-<i>Mas1<sup>em1Mcwi+/+</sup></i>SS-<i>Mas1<sup>em1Mcwi+</sup>/Mas1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688028SS-<i>Mas1<sup>em1Mcwi-/-</sup></i>SS-<i>Mas1<sup>em1Mcwi-</sup>/Mas1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688030SS-<i>Mmp2<sup>em1Mcwi-/-</sup></i>SS-<i>Mmp2<sup>em1Mcwi-</sup>/Mmp2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688032SS-<i>Mmp2<sup>em1Mcwi+/+</sup></i>SS-<i>Mmp2<sup>em1Mcwi+</sup>/Mmp2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688034SS-<i>Mmp2<sup>em2Mcwi-/-</sup></i>SS-<i>Mmp2<sup>em2Mcwi-</sup>/Mmp2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5508392HsdHlr:ZUC-<i>Lepr</i><sup>fa</sup>Derived from a colony obtained in 1992<a href =http://www.harlan.com/models/aci.asp> Harlan</a>outbred5508393BN/RijHsdThese were derived from a nucleus colony obtained directly from the TNO Institute, the Netherlands now available at Harlan.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/brown_norway_inbred_rat.hl> Harlan</a>inbred5508394FBNF1/HsdOffspring of a cross between the F344/NHsd inbred female<a href =http://www.harlan.com/models/aci.asp> Harlan</a>hybrid5508395Hsd:RH-<i>Foxn1</i><sup>rnu</sup>Athymic NudeDerived from animals obtained from the Rowett Research Institute, Aberdeen, Scotland.<a href =http://www.harlan.com/models/aci.asp> Harlan</a>outbred5508396RccHan:WISTDerived at Biological Research Laboratories Limited (BRL), formerly RCC, now Harlan Laboratories Ltd., Fullinsdorf, Switzerland from original colony at Zentralinstitute fur Versuchstierzucht, Hannover in 1989. Transferred to Harlan Sprague-Dawley, Inc.,<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/wistar_han_aged_outbred_rat.hl> Harlan</a>outbred5508397HsdHot:SDSprague DawleyOriginally developed by the Holtzman Company in Madison, Wisconsin, from Sprague Dawley stock in 1947; to Harlan through acquisition in 1986.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/holtzman_outbred_rat.hl> Harlan</a>outbred5508398HsdBlu:LELong Evans (Blue Spruce)From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988.<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/long_evans_blue_spruce_outbred_rat.hl> Harlan</a>outbred5529230ACI.FHH-(<i>D1Hmgc16-D1Rat225</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicSperm5529529ACI.FHH-(<i>D1Hmgc1-D1Hmgc19</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicSperm5529731ACI.FHH-(<i>D1Hmgc20-D1Hmgc21</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicSperm5686308SS-<i>Hexim2<sup>em4Mcwi-/-</sup></i>SS-<i>Hexim2<sup>em4Mcwi-</sup>/Hexim2<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686311SS-<i>Hexim2<sup>em4Mcwi+/+</sup></i>SS-<i>Hexim2<sup>em4Mcwi+</sup>/Hexim2<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686314SS-<i>Rasgrp3<sup>em1Mcwi-/-</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi-</sup>/Rasgrp3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686316SS-<i>Rasgrp3<sup>em1Mcwi+/+</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi+</sup>/Rasgrp3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686654SS-<i>Agtr1a<sup>em1Mcwi+/+</sup></i>SS-<i>Agtr1a<sup>em1Mcwi+</sup>/Agtr1a<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686657SS-<i>Agtr1a<sup>em5Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em5Mcwi-</sup>/Agtr1a<sup>em5Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686659SS-<i>Agtrap<sup>em8Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em8Mcwi-</sup>/Agtrap<sup>em8Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686662SS-<i>Agtrap<sup>em8Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em8Mcwi+</sup>/Agtrap<sup>em8Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686664SS-<i>Aldh2<sup>em2Mcwi-/-</sup></i>SS-<i>Aldh2<sup>em2Mcwi-</sup>/Aldh2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686666SS-<i>Aldh2<sup>em2Mcwi+/+</sup></i>SS-<i>Aldh2<sup>em2Mcwi+</sup>/Aldh2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686668SS-<i>Cdh13<sup>em1Mcwi-/-</sup></i>SS-<i>Cdh13<sup>em1Mcwi-</sup>/Cdh13<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688037SS-<i>Mmp2<sup>em2Mcwi+/+</sup></i>SS-<i>Mmp2<sup>em2Mcwi+</sup>/Mmp2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688039SS-<i>Mthfr<sup>em1Mcwi+/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi+</sup>/Mthfr<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688041SS-<i>Mthfr<sup>em1Mcwi-/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi-</sup>/Mthfr<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688043SS-<i>Nckap5<sup>em1Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em1Mcwi-</sup>/Nckap5<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688045SS-<i>Nckap5<sup>em1Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em1Mcwi+</sup>/Nckap5<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5508304WUN-<i>Abcc2<sup>TR-</i></sup>/HsdRrrcSpontaneous mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC).<a href=http://www.rrrc.us/Strain/?x=442>Rat Resource and Research Center</a>mutantEmbryo; SpermAbcc223665508305F344-WUN-<i>Abcc2<sup>TR-</i></sup>Dpp4<sup>DPPIV-</i></sup>/DchcHsdRrrcThe DPP4 mutant rat was a spontaneous mutation in Fischer 344 rats, which caused a deficiency in DPPIV, was identified by Dr. Douglas C. Hixson at Rhode Island Hospital.<a href=http://www.rrrc.us/Strain/?x=443>Rat Resource and Research Center</a>mutantEmbryo; SpermDpp425155686318SS-<i>Sh2b3<sup>em1Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686320SS-<i>Sh2b3<sup>em1Mcwi+/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi+</sup>/Sh2b3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686322SS-<i>Sh2b3<sup>em1Mcwi-/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686326SS-<i>Ulk3<sup>em4Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686328SS-<i>Ulk3<sup>em4Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi+</sup>/Ulk3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686330SS-<i>Ulk3<sup>em4Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686332SS-<i>Wdr72<sup>em2Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em2Mcwi-</sup>/Wdr72<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686335SS-</i>Wdr72<sup>em2Mcwi+/+</sup></i>SS-</i>Wdr72<sup>em2Mcwi+</sup>/Wdr72<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686728SS-Nppa<sup>em4Mcwi+/+</sup>SS-Nppa<sup>em4Mcwi+</sup>/Nppa<sup>em4Mcwi+</sup>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686730SS-Nppb<sup>em2Mcwi-/-</sup>SS-Nppb<sup>em2Mcwi-</sup>/Nppb<sup>em2Mcwi-</sup>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686732SS-Nppb<sup>em2Mcwi+/+</sup>SS-Nppb<sup>em2Mcwi+</sup>/Nppb<sup>em2Mcwi+</sup>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688047SS-<i>Nckap5<sup>em2Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em2Mcwi-</sup>/Nckap5<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688049SS-<i>Nckap5<sup>em2Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em2Mcwi+</sup>/Nckap5<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688051SS-<i>Nckap5<sup>em3Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em3Mcwi-</sup>/Nckap5<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688053SS-<i>Nckap5<sup>em3Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em3Mcwi+</sup>/Nckap5<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688059SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/-</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688061SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+</sup>/Nckap5<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688063SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688066SS-<i>Ncf2<sup>em1Mcwi-/-</sup></i>SS-<i>Ncf2<sup>em1Mcwi-</sup>/Ncf2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688069SS-<i>Ncf2<sup>em1Mcwi+/+</sup></i>SS-<i>Ncf2<sup>em1Mcwi+</sup>/Ncf2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688074SS-<i>Nox4<sup>em2Mcwi-/-</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688077SS-<i>Nox4<sup>em2Mcwi+/+</sup></i>SS-<i>Nox4<sup>em2Mcwi+</sup>/Nox4<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5509086ACI.BN-(<i>D5Rat72-D5Rat36</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5509087ACI.BN-(<i>D5Rat113-D5Rat159</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic5686734SS-<i>Nppb<sup>em4Mcwi-/-</sup></i>SS-<i>Nppb<sup>em4Mcwi-</sup>/Nppb<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686736SS-<i>Nppb<sup>em4Mcwi+/+</sup></i>SS-<i>Nppb<sup>em4Mcwi+</sup>/Nppb<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686738SS-<i>Plcd3<sup>em4Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em4Mcwi-</sup>/Plcd3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686740SS-<i>Plcd3<sup>em4Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em4Mcwi+</sup>/Plcd3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686742SS-<i>Plcd3<sup>em7Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em7Mcwi-</sup>/Plcd3<sup>em7Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686744SS-<i>Plcd3<sup>em7Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em7Mcwi+</sup>/Plcd3<sup>em7Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686747SS-<i>Plekha7<sup>em1Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em1Mcwi-</sup>/Plekha7<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686749SS-<i>Plekha7<sup>em1Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em1Mcwi+</sup>/Plekha7<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686758SS-<i>Plekha7<sup>em4Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em4Mcwi-</sup>/Plekha7<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686760SS-<i>Plekha7<sup>em4Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em4Mcwi+</sup>/Plekha7<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5686762SS-<i>Plod1<sup>em1Mcwi-/-</sup></i>SS-<i>Plod1<sup>em1Mcwi-</sup>/Plod1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688080SS-<i>Nox4<sup>em2Mcwi-/+</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688083SS-<i>Prex1<sup>em2Mcwi-/-</sup></i>SS-<i>Prex1<sup>em2Mcwi-</sup>/Prex1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688107FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-/-</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-</sup>/Sorcs1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688109FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+/+</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+</sup>/Sorcs1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688111SS-<i>Tfdp2<sup>em2Mcwi-/-</sup></i>SS-<i>Tfdp2<sup>em2Mcwi-</sup>/Tfdp2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688113SS-<i>Tfdp2<sup>em2Mcwi+/+</sup></i>SS-<i>Tfdp2<sup>em2Mcwi+</sup>/Tfdp2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688116SS-<i>Tgfb1<sup>em1Mcwi+/+</sup></i>SS-<i>Tgfb1<sup>em1Mcwi+</sup>/Tgfb1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688119SS-<i>Tgfb1<sup>em3Mcwi-/+</sup></i>SS-<i>Tgfb1<sup>em3Mcwi-</sup>/Tgfb1<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688121SS-<i>Ube2q2<sup>em3Mcwi-/-</sup></i>SS-<i>Ube2q2<sup>em3Mcwi-</sup>/Ube2q2<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688123SS-<i>Ube2q2<sup>em3Mcwi+/+</sup></i>SS-<i>Ube2q2<sup>em3Mcwi+</sup>/Ube2q2<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant5688125SS-<i>Ulk4<sup>em3Mcwi-/-</sup></i>SS-<i>Ulk4<sup>em3Mcwi-</sup>/Ulk4<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutant6478789LEW-Tg(CAG-EGFP)YsRrrcTransgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegalovirus enhancer, chicken b-actin enhancerÿ¿promoter and rabbit b-globin poly(A) signal.