{ "linkml_version" : "v2.13.0", "alliance_member_release_version" : "v2025-12-08", "allele_ingest_set" : [ { "allele_full_name_dto" : { "internal" : false, "format_text" : "SET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of Sciences", "display_text" : "SET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sbf1[m1Ipcv]", "display_text" : "Sbf1m1Ipcv", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "ifm", "display_text" : "ifm", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "ifm", "display_text" : "ifm", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Sbf1m1Ipcv", "display_text" : "Sbf1m1Ipcv", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10002755", "page_area" : "allele", "display_name" : "RGD:10002755" } }, "date_created" : "2015-04-24T00:00:00.000-05:00", "date_updated" : "2017-01-25T12:46:15.000-06:00", "internal" : false, "primary_external_id" : "RGD:10002755", "note_dtos" : [ { "internal" : false, "free_text" : "spontaneous recessive mutation found in the colony of SHR/OlaIpcv; the mutated nucleotide is chr7:127585309 (of Baylor 3.4) and it is last nucleotide of intron 37 (-1 of exon 38) of Sbf1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27335132", "RGD:10002756", "RGD:38549340" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "keratin 71, type II; mutation 1, Laboratory Animal Center of Zhengzhou University", "display_text" : "keratin 71, type II; mutation 1, Laboratory Animal Center of Zhengzhou University", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Krt71[m1Yuyi]", "display_text" : "Krt71m1Yuyi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "KRT71RN", "display_text" : "KRT71RN", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Krt71m1Yuyi", "display_text" : "Krt71m1Yuyi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10002785", "page_area" : "allele", "display_name" : "RGD:10002785" } }, "date_created" : "2015-04-28T00:00:00.000-05:00", "date_updated" : "2017-02-27T15:47:55.000-06:00", "internal" : false, "primary_external_id" : "RGD:10002785", "note_dtos" : [ { "internal" : false, "free_text" : "a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10002786" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fumarylacetoacetate hydrolase; TALEN induced mutant 3, Medical College of Wisconsin", "display_text" : "fumarylacetoacetate hydrolase; TALEN induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fah[em3Mcwi]", "display_text" : "Fahem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fahem3Mcwi", "display_text" : "Fahem3Mcwi", "name_type_name" : "unspecified" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10002790", "page_area" : "allele", "display_name" : "RGD:10002790" } }, "date_created" : "2015-04-28T00:00:00.000-05:00", "date_updated" : "2015-04-28T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10002790", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 3 causing a predicted non-functional protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor, gamma; TALEN induced mutant 2, Medical College of Wisconsin", "display_text" : "interleukin 2 receptor, gamma; TALEN induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em2Mcwi]", "display_text" : "Il2rgem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem2Mcwi", "display_text" : "Il2rgem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10002792", "page_area" : "allele", "display_name" : "RGD:10002792" } }, "date_created" : "2015-04-28T00:00:00.000-05:00", "date_updated" : "2015-04-28T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10002792", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 2 causing a predicted non-functional protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dystrophin; CRISPR/Cas9 system induced mutant 1, Keitaro Yamanouchi", "display_text" : "dystrophin; CRISPR/Cas9 system induced mutant 1, Keitaro Yamanouchi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2015-06-12T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Dmd[em1Kykn]", "display_text" : "Dmdem1Kykn", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dmdem1Kykn", "display_text" : "Dmdem1Kykn", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Dmd[em1Kykn]", "display_text" : "Dmdem1Kykn", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10045592", "page_area" : "allele", "display_name" : "RGD:10045592" } }, "date_created" : "2015-06-12T00:00:00.000-05:00", "date_updated" : "2015-06-12T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10045592", "note_dtos" : [ { "internal" : false, "free_text" : "mutation induced by CRISPR/Cas9 system in the Dmd gene resulting 329-bp deletion around exon 3 and 2-bp substitution in exon16.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25005781", "RGD:11040981", "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 1, Kyoto University", "display_text" : "nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 1, Kyoto University", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nfe2l2[em1Kyo]", "display_text" : "Nfe2l2em1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nfe2l2em1Kyo", "display_text" : "Nfe2l2em1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10045594", "page_area" : "allele", "display_name" : "RGD:10045594" } }, "date_created" : "2015-06-12T00:00:00.000-05:00", "date_updated" : "2015-06-12T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10045594", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27071940", "RGD:12910550", "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 2, Kyoto University", "display_text" : "nuclear factor, erythroid 2-like 2; zinc finger nuclease induced mutant 2, Kyoto University", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nfe2l2[em2Kyo]", "display_text" : "Nfe2l2em2Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nfe2l2em2Kyo", "display_text" : "Nfe2l2em2Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10045598", "page_area" : "allele", "display_name" : "RGD:10045598" } }, "date_created" : "2015-06-12T00:00:00.000-05:00", "date_updated" : "2015-06-12T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10045598", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27071940", "RGD:12910550", "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Fus RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "display_text" : "Fus RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-05-06T13:41:44.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fus[em1Ionsz]", "display_text" : "Fusem1Ionsz", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fusem1Ionsz", "display_text" : "Fusem1Ionsz", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "fused in sarcoma RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "display_text" : "fused in sarcoma RNA binding protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10047084", "page_area" : "allele", "display_name" : "RGD:10047084" } }, "date_created" : "2015-07-08T00:00:00.000-05:00", "date_updated" : "2015-07-08T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10047084", "note_dtos" : [ { "internal" : false, "free_text" : "mutation induced by CRISPR/Cas9 system in the Fus gene that made the 521th amino acid Arg into Cys", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10047082" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "forkhead box N1; CRISPR/Cas9 system induced mutant 1, National Institute for Physiological Sciences", "display_text" : "forkhead box N1; CRISPR/Cas9 system induced mutant 1, National Institute for Physiological Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Foxn1[em1Nips]", "display_text" : "Foxn1em1Nips", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Foxn1em1Nips", "display_text" : "Foxn1em1Nips", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10053596", "page_area" : "allele", "display_name" : "RGD:10053596" } }, "date_created" : "2015-07-15T00:00:00.000-05:00", "date_updated" : "2016-12-12T13:51:00.000-06:00", "internal" : false, "primary_external_id" : "RGD:10053596", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR mutagenesis. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26931321", "RGD:11568681", "RGD:7411635" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "forkhead box N1; CRISPR/Cas9 system induced mutant 2, National Institute for Physiological Sciences", "display_text" : "forkhead box N1; CRISPR/Cas9 system induced mutant 2, National Institute for Physiological Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Foxn1[em2Nips]", "display_text" : "Foxn1em2Nips", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Foxn1em2Nips", "display_text" : "Foxn1em2Nips", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10053599", "page_area" : "allele", "display_name" : "RGD:10053599" } }, "date_created" : "2015-07-15T00:00:00.000-05:00", "date_updated" : "2016-12-12T13:55:25.000-06:00", "internal" : false, "primary_external_id" : "RGD:10053599", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR mutagenesis. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26931321", "RGD:11568681", "RGD:7411635" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2015-07-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcd1[em2Mcwi]", "display_text" : "Abcd1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcd1em2Mcwi", "display_text" : "Abcd1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054237", "page_area" : "allele", "display_name" : "RGD:10054237" } }, "date_created" : "2015-07-30T00:00:00.000-05:00", "date_updated" : "2016-10-19T14:44:06.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054237", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon1 of the rat Abcd1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "ATP-binding cassette, subfamily D (ALD), member 1; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2015-07-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcd1[em4Mcwi]", "display_text" : "Abcd1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcd1em4Mcwi", "display_text" : "Abcd1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "ATP-binding cassette, subfamily D (ALD), member 1", "display_text" : "ATP-binding cassette, subfamily D (ALD), member 1", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Abcd1[em2Mcwi]", "display_text" : "Abcd1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054240", "page_area" : "allele", "display_name" : "RGD:10054240" } }, "date_created" : "2015-07-30T00:00:00.000-05:00", "date_updated" : "2016-10-24T14:41:11.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054240", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 203-bp deletion in the Abcd1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A1 receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "adenosine A1 receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2015-07-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora1[em3Mcwi]", "display_text" : "Adora1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora1em3Mcwi", "display_text" : "Adora1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "adenosine A1 receptor", "display_text" : "adenosine A1 receptor", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Adora1[em1Mcwi]", "display_text" : "Adora1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054243", "page_area" : "allele", "display_name" : "RGD:10054243" } }, "date_created" : "2015-07-30T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:22:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054243", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Adora1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "valosin-containing protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "display_text" : "valosin-containing protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Vcp[em1Ionsz]", "display_text" : "Vcpem1Ionsz", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Vcpem1Ionsz", "display_text" : "Vcpem1Ionsz", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Vcp em1(R155H)Ionsz", "display_text" : "Vcp em1(R155H)Ionsz", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054274", "page_area" : "allele", "display_name" : "RGD:10054274" } }, "date_created" : "2015-08-03T00:00:00.000-05:00", "date_updated" : "2015-08-03T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054274", "note_dtos" : [ { "internal" : false, "free_text" : "mutation induced by CRISPR/Cas9 system in the Vcp gene that made the 155th amino acid Arg into His", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10047082" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glial fibrillary acidic protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "display_text" : "glial fibrillary acidic protein; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gfap[em1Ionsz]", "display_text" : "Gfapem1Ionsz", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gfapem1Ionsz", "display_text" : "Gfapem1Ionsz", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Gfap tm(2A-EYFP)/Ionsz", "display_text" : "Gfap tm(2A-EYFP)/Ionsz", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054277", "page_area" : "allele", "display_name" : "RGD:10054277" } }, "date_created" : "2015-08-03T00:00:00.000-05:00", "date_updated" : "2015-08-03T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054277", "note_dtos" : [ { "internal" : false, "free_text" : "mutation induced by CRISPR/Cas9 system that added a 2A and EYFP behind the last exon of Gfap", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10047082" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A1 receptor; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "adenosine A1 receptor; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora1[em4Mcwi]", "display_text" : "Adora1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora1em4Mcwi", "display_text" : "Adora1em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054282", "page_area" : "allele", "display_name" : "RGD:10054282" } }, "date_created" : "2015-08-03T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:24:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054282", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 34-bp deletion in the Adora1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2a receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "adenosine A2a receptor; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2a[em3Mcwi]", "display_text" : "Adora2aem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2aem3Mcwi", "display_text" : "Adora2aem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054285", "page_area" : "allele", "display_name" : "RGD:10054285" } }, "date_created" : "2015-08-03T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:27:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054285", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 98-bp deletion in the Adora2a gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Arhgef11[em4Mcwi]", "display_text" : "Arhgef11em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Arhgef11em4Mcwi", "display_text" : "Arhgef11em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054289", "page_area" : "allele", "display_name" : "RGD:10054289" } }, "date_created" : "2015-08-03T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:31:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054289", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Arhgef11 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "display_text" : "Rho guanine nucleotide exchange factor (GEF) 11; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Arhgef11[em5Mcwi]", "display_text" : "Arhgef11em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Arhgef11em5Mcwi", "display_text" : "Arhgef11em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054293", "page_area" : "allele", "display_name" : "RGD:10054293" } }, "date_created" : "2015-08-03T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:33:10.