<a href=http://www.rrrc.us/Strain/?x=296>Rat Resource and Research Center</a>transgenicEmbryo; Sperm; Cryo-recovery6893530BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/RhwKoletsky rat leptin receptor mutant (lepr) from the LA/N-<i>cp</i> was introgressed into the BBDR/Rhw rats by marker-assisted breeding. This was initiated in 2001 by Dr. Hansen and completed in 2007 at the University of Washington, Seattle.R. H. William Laboratory, University of Washington, Seattle, Washingtoncongenic6893599SS-<i>Pdc<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 47-bp deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPdc<sup>em3Mcwi</sup>56877126893600SS-<i>Abcb1b<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAbcb1b<sup>em2Mcwi</sup>68935986893429SS-<i>Nos3<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 109-bp deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNos3<sup>em8Mcwi</sup>68934216893430SS-<i>Nat8<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACATCCGCCAGTTCCAGgagaggGACTATGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNat8<sup>em4Mcwi</sup>68934136893431SS-<i>Nos3<sup>em13Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermNos3<sup>em13Mcwi</sup>68934226893432SS-<i>Hvcn1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermHvcn1<sup>em1Mcwi</sup>68934106893433SS-<i>Nos3<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNos3<sup>em2Mcwi</sup>68934186893434SS-<i>Kcnj16<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermKcnj16<sup>em1Mcwi</sup>68934236893435SS-<i>Tfdp2<sup>em6Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermTfdp2<sup>em6Mcwi</sup>68934176893436SS-<i>Kcnmb1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a net 4-bp deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermKcnmb1<sup>em1Mcwi</sup>68934156893437BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctIl1r1<sup>em1Mcwi</sup>68934256893438SS-<i>Fgf1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCAGTTCAGCTGCAGCtcagtGCGGAAAGCGCGGGCGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermFgf1<sup>em2Mcwi</sup>68934126893439SS-<i>Hvcn1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermHvcn1<sup>em2Mcwi</sup>68934196893440SS-<i>Fyn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctFyn<sup>em1Mcwi</sup>68934116893441SS-<i>Grm7<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermGrm7<sup>em2Mcwi</sup>68934166893442SS-<i>Pparg<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 133-bp deletion of part of intron 4 and exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermPparg<sup>em1Mcwi</sup>68934246893443BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctIl1r1<sup>em2Mcwi</sup>68934146893444SS-<i>Kcnmb1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermKcnmb1<sup>em3Mcwi</sup>68934206893382BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwi-<i>Il1r1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 5.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermIl1r1<sup>em3Mcwi</sup>68933786893383SS-<i>Fyn<sup>em6Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermFyn<sup>em6Mcwi</sup>68933806893384SS-<i>Kcnj11<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermKcnj11<sup>em9Mcwi</sup>68933816893385SS-<i>Kcnj11<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermKcnj11<sup>em5Mcwi</sup>68933796484574SS-<i>Umod<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctUmod<sup>em1Mcwi</sup>56876976484575SS-<i>Resp18<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp substitution in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermResp18<sup>em3Mcwi</sup>56877146484576SS-<i>Adipoq<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAdipoq<sup>em1Mcwi</sup>56877096484577SS-<i>Gnb3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGCTCCCTCTCTCCTGGCagtccTTGTGGGACATTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 111-bp deletion overlapping exon 7.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermGnb3<sup>em1Mcwi</sup>56876966484578SS-<i>Mylip<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermMylip<sup>em1Mcwi</sup>55083476484579SS-Chr 5<sup>BN</sup>-<i>Cyp4a3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantExtinctCyp4a3<sup>em3Mcwi</sup>56877376484580SS-<i>Ldlr<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 123-bp frameshift deletion in exon 4.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLdlr<sup>em2Mcwi</sup>51440946484581SS-<i>Resp18<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp substitution in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermResp18<sup>em2Mcwi</sup>56877056484582SS-<i>Cd247<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermCd247<sup>em1Mcwi</sup>56877036484583SS-<i>Nr2f2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTTCTTCCCTGACCTGCagatcACGGACCAGGTGGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermNr2f2<sup>em1Mcwi</sup>56877216484584SS-<i>Adipoq<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAdipoq<sup>em2Mcwi</sup>56877166484585SS-<i>Slc7a9<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSlc7a9<sup>em2Mcwi</sup>56877016902893BB.SHR-(<i>Acsm3-Igf2</i>)/KCongenics extablished as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK ratsDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germanycongenic6903912SS.SHR-(<i>D9Mco72-D9Rat89</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903914SS.SHR-(<i>D9Mco72-D9Rat55</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903917SS.SHR-(<i>D9Mco72-D9Mco109</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903920SS.SHR-(<i>D9Mco72-D9Uia4</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903922SS.SHR-(<i>D9Mco72-D9Mco106</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903925SS.SHR-(<i>D9Mco72-D9Mco105</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903928SS.SHR-(<i>D9Rat7-D9Got111</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903932SS.SHR-(<i>D9Rat7-D9Rat52</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903934SS.SHR-(<i>D9Rat7-D9Mco91</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903936SS.SHR-(<i>D9Rat7-D9Rat84</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regionMedical College of Ohio, Toledo, Ohiocongenic6903879SS/NEisSlc1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japaninbred6903881SR/NEisSlc1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japaninbred6903902WF.COP-(<i>D2Uwm14-D2Uwm13</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background.University of Wisconsin, Madison, Wisconsin, USAcongenic6903904WF.COP-(<i>D2Uwm17-D2Rat16</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background.University of Wisconsin, Madison, Wisconsin, USAcongenic6766770BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwiThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene; maintained at Medical College of WisconsinMedical College of Wisconsin, Milwaukee, Wisconsincongenic6893535BBDR.LA-(<i>D5Rat98-D5Rat233</i>), BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwHeterozygous BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/Rhw (DR.<sup><i>lepr</sup></i>) were crossed with homozygous BBDR.BBDP-(-(<i>D4Mit6-D4Mit7</i>)/Rhw (DR.<sup><i>Gimap5</sup></i>), to geenrate teh double congenic rats that had mutations for Gimap5 and lepr genes.R. H. William Laboratory, University of Washington, Seattle, Washingtoncongenic6484711SS-<i>Atp2b1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TACCTTCTGGGTTCAgaagagGCCGTGGCTTGCTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 117-bp deletion in intron 8 and exon 9.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAtp2b1<sup>em2Mcwi</sup>64847076484712SS-<i>Lpin1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermLpin1<sup>em1Mcwi</sup>64847096484713SS-<i>Cubn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGGGAGTACCTTCAGATTcatgatGGAGACTCCTCAGCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 14.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermCubn<sup>em1Mcwi</sup>64847056484714SS-<i>Lss<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 12-bp deletion in exon 2.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermLss<sup>em2Mcwi</sup>64847066484715SS-<i>Adora2b<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 162-bp deletion in exon 1<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermAdora2b<sup>em2Mcwi</sup>56876986484716SS-<i>Bcat1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGTCTGTACATCCGCCCCacattCATCGGGATTGAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is 15-bp deletion in exon 5<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermBcat1<sup>em2Mcwi</sup>64847086484717SS-<i>Cacna1h<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCGACCCACAGTGTCtgggagATCGTGGGGCAGGCAGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 11.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermCacna1h<sup>em2Mcwi</sup>64847036484718SS-<i>Ace<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermAce<sup>em2Mcwi</sup>64847046484719SS-<i>Lepr<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCATCGTACTGCCCacaatgGGACATGGTCACAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp deletion in exon 11.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermLepr<sup>em2Mcwi</sup>64847016484720SS-<i>Lep<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTGCCTATCCacaaaGTCCAGGATGACACC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermLep<sup>em5Mcwi</sup>64847006484721SS-<i>Ace<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantLive Animals; SpermAce<sup>em1Mcwi</sup>64847026893551DA.PVG.1AV1-(<i>D1Rat32-D1Rat51</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1097> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology6893554DA.PVG.1AV1-(<i>D1Rat193-D1Rat68</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1098> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology7245556WKHT/EdhWKHT rats are derived from a cross between SHR and WKY. Brother/sister inbreeding of the hybrids and successive generations was performed, selecting for the hypertension, but not the behavioral hyperactivity, of the SHR.<a href=http://www.rrrc.us/Strain/?x=619>Rat Resource and Research Center</a>inbred7365040SS.SR-(<i>rs65785750-rs13452155</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainsWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts.congenic7365043SS.SR-(<i>rs65785750-rs106808193</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainsWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts.congenic7411634WDB/NipsCrlj:WI females were bred to DA/Slc males to generate F<sub>1</sub> pups which were bred by brother-sister mating; only black (non-agouti) pups were picked for breeding. (The genotype of the pups was checked by backcrossing to BN (for BB or Bb) and Hooded strains (for HH or Hh) genotype.) When the aaBBCCHH genotype of F2 was confirmed then the strain was maintained by brother-sister mating.Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPANinbred8551714SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D10Chm246-D10Chm257</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D10Chm246-D10Chm257</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551716SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D16Chm48-D16Chm60</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551718SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D16Chm48-D16Chm60</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551721SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551723SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551725SS.LEW-(<i>D8Chm12-D8Rat15</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Chm12-D8Rat15</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551727SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551737SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551739SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551748SS.LEW-(<i>D3Rat17-D3Mco80</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat17-D3Mco80</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic7771589SS.SR-(<i>D2Rat352-rs63922710</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainsBoston University School of Medicine, Boston, Massachusettscongenic8551711SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8552285F344.WI-Tg(Per1-luc)YlabThe original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1005> National BioResource Project for the Rat in Japan</a>transgenicSperm8552346DA.PVG.1AV1-(<i>D4Rat107-D4Got132</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by selective transferring of PVG alleles in the interval between D4Rat137 and D4Kiru157 onto DA background in minimum of 13 backcross generations.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1121> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology8552348DA.PVG.1AV1-(<i>D13Rat105-D13Rat131</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). The congenic line was established from DA and MHC-identical PVG.A rats using a speed-congenic approach with marker assisted selection. DA females were mated with male offspring selected from F2 (DAxPVG.A) with heterozygote alleles within chromosome 13 and Eae34 QTL interval and with the lowest PVG.A background contamination using 96 microsatellite markers equally spaced throughout the genome (at 20 centimorgan cM intervals). A breeding pair selected from the N7 generation were crossed for two generations to produce homozygous DA.PVG-Eae34 congenic rats.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1124> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology8657079SS.LEW-(<i>D18Chm124-D18Chm126</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic7240512DA.PVG.1AV1-(<i>D4Rat113-D4Kiru80</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKiniDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Swedencongenic7240513DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKiniDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Swedencongenic7240514DA.PVG.1AV1-(<i>D4Kiru12-D4Kiru55</i>)/KiruCongenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/Kiru onto the genetic background of DA/ZtmKiniDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Swedencongenic7240521DA.PVG.1AV1-(<i>D4Kini3-D4Rat177</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strainDepartment of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, Swedencongenic7240522DA.PVG.1AV1-(<i>D4Kini3-D4Mgh14</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strainDepartment of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1118> National BioResource Project for the Rat in Japan</a>congenicSpermViral encephalitis (HSE)7777138SS.LEW-(<i>D5Mco41-D5Mco47</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic7777140SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco41-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1Mco and SS.LEW-(<i>D5Mco41-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicsMedical College of Ohio, Toledo, Ohio, USAcongenic7777143SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic7800692MKO/TamiMinko RatMKO rat is derived from Wistar male rat which exhibited large-size and abnormal lipid metabolism.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=974> National BioResource Project for the Rat in Japan</a>inbredLiving Animals; Embryo7800694NER.F344-(<i>D1Rat132</i>)(<i>D5Rat100</i>)/KyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1051> National BioResource Project for the Rat in Japan</a>congenic7800705KHR/Kyo<sup>-/+</sup>kaken hairless ratKaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=413 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermDermatologyOca223184128551752SS.LEW-(<i>D1Rat320-D1Mgh32</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551755SS.LEW-(<i>D1Chm64-D1Rat19</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Chm64-D1Rat19</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551757SS.LEW-(<i>D7Uia3-D7Mgh1</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D7Uia3-D7Mgh1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic7411703SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/Izmconstructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segmentsDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenic7411705SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/Izmconstructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segmentsDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenic7411707SHRSP.SHR-(<i>D1Mgh5-D1Got87</i>)/Izmmale SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/IzmDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenic7411709SHRSP.SHR-(<i>D1Mit30-D1Rat269</i>)/Izmmale SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/IzmDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenic7800702KHR/Kyo<sup>-/-</sup>kaken hairless ratKaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=678 > National BioResource Project for the Rat in Japan</a>mutantEmbryo; SpermDermatologyOca223184128551763SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8662878LOU.BN-(<i>D5Rat59-D5Rat125</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic6907094WF.WKY-(<i>D5Uwm87-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907096WF.WKY-(<i>D5Uwm85-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907098WF.WKY-(<i>D5Uwm82-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907100WF.WKY-(<i>D5Uwm82-D5Uwm91</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907104WF.WKY-(<i>D5Uwm77-D5Uwm91</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic7207880LEW.WKY-(<i>D13Arb15-D13Rat58</i>)/TjaSegment of interest from chr 13 of WKY/NCrl was introgressed into LEW/SsNHsdImperial College, London, UKcongenic7771610SHRSP-Chr 1<sup>F344</sup>/RkbSHRSP/Bbb male was crossed with female F344/Crl to get F1 animals which in turn were backcrossed with female SHRSP, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germanyconsomic8551750SS.LEW-(<i>D1Uia4-D1Rat320</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D1Uia4-D1Rat320</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8657399SS.MNS-(<i>D2Chm214-D2Chm302</i>)/AydCongenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic8657402SS.LEW-(<i>D3Rat52-D3Chm57</i>),MNS-(<i>D2Chm214-D2Chm302</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Chm57</i>)/Ayd, SS.MNS-(<i>D2Chm214-D2Chm302</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic7421599SS.LEW-(<i>D1Chm64-D1Rat19</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421606SS.LEW-(<i>D1Uia4-D1Rat320</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421617SS.LEW-(<i>D17Chm14-D17Rat65</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421619SS.LEW-(<i>D17Chm85-D17Chm71</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421621SS.LEW-(<i>D17Chm31-D17Chm93</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421623SS.LEW-(<i>D17Rat84-D17Chm17</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7771600SS.SR-(<i>rs106870553-rs63922710</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainsBoston University School of Medicine, Boston, Massachusettscongenic8142383SHRSP/BbbUtxAnimals transferred from Harvard University/Brigham (Dr Klaus Lindpaintner) originating from SHRSP colony at University of HeidelbergUniversity of Texas, Houston, TXinbred8142385SHR/UtxAnimals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974University of Texas, Houston, TXinbred8549599BN.LEW-(<i>D10Rat32-D10Rat133</i>)/CimlCongenic strain created from parental BN/Rj and LEW/Rj strains.Institut