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054293", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp deletion in the Arhgef11 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 11, Medical College of Wisconsin", "display_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 11, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Btg2[em11Mcwi]", "display_text" : "Btg2em11Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Btg2em11Mcwi", "display_text" : "Btg2em11Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054297", "page_area" : "allele", "display_name" : "RGD:10054297" } }, "date_created" : "2015-08-03T00:00:00.000-05:00", "date_updated" : "2016-10-03T13:34:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054297", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Btg2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 13, Medical College of Wisconsin", "display_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 13, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Btg2[em13Mcwi]", "display_text" : "Btg2em13Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Btg2em13Mcwi", "display_text" : "Btg2em13Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054302", "page_area" : "allele", "display_name" : "RGD:10054302" } }, "date_created" : "2015-08-04T00:00:00.000-05:00", "date_updated" : "2016-10-03T13:59:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054302", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the Btg2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin", "display_text" : "BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2020-01-23T16:35:04.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Btg2[em7Mcwi]", "display_text" : "Btg2em7Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Btg2em7Mcwi", "display_text" : "Btg2em7Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin", "display_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054305", "page_area" : "allele", "display_name" : "RGD:10054305" } }, "date_created" : "2015-08-04T00:00:00.000-05:00", "date_updated" : "2016-10-03T14:09:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054305", "note_dtos" : [ { "internal" : false, "free_text" : "The Btg2 mutation was generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "calcium-sensing receptor; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "calcium-sensing receptor; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ ], "allele_secondary_id_dtos" : [ { "internal" : false, "date_updated" : "2017-07-21T14:38:35.000-05:00", "secondary_id" : "RGD:10401180", "date_created" : "2015-09-30T00:00:00.000-05:00", "obsolete" : true } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Casr[em1Mcwi]", "display_text" : "Casrem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Casrem1Mcwi", "display_text" : "Casrem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054308", "page_area" : "allele", "display_name" : "RGD:10054308" } }, "date_created" : "2015-08-04T00:00:00.000-05:00", "date_updated" : "2017-07-21T14:38:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054308", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (T) insertion in the Casr gene; (RGSC 5.0/rn5): chr11:70,329,456-70,329,457", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna3[em1Mcwi]", "display_text" : "Chrna3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrna3em1Mcwi", "display_text" : "Chrna3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054371", "page_area" : "allele", "display_name" : "RGD:10054371" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-03T15:41:10.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054371", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene;(RGSC 5.0/rn5) chr8:58,186,969-58,186,970", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 9, Medical College of Wisconsin", "display_text" : "cholinergic receptor, nicotinic, alpha 3 (neuronal); CRISPR/Cas9 system induced mutant 9, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna3[em9Mcwi]", "display_text" : "Chrna3em9Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrna3em9Mcwi", "display_text" : "Chrna3em9Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054374", "page_area" : "allele", "display_name" : "RGD:10054374" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-03T15:37:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054374", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in the Chrna3 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna4[em4Mcwi]", "display_text" : "Chrna4em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrna4em4Mcwi", "display_text" : "Chrna4em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054377", "page_area" : "allele", "display_name" : "RGD:10054377" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-03T15:28:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054377", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion (16-bp deletion and 11-bp insertion) in the Chrna4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna4[em3Mcwi]", "display_text" : "Chrna4em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrna4em3Mcwi", "display_text" : "Chrna4em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054380", "page_area" : "allele", "display_name" : "RGD:10054380" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-03T15:24:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054380", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Chrna4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna5[em1Mcwi]", "display_text" : "Chrna5em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrna5em1Mcwi", "display_text" : "Chrna5em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054384", "page_area" : "allele", "display_name" : "RGD:10054384" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T14:53:48.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054384", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Chrna5 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna5[em2Mcwi]", "display_text" : "Chrna5em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrna5em2Mcwi", "display_text" : "Chrna5em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054387", "page_area" : "allele", "display_name" : "RGD:10054387" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T14:56:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054387", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 20-bp deletion in the Chrna5 gene (RGSC 5.0/rn5) chr8:58,166,756-58,166,775", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "galactosidase, alpha; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gla[em2Mcwi]", "display_text" : "Glaem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Glaem2Mcwi", "display_text" : "Glaem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054395", "page_area" : "allele", "display_name" : "RGD:10054395" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T14:48:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054395", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 47-bp deletion in the Gla gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29563343", "PMID:29979634", "PMID:31253878", "PMID:34320241", "PMID:34541380", "PMID:36660199", "RGD:10054229", "RGD:150429980", "RGD:401976416", "RGD:401976417", "RGD:401976418", "RGD:401976419", "RGD:401976421" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Helz2[em3Mcwi]", "display_text" : "Helz2em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Helz2em3Mcwi", "display_text" : "Helz2em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054399", "page_area" : "allele", "display_name" : "RGD:10054399" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T14:50:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054399", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 11-bp deletion in the Helz2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "helicase with zinc finger 2, transcriptional coactivator; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Helz2[em4Mcwi]", "display_text" : "Helz2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Helz2em4Mcwi", "display_text" : "Helz2em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054402", "page_area" : "allele", "display_name" : "RGD:10054402" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T14:52:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054402", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Helz2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj10[em1Mcwi]", "display_text" : "Kcnj10em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnj10em1Mcwi", "display_text" : "Kcnj10em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054406", "page_area" : "allele", "display_name" : "RGD:10054406" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:44:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054406", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Kcnj10 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-03-29T15:42:12.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj10[em3Mcwi]", "display_text" : "Kcnj10em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnj10em3Mcwi", "display_text" : "Kcnj10em3Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "potassium channel, inwardly rectifying subfamily J, member 10; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054409", "page_area" : "allele", "display_name" : "RGD:10054409" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:45:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054409", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp deletion in the Kcnj10 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "display_text" : "matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mmp9[em6Mcwi]", "display_text" : "Mmp9em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mmp9em6Mcwi", "display_text" : "Mmp9em6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054415", "page_area" : "allele", "display_name" : "RGD:10054415" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-06T09:23:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054415", "note_dtos" : [ { "internal" : false, "free_text" : "This delins allele was made by CRISPR/Cas9 system.The mutation is a 1-bp (t) deletion and a 5-bp (cgggta) insertion in in exon 4, which causes frameshift of the coded protein and premature stop codon in exon 8.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:37423509", "RGD:597805897" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "mitochondrial ribosomal protein L28; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "mitochondrial ribosomal protein L28; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mrpl28[em1Mcwi]", "display_text" : "Mrpl28em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mrpl28em1Mcwi", "display_text" : "Mrpl28em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054418", "page_area" : "allele", "display_name" : "RGD:10054418" } }, "date_created" : "2015-08-05T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:03:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054418", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion in the 2-bp deletion site in the Mrpl28 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pkd1[em2Mcwi]", "display_text" : "Pkd1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pkd1em2Mcwi", "display_text" : "Pkd1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054428", "page_area" : "allele", "display_name" : "RGD:10054428" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:08:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054428", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pkd1[em3Mcwi]", "display_text" : "Pkd1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pkd1em3Mcwi", "display_text" : "Pkd1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054431", "page_area" : "allele", "display_name" : "RGD:10054431" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2017-01-24T14:32:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:10054431", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 12-bp deletion in the Pkd1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pkd1[em1Mcwi]", "display_text" : "Pkd1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pkd1em1Mcwi", "display_text" : "Pkd1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054434", "page_area" : "allele", "display_name" : "RGD:10054434" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:05:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054434", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion in the Pkd1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "display_text" : "polycystic kidney disease 1; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pkd1[em6Mcwi]", "display_text" : "Pkd1em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pkd1em6Mcwi", "display_text" : "Pkd1em6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054437", "page_area" : "allele", "display_name" : "RGD:10054437" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:12:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054437", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Pkd1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rorc[em3Mcwi]", "display_text" : "Rorcem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rorcem3Mcwi", "display_text" : "Rorcem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054442", "page_area" : "allele", "display_name" : "RGD:10054442" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:17:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054442", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in the Rorc gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "display_text" : "RAR-related orphan receptor C; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rorc[em5Mcwi]", "display_text" : "Rorcem5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rorcem5Mcwi", "display_text" : "Rorcem5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054445", "page_area" : "allele", "display_name" : "RGD:10054445" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:21:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054445", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 69-bp deletion in the genome and a 9-bp insertion at the deletion site, net 60-bp deletion in the Rorc gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 25, Medical College of Wisconsin", "display_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 25, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sirt3[em25Mcwi]", "display_text" : "Sirt3em25Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sirt3em25Mcwi", "display_text" : "Sirt3em25Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054448", "page_area" : "allele", "display_name" : "RGD:10054448" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:49:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054448", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 13-bp deletion in the Sirt3 gene;(RGSC 5.0/rn5) deleted region: chr1:220,552,421-220,552,433", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sirt3[em4Mcwi]", "display_text" : "Sirt3em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sirt3em4Mcwi", "display_text" : "Sirt3em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054451", "page_area" : "allele", "display_name" : "RGD:10054451" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:51:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054451", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in the Sirt3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 35, Medical College of Wisconsin", "display_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 35, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sirt3[em35Mcwi]", "display_text" : "Sirt3em35Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sirt3em35Mcwi", "display_text" : "Sirt3em35Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054454", "page_area" : "allele", "display_name" : "RGD:10054454" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-05T15:23:48.