National de la Sante et de la Recherche Medicale, Toulouse, Francecongenic8552331F344-<i>Il2rg<sup>em7Kyo</sup></i>The strain having a Endonuclease-induced mutation in Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1099> National BioResource Project for the Rat in Japan</a>mutantHematology; Immunology7421612SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydA segment of chromosome 16 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic8551759SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551761SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Got112-Igfbp4</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Got112-Igfbp4</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551880DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8661235FHH-Tg(T2/Rab38)AMcwiThis strain was made by pronuclear microinjection of a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving the Brown Norway allele cDNA for Rab38 along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 14 near 13.2 Mb (rn4)Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsintransgenicRab386287528661233SS-Tg(T2GFP)E3McwiThis strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 15 near 35.6 Mb (rn4)Medical College of Wisconsin, Milwaukee, Wisconsintransgenic8663453BN.ACI-(<i>D14Uwm4-D14Rat39</i>)/ShulThis congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic8663455BN.ACI-(<i>D14Uwm1-D14Uwm5</i>)/ShulThis congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7241594(SDxF344)F1-<i>Rbm20<sup>m1Mlgw</i></sup>This mutation was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.University of Wisconsin, MadisonmutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937241595(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw+/+</i></sup>Heterozygous offsprings were intercrossed and maintained as wild typeUniversity of Wisconsin, MadisonmutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937241596(SDxF344)F1-<i>Rbm20<sup>m1Mlgw+/+</i></sup>Heterozygous offsprings were intercrossed and maintained as wild typeUniversity of Wisconsin, MadisonmutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937241597(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw</i></sup>This mutation was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on (Hsd:SD x F344/NHsd)F1 x BN/SsNHsd.University of Wisconsin, MadisonmutantSpermRbm20<i><sup>m1Mlgw</i></sup>72415937204133LEW-<i>Rag1<sup>em1Ztm</sup></i>This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.Zentrales Tierlaboratorium, Medizinische Hochschule Hannover, GermanymutantRag1<sup>em1Ztm</sup>72041328552366WI-Tg(CAG-Cre)NipsThe construct contains CAG--NLS-Cre--pA (3.3 kb)which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotesSection of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPANtransgenic8552368WI-Tg(CAG/Venus)NipsThe construct contains L2-Venus × CAG-Cre (CAG--lox P--Venus--pA (3.1 kb)) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotesSection of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPANtransgenic8552371WDB-<i>Rosa26<sup>em1(RT2)Nips</sup></i>This strain was produced by knock-in in the rat Rosa26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb)Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPANmutant7777180SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic8552364WI-Tg(L2-Venus)NipsThe construct contains CAG--lox P--Neo-pA--lox P--Venus--pA (4.3 kb) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotesSection of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPANtransgenic8552293SR/JrSeacDahl Salt-ResistantSubstrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1042> National BioResource Project for the Rat in Japan</a>inbredEmbryo; SpermCardio- Hypertension8662861LOU.BN-(<i>D5Rat59-D5Rat133</i>)/Bbbthe desired chromosomal segment from BN/Rj was introgressed into the genetic background of LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic8657392SS.LEW-(<i>D10Rat155-D10Chm171</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic9587466SD-Tg(UBC-Cre/ERT2)7NarlThis strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter.<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23002> National Laboratory Animal Center, Taiwan </a>transgenicEmbryoUBC13468537401201SS.SR-(<i>D17Rat24-rs106534785</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainsWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts.congenic7401203SS.SR-(<i>rs105019230-D17Rat44</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainsWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts.congenic8553005BN/RijHsdArcTo Animal Resources Centre, Australia from Harlan.<a href=http://www.arc.wa.gov.au/?page_id=1513> Animal Resources Centre, Australia</a>inbred8662449LOU/MBbbLOU/M strain maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, GermanyMax-Delbruck-Center for Molecular Medicine, Berlin, Germanyinbred8663462ACI.BN-(<i>D7Uwm32-D7Uwm43</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic8657361SS.MNS-(<i>D2Chm254-D2Chm161</i>),LEW-(<i>D10Chm246-D10Chm257</i>),LEW-(<i>D16Chm48-D16Chm60</i>),LEW-(<i>D18Rat55-D18Mgh2</i>)/AydA congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm254-D2Chm161</i>)/Ayd, SS.LEW-(<i>D10Chm246-D10Chm257</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic9587464SD-Tg(UBC-DsRedT3-emGFP)18NarlSD-Tg(UBC-DsRedT3-emGFP)18This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23001> National Laboratory Animal Center, Taiwan </a>transgenicLive AnimalsUBC13468539587475SD-Tg(UBC-DsRed-GFP)(Col1a(5A)-Cre)NarlThis strain was produced by microinjection of Col1a(5A)-Cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)26Narl. As loxP-flanked DsRed is removed by Col1a(5A) promoter-driven Cre recombinaseNational Laboratory Animal Center, Taiwantransgenic7241047LE-<i>Lrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup></i>This strain was produced by crossing LE-Lrrk1<sup>em1Sage</sup> with LE-Lrrk2<sup>em1Sage</sup><a href= http://www.sageresearchmodels.com/research-models> Sigma Advanced Genetic Engineering Labs</a>mutantLrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>72410437241048LE-<i>Park7<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/park7-dj-1-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantPark7<sup>em1Sage</sup>72410427241049LE-<i>Pink1<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/pink1-park6-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantPink1<sup>em1Sage</sup>72410467241050LE-<i>Lrrk2<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30.<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/lrrk2-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantLrrk2<sup>em1Sage</sup>72410457241051LE-<i>Lrrk1<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.<a href= http://www.sageresearchmodels.com/research-models> Sigma Advanced Genetic Engineering Labs Labs</a>mutantLrrk1<sup>em1Sage</sup>72410447241052LE-<i>Park2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/park2-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantPark2<sup>em1Sage</sup>72410417241053LE-<i>Lrrk1<sup>em1Sage-/-</sup>Lrrk2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous<a href= http://www.sageresearchmodels.com/research-models> Sigma Advanced Genetic Engineering Labs Labs</a>mutantLrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>72410437241054LE-<i>Pink1<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4.<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/pink1-park6-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantPink1<sup>em1Sage</sup>72410467241055LE-<i>Park7<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/park7-dj-1-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantPark7<sup>em1Sage</sup>72410427241056LE-<i>Lrrk2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/lrrk2-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantLrrk2<sup>em1Sage</sup>72410457241057LE-<i>Lrrk1<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous<a href= http://www.sageresearchmodels.com/research-models> Sigma Advanced Genetic Engineering Labs</a>mutantLrrk1<sup>em1Sage</sup>72410447241058LE-<i>Park2<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4.<a href=http://www.sageresearchmodels.com/research-models/knockout-rats/park2-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantPark2<sup>em1Sage</sup>72410417794700SS.LEW-(<i>D5Mco39-D5Mco41</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic8553013SHR/NCrlArcTo Animal Resources Centre from Charles River<a href=http://www.arc.wa.gov.au/?page_id=1523> Animal Resources Centre, Australia</a>inbred8553015WKY/NCrlArcTo Animal Resources Centre from Charles River<a href=http://www.arc.wa.gov.au/?page_id=1511> Animal Resources Centre, Australia</a>inbred8663464ACI.BN-(<i>D7Uwm33-D7Uwm43</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic6907054WF.WKY-(<i>D5Uwm67-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907057WF.WKY-(<i>D5Uwm76-D5Uwm61</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907059WF.WKY-(<i>D5Uwm76-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907061WF.WKY-(<i>D5Uwm67-D5Uwm78</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907063WF.WKY-(<i>D5Uwm76-D5Got18</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic7204136Wild-<i>Rag1<sup>em1Ang</sup></i>This strain was produced by injecting ZFNs into wild rat embryos. The resulting mutation is a 21-bp frameshift deletion in exon 2.Institut National de la Sante et de la Recherche Medicale (INSERM)mutantRag1<sup>em1Ang</sup>72041357241239DA.BN-(<i>D9Wox18-D9Rat20</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7241240DA.BN-(<i>D9Mit6-D9Rat29</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7241241DA.BN-(<i>D9Mit6-D9Got15</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7241242DA.BN-(<i>D9Got8-D9Rat139</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7241243DA.BN-(<i>D9Wox24-D9Rat20</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1101> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology7241244DA.BN-(<i>D9Wox24-D9Wox18</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7241245DA.BN-(<i>D9Wox24-D9Rat139</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7241246DA.BN-(<i>D9Wox24-D9Rat44</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7241247LEW.BN-(<i>D9Got8-D9Got22</i>)/KiniLEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic6907436SS.BN-(<i>D13Hmgc41-D13Hmgc23</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.Medical College of Wisconsin, Milwaukee, Wisconsincongenic6907438SS.BN-(<i>D13Rat77-D13Rat105</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.Medical College of Wisconsin, Milwaukee, Wisconsincongenic6907445SS.BN-(<i>D13Rat124-D13Rat101</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.Medical College of Wisconsin, Milwaukee, Wisconsincongenic7247594WKY.SHR-(<i>D1Rat90-D1Mit18</i>)/IwaiFragment of the chromosome 1 derived from SHR and repeated backcross to WKYShiga University of Medical Science, Otsu, Japancongenic7241248LEW.BN-(<i>D9Wox24-D9Got22</i>)/KiniLEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratsCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedencongenic7394821P.NP-(<i>Snca-D4Rat35</i>)/IusmP.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectionDepartment of Medicine, Indiana University School of Medicine, Indianapolis, Indianacongenic7794691SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco42-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicsMedical College of Ohio, Toledo, Ohio, USAcongenic8551885DA.PVG.1AV1-(<i>D4Mit22-D4Rat84</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8551887DA.PVG.1AV1-(<i>D4Got126-D4Rat203</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8551889DA.PVG.1AV1-(<i>D4Rat62-D4Got136</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8655992W-<i>Lepr</i><sup>faNin</sup>Spontaneously developed obese rat in the colony of inbred W/Nin was isolated and selectively bredNational Institute of Nutrition (NIN), Hyderabad, Indiamutant7245521SD-Tg(SNCA)3Insthe transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (TH)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines<a href=http://www.rrrc.us/Strain/?x=604>Rat Resource and Research Center</a>transgenic7245523SD-Tg(SNCA)4Insthe transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (TH)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines<a href=http://www.rrrc.us/Strain/?x=605>Rat Resource and Research Center</a>transgenic7247286F344-Tg(APP)21BeseyF344/NHsd embryos were microinjected with a DNA construct containing human beta amyloid precursor protein (APP), Swedish (Swe) double mutation (K670N-M671L) and Indiana (Ind) single autosomal dominant mutation (V642F). The transgene is driven by an ubiquitin-C promoter. Homozygous transgenic rats exhibit approximately 2.9-fold more expression of APP mRNA than wild-type rats.<a href=http://www.rrrc.us/Strain/?x=606>Rat Resource and Research Center</a>transgenicSperm7247289SD-Tg(TETRA-EGFP)BeseySD embryos were microinjected with a DNA construct containing the GFP gene downstream of a miniCMV promoter under the control of tetracycline response element (TRE). The pLV-Tet-GFP was generated by co-transfection of pLV-Tet-GFP, pΔ8.9 and pVSV-G into a 293FT packaging cell line<a href=http://www.rrrc.us/Strain/?x=608>Rat Resource and Research Center</a>transgenicSperm7247290SD-Tg(P2ry2)BeseySD embryos were microinjected with a lentiviral construct containing the rat P2ry2 gene (G protein-coupled purinergic receptor P2Y2) under control of an ubiquitin-C promoter. Results in over-expression of P2ry2 mRNA.<a href=http://www.rrrc.us/Strain/?x=596>Rat Resource and Research Center</a>transgenicSperm7248453SS.BN-(<i>D12Hmgc3-AU047911</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.Medical College of Wisconsin, Milwaukee, Wisconsincongenic7248454SS.BN-(<i>D12Hmgc7-D12Hmgc6</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.Medical College of Wisconsin, Milwaukee, Wisconsincongenic7248456SS.BN-(<i>D12Hmgc3- D12Got29</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.Medical College of Wisconsin, Milwaukee, Wisconsincongenic7364919SS.BN-(<i>rs64114288-rs107464428</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from the top to ~227 Mb transferred to the SS/JrHsdMcwi strain background.<a href=http://www.rrrc.us/Strain/?x=641>Rat Resource and Research Center</a>congenicSpermcardiac ischemia7364923SS.BN-(<i>rs106982173-rs65057186</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.<a href=http://www.rrrc.us/Strain/?x=640>Rat Resource and Research Center</a>congenicSpermcardiac ischemia7364927SS.BN-(<i>rs13453786-rs66377062</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.<a href=http://www.rrrc.us/Strain/?x=639>Rat Resource and Research Center</a>congenicSpermcardiac ischemia7364932ACI.BN-(<i>D7Rat86-rs198562267</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7364934ACI.BN-(<i>rs199006987-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7364936ACI.BN-(<i>rs198562267-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7364938(LE x RCS-<i>p</i><sup>+</sup>/LavRrrc)F1RCS-<i>p</i><sup>+</sup>/LavRrrc males were mated to LE females.<a href=http://www.rrrc.us/Strain/?x=618>Rat Resource and Research Center</a>congenicSpermRetinal ResearchMertk692837364940F344-<i>Tp53<sup>tm1(EGFP-Pac)</sup>QlyRrrc</i>Backcrossed STOCK-Tp53<sup>tm1(EGFP-Pac)</sup>QlyRrrc with F344 using speed congenic approach to move mutation onto F344 genetic background.<a href=http://www.rrrc.us/Strain/?x=656>Rat Resource and Research Center</a>mutanttumorigenesis model8662925LOU.BN-(<i>D5Rat59-rs13448399</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic8551864DA.LEW.1AV1-(<i>D4Mgh17-D4Mgh21</i>)/KiruLEW.1AV1/Kini allele is introgressed into the DA/ZtmKini rats.Department of Medicine, Karolinska Institutet, Stockholm, Swedencongenic8551866LEW.1AV1.DA-(<i>D4Mgh17-D4Rat203</i>)/KiruDA/ZtmKini allele is introgressed into the LEW.1AV1/kini rats.Department of Medicine, Karolinska Institutet, Stockholm, Swedencongenic8551868PVG.1AV1.DA-(<i>D4Mgh17-D4Rat84</i>)/KiruDA/ZtmKini allele is introgressed into the PVG.1AV1/Kini rats.Department of Medicine, Karolinska Institutet, Stockholm, Swedencongenic8551882DA.PVG.1AV1-(<i>D4Rat203-D4Mit22</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic7247278SD-Tg(Camk2a-tTA)XgxCamk2a-tTA transgenic rats expressing tTA under regulatory control of the forebrain promotor Camk2a. Transgene expression can be blocked by administration of doxycycline to drinking water.<a href=http://www.rrrc.us/Strain/?x=613>Rat Resource and Research Center</a>transgenicSperm7247279SD-Tg(TRE-FUS-R521C)XgxOverexpression of R521C mutant form of human FUS (Fused in Sarcoma) transgene is under regulatory control of tetracycline-responsive promoter element.<a href=http://www.rrrc.us/Strain/?x=612>Rat Resource and Research Center</a>transgenicSperm7247280SD-Tg(TRE-LacZ)XgxLacZ gene was assembled downstream of the TRE (tetracycline-responsive promoter elements) promoter, allowing inducible gene expression.<a href=http://www.rrrc.us/Strain/?x=614>Rat Resource and Research Center</a>transgenicSperm8548794F344-Tg(NC1-269B17)1NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=970 > National BioResource Project for the Rat in Japan</a>transgenicSpermCasp322758662933LOU.BN-(<i>rs65016308-D5Rat133</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic8663458ACI.BN-(<i>D7Rat164-D7Rat22</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic8548809F344-Tg(NC1-269B17)2NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=971 > National BioResource Project for the Rat in Japan</a>transgenicSpermCasp322758548812F344-Tg(NC1-269B17)3NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=972 > National BioResource Project for the Rat in Japan</a>transgenicSpermCasp322758548815F344-Tg(NC1-269B17)4NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=973 > National BioResource Project for the Rat in Japan</a>transgenicSpermCasp322758548817KDP.PVG-RT1<sup>a/u</sup>/NyoMHC haplotype (RT1.B<i>a</i>D<i>a</i>) of PVG.R23 was transferred onto the genetic background of KDP/Tky strain (RT1.B<i>u</i>D<i>u</i>). This allele has been maintained in heterozygous condition. Backcrossing has started since 2003 and afterwards maintained by sib mating<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=993 > National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity9587470SD-Tg(UBC-DsRedT3-emGFP)26NarlThis strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23003> National Laboratory Animal Center, Taiwan </a>transgenicEmbryoUBC13468537245527WKHA/Edhderived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressure<a href=http://www.rrrc.us/Strain/?x=620>Rat Resource and Research Center</a>inbred7394698ZUC.BN-(<i>D1Rat42-D1Rat90</i>)/Stehomozygous lean wild-type ZUC-<I>Lepr</I><sup>+Ste</sup> were crossed with BN/Crl to get F<sub>1</sub>; these were backcrossed to lean ZUC males; congenics were selected by genotyping with markersUniversity of California Davis, Davis, CAcongenic7411676SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/GcrcCongenic strain created by speed congenic strategy where the desired region from Chromosome 3 of WKY/Gcrc was introgressed into the SHRSP/Gcrc background.University of Glasgow, Western Infirmary, Glasgow, UKcongenic7411679SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)(<i>D3Mgh16-D3Rat114</i>)/GcrcF<sub>1</sub> rats generated by crossing SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/Gcrc and SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc were backcrossed to SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc; heterozygous animals for chr 3 fragment were crossed with homozygous animals for chr 2; animals that were homozygous for both fragments were intercrossed to get teh desired bicongenic strainUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenic8657351SS.MNS-(<i>D2Chm366-D2Rat52</i>),LEW-(<i>D18Rat61-D18Rat45</i>),LEW-(<i>D10Chm128-D10Chm121</i>)/AydA triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm366-D2Rat52</i>)/Ayd, SS.LEW-(<i>D18Rat61-D18Rat45</i>)/Ayd and SS.LEW-(<i>D10Chm128-D10Chm121</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8662955LOU.BN-(<i>rs13448399-D5Rat133</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic8662958LOU.BN-(<i>D5Rat59-rs13448399</i>)/Bbb-/+this heterozygous congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic8549776F344-<i>Lep<sup>m1Kyo</sup></i>F344 OB ratThis strain has Lep mutation （Q92X)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=995> National BioResource Project for the Rat in Japan</a>mutantLive AnimalsDiabetes ObesityLep30008549778PVG.KDP-<i>Cblb<i>/NyoPVG.KDP-Cblb congenicDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1010> National BioResource Project for the Rat in Japan</a>congenicEmbryoDiabetes ObesityCblb6205358549779DRU/UubcThe mutant rat showing microphthalmia was found in the colony of Donryu rats at Central Institute for Experimental Animals in 1974. A pair of F3 rats was transferred to The Third Department for Anatomy, School of Medicine, Chiba University in 1975 and maintained by sib mating. F50 rats were transferred to Faculty of Agriculture, Utsunomiya University by Dr. S Sugita in 1991<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=991> National BioResource Project for the Rat in Japan</a>inbredEmbryo8549782SD.GR-<i>Ugt1a1<sup>j</i></sup>/AonDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=975 > National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology; MetabolismUgt1a139358549785W.GR-<i>Ugt1a1<sup>j</i></sup>/AonDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=976 > National BioResource Project for the Rat in Japan</a>congenicNeurobiology; MetabolismUgt1a139357349357DA.PVG.1AV1-(<i>D4Got128-D4Got136</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8552341DA.PVG.1AV1-(<i>D10Got6-D10Rat184</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by transfer of the defined Vra4 segment selected from male donors of G8 generation of a DAxPVG1.AV1 andvanced intercross line. Subsequential backcrossing for 9 generations.