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054454", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 30, Medical College of Wisconsin", "display_text" : "sirtuin 3; CRISPR/Cas9 system induced mutant 30, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sirt3[em30Mcwi]", "display_text" : "Sirt3em30Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sirt3em30Mcwi", "display_text" : "Sirt3em30Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054457", "page_area" : "allele", "display_name" : "RGD:10054457" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-05T15:30:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054457", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion of exon 3 in the Sirt3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "serine threonine kinase 39; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "display_text" : "serine threonine kinase 39; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Stk39[em5Mcwi]", "display_text" : "Stk39em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Stk39em5Mcwi", "display_text" : "Stk39em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054460", "page_area" : "allele", "display_name" : "RGD:10054460" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:52:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054460", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "serine threonine kinase 39; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "display_text" : "serine threonine kinase 39; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Stk39[em6Mcwi]", "display_text" : "Stk39em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Stk39em6Mcwi", "display_text" : "Stk39em6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10054463", "page_area" : "allele", "display_name" : "RGD:10054463" } }, "date_created" : "2015-08-06T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:53:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:10054463", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in the Stk39 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2a receptor; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "display_text" : "adenosine A2a receptor; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2a[em5Mcwi]", "display_text" : "Adora2aem5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2aem5Mcwi", "display_text" : "Adora2aem5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10059571", "page_area" : "allele", "display_name" : "RGD:10059571" } }, "date_created" : "2015-08-19T00:00:00.000-05:00", "date_updated" : "2016-10-19T15:28:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:10059571", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sik2[em4Mcwi]", "display_text" : "Sik2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sik2em4Mcwi", "display_text" : "Sik2em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10059574", "page_area" : "allele", "display_name" : "RGD:10059574" } }, "date_created" : "2015-08-19T00:00:00.000-05:00", "date_updated" : "2016-10-04T13:19:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:10059574", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 39 (zinc transporter), member 12; zinc finger nuclease induced mutant 77, Timothy J. Aitman", "display_text" : "solute carrier family 39 (zinc transporter), member 12; zinc finger nuclease induced mutant 77, Timothy J. Aitman", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc39a12[em77Tja]", "display_text" : "Slc39a12em77Tja", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc39a12em77Tja", "display_text" : "Slc39a12em77Tja", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10401842", "page_area" : "allele", "display_name" : "RGD:10401842" } }, "date_created" : "2015-10-08T00:00:00.000-05:00", "date_updated" : "2015-10-08T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10401842", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26258299", "RGD:10401832" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tryptophan hydroxylase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "tryptophan hydroxylase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tph2[em2Mcwi]", "display_text" : "Tph2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tph2em2Mcwi", "display_text" : "Tph2em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10402817", "page_area" : "allele", "display_name" : "RGD:10402817" } }, "date_created" : "2015-10-30T00:00:00.000-05:00", "date_updated" : "2015-10-30T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10402817", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1027-1036)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tryptophan hydroxylase 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "tryptophan hydroxylase 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tph2[em3Mcwi]", "display_text" : "Tph2em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tph2em3Mcwi", "display_text" : "Tph2em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10402820", "page_area" : "allele", "display_name" : "RGD:10402820" } }, "date_created" : "2015-10-30T00:00:00.000-05:00", "date_updated" : "2015-10-30T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:10402820", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 11-bp frameshift deletion in exon 7 (del 1027-1037)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 1, Qiaoli Li", "display_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 1, Qiaoli Li", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc6[em1Qlju]", "display_text" : "Abcc6em1Qlju", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcc6em1Qlju", "display_text" : "Abcc6em1Qlju", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10413843", "page_area" : "allele", "display_name" : "RGD:10413843" } }, "date_created" : "2015-11-25T00:00:00.000-06:00", "date_updated" : "2018-09-20T12:14:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:10413843", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis.ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 44-53 (CAGGCCTGAG).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28111129", "RGD:10413845", "RGD:13792593" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li", "display_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc6[em2Qlju]", "display_text" : "Abcc6em2Qlju", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcc6em2Qlju", "display_text" : "Abcc6em2Qlju", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10413846", "page_area" : "allele", "display_name" : "RGD:10413846" } }, "date_created" : "2015-11-25T00:00:00.000-06:00", "date_updated" : "2016-12-08T16:32:23.000-06:00", "internal" : false, "primary_external_id" : "RGD:10413846", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28111129", "RGD:10413845", "RGD:13792593" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 3, Qiaoli Li", "display_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 3, Qiaoli Li", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc6[em3Qlju]", "display_text" : "Abcc6em3Qlju", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcc6em3Qlju", "display_text" : "Abcc6em3Qlju", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10413847", "page_area" : "allele", "display_name" : "RGD:10413847" } }, "date_created" : "2015-11-25T00:00:00.000-06:00", "date_updated" : "2016-12-08T16:31:03.000-06:00", "internal" : false, "primary_external_id" : "RGD:10413847", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion from cDNA position 42-51 (CGCAGGCCTG).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28111129", "RGD:10413845", "RGD:13792593" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li", "display_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc6[em4Qlju]", "display_text" : "Abcc6em4Qlju", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcc6em4Qlju", "display_text" : "Abcc6em4Qlju", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10413848", "page_area" : "allele", "display_name" : "RGD:10413848" } }, "date_created" : "2015-11-25T00:00:00.000-06:00", "date_updated" : "2016-12-08T16:34:45.000-06:00", "internal" : false, "primary_external_id" : "RGD:10413848", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28111129", "RGD:10413845", "RGD:13792593" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 5, Qiaoli Li", "display_text" : "ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 5, Qiaoli Li", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc6[em5Qlju]", "display_text" : "Abcc6em5Qlju", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcc6em5Qlju", "display_text" : "Abcc6em5Qlju", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10413849", "page_area" : "allele", "display_name" : "RGD:10413849" } }, "date_created" : "2015-11-25T00:00:00.000-06:00", "date_updated" : "2016-12-08T16:28:14.000-06:00", "internal" : false, "primary_external_id" : "RGD:10413849", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28111129", "RGD:10413845", "RGD:13792593" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "bassoon (presynaptic cytomatrix protein); CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "display_text" : "bassoon (presynaptic cytomatrix protein); CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bsn[em1Ionsz]", "display_text" : "Bsnem1Ionsz", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bsnem1Ionsz", "display_text" : "Bsnem1Ionsz", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10450488", "page_area" : "allele", "display_name" : "RGD:10450488" } }, "date_created" : "2016-01-14T00:00:00.000-06:00", "date_updated" : "2016-01-14T00:00:00.000-06:00", "internal" : false, "primary_external_id" : "RGD:10450488", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10047082" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "endothelin receptor type B, spotting lethal", "display_text" : "endothelin receptor type B, spotting lethal", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-07T15:16:22.000-06:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-31T11:05:11.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ednrb[sl]", "display_text" : "Ednrbsl", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ednrb[sl]Hkv", "display_text" : "EdnrbslHkv", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "EdnrbslHkv", "display_text" : "EdnrbslHkv", "name_type_name" : "unspecified" }, { "internal" : false, "format_text" : "Ednrbsl", "display_text" : "Ednrbsl", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10755424", "page_area" : "allele", "display_name" : "RGD:10755424" } }, "date_created" : "2016-01-27T14:33:17.000-06:00", "date_updated" : "2016-11-07T15:14:56.000-06:00", "internal" : false, "primary_external_id" : "RGD:10755424", "note_dtos" : [ { "internal" : false, "free_text" : "This allele has a 301-bp deletion spanning the exon 1-intron 1 junction of the Ednrb gene is a spontaneous null mutation identified in spotting lethal rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21915282", "PMID:22132166", "PMID:22975636", "PMID:26796131", "PMID:8570650", "RGD:10755346", "RGD:628515", "RGD:6480215", "RGD:6480217", "RGD:7207471" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutaryl-CoA dehydrogenase; CRISPR/Cas9 system induced mutant 1, Diana Ballhausen, CHUV, Switzerland", "display_text" : "glutaryl-CoA dehydrogenase; CRISPR/Cas9 system induced mutant 1, Diana Ballhausen, CHUV, Switzerland", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gcdh[em1Dba]", "display_text" : "Gcdhem1Dba", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "GCDHem1Dba", "display_text" : "GCDHem1Dba", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:10758636", "page_area" : "allele", "display_name" : "RGD:10758636" } }, "date_created" : "2016-02-05T00:00:00.000-06:00", "date_updated" : "2023-09-28T09:06:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:10758636", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; the resulting knock-in mutation is R411W in exon 11 of the GCDH gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10758867" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "corticotropin releasing hormone; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "display_text" : "corticotropin releasing hormone; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Crh[em1Ionsz]", "display_text" : "Crhem1Ionsz", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Crhem1Ionsz", "display_text" : "Crhem1Ionsz", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11049142", "page_area" : "allele", "display_name" : "RGD:11049142" } }, "date_created" : "2016-04-05T09:14:04.000-05:00", "date_updated" : "2016-04-05T09:14:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:11049142", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10047082" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "microRNA 29b-1; TALEN induced mutant 1, Medical College of Wisconsin", "display_text" : "microRNA 29b-1; TALEN induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mir29b1[em1Mcwi]", "display_text" : "Mir29b1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mir29b1em1Mcwi", "display_text" : "Mir29b1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11073608", "page_area" : "allele", "display_name" : "RGD:11073608" } }, "date_created" : "2016-04-29T10:51:07.000-05:00", "date_updated" : "2016-04-29T10:51:07.000-05:00", "internal" : false, "primary_external_id" : "RGD:11073608", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by TALEN mutagenesis. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequence", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:29374012", "RGD:13702880", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dopamine receptor D1; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "display_text" : "dopamine receptor D1; CRISPR/Cas9 system induced mutant 1, Institute of Neuroscience, Chinese Academy of Sciences", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Drd1[em1Ionsz]", "display_text" : "Drd1em1Ionsz", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Drd1em1Ionsz", "display_text" : "Drd1em1Ionsz", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11073717", "page_area" : "allele", "display_name" : "RGD:11073717" } }, "date_created" : "2016-05-04T12:46:54.000-05:00", "date_updated" : "2016-05-04T12:46:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:11073717", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10047082" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "JunD proto-oncogene, AP-1 transcription factor subunit; zinc finger nuclease induced mutant 1, Timothy Aitman", "display_text" : "JunD proto-oncogene, AP-1 transcription factor subunit; zinc finger nuclease induced mutant 1, Timothy Aitman", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Jund[em1Tja]", "display_text" : "Jundem1Tja", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Jundem1Tja", "display_text" : "Jundem1Tja", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11084926", "page_area" : "allele", "display_name" : "RGD:11084926" } }, "date_created" : "2016-06-01T10:00:59.000-05:00", "date_updated" : "2016-06-01T10:00:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:11084926", "note_dtos" : [ { "internal" : false, "free_text" : "The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:2292495" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neuropeptide Y; zinc finger nuclease induced mutant 6, Sigma Advanced Genetic Engineering Labs", "display_text" : "neuropeptide Y; zinc finger nuclease induced mutant 6, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Npy[em6Sage]", "display_text" : "Npyem6Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Npyem6Sage", "display_text" : "Npyem6Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11530022", "page_area" : "allele", "display_name" : "RGD:11530022" } }, "date_created" : "2016-08-19T00:00:00.000-05:00", "date_updated" : "2016-08-19T15:35:48.000-05:00", "internal" : false, "primary_external_id" : "RGD:11530022", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 26-bp deletion at the targeted site, including 6 bp in intron 1 and 20 bp in exon 2.