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1120> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology8552351DA.PVG.1AV1-(<i>D9Wox24-D9Rat44</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Briefly, in each backcross generation, rats for further breeding were selected on the basis of genotyping of 8 microsatellite markers in the congenic region, from marker D9Wox24 to D9Rat20. The genetic background of rats was also screened with 100 markers. After the complete removal of the donor genome outside the congenic fragment, two heterozygous rats were intercrossed to produce the homozygous strains DA.BN-Eae4(N7F1). Subsequently, interval-specific recombinants were bred from an F2 breeding. R25 recombinant was established in 2003.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1123> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology7364902SS-Chr 2<sup>BN</sup>/1McwiAekCompared to the current SS-Chr 2<sup>BN</sup>/Mcwi colony at the Medical College of Wisconsin (where this strain originated) it is a more complete consomic strain (a smaller piece of distal Chromosome 2 is of the SS genotype compared to the SS-Chr 2<sup>BN</sup>/Mcwi strain).<a href=http://www.rrrc.us/Strain/?x=642>Rat Resource and Research Center</a>consomicEmbryoStudies of ischemia reperfusion injury or hypertension7364954DA.ACI-(<i>D2Mit12-D2Got121</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 7 times then brother-sister mating to maintain in the homozygous stateNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=623>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies7364956DA.ACI-(<i>D2Wox20-D2Mit14</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 10 times then brother-sister mating to maintain in the homozygous stateNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=624>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies7364959DA.ACI-(<i>D2Uwm24-D2Rat54</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 8 times then brother-sister mating to maintain in the homozygous stateNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=625>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies7364970DA.ACI-(<i>D12Mit2-D12Got49</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 12 times then brother-sister mating to maintain in the homozygous stateNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=626>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies7364974DA.F344-(<i>D10Rat195-D10Rat92</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous stateNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=631>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies7364976DA.F344-(<i>D10Rat195-D10Arb27</i>)/NsiCongenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous stateNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=632>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies7364978DA.F344-(<i>D10Arb27-D10Rat92</i>)/NsiCongenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous stateNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, <a href=http://www.rrrc.us/Strain/?x=633>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies8662874LOU.BN-(<i>D5Rat59-D5Rat127</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(<i>D5Rat59-D5Rat133</i>)/Bbb to LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, Germanycongenic7364879SS-<i>Apoe<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermApoe<sup>em8Mcwi</sup>51319157364880SS-<i>Cst3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermCst3<sup>em1Mcwi</sup>56877087364881SS-<i>Slc7a9<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSlc7a9<sup>em1Mcwi</sup>56877007364882SS-<i>Sorcs2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15.<a href= http://rgd.mcw.edu/wg/physgenknockouts>PhysGen Knockouts</a>mutantSpermSorcs2<sup>em1Mcwi</sup>55083437364981DA.F344-(<i>D7Rat22-D7Rat15</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 11 times then brother-sister mating to maintain in the homozygous stateThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland, <a href=http://www.rrrc.us/Strain/?x=635>Rat Resource and Research Center</a>congenicSpermarthritis/autoimmunity studies7364991ACI/EurMcwiACI (August × Copenhagen Irish)substrain of ACI derived from ACI/EurMedical College of Wisconsin, <a href=http://www.rrrc.us/Strain/?x=284>Rat Resource & Research Center</a>inbredEmbryo; SpermRenal disease7800671F344-<i>Sv2a<sup>m1Kyo</sup></i>Established by ENU mutagenesis. A point mutation in Sv2a: synaptic vesicle glycoprotein 2a<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1056> National BioResource Project for the Rat in Japan</a>mutantSv2a6197157800673KFRS2/Kyo<sup>-/+</sup>KFRS2<sup>-/+</sup>A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1002> National BioResource Project for the Rat in Japan</a>mutantLive Animals; SpermOphthalmology; DermatologyTyr15897558552279WI-Tg(Per1-luc)YlabThe original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1004> National BioResource Project for the Rat in Japan</a>transgenicSperm8552287F344.WIC-Tg<i><sup>rdw</i>Kts</sup>Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1037> National BioResource Project for the Rat in Japan</a>congenicSpermMetabolism8552296UPL/CasTakeuSubstrain of UPL<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1040> National BioResource Project for the Rat in Japan</a>inbredEmbryoOphthalmology8552996F344/Arcsubstrain of F344 bred at Animal Resources Centre Australia<a href=http://www.arc.wa.gov.au/?page_id=1517> Animal Resources Centre, Australia</a>inbred8553001ArcCrl:CD(SD)substrain derived from Crl:CD(SD); IGS refers to animals bred using the CRL International Genetic Standard system.<a href=http://www.arc.wa.gov.au/?page_id=1469> Animal Resources Centre, Australia</a>outbred8553003ArcCrl:WIWistar ratsFrom Charles River to Animal Resources Centre, Australia<a href=http://www.arc.wa.gov.au/?page_id=1473> Animal Resources Centre, Australia</a>outbred8553008LEW/CrlArcLewisDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To Animal Resources Centre, Australia from Charles River<a href=http://www.arc.wa.gov.au/?page_id=1519> Animal Resources Centre, Australia</a>inbred8553010PVG/Arcsubstrain of PVG maintained at Animal Resources Centre<a href=http://www.arc.wa.gov.au/?page_id=1521> Animal Resources Centre, Australia</a>inbred7257663WI-<i>Tlr4<sup>em1Geh</i></sup>This strain was produced by TALEN mediated 13 bp deletion in Exon 1 in the rat Tlr4 gene; background strain is Crl:WIUniversity of Pittsburgh, <a href=http://www.rrrc.us/Strain/?x=654>Rat Resource and Research Center</a>mutantalcohol action, immune system function, septic shockTlr4<i><sup>em1Geh</i></sup>72576617401261LOU/NimrOlaHsdLouvainLOU/C was selected for high immunocytoma incidence; to National Institute of Medical Research, Mill Hill; in 1985 from Nimr to Harlan<a href =http://www.harlan.com/products_and_services/research_models_and_services/research_models/louc_inbred_rat.hl>Harlan</a>inbredCryopreserved8553006DA/Arcsubstrain of DA bred at Animal Resources Centre, Australia<a href=http://www.arc.wa.gov.au/?page_id=1515> Animal Resources Centre, Australia</a>inbred8655977W/NinWistar NINInbred stock of Wistar rats dating back to 1920National Institute of Nutrition (NIN), Hyderabad, Indiainbred7800661F344.Cg-<i>Du Tyr<sup>CKyo+/+</i></sup>downunder ratDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1053> National BioResource Project for the Rat in Japan</a>mutant8552309ODUS/OduThe mutant rat showing spontaneous gingivitis was found in the colony of WKY rats in 1972. The inbred strain was established in 1991.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1067> National BioResource Project for the Rat in Japan</a>inbredEmbryo8552311ODUR/OduThis inbred strain was established from WKY rats as a control for ODUS/Odu.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1066> National BioResource Project for the Rat in Japan</a>inbredEmbryo8552313DA.PVG.1AV1-(<i>D10Rat81-D10Rat238</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1100> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology8552315W-Tg(Thy1-COP4/YFP*)4JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1072> National BioResource Project for the Rat in Japan</a>transgenicSpermOphthalmology; Otorhinology8552317W-Tg(Thy1-COP4/YFP*)5JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1077> National BioResource Project for the Rat in Japan</a>transgenicSpermOphthalmology; Otorhinology8552319W-Tg(Thy1-COP4/YFP*)6JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1078> National BioResource Project for the Rat in Japan</a>transgenicSpermOphthalmology; Otorhinology8552321SHR-Tg(APOC3-CETP)1TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC3 promoter into SHR/Izm rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1095> National BioResource Project for the Rat in Japan</a>transgenicEmbryoDiabetes Obesity; Neurobiology8552323SHR-Tg(APOC3-CETP)2TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1114> National BioResource Project for the Rat in Japan</a>transgenicSpermDiabetes Obesity; Neurobiology8552325SHR-Tg(APOC3-CETP)3TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC5 promoter into SHR/Izm rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1115> National BioResource Project for the Rat in Japan</a>transgenicSpermDiabetes Obesity; Neurobiology8552327SHR-Tg(APOC3-CETP)4TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1116> National BioResource Project for the Rat in Japan</a>transgenicSpermDiabetes Obesity; Neurobiology8552329W-Tg(Nqo1)KopThe transgenic rats were established by injection of transgene consisting of NAD(P)H quinone oxidoreductase 1 gene derived from a DA/Slc rat strain into Wistar rat fertile eggs.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1107> National BioResource Project for the Rat in Japan</a>transgenicSpermOncology; Metabolism7800676KFRS3A/Kyo<sup>+/+</sup>A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1059> National BioResource Project for the Rat in Japan</a>mutant8552235SD-Tg(Pbsn-TAg)1ObsSV40 Large T Antigen along with Rat probasin promoter<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=998 > National BioResource Project for the Rat in Japan</a>transgenicSpermPbsn7085718552267SHRSP.WKY-(<i>D1Rat116-D1Wox10</i>)/TkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1031> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity8552269SHRSP.WKY-(<i>D1Tkyo58-D1Rat90</i>)/TkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1032> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity8552271SHRSP.WKY-(<i>D1Rat27-D1Wox18</i>)/TkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1033> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity8552273SHRSP.WKY-(<i>D1Tkyo57-D1Wox18</i>)/TkyoDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1034> National BioResource Project for the Rat in Japan</a>congenicSpermDiabetes Obesity8552275F344-<i>Lgi1<sup>m1Kyo</i></sup>Developed by gene driven ENU mutagenesis. Lgi1-mutant rats carrying a missense mutation (L385R).<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1036> National BioResource Project for the Rat in Japan</a>mutantSpermLgi16287428552298DA-<i>Tyr<sup>em1Kyo</i></sup>Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1092> National BioResource Project for the Rat in Japan</a>mutantSpermBehavior; DermatologyTyr15897558552303DA-<i>Tyr<sup>em2Kyo</i></sup>Developed by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1093> National BioResource Project for the Rat in Japan</a>mutantSperm; Live AnimalsBehavior; Dermatology8657348SS.LEW-(<i>D17Chm31-D17Chm93</i>),MNS-(<i>D2Rat155-D2Chm161</i>),LEW-(<i>D18Chm41-D18Rat92</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd, SS.MNS-(<i>D2Rat155-D2Chm161</i>)/Ayd and SS.LEW-(<i>D18Chm41-D18Rat92</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic7243955DA.F344-(<i>D4Got44-D4Arb21</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosityThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic7349321LEXF2D/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.Saitama Cancer Center Research Institute, Saitama, Japanrecombinant_inbred7349322LEXF8B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.Saitama Cancer Center Research Institute, Saitama, Japanrecombinant_inbred7394818P.NP-(<i>D4Mgh16-D4Rat173</i>)/IusmP.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectionDepartment of Medicine, Indiana University School of Medicine, Indianapolis, Indianacongenic7421634SS.MNS-(<i>D2Got93-D2Rat222</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421636SS.MNS-(<i>D2Chm90-D2Rat38</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421638SS.MNS-(<i>D2Chm381-D2Chm225</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421640SS.MNS-(<i>D2Rat155-D2Chm161</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421643SS.MNS-(<i>D2Chm254-D2Chm161</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421645SS.MNS-(<i>D2Rat155-D2Chm419</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421647SS.MNS-(<i>D2Chm161-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421649SS.MNS-(<i>D2Chm153-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421651SS.MNS-(<i>D2Chm442-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421654SS.MNS-(<i>D2Chm366-D2Rat52</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7240510DA.PVG.1AV1-(<i>D4Rat113-D4Kiru96</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKiniDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Swedencongenic7421603SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic7421610SS.LEW-(<i>D5Mit5-D5M4Mit14</i>)/AydA segment of chromosome 5 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic8551872DA.PVG.1AV1-(<i>D4Rat155-D4Rat113</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8551874DA.PVG.1AV1-(<i>D4Rat63-D4Rat84</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8551876DA.PVG.1AV1-(<i>D4Rat203-D4Got130</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic8657051F344/NinSubstrain of F344 maintained at National Institute of Nutrition (NIN), Hyderabad, India.National Institute of Nutrition (NIN), Hyderabad, Indiainbred7248725ACI.BN-(<i>D7Rat164-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248727ACI.BN-(<i>D7Rat164-D7Uwm30</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248729ACI.BN-(<i>D7Rat206-D7Uwm30</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248731ACI.BN-(<i>D7Rat164-D7Uwm31</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248733ACI.BN-(<i>D7Rat164-D7Uwm33</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248736ACI.BN-(<i>D7Uwm32-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248738ACI.BN-(<i>D7Uwm36-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248740ACI.BN-(<i>D7Uwm38-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248742ACI.BN-(<i>D7Uwm33-D7Mit27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248744ACI.BN-(<i>D7Uwm33-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248746ACI.BN-(<i>D7Uwm41-D7Mit16</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic7248748ACI.BN-(<i>D7Uwm28-D7Mit16</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madisoncongenic8655639WAG/NovSubstrain of WAG, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk)Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russiainbred8655663WAG.OXYS-(<i>D1Rat219-D1Rat81</i>)/Novdesired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russiacongenic9586448SHR/NCrlPrinSubstrain of SHR originally from Charles River now maintained at University of CaliforniaDept. of Pharmacology, University of California, San Diego, La Jolla, Californiainbred9586450SHR/OlaIpcvPrinThese are substrains of SHR from Czech Academy of Sciences now maintained at University of CaliforniaDept. of Pharmacology, University of California, San Diego, La Jolla, Californiainbred7246924HanTacFcfiq:WHWistar HannoverReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.<a href=http://www.usp.br/bioterio/Animais_Tipo_Linhagem.asp>Universidade de Sao Paulo</a>outbred8551772SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551774SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic6907076WF.WKY-(<i>D5Uwm78-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907078WF.WKY-(<i>D5Uwm95-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907080WF.WKY-(<i>D5Uwm67-D5Uwm81</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907084WF.WKY-(<i>D5Uwm76-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907087WF.WKY-(<i>D5Uwm78-D5Uwm84</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907090WF.WKY-(<i>D5Uwm78-D5Uwm93</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic6907092WF.WKY-(<i>D5Uwm88-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.University of Wisconsin School of Medicine, Madison, Wisconsincongenic7257722WKY.SHR-(<i>D1Mgh14-D1Rat77</i>)/IwaiFragment of the chromosome 1 derived from SHR/NCrlj and repeated backcross to WKY/NCrlCrljShiga University of Medical Science, Otsu, Japancongenic8661234SS-Tg(T2ePet-eGFP)A1McwiThis strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a serotonergic neuron-specific ePet1 promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 7 near 123.8Mb (rn4)Medical College of Wisconsin, Milwaukee, Wisconsintransgenic6907047WF.WKY-(<i>D5Uwm63-D5Uwm60</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).University of Wisconsin School of Medicine, Madison, Wisconsincongenic7777135SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic8551778SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D3Rat2-D3Chm79</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D3Rat2-D3Chm79</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551892DA.PVG.1AV1-(<i>D4Rat113-D4Rat62</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.Center for Molecular Medicine, Karolinska Institute, Stockholm, Swedencongenic7241811BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)(<i>D13Rat124-D13Mgh5</i>)/Sunna double congenic strain which has more than 38.74 Mb of chr 8 and more than 16.78 Mb of chr 13 of Wistar Furth introgressed into the gentic background of BBDP/WorSunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canadacongenic7244374FXLE/StmRecombinant inbred strain derived from Le/Stm (from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/DuCrlj (from Charles River Japan) and then maintained by brother-sister mating.Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japanadvanced_intercross_line7244380DA.F344(Cia3c)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosityThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic7244381DA.F344(Cia3e)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosityThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic7246927NTacFcfiq:SDSprague DawleyReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.<a href=http://www.usp.br/bioterio/Animais_Tipo_Linhagem.asp>Universidade de Sao Paulo</a>outbred7246928NTac:NIH-<i>Foxn1</i><sup>rnu</sup>nudeThe NIH nude Spontaneous mutant model was developed by NIH in 1979-1980 by intercrossing eight strains of rats. Taconic received stock from NIH Animal Genetic Resource in 1981. The rats were derived by hysterectomy in 1987 and again in 1998. Animals are randomly bred at Taconic without selection for coat color or pigmentation.