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27461754", "RGD:11530013" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coagulation factor VIII, procoagulant component; zinc finger nuclease induced mutant1, Sage", "display_text" : "coagulation factor VIII, procoagulant component; zinc finger nuclease induced mutant1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-08-25T12:02:56.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "F8[em1Sage]", "display_text" : "F8em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "zinc finger nuclease induced mutant1, Sage, Ycb", "display_text" : "zinc finger nuclease induced mutant1, Sage, Ycb", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "coagulation factor VIII, procoagulant component", "display_text" : "coagulation factor VIII, procoagulant component", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "F8em1Sage", "display_text" : "F8em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11531096", "page_area" : "allele", "display_name" : "RGD:11531096" } }, "date_created" : "2016-08-25T00:00:00.000-05:00", "date_updated" : "2016-08-25T16:51:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:11531096", "note_dtos" : [ { "internal" : false, "free_text" : "This F8 mutant allele carrying a 13-bp deletion in exon 16 causing a premature translation stop in the C-terminal part of the A3 domain.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24931420", "PMID:27060449", "PMID:31899798", "RGD:11530071", "RGD:150520059", "RGD:150520060" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATPase copper transporting beta; hepatitis", "display_text" : "ATPase copper transporting beta; hepatitis", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-04-03T16:30:25.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-02-27T15:54:40.000-06:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-09-06T10:44:26.000-05:00", "nomenclature_event_name" : "data_merged" } ], "allele_secondary_id_dtos" : [ { "internal" : false, "date_updated" : "2017-07-21T13:48:58.000-05:00", "secondary_id" : "RGD:11532743", "date_created" : "2016-09-06T10:43:57.000-05:00", "obsolete" : true } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Atp7b[hts]", "display_text" : "Atp7bhts", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Atp[hts]", "display_text" : "Atphts", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Atp7bhts", "display_text" : "Atp7bhts", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "ATPase copper transporting beta, hepatitis", "display_text" : "ATPase copper transporting beta, hepatitis", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11532742", "page_area" : "allele", "display_name" : "RGD:11532742" } }, "date_created" : "2016-09-06T10:41:22.000-05:00", "date_updated" : "2017-07-21T13:48:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:11532742", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneously deletion mutant found in LEC rats. The deletion removes at least 900 bp of the coding region at the 3' end, includes the crucial ATP binding domain and extends downstream of the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:11509115", "PMID:1561010", "PMID:17303181", "PMID:17434290", "PMID:2022751", "PMID:24358170", "PMID:30733544", "PMID:3392951", "PMID:3429843", "PMID:7951327", "PMID:8291609", "RGD:1302456", "RGD:1302497", "RGD:15036800", "RGD:15036817", "RGD:2292672", "RGD:25823141", "RGD:25823147", "RGD:25823153", "RGD:25823154", "RGD:35316074", "RGD:631728" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ankyrin repeat and sterile alpha motif domain containing 6, polycystic kidney disease", "display_text" : "ankyrin repeat and sterile alpha motif domain containing 6, polycystic kidney disease", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-03-14T13:29:06.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-29T15:27:15.000-06:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-09-16T15:18:59.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_secondary_id_dtos" : [ { "internal" : false, "date_updated" : "2017-07-21T13:37:39.000-05:00", "secondary_id" : "RGD:11535002", "date_created" : "2016-09-16T16:12:38.000-05:00", "obsolete" : true } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Anks6[PKD]", "display_text" : "Anks6PKD", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Anks6 [PKD(p.R823W)]", "display_text" : "Anks6 PKD(p.R823W)", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Anks6 PKD", "display_text" : "Anks6 PKD", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Anks6 [PKD]", "display_text" : "Anks6 PKD", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11534996", "page_area" : "allele", "display_name" : "RGD:11534996" } }, "date_created" : "2016-09-16T15:10:47.000-05:00", "date_updated" : "2017-07-21T13:37:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:11534996", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneous missense mutant found in a polycystic kidney diseased male Sprague Dawley rat. The mutation was a C to T transition that replaced an arginine with a tryptophan at amino acid 823 in the protein sequence.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:16207829", "PMID:21119215", "PMID:7933831", "RGD:11534987", "RGD:1300446", "RGD:7207426" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "polycystic kidney and hepatic disease 1,polycystic kidney disease", "display_text" : "polycystic kidney and hepatic disease 1,polycystic kidney disease", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-09-22T16:28:19.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Pkhd1[pck]", "display_text" : "Pkhd1pck", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pkdh1[pck]", "display_text" : "Pkdh1pck", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Pkhd1pck", "display_text" : "Pkhd1pck", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11535943", "page_area" : "allele", "display_name" : "RGD:11535943" } }, "date_created" : "2016-09-22T16:21:45.000-05:00", "date_updated" : "2016-09-22T16:33:49.000-05:00", "internal" : false, "primary_external_id" : "RGD:11535943", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneously deletion mutant developed in a female rat with polycysts on both kidney and liver in the colony of Crj:CD (SD) rats. The mutation was a splicing change, IVS35-2A>T that caused skipping of the 157-bp exon36, leading to a frame shift.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:10803363", "PMID:11919560", "RGD:1580540", "RGD:70439" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant5, Medical College of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T14:59:10.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T13:27:42.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpv4[em5Mcwi]", "display_text" : "Trpv4em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "two pore segment channel 2", "display_text" : "two pore segment channel 2", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "ZFN induced mutant5, Medical College of Wisconsin", "display_text" : "ZFN induced mutant5, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Trpv4em5Mcwi", "display_text" : "Trpv4em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553847", "page_area" : "allele", "display_name" : "RGD:11553847" } }, "date_created" : "2016-10-14T13:50:22.000-05:00", "date_updated" : "2016-10-14T13:50:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553847", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily V, member 4; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:06:52.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpv4[em4Mcwi]", "display_text" : "Trpv4em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trpv4em4Mcwi", "display_text" : "Trpv4em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553851", "page_area" : "allele", "display_name" : "RGD:11553851" } }, "date_created" : "2016-10-14T14:36:05.000-05:00", "date_updated" : "2016-10-14T15:03:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553851", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "vanin 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "display_text" : "vanin 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-01-26T13:40:07.000-06:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-01-26T13:39:39.000-06:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:11:47.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Vnn1[em2Mcwi]", "display_text" : "Vnn1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Vnn1[em1(N131S)Mcwi]", "display_text" : "Vnn1em1(N131S)Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Vnn1[tm1(N131S)Mcwi]", "display_text" : "Vnn1tm1(N131S)Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "vanin 1; CRISPR/Cas9 induced mutant 1 (N131S), Medical College of Wisconsin", "display_text" : "vanin 1; CRISPR/Cas9 induced mutant 1 (N131S), Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Vnn1em2Mcwi", "display_text" : "Vnn1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553853", "page_area" : "allele", "display_name" : "RGD:11553853" } }, "date_created" : "2016-10-14T14:50:38.000-05:00", "date_updated" : "2016-10-14T14:53:03.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553853", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SHC adaptor protein 1; ZFN induced mutant 1, Medical College of Wisconsin", "display_text" : "SHC adaptor protein 1; ZFN induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:52:53.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-14T15:28:52.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Shc1[em1Mcwi]", "display_text" : "Shc1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "p66Shc[em1Mcwi]", "display_text" : "p66Shcem1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Shc1em1Mcwi", "display_text" : "Shc1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553854", "page_area" : "allele", "display_name" : "RGD:11553854" } }, "date_created" : "2016-10-14T15:11:52.000-05:00", "date_updated" : "2016-10-14T15:28:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553854", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27270176", "RGD:12792230" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "vanin 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "vanin 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:21:41.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Vnn1[em1Mcwi]", "display_text" : "Vnn1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Vnn1em1Mcwi", "display_text" : "Vnn1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553856", "page_area" : "allele", "display_name" : "RGD:11553856" } }, "date_created" : "2016-10-14T15:33:10.000-05:00", "date_updated" : "2016-10-14T15:33:10.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553856", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp deletion in Exon 3 of the Vnn1 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RNA binding motif protein 20; ZFN induced mutant 5, Medical College of Wisconsin", "display_text" : "RNA binding motif protein 20; ZFN induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:28:36.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rbm20[em5Mcwi]", "display_text" : "Rbm20em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rbm20em5Mcwi", "display_text" : "Rbm20em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553857", "page_area" : "allele", "display_name" : "RGD:11553857" } }, "date_created" : "2016-10-14T15:36:51.000-05:00", "date_updated" : "2016-10-14T15:36:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553857", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 5; ZFN induced mutant2, Medical College of Wisconsin", "display_text" : "sodium voltage-gated channel alpha subunit 5; ZFN induced mutant2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Scn5a[em2Mcwi]", "display_text" : "Scn5aem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Scn5aem2Mcwi", "display_text" : "Scn5aem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553859", "page_area" : "allele", "display_name" : "RGD:11553859" } }, "date_created" : "2016-10-14T16:00:45.000-05:00", "date_updated" : "2016-10-14T16:00:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553859", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "FMRP translational regulator 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "display_text" : "FMRP translational regulator 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-03-26T11:58:30.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fmr1[em2Mcwi]", "display_text" : "Fmr1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fmr1em2Mcwi", "display_text" : "Fmr1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "fragile X mental retardation 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "display_text" : "fragile X mental retardation 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553872", "page_area" : "allele", "display_name" : "RGD:11553872" } }, "date_created" : "2016-10-17T09:32:19.000-05:00", "date_updated" : "2016-10-17T09:32:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553872", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in exon 7 of the Fmr1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32144356", "PMID:38107412", "PMID:38378836", "RGD:35668860", "RGD:401976422", "RGD:401976423" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "FMRP translational regulator 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "display_text" : "FMRP translational regulator 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-03-26T12:01:08.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fmr1[em4Mcwi]", "display_text" : "Fmr1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fmr1em4Mcwi", "display_text" : "Fmr1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "fragile X mental retardation 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "display_text" : "fragile X mental retardation 1; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553874", "page_area" : "allele", "display_name" : "RGD:11553874" } }, "date_created" : "2016-10-17T09:44:18.000-05:00", "date_updated" : "2016-10-17T09:44:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553874", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in exon 7 of the Fmr1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:25:30.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx1[em1Mcwi]", "display_text" : "P2rx1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "P2rx1em1Mcwi", "display_text" : "P2rx1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553876", "page_area" : "allele", "display_name" : "RGD:11553876" } }, "date_created" : "2016-10-17T09:51:27.000-05:00", "date_updated" : "2016-10-17T09:51:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553876", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RNA binding motif protein 20; ZFN induced mutant 10, Medical College of Wisconsin", "display_text" : "RNA binding motif protein 20; ZFN induced mutant 10, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:34:38.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_secondary_id_dtos" : [ { "internal" : false, "date_updated" : "2017-07-21T13:24:56.000-05:00", "secondary_id" : "RGD:11553879", "date_created" : "2016-10-17T10:36:50.000-05:00", "obsolete" : true } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rbm20[em10Mcwi]", "display_text" : "Rbm20em10Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rbm20em10Mcwi", "display_text" : "Rbm20em10Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553880", "page_area" : "allele", "display_name" : "RGD:11553880" } }, "date_created" : "2016-10-17T10:38:22.000-05:00", "date_updated" : "2017-07-21T13:24:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553880", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RNA binding motif protein 20; ZFN induced mutant 8, Medical College of Wisconsin", "display_text" : "RNA binding motif protein 20; ZFN induced mutant 8, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-18T15:31:07.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rbm20[em8Mcwi]", "display_text" : "Rbm20em8Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rbm20em8Mcwi", "display_text" : "Rbm20em8Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553882", "page_area" : "allele", "display_name" : "RGD:11553882" } }, "date_created" : "2016-10-17T10:55:17.000-05:00", "date_updated" : "2016-10-17T10:55:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553882", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tumor protein p53;zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "tumor protein p53;zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T11:25:39.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T11:24:08.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tp53[em3Mcwi]", "display_text" : "Tp53em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "tumor protein p53", "display_text" : "tumor protein p53", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Tp53em3Mcwi", "display_text" : "Tp53em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553885", "page_area" : "allele", "display_name" : "RGD:11553885" } }, "date_created" : "2016-10-17T11:19:55.000-05:00", "date_updated" : "2016-10-17T11:19:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553885", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T11:45:37.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpc3[em2Mcwi]", "display_text" : "Trpc3em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 3", "display_text" : "transient receptor potential cation channel, subfamily C, member 3", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin", "display_text" : "CRISPR/Cas9 induced mutant 2, Medical college of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Trpc3em2Mcwi", "display_text" : "Trpc3em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553887", "page_area" : "allele", "display_name" : "RGD:11553887" } }, "date_created" : "2016-10-17T11:44:40.000-05:00", "date_updated" : "2016-10-17T11:44:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553887", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 1, Medical college of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily C, member 3; CRISPR/Cas9 induced mutant 1, Medical college of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpc3[em1Mcwi]", "display_text" : "Trpc3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trpc3em1Mcwi", "display_text" : "Trpc3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553891", "page_area" : "allele", "display_name" : "RGD:11553891" } }, "date_created" : "2016-10-17T11:51:23.000-05:00", "date_updated" : "2016-10-17T11:51:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553891", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "two pore segment channel 2; ZFN induced mutant 5, Medical College of Wisconsin", "display_text" : "two pore segment channel 2; ZFN induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T13:29:24.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tpcn2[em1Mcwi]", "display_text" : "Tpcn2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "two pore segment channel 2", "display_text" : "two pore segment channel 2", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "ZFN induced mutant5, Medical College of Wisconsin", "display_text" : "ZFN induced mutant5, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Tpcn2em1Mcwi", "display_text" : "Tpcn2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553893", "page_area" : "allele", "display_name" : "RGD:11553893" } }, "date_created" : "2016-10-17T13:28:54.000-05:00", "date_updated" : "2016-10-17T13:28:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553893", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Spp1[em1Mcwi]", "display_text" : "Spp1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Spp1em1Mcwi", "display_text" : "Spp1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553895", "page_area" : "allele", "display_name" : "RGD:11553895" } }, "date_created" : "2016-10-17T13:36:33.000-05:00", "date_updated" : "2016-10-17T13:36:33.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553895", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily V, member 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily V, member 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpv2[em1Mcwi]", "display_text" : "Trpv2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trpv2em1Mcwi", "display_text" : "Trpv2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553898", "page_area" : "allele", "display_name" : "RGD:11553898" } }, "date_created" : "2016-10-17T13:43:33.000-05:00", "date_updated" : "2016-10-17T13:43:33.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553898", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpc6[em3Mcwi]", "display_text" : "Trpc6em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trpc6em3Mcwi", "display_text" : "Trpc6em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553901", "page_area" : "allele", "display_name" : "RGD:11553901" } }, "date_created" : "2016-10-17T14:33:42.000-05:00", "date_updated" : "2016-10-17T14:33:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553901", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SHC adaptor protein 1; ZFN induced mutant 3, Medical College of Wisconsin", "display_text" : "SHC adaptor protein 1; ZFN induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Shc1[em3Mcwi]", "display_text" : "Shc1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "p66Shcem3Mcwi", "display_text" : "p66Shcem3Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Shc1em3Mcwi", "display_text" : "Shc1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553903", "page_area" : "allele", "display_name" : "RGD:11553903" } }, "date_created" : "2016-10-17T14:41:37.000-05:00", "date_updated" : "2016-10-17T14:41:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553903", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-01-26T13:08:54.000-06:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-01-26T11:38:20.000-06:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T15:35:23.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpc6[em4Mcwi]", "display_text" : "Trpc6em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trpc6 CRISPR/Cas9 induced mutant 1 (P112Q)", "display_text" : "Trpc6 CRISPR/Cas9 induced mutant 1 (P112Q)", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Trpc6[em1(P112Q)Mcwi]", "display_text" : "Trpc6em1(P112Q)Mcwi", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Trpc6em4Mcwi", "display_text" : "Trpc6em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553907", "page_area" : "allele", "display_name" : "RGD:11553907" } }, "date_created" : "2016-10-17T15:14:49.000-05:00", "date_updated" : "2016-10-17T15:14:49.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553907", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily C, member 6; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpc6[em1Mcwi]", "display_text" : "Trpc6em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trpc6em1Mcwi", "display_text" : "Trpc6em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553911", "page_area" : "allele", "display_name" : "RGD:11553911" } }, "date_created" : "2016-10-17T15:38:42.000-05:00", "date_updated" : "2016-10-17T15:38:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553911", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29923767", "RGD:149735534" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SHC adaptor protein 1; ZFN induced mutant 4, Medical College of Wisconsin", "display_text" : "SHC adaptor protein 1; ZFN induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T15:48:42.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Shc1[em4Mcwi]", "display_text" : "Shc1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "p66Shcem4Mcwi", "display_text" : "p66Shcem4Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "p66Shc[em4Mcwi]", "display_text" : "p66Shcem4Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Shc1em4Mcwi", "display_text" : "Shc1em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553913", "page_area" : "allele", "display_name" : "RGD:11553913" } }, "date_created" : "2016-10-17T15:45:40.000-05:00", "date_updated" : "2016-10-17T15:45:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553913", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 13-bp deletion in Exon 2 of the Shc1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27270176", "RGD:12792230" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SHC adaptor protein 1; ZFN induced mutant 5, Medical College of Wisconsin", "display_text" : "SHC adaptor protein 1; ZFN induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-01-25T15:37:02.000-06:00", "nomenclature_event_name" : "symbol_and_name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T15:57:39.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Shc1[em5Mcwi]", "display_text" : "Shc1em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "p66Shctm1(S36A)Mcwi", "display_text" : "p66Shctm1(S36A)Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Shc1[em1(S36A)Mcwi]", "display_text" : "Shc1em1(S36A)Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "SHC adaptor protein 1; ZFN induced mutant 1 (S36A), Medical College of Wisconsin", "display_text" : "SHC adaptor protein 1; ZFN induced mutant 1 (S36A), Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Shc1em5Mcwi", "display_text" : "Shc1em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11553915", "page_area" : "allele", "display_name" : "RGD:11553915" } }, "date_created" : "2016-10-17T15:56:32.000-05:00", "date_updated" : "2016-10-17T15:56:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:11553915", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a T>C substitution to generate S36A in Exon 2 of theShc1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27270176", "RGD:12792230" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "locus regulating alcohol preference; CRISPR/Cas9 system induced mutant 1,Geh", "display_text" : "locus regulating alcohol preference; CRISPR/Cas9 system induced mutant 1,Geh", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-11T14:43:40.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrap[em1Geh]", "display_text" : "Lrapem1Geh", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "locus regulating alcohol preference, CRISPR/Cas9 system induced mutant 1,Geh", "display_text" : "locus regulating alcohol preference, CRISPR/Cas9 system induced mutant 1,Geh", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Lrapem1Geh", "display_text" : "Lrapem1Geh", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11561896", "page_area" : "allele", "display_name" : "RGD:11561896" } }, "date_created" : "2016-11-10T11:30:39.000-06:00", "date_updated" : "2016-11-10T11:30:39.000-06:00", "internal" : false, "primary_external_id" : "RGD:11561896", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 genome editing system was used to create a 618-bp deletion in rat Lrap (RGD:7734862) gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "gamma-aminobutyric acid type A receptor beta 1 subunit; Bhr2 transposon insertion 1, Wmukf", "display_text" : "gamma-aminobutyric acid type A receptor beta 1 subunit; Bhr2 transposon insertion 1, Wmukf", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-11T14:42:36.000-06:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-11T14:41:59.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Gabrb1[Tn(pb-Bhr2)1Wmukf]", "display_text" : "Gabrb1Tn(pb-Bhr2)1Wmukf", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon-incuded mutant 1, Wmukf", "display_text" : "gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon-incuded mutant 1, Wmukf", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon insertion 1, Wmukf", "display_text" : "gamma-aminobutyric acid type A receptor beta 1 subunit,Bhr2 transposon insertion 1, Wmukf", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Gabrb1Tn(pb-Bhr2)1Wmukf", "display_text" : "Gabrb1Tn(pb-Bhr2)1Wmukf", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11561925", "page_area" : "allele", "display_name" : "RGD:11561925" } }, "date_created" : "2016-11-11T13:30:04.000-06:00", "date_updated" : "2016-11-11T13:30:04.000-06:00", "internal" : false, "primary_external_id" : "RGD:11561925", "note_dtos" : [ { "internal" : false, "free_text" : "Transposon \"Bhr2\" was inserted into intron 4 of Gabrb1 gene.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf", "display_text" : "spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-11T14:40:49.000-06:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-11T14:39:57.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Samt4[Tn(pb-Bhr7)1Wmukf]", "display_text" : "Samt4Tn(pb-Bhr7)1Wmukf", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "spermatogenesis associated multipass transmembrane protein 4, Bhr7 transposon-incuded mutant 1, Wmukf)", "display_text" : "spermatogenesis associated multipass transmembrane protein 4, Bhr7 transposon-incuded mutant 1, Wmukf)", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf)", "display_text" : "spermatogenesis associated multipass transmembrane protein 4; Bhr7 transposon insertion 1, Wmukf)", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Samt4Tn(pb-Bhr7)1Wmukf", "display_text" : "Samt4Tn(pb-Bhr7)1Wmukf", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11561928", "page_area" : "allele", "display_name" : "RGD:11561928" } }, "date_created" : "2016-11-11T13:46:19.000-06:00", "date_updated" : "2016-11-11T13:46:19.000-06:00", "internal" : false, "primary_external_id" : "RGD:11561928", "note_dtos" : [ { "internal" : false, "free_text" : "Transposon \"Bhr7\" was inserted into the first Met-coding exon region of rat Samt4 gene", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "zinc finger and BTB domain containing 20;Bhr7 transposon insertion 1, Wmukf", "display_text" : "zinc finger and BTB domain containing 20;Bhr7 transposon insertion 1, Wmukf", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-15T13:51:14.000-06:00", "nomenclature_event_name" : "data_merged" } ], "allele_secondary_id_dtos" : [ { "internal" : false, "date_updated" : "2017-07-21T13:20:33.000-05:00", "secondary_id" : "RGD:11561973", "date_created" : "2016-11-15T13:50:49.000-06:00", "obsolete" : true } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Zbtb20[Tn(pb-Bhr7)1Wmukf]", "display_text" : "Zbtb20Tn(pb-Bhr7)1Wmukf", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Zbtb20Tn(pb-Bhr7)1Wmukf", "display_text" : "Zbtb20Tn(pb-Bhr7)1Wmukf", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11561972", "page_area" : "allele", "display_name" : "RGD:11561972" } }, "date_created" : "2016-11-15T13:47:04.000-06:00", "date_updated" : "2017-07-21T13:20:33.000-05:00", "internal" : false, "primary_external_id" : "RGD:11561972", "note_dtos" : [ { "internal" : false, "free_text" : "Transposon \"Bhr7\" was inserted into the Intron 3 of Zbtb20 gene.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phospholipase C beta 1;Bhr2 transposon insertion 1, Wmukf", "display_text" : "phospholipase C beta 1;Bhr2 transposon insertion 1, Wmukf", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plcb1[Tn(pb-Bhr2)1Wmukf]", "display_text" : "Plcb1Tn(pb-Bhr2)1Wmukf", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plcb1Tn(pb-Bhr2)1Wmukf", "display_text" : "Plcb1Tn(pb-Bhr2)1Wmukf", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11561974", "page_area" : "allele", "display_name" : "RGD:11561974" } }, "date_created" : "2016-11-15T14:02:03.000-06:00", "date_updated" : "2016-11-15T14:02:03.000-06:00", "internal" : false, "primary_external_id" : "RGD:11561974", "note_dtos" : [ { "internal" : false, "free_text" : "Transposon \"Bhr2\" was inserted into Plcb1 gene.