<a href=http://www.taconic.com/wmspage.cfm?parm1=868>Taconic</a>outbred7246929NTacFcfiq:NIH-<i>Foxn1</i><sup>rnu</sup>nudeReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating between homozygous male x heterozygous female.<a href=http://www.usp.br/bioterio/Animais_Tipo_Linhagem.asp>Universidade de Sao Paulo</a>outbred8655660WAG.OXYS-(<i>D1Rat30-D1Rat219</i>)/Novdesired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russiacongenic7241265SHR-Chr Y<sup>WKY</sup>/MetWKY/NHsd males were crosssed with SHR/NHsd females to get F1 animals, the hybrid animals were backcrossed with female SHR/NHsd to transfer the Y chromosomeDepartment of Biology, The University of Akron, Akron, Ohioconsomic7241267WKY-Chr Y<sup>SHR</sup>/MetSHR/NHsd males were crosssed with WKY/NHsd females to get F1 animals, the hybrid animals were backcrossed with female WKY/NHsd to transfer the Y chromosomeDepartment of Biology, The University of Akron, Akron, Ohioconsomic7241271SHR.BN-(<i>D10Mit4-D10Wox11</i>)/CubSegment of chromosome 10 from BN.<i>Lx</i>/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenicInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republiccongenic7794694SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic7794696SS.LEW-(<i>D5Mco43-D5Mco47</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic7794698SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco43-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3Mco and SS.LEW-(<i>D5Mco413-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicsMedical College of Ohio, Toledo, Ohio, USAcongenic7794704SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strainMedical College of Ohio, Toledo, Ohio, USAcongenic7794706SS.LEW-(<i>D5Mco39-D5Mco41</i>)(<i>D5Mco42-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco41</i>)/Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicsMedical College of Ohio, Toledo, Ohio, USAcongenic7800667F344.Cg-<i>Foxn1<sup>rnuKyo-/+</sup></i>Jic N13 to Kyo (1988)<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=152> National BioResource Project for the Rat in Japan</a>mutantLive Animals; SpermImmunology; CancerFoxn139707245481SD-Tg(hsMt-LacZ)Rehpresses LacZ under the transcriptional control of the mouse metallothionein regulatory sequences. Transgene expression in germ cells is constitutive; expression of the transgene can be induced in liver by zinc or cadmium.<a href=http://www.rrrc.us/Strain/?x=526>Rat Resource and Research Center</a>transgenicEmbryo; Sperm7245482SD-Tg(ROSA26-EGFP)RehRrrcStrain carries a 1.8kb transgene consisting of the mouse ROSA26 regulatory sequences driving EGFP. FISH was used to localize the transgene insertion to Chromosome 11q11-q12, proximal to Grik1 and near Ncam2. The transgene is expressed exclusively in male and female germ cells throughtout development.<a href=http://www.rrrc.us/Strain/?x=527>Rat Resource and Research Center</a>transgenicEmbryo; Sperm7245488SD-Tg(Chat-tTA)Rats express a mouse tetracycline-controlled transactivator (tTA) driven by the mouse choline acetyltransferase (Chat) promotor. When mated to a second transgenic strain (RRRC:00633) that carries a target gene (TDP43) under the regulation of a tetracycline response element (TRE), the expression of TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.<a href=http://www.rrrc.us/Strain/?x=598>Rat Resource and Research Center</a>transgenicSperm7245494SD-Tg(TRE-TDP43-M337V)Strain carries a transgene expressing human TDP43 with the M337V mutation under control of a tTA-dependent promoter (TRE). When mated to a second transgenic strain (RRRC:632) that carries a tetracycline-controlled transactivator driven by the mouse choline acetyltransferase (Chat) promoter, the expression of mutant TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.<a href=http://www.rrrc.us/Strain/?x=599>Rat Resource and Research Center</a>transgenicSperm8547938CrljJcl:SDSprague-Dawley from Charles River Laboratory Japan, to CLEA Japan, Inc.CLEA Japan, Inc.outbred8552337DA.PVG.1AV1-(<i>D10Got406-D10Rat93</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Animals for congenic breeding were selected from the 10th generation of an advanced intercross line (AIL) originating from the EAE-susceptible DA and EAE-resistant PVG.1AV1 rat strains. Selected males containing a PVG.1AV1 fragment in the Eae18b region (from OT24.18 to D10Rat93 marker, at 68.36 Mb and 81.9 Mb, respectively) were backcrossed with DA females for 8 generations, and offspring was genotyped using microsatellite markers in each generation. In the 8th generation, heterozygous males and females were crossed to obtain the experimental population of homozygous congenic rats and littermate controls.Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1122> National BioResource Project for the Rat in Japan</a>congenicSpermNeurobiology9587473SD-Tg(UBC-emGFP)18NarlThis strain was produced by microinjection of UBC-cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)18Narl<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23004> National Laboratory Animal Center, Taiwan </a>transgenicLive AnimalsUBC13468537800659F344.Cg-<i>Du Tyr<sup>C</sup></i>/Kyodownunder ratDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1057> National BioResource Project for the Rat in Japan</a>congenicDevelopment8549798WMS/SimNcpMunich, Germany from Wistar stock selectively bred for superficial glomeruli. To Simonsen Labs, CA via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Transferred at Nigata University from Simonsen Laboratory in 2005. at Niigata UniversityDepartment of cellular physiology, Institute of Nephrology, Niigata University, Niigata, Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=997 > National BioResource Project for the Rat in Japan</a>inbredEmbryo8551776SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551782SS.LEW-(<i>D18Chm90-D18Chm4</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic7241794SHR/BbbThis SHR colony is maintained at Max-Delbruck Center for Molecular Medicine, GermanyMax-Delbruck Center for Molecular Medicine, Germanyinbred8551730SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551732SS.LEW-(<i>D17Chm31-D17Chm93</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551734SS.LEW-(<i>D17Chm31-D17Chm93</i>)(<i>D17Rat84-D17Chm17</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D17Rat84-D17Chm17</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8551742SS.LEW-(<i>D16Chm48-D16Chm60</i>)(<i>D18Rat101-D18Rat92</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat101-D18Rat92</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canadacongenic8657135SS.LEW-(<i>D10Chm280-D10Chm216</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, Canadacongenic8551766SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canadacongenic8552242ETR/EisEisai Turning RatDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1013 > National BioResource Project for the Rat in Japan</a>inbredEmbryoBehavior8552244SD-Tg(Dsp-mCherry-DTR)JflnThis rat carries a transgene consisting of the Dsp promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. Red fluorescence can be detected from the skin of the animals but not the brain.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1018 > National BioResource Project for the Rat in Japan</a>transgenicSperm7243960DA.F344-(<i>D4Got44-D4Rat128</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosityThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic7243963DA.F344-(<i>D4Uia2-D4Wox21</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosityThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic7243965DA.F344-(<i>D4Arb21-D4Arb4</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosityThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic7243966DA.F344-(<i>D4Arb5-D4Arb4</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosityThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Marylandcongenic8551785SS.LEW-(<i>D18Wox7-D18Rat67</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic8551787SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic8551789SS.LEW-(<i>D18Chm59-D18Rat1</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strainResearch Centre-CHUM, Montreal, Quebec, Canadacongenic8552237WI-Tg(Nanog-GFP-PuroR)22Kyomouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performance<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1011 > National BioResource Project for the Rat in Japan</a>transgenicLive Animals8552239F344.WI-Tg(Nanog-GFP-PuroR)KyoWI-Tg(Nanog-GFP-puro-R)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic background<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1012 > National BioResource Project for the Rat in Japan</a>transgenicSperm8552247SD-Tg(Neurod6-mCherry-DTR)JflnThis rat carries a transgene consisting of the NeuroD6 promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. This model is yet to be validated.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1019 > National BioResource Project for the Rat in Japan</a>transgenicSperm8552249SD-Tg(Camk2a-FLPo)JflnThis transgene consists of approximately 6kb of the CamK2a promoter followed by a gene encoding FLP, optimised for mamalian exprssion (FLPo). This rat remains unvalidated.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1020 > National BioResource Project for the Rat in Japan</a>transgenicSperm8552252ACI.BUF-<i>Aftm1</i>/2MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=977> National BioResource Project for the Rat in Japan</a>congenicEmbryo8552255LAP/Hshyolow alcohol preference ratDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1009> National BioResource Project for the Rat in Japan</a>inbredEmbryo8552257HAP/Hshyohigh alcohol preference ratDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1008> National BioResource Project for the Rat in Japan</a>inbredEmbryo8552259F344-<i>Ldlr<sup>m1Kyo</i></sup>/TaDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1030> National BioResource Project for the Rat in Japan</a>mutantEmbryo8552261WIAR.MPR-<i>Arsb<sup>abd</i></sup>/NcchdDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=992> National BioResource Project for the Rat in Japan</a>mutantEmbryoOsteology; MetabolismArsb21588552289A5M/KhosDeveloped by the DEPOSITOR<a href=http://www.anim.med.kyoto-u.ac.jp/nbr/strainsx/Strains_d.aspx?StrainID=1039> National BioResource Project for the Rat in Japan</a>inbredEmbryoMetabolism