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aspartoacylase;TALEN induced mutant 31,Kyo", "display_text" : "aspartoacylase;TALEN induced mutant 31,Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Aspa[em31Kyo]", "display_text" : "Aspaem31Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Aspaem31Kyo", "display_text" : "Aspaem31Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11564344", "page_area" : "allele", "display_name" : "RGD:11564344" } }, "date_created" : "2016-11-16T15:28:04.000-06:00", "date_updated" : "2016-11-16T15:28:04.000-06:00", "internal" : false, "primary_external_id" : "RGD:11564344", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aspartoacylase;TALEN induced mutant 34,Kyo", "display_text" : "aspartoacylase;TALEN induced mutant 34,Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Aspa[em34Kyo]", "display_text" : "Aspaem34Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Aspaem34Kyo", "display_text" : "Aspaem34Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11564348", "page_area" : "allele", "display_name" : "RGD:11564348" } }, "date_created" : "2016-11-16T16:01:52.000-06:00", "date_updated" : "2016-11-16T16:01:52.000-06:00", "internal" : false, "primary_external_id" : "RGD:11564348", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27026062", "PMID:32507787", "RGD:1302502", "RGD:13464274", "RGD:150429620" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coiled-coil domain containing 85C; TALEN induced mutant1,Kyo", "display_text" : "coiled-coil domain containing 85C; TALEN induced mutant1,Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ccdc85c[em1Kyo]", "display_text" : "Ccdc85cem1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ccdc85cem1Kyo", "display_text" : "Ccdc85cem1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11565090", "page_area" : "allele", "display_name" : "RGD:11565090" } }, "date_created" : "2016-11-18T15:14:15.000-06:00", "date_updated" : "2016-11-18T15:14:15.000-06:00", "internal" : false, "primary_external_id" : "RGD:11565090", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31341137", "RGD:150520163" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Titin; zinc finger nuclease induced mutant 1,Sigma Advanced Genetic Engineering Labs", "display_text" : "Titin; zinc finger nuclease induced mutant 1,Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-28T16:15:52.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ttn[em1Sage]", "display_text" : "Ttnem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Titin; zinc finger nuclease induced mutant1,Sigma Advanced Genetic Engineering Labs", "display_text" : "Titin; zinc finger nuclease induced mutant1,Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "TTNtvA", "display_text" : "TTNtvA", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Ttnem1Sage", "display_text" : "Ttnem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11565825", "page_area" : "allele", "display_name" : "RGD:11565825" } }, "date_created" : "2016-11-28T14:19:50.000-06:00", "date_updated" : "2016-11-28T14:19:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:11565825", "note_dtos" : [ { "internal" : false, "free_text" : "The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27869827", "RGD:11565821" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Titin; zinc finger nuclease induced mutant 2,Sigma Advanced Genetic Engineering Labs", "display_text" : "Titin; zinc finger nuclease induced mutant 2,Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-11-28T16:15:19.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ttn[em2Sage]", "display_text" : "Ttnem2Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "TTNtvZ", "display_text" : "TTNtvZ", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Titin; zinc finger nuclease induced mutant2,Sigma Advanced Genetic Engineering Labs", "display_text" : "Titin; zinc finger nuclease induced mutant2,Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Ttnem2Sage", "display_text" : "Ttnem2Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11565827", "page_area" : "allele", "display_name" : "RGD:11565827" } }, "date_created" : "2016-11-28T16:09:16.000-06:00", "date_updated" : "2016-11-28T16:09:16.000-06:00", "internal" : false, "primary_external_id" : "RGD:11565827", "note_dtos" : [ { "internal" : false, "free_text" : "The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27869827", "RGD:11565821" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "methyl CpG binding protein 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "methyl CpG binding protein 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-12-07T15:28:42.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Mecp2[em1Sage]", "display_text" : "Mecp2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "methyl CpG binding protein 2;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "methyl CpG binding protein 2;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Mecp2em1Sage", "display_text" : "Mecp2em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568035", "page_area" : "allele", "display_name" : "RGD:11568035" } }, "date_created" : "2016-12-06T14:44:02.000-06:00", "date_updated" : "2016-12-06T14:44:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568035", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. The resulting mutation was a knockout of the methyl CpG binding protein 2 (Mecp2) demonstrated by western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27313794", "PMID:27329765", "PMID:27365498", "PMID:28201743", "RGD:11568036", "RGD:11568037", "RGD:124713407", "RGD:40924662" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-03-26T12:02:44.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fmr1[em1Sage]", "display_text" : "Fmr1em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fmr1em1Sage", "display_text" : "Fmr1em1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568041", "page_area" : "allele", "display_name" : "RGD:11568041" } }, "date_created" : "2016-12-06T15:08:24.000-06:00", "date_updated" : "2016-12-06T15:08:24.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568041", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp and caused knockout of Fmr1 demonstrated by western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24773431", "PMID:26166728", "PMID:27465362", "PMID:30877790", "PMID:34751141", "PMID:35328827", "PMID:36536454", "PMID:36581671", "RGD:11080370", "RGD:38548926", "RGD:38548928", "RGD:401976427", "RGD:401976434", "RGD:405100966", "RGD:405100968", "RGD:9831152" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neurexin 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "neurexin 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nrxn1[em1]", "display_text" : "Nrxn1em1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nrxn1[tm1Sage", "display_text" : "Nrxn1tm1Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Nrxn1em1", "display_text" : "Nrxn1em1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568059", "page_area" : "allele", "display_name" : "RGD:11568059" } }, "date_created" : "2016-12-07T15:10:29.000-06:00", "date_updated" : "2021-05-21T11:05:30.000-05:00", "internal" : false, "primary_external_id" : "RGD:11568059", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. The resulting mutation was a a 16-bp deletion in Exon 1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25420124", "RGD:12914797" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphatase and tensin homolog; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "phosphatase and tensin homolog; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pten[em1Sage]", "display_text" : "Ptenem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ptenem1Sage", "display_text" : "Ptenem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568063", "page_area" : "allele", "display_name" : "RGD:11568063" } }, "date_created" : "2016-12-07T15:32:41.000-06:00", "date_updated" : "2016-12-07T15:32:41.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568063", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutamate metabotropic receptor 5; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "glutamate metabotropic receptor 5; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Grm5[em1Sage]", "display_text" : "Grm5em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Grm5[tm1Sage]", "display_text" : "Grm5tm1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Grm5em1Sage", "display_text" : "Grm5em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568068", "page_area" : "allele", "display_name" : "RGD:11568068" } }, "date_created" : "2016-12-07T16:00:37.000-06:00", "date_updated" : "2016-12-07T16:00:37.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568068", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "MET proto-oncogene, receptor tyrosine kinase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "MET proto-oncogene, receptor tyrosine kinase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Met[em1Sage]", "display_text" : "Metem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Met[tm1Sage]", "display_text" : "Mettm1Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Metem1Sage", "display_text" : "Metem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568072", "page_area" : "allele", "display_name" : "RGD:11568072" } }, "date_created" : "2016-12-07T16:35:50.000-06:00", "date_updated" : "2016-12-07T16:35:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568072", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "contactin associated protein-like 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "contactin associated protein-like 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cntnap2[em1Sage]", "display_text" : "Cntnap2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cntnap2[tm1Sage]", "display_text" : "Cntnap2tm1Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Cntnap2em1Sage", "display_text" : "Cntnap2em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568647", "page_area" : "allele", "display_name" : "RGD:11568647" } }, "date_created" : "2016-12-08T14:46:38.000-06:00", "date_updated" : "2016-12-08T14:46:38.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568647", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28364455", "PMID:30126973", "RGD:126790476", "RGD:12880397" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neuroligin 3; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "neuroligin 3; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nlgn3[em1Sage]", "display_text" : "Nlgn3em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nlgn3[tm1Sage]", "display_text" : "Nlgn3tm1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nlgn3em1Sage", "display_text" : "Nlgn3em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568701", "page_area" : "allele", "display_name" : "RGD:11568701" } }, "date_created" : "2016-12-13T14:02:46.000-06:00", "date_updated" : "2016-12-13T14:02:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568701", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. The resulting mutation was a 58bp deletion of the exon5/intron 5 junction occurred at 9874bp-9931bp. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24773431", "PMID:28958035", "RGD:126790492", "RGD:9831152" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "calcium voltage-gated channel subunit alpha1 C; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "calcium voltage-gated channel subunit alpha1 C; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cacna1c[em1Sage]", "display_text" : "Cacna1cem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cacna1c[tm1Sage]", "display_text" : "Cacna1ctm1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Cacna1cem1Sage", "display_text" : "Cacna1cem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11568704", "page_area" : "allele", "display_name" : "RGD:11568704" } }, "date_created" : "2016-12-13T14:37:03.000-06:00", "date_updated" : "2016-12-13T14:37:03.000-06:00", "internal" : false, "primary_external_id" : "RGD:11568704", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Cacna1c into Sprague Dawley embryos. This allele contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an early stop codon in exon 6.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29739816", "PMID:29800644", "PMID:30902660", "RGD:42724470", "RGD:42724471", "RGD:42724472" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "keratin 71; autosomal dominant Rex", "display_text" : "keratin 71; autosomal dominant Rex", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-12-14T16:42:16.000-06:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Krt71[Rex]", "display_text" : "Krt71Rex", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "keratin 71; autosomal dominant Re", "display_text" : "keratin 71; autosomal dominant Re", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Krt71[Re]", "display_text" : "Krt71Re", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Krt71Rex", "display_text" : "Krt71Rex", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11570416", "page_area" : "allele", "display_name" : "RGD:11570416" } }, "date_created" : "2016-12-14T16:39:17.000-06:00", "date_updated" : "2016-12-14T16:39:17.000-06:00", "internal" : false, "primary_external_id" : "RGD:11570416", "note_dtos" : [ { "internal" : false, "free_text" : "A 7-bp deletion at the splice acceptor site of the first -> second coding exons of the keratin 71 (Krt71) gene is identified in this allele.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20179389", "RGD:11570415" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor;corpulent", "display_text" : "leptin receptor;corpulent", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[cp]", "display_text" : "Leprcp", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "fa[k]", "display_text" : "fak", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Leprcp", "display_text" : "Leprcp", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:11570565", "page_area" : "allele", "display_name" : "RGD:11570565" } }, "date_created" : "2016-12-20T15:35:28.000-06:00", "date_updated" : "2016-12-20T15:35:28.000-06:00", "internal" : false, "primary_external_id" : "RGD:11570565", "note_dtos" : [ { "internal" : false, "free_text" : "Nonsense mutation of leptin receptor gene identified in the obese spontaneously hypertensive Koletsky rat. The T to A transversion at 2289 results in premature stop at position 763.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:8841178", "PMID:9032111", "RGD:11570540", "RGD:1600612" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 27, subfamily b, polypeptide 1; CRISPR/Cas9 induced mutant 1, Thka", "display_text" : "cytochrome P450, family 27, subfamily b, polypeptide 1; CRISPR/Cas9 induced mutant 1, Thka", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp27b1[em1Thka]", "display_text" : "Cyp27b1em1Thka", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:124713545", "page_area" : "allele", "display_name" : "RGD:124713545" } }, "date_created" : "2021-03-19T12:35:51.000-05:00", "date_updated" : "2021-03-19T12:35:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:124713545", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32231239", "RGD:32716373" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 1, Thka", "display_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 1, Thka", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Vdr[em1Thka]", "display_text" : "Vdrem1Thka", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:124713547", "page_area" : "allele", "display_name" : "RGD:124713547" } }, "date_created" : "2021-03-19T13:02:24.000-05:00", "date_updated" : "2021-03-19T13:02:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:124713547", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32231239", "RGD:32716373" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 2, Thka", "display_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 2, Thka", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Vdr[em2Thka]", "display_text" : "Vdrem2Thka", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:124713550", "page_area" : "allele", "display_name" : "RGD:124713550" } }, "date_created" : "2021-03-19T15:41:55.000-05:00", "date_updated" : "2021-03-19T15:41:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:124713550", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was created by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32231239", "RGD:32716373" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "FMRP translational regulator 1; CRISPR/Cas9 induced mutant1, Mzhe", "display_text" : "FMRP translational regulator 1; CRISPR/Cas9 induced mutant1, Mzhe", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fmr1[em1Mzhe]", "display_text" : "Fmr1em1Mzhe", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:124715480", "page_area" : "allele", "display_name" : "RGD:124715480" } }, "date_created" : "2021-03-26T12:12:24.000-05:00", "date_updated" : "2021-03-26T12:12:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:124715480", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of rat Fmr1 gene of outbred Sprague-Dawley embryos. The resulting mutation a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification resulted in a frame-shift starting from the second Agenet-like 2 domain in Fmr1 protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28894415", "RGD:38501107" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 1, Lizh", "display_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 1, Lizh", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pon1[em1Lizh]", "display_text" : "Pon1em1Lizh", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:124715481", "page_area" : "allele", "display_name" : "RGD:124715481" } }, "date_created" : "2021-03-26T12:27:21.000-05:00", "date_updated" : "2021-03-26T12:27:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:124715481", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague-Dawley embryos.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30262871", "RGD:45073131" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "DISC1 scaffold protein; CRISPR/Cas9 induced mutant 1, Rst", "display_text" : "DISC1 scaffold protein; CRISPR/Cas9 induced mutant 1, Rst", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Disc1[em1Rst]", "display_text" : "Disc1em1Rst", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:125093747", "page_area" : "allele", "display_name" : "RGD:125093747" } }, "date_created" : "2021-03-30T14:35:17.000-05:00", "date_updated" : "2021-03-30T14:35:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:125093747", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Jhrmn", "display_text" : "nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Jhrmn", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-09T11:17:44.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-09T11:17:18.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nr3c1[em1Jhrmn]", "display_text" : "Nr3c1em1Jhrmn", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Kuan", "display_text" : "nuclear receptor subfamily 3, group C, member 1; CRISPR/Cas9 induced mutant1, Kuan", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Nr3c1[em1Kuan]", "display_text" : "Nr3c1em1Kuan", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nr3c1[em1KuanJhrmn]", "display_text" : "Nr3c1em1KuanJhrmn", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:125097487", "page_area" : "allele", "display_name" : "RGD:125097487" } }, "date_created" : "2021-03-31T17:01:20.000-05:00", "date_updated" : "2021-03-31T17:01:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:125097487", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. This allele contains CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR)", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31329100", "RGD:407571699" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "mohawk homeobox; CRISPR/Cas9 system induced mutant 1, Asah", "display_text" : "mohawk homeobox; CRISPR/Cas9 system induced mutant 1, Asah", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mkx[em1Asah]", "display_text" : "Mkxem1Asah", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126777685", "page_area" : "allele", "display_name" : "RGD:126777685" } }, "date_created" : "2021-04-07T13:33:59.000-05:00", "date_updated" : "2021-04-07T13:33:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:126777685", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out allele with 14- bp deletion causing frameshift mutation in the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27370800", "RGD:40924660" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "colony stimulating factor 1 receptor; target mutant, Tset", "display_text" : "colony stimulating factor 1 receptor; target mutant, Tset", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Csf1r[tm(EGFP)Tset]", "display_text" : "Csf1rtm(EGFP)Tset", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126781692", "page_area" : "allele", "display_name" : "RGD:126781692" } }, "date_created" : "2021-04-15T11:52:00.000-05:00", "date_updated" : "2021-04-15T11:52:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:126781692", "note_dtos" : [ { "internal" : false, "free_text" : "Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:30249809", "PMID:33450391", "RGD:126781687", "RGD:41404725" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "KiSS-1 metastasis-suppressor; targeted mutant 8, Nips", "display_text" : "KiSS-1 metastasis-suppressor; targeted mutant 8, Nips", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kiss1[tm8Nips]", "display_text" : "Kiss1tm8Nips", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126781693", "page_area" : "allele", "display_name" : "RGD:126781693" } }, "date_created" : "2021-04-15T12:21:54.000-05:00", "date_updated" : "2021-04-15T12:21:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:126781693", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was created by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spalt-like transcription factor 1; CRISPR/Cas9 induced mutant 1, Nips", "display_text" : "spalt-like transcription factor 1; CRISPR/Cas9 induced mutant 1, Nips", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sall1[em1Nips]", "display_text" : "Sall1em1Nips", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126781694", "page_area" : "allele", "display_name" : "RGD:126781694" } }, "date_created" : "2021-04-15T13:00:48.000-05:00", "date_updated" : "2021-04-15T13:00:48.000-05:00", "internal" : false, "primary_external_id" : "RGD:126781694", "note_dtos" : [ { "internal" : false, "free_text" : "Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spalt-like transcription factor 1; targeted mutant 4, Nips", "display_text" : "spalt-like transcription factor 1; targeted mutant 4, Nips", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sall1[tm4(tdTomato)Nips]", "display_text" : "Sall1tm4(tdTomato)Nips", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126781695", "page_area" : "allele", "display_name" : "RGD:126781695" } }, "date_created" : "2021-04-15T13:21:34.000-05:00", "date_updated" : "2021-04-15T13:21:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:126781695", "note_dtos" : [ { "internal" : false, "free_text" : "Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Founder animals were backcrossed to Crlj:WI. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "PR/SET domain 14; targeted mutant 1, Nips", "display_text" : "PR/SET domain 14; targeted mutant 1, Nips", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prdm14[tm1(H2BVenus)Nips]", "display_text" : "Prdm14tm1(H2BVenus)Nips", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126781696", "page_area" : "allele", "display_name" : "RGD:126781696" } }, "date_created" : "2021-04-15T13:44:30.000-05:00", "date_updated" : "2021-04-15T13:44:30.000-05:00", "internal" : false, "primary_external_id" : "RGD:126781696", "note_dtos" : [ { "internal" : false, "free_text" : "Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by Lipofectamin 2000. Founder animals were backcrossed to Crlj:WI. Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ubiquitin protein ligase E3A; CRISPR/Cas9 induced mutant1, Jue", "display_text" : "ubiquitin protein ligase E3A; CRISPR/Cas9 induced mutant1, Jue", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ube3a[em1Jue]", "display_text" : "Ube3aem1Jue", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126790465", "page_area" : "allele", "display_name" : "RGD:126790465" } }, "date_created" : "2021-04-22T10:18:32.000-05:00", "date_updated" : "2021-04-22T10:18:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:126790465", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos to induce 90kb deletion in rat Ube3a gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32066685", "RGD:126790466" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SH3 and multiple ankyrin repeat domains 2; ZFN induced mutant13, Sage", "display_text" : "SH3 and multiple ankyrin repeat domains 2; ZFN induced mutant13, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-04-23T13:39:56.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-04-23T13:39:14.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Shank2[em13Sage]", "display_text" : "Shank2em13Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126790499", "page_area" : "allele", "display_name" : "RGD:126790499" } }, "date_created" : "2021-04-23T13:38:03.000-05:00", "date_updated" : "2021-04-23T13:38:03.000-05:00", "internal" : false, "primary_external_id" : "RGD:126790499", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29970986", "RGD:126790534" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aryl hydrocarbon receptor; ZFN induced mutant2, Sage", "display_text" : "aryl hydrocarbon receptor; ZFN induced mutant2, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ahr[em2Sage]", "display_text" : "Ahrem2Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126790510", "page_area" : "allele", "display_name" : "RGD:126790510" } }, "date_created" : "2021-04-23T15:29:00.000-05:00", "date_updated" : "2021-04-23T15:29:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:126790510", "note_dtos" : [ { "internal" : false, "free_text" : "ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene. The ZFN system was injected to embryos from outbred Sprague Dawle from Harlan and one founder contained a 29-bp deletion in the rat Ahr gene. The deletion resulted in a premature stop codon within exon 2.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23859880", "PMID:27856527", "PMID:30769105", "RGD:127285625", "RGD:13204753", "RGD:407419883" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Ras and Rab interactor 1; TALEN induced mutant 1, Hcz", "display_text" : "Ras and Rab interactor 1; TALEN induced mutant 1, Hcz", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-04-26T15:00:08.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rin1[em1Hcz]", "display_text" : "Rin1em1Hcz", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rin1[em1-/-Hcz]", "display_text" : "Rin1em1-/-Hcz", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126790548", "page_area" : "allele", "display_name" : "RGD:126790548" } }, "date_created" : "2021-04-26T14:40:36.000-05:00", "date_updated" : "2021-04-26T14:40:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:126790548", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32174475", "RGD:126790555" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "mutS homolog 6; ENU induced mutant 1, Hubr", "display_text" : "mutS homolog 6; ENU induced mutant 1, Hubr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Msh6[m1Hubr]", "display_text" : "Msh6m1Hubr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126848738", "page_area" : "allele", "display_name" : "RGD:126848738" } }, "date_created" : "2021-04-28T10:40:42.000-05:00", "date_updated" : "2021-04-28T10:40:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:126848738", "note_dtos" : [ { "internal" : false, "free_text" : "The Msh6 knockout allele was generated by ENU-driven mutagenesis on Crl:WI rats. The allele carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:18417481", "RGD:2292505" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lysophosphatidic acid receptor 1; ENU induced mutant 1, Hubr", "display_text" : "lysophosphatidic acid receptor 1; ENU induced mutant 1, Hubr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lpar1[m1Hubr]", "display_text" : "Lpar1m1Hubr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126848739", "page_area" : "allele", "display_name" : "RGD:126848739" } }, "date_created" : "2021-04-28T10:46:46.000-05:00", "date_updated" : "2021-04-28T10:46:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:126848739", "note_dtos" : [ { "internal" : false, "free_text" : "This allele carried an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. This allele was identified from target-selected ENU-driven mutagenesis of male MSH6 knockout rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20531371", "RGD:13825198" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "gulonolactone (L-) oxidase; osteogenic discorder mutant", "display_text" : "gulonolactone (L-) oxidase; osteogenic discorder mutant", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-04-29T14:34:26.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-04-29T14:33:55.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Gulo[od]", "display_text" : "Gulood", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "gulonolactone (L-) oxidase; osteogenic discorderr, scurvy mutant", "display_text" : "gulonolactone (L-) oxidase; osteogenic discorderr, scurvy mutant", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Gulo[ods]", "display_text" : "Guloods", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126848761", "page_area" : "allele", "display_name" : "RGD:126848761" } }, "date_created" : "2021-04-29T14:28:59.000-05:00", "date_updated" : "2021-04-29T14:28:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:126848761", "note_dtos" : [ { "internal" : false, "free_text" : "A point mutation (from G to A) at 182 nucelotide was identified in the cDNA isolated from ODS wistar rat. This mutation altered the 61st amino acid Cys to Tyr and resulted in the low gulonolactone (L-) oxidase activity in the ODS rat.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:1400508", "RGD:126848762" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 4; sleeping beauty induced mutant, Tngen", "display_text" : "transient receptor potential cation channel, subfamily C, member 4; sleeping beauty induced mutant, Tngen", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpc4[Tn(sb)Tngen]", "display_text" : "Trpc4Tn(sb)Tngen", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126848808", "page_area" : "allele", "display_name" : "RGD:126848808" } }, "date_created" : "2021-05-04T15:58:00.000-05:00", "date_updated" : "2021-05-04T15:58:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:126848808", "note_dtos" : [ { "internal" : false, "free_text" : "The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. This insertion resulted in knockout of Trpc4.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24113457", "PMID:24555056", "PMID:26988269", "RGD:126848803", "RGD:126848805", "RGD:150429956" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium two pore domain channel subfamily K member 3; CRISPR/Cas9 induced mutant1, Ang", "display_text" : "potassium two pore domain channel subfamily K member 3; CRISPR/Cas9 induced mutant1, Ang", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-05-10T14:27:46.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnk3[em1Ang]", "display_text" : "Kcnk3em1Ang", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnk3[em1Ang-/-]", "display_text" : "Kcnk3em1Ang-/-", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126908015", "page_area" : "allele", "display_name" : "RGD:126908015" } }, "date_created" : "2021-05-10T14:25:20.000-05:00", "date_updated" : "2021-05-10T14:25:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:126908015", "note_dtos" : [ { "internal" : false, "free_text" : "The mutation created by CRISPR/Cas9 in Crl:SD embryos contained a 94- bp deletion in exon1 of resulted a premature stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31347976", "RGD:151347452" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 1 receptor-like 2; tm1 (Myh6-cre), Mhzh", "display_text" : "interleukin 1 receptor-like 2; tm1 (Myh6-cre), Mhzh", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-05-13T15:33:59.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Il1rl2[tm1(Myh6-cre)Mhzh]", "display_text" : "Il1rl2tm1(Myh6-cre)Mhzh", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Myh6-Cre IL1RL2flox/flox", "display_text" : "Myh6-Cre IL1RL2flox/flox", "name_type_name" : "unspecified" }, { "internal" : false, "format_text" : "interleukin 1 receptor-like 2; tm1, Mhzh", "display_text" : "interleukin 1 receptor-like 2; tm1, Mhzh", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925159", "page_area" : "allele", "display_name" : "RGD:126925159" } }, "date_created" : "2021-05-13T14:13:08.000-05:00", "date_updated" : "2021-05-13T14:13:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925159", "note_dtos" : [ { "internal" : false, "free_text" : "The expression of Il1rl2 was knockout by Cre-loxP system in cardiomyocytes.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:32048631", "RGD:126925167" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 36 receptor antagonist; tm1, Mhzh", "display_text" : "interleukin 36 receptor antagonist; tm1, Mhzh", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il36rn[tm1(Myh6-cre)Mhzh]", "display_text" : "Il36rntm1(Myh6-cre)Mhzh", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925161", "page_area" : "allele", "display_name" : "RGD:126925161" } }, "date_created" : "2021-05-13T14:20:12.000-05:00", "date_updated" : "2021-05-13T14:20:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925161", "note_dtos" : [ { "internal" : false, "free_text" : "The expression of Il36rn was knockout by Cre-loxP system in cardiomyocytes.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:32048631", "RGD:126925167" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "DNA methyltransferase 1; tm1(Myh6-cre), Cqin", "display_text" : "DNA methyltransferase 1; tm1(Myh6-cre), Cqin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-05-13T15:37:03.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Dnmt1[tm1(Myh6-cre)Cqin]", "display_text" : "Dnmt1tm1(Myh6-cre)Cqin", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "DNA methyltransferase 1;tm1(Myh6-cre), Cqin", "display_text" : "DNA methyltransferase 1;tm1(Myh6-cre), Cqin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925165", "page_area" : "allele", "display_name" : "RGD:126925165" } }, "date_created" : "2021-05-13T15:36:43.000-05:00", "date_updated" : "2021-05-13T15:36:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925165", "note_dtos" : [ { "internal" : false, "free_text" : "Cre-loxP system was use to specifically knockout cardiac expression of Dnmt1.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:32051532", "RGD:126925233" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ubiquitin D; CRISPR/Cas9 induced mutant1", "display_text" : "ubiquitin D; CRISPR/Cas9 induced mutant1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ubd[em1]", "display_text" : "Ubdem1", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925166", "page_area" : "allele", "display_name" : "RGD:126925166" } }, "date_created" : "2021-05-13T16:09:56.000-05:00", "date_updated" : "2021-05-13T16:09:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925166", "note_dtos" : [ { "internal" : false, "free_text" : "This Ubd knockout rat allele was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29438664", "RGD:126925221" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "oxoglutarate dehydrogenase; TALEN induced mutant 1, Yuyi", "display_text" : "oxoglutarate dehydrogenase; TALEN induced mutant 1, Yuyi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ogdh[em1Yuyi]", "display_text" : "Ogdhem1Yuyi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925168", "page_area" : "allele", "display_name" : "RGD:126925168" } }, "date_created" : "2021-05-13T16:14:37.000-05:00", "date_updated" : "2021-05-13T16:14:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925168", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 6 member 3; ENU induced mutant 1, Span", "display_text" : "solute carrier family 6 member 3; ENU induced mutant 1, Span", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc6a3[m1Span]", "display_text" : "Slc6a3m1Span", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925197", "page_area" : "allele", "display_name" : "RGD:126925197" } }, "date_created" : "2021-05-14T12:54:41.000-05:00", "date_updated" : "2021-05-14T12:54:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925197", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dopamine receptor D1; ENU induced mutant 1, Hubr", "display_text" : "dopamine receptor D1; ENU induced mutant 1, Hubr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Drd1[m1Hubr]", "display_text" : "Drd1m1Hubr", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Drd1I116S", "display_text" : "Drd1I116S", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925213", "page_area" : "allele", "display_name" : "RGD:126925213" } }, "date_created" : "2021-05-14T15:55:29.000-05:00", "date_updated" : "2021-05-14T15:55:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925213", "note_dtos" : [ { "internal" : false, "free_text" : "The Drd1 mutant allele was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27483345", "RGD:13825241" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "crystallin, beta A1;Nuc1 mutant, Dbsa", "display_text" : "crystallin, beta A1;Nuc1 mutant, Dbsa", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cryba1[Nuc1Dbsa]", "display_text" : "Cryba1Nuc1Dbsa", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925758", "page_area" : "allele", "display_name" : "RGD:126925758" } }, "date_created" : "2021-05-19T11:38:34.000-05:00", "date_updated" : "2021-05-19T11:38:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925758", "note_dtos" : [ { "internal" : false, "free_text" : "This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:15721615", "PMID:17931883", "PMID:21266465", "RGD:126925759", "RGD:126925760", "RGD:2303652" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin heavy chain 7B; CRISPR/Cas9 induced mutant 1, Blar", "display_text" : "myosin heavy chain 7B; CRISPR/Cas9 induced mutant 1, Blar", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-07-30T15:22:38.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Myh7b[em1Blar]", "display_text" : "Myh7bem1Blar", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Myh7b[em1Blar-/-]", "display_text" : "Myh7bem1Blar-/-", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925953", "page_area" : "allele", "display_name" : "RGD:126925953" } }, "date_created" : "2021-05-20T09:56:43.000-05:00", "date_updated" : "2021-05-20T09:56:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925953", "note_dtos" : [ { "internal" : false, "free_text" : "The Myh7b knockout allele was generated using the CRISPR/Cas9 system targeting exon 2 in SD embryos, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32207065", "RGD:126925946" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ERCC excision repair 6, chromatin remodeling factor; CRISPR/Cas9 induced mutant 1, Cgen", "display_text" : "ERCC excision repair 6, chromatin remodeling factor; CRISPR/Cas9 induced mutant 1, Cgen", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ercc6[em1Cgen]", "display_text" : "Ercc6em1Cgen", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925980", "page_area" : "allele", "display_name" : "RGD:126925980" } }, "date_created" : "2021-05-24T16:54:17.000-05:00", "date_updated" : "2021-05-24T16:54:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925980", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA) to SD embryos.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31644904", "RGD:126925983" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Ang", "display_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cftr[em1Ang]", "display_text" : "Cftrem1Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925993", "page_area" : "allele", "display_name" : "RGD:126925993" } }, "date_created" : "2021-05-25T16:17:27.000-05:00", "date_updated" : "2021-05-25T16:17:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925993", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31942562", "RGD:126928119" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Ang", "display_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Ang", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-05-25T16:35:17.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cftr[em2Ang]", "display_text" : "Cftrem2Ang", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CFTR KO", "display_text" : "CFTR KO", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126925995", "page_area" : "allele", "display_name" : "RGD:126925995" } }, "date_created" : "2021-05-25T16:34:38.000-05:00", "date_updated" : "2021-05-25T16:34:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:126925995", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31942562", "RGD:126928119" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 1, Musc", "display_text" : "cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 1, Musc", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cdkn1b[em1Musc]", "display_text" : "Cdkn1bem1Musc", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "DEL-32", "display_text" : "DEL-32", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126928147", "page_area" : "allele", "display_name" : "RGD:126928147" } }, "date_created" : "2021-06-01T15:27:05.000-05:00", "date_updated" : "2021-06-01T15:27:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:126928147", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 32-bp deletion that disrupts the reading frame of the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30893315", "RGD:126908018", "RGD:126928148" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 4, Musc", "display_text" : "cyclin-dependent kinase inhibitor 1B; CRISPR/Cas9 induced mutant 4, Musc", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cdkn1b[em4Musc]", "display_text" : "Cdkn1bem4Musc", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:126928151", "page_area" : "allele", "display_name" : "RGD:126928151" } }, "date_created" : "2021-06-01T15:59:15.000-05:00", "date_updated" : "2021-06-01T15:59:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:126928151", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. This allele contains 65-bp deletion that disrupts the reading frame of the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30893315", "RGD:126908018" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "natriuretic peptide C; ZFN induced mutant 1, Kyo", "display_text" : "natriuretic peptide C; ZFN induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nppc[em1Kyo]", "display_text" : "Nppcem1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127284866", "page_area" : "allele", "display_name" : "RGD:127284866" } }, "date_created" : "2021-06-11T16:01:57.000-05:00", "date_updated" : "2021-06-11T16:01:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:127284866", "note_dtos" : [ { "internal" : false, "free_text" : "Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "natriuretic peptide C; ZFN induced mutant 2 , Kyo", "display_text" : "natriuretic peptide C; ZFN induced mutant 2 , Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nppc[em2Kyo]", "display_text" : "Nppcem2Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127284869", "page_area" : "allele", "display_name" : "RGD:127284869" } }, "date_created" : "2021-06-11T16:27:01.000-05:00", "date_updated" : "2021-06-11T16:27:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:127284869", "note_dtos" : [ { "internal" : false, "free_text" : "Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This allele ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194, NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "natriuretic peptide C; ZFN induced mutant 3, Kyo", "display_text" : "natriuretic peptide C; ZFN induced mutant 3, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nppc[em3Kyo]", "display_text" : "Nppcem3Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127284871", "page_area" : "allele", "display_name" : "RGD:127284871" } }, "date_created" : "2021-06-11T16:43:13.000-05:00", "date_updated" : "2021-06-11T16:43:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:127284871", "note_dtos" : [ { "internal" : false, "free_text" : "Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem3Kyo allele ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1)", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:29566041", "RGD:127284867" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "natriuretic peptide C; ZFN induced mutant 4, Kyo", "display_text" : "natriuretic peptide C; ZFN induced mutant 4, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nppc[em4Kyo]", "display_text" : "Nppcem4Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127284873", "page_area" : "allele", "display_name" : "RGD:127284873" } }, "date_created" : "2021-06-14T09:47:18.000-05:00", "date_updated" : "2021-06-14T09:47:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:127284873", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was induced by Zinc-finger nucleases (ZFNs) system injuected to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). This Nppcem4Kyo ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29566041", "RGD:127284867" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aquaporin 4; TALEN induced mutant 1, Hrt", "display_text" : "aquaporin 4; TALEN induced mutant 1, Hrt", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Aqp4[em1Hrt]", "display_text" : "Aqp4em1Hrt", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127284884", "page_area" : "allele", "display_name" : "RGD:127284884" } }, "date_created" : "2021-06-15T11:39:58.000-05:00", "date_updated" : "2021-06-15T11:39:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:127284884", "note_dtos" : [ { "internal" : false, "free_text" : "The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate this Aqp4 deletion allele. TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. This allele was identified with 3-bp deletion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:33574749", "RGD:127284879" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "complement factor B, ZFN induced mutant 1, Tja", "display_text" : "complement factor B, ZFN induced mutant 1, Tja", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cfb[em1Tja]", "display_text" : "Cfbem1Tja", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127285405", "page_area" : "allele", "display_name" : "RGD:127285405" } }, "date_created" : "2021-06-21T09:41:10.000-05:00", "date_updated" : "2021-06-21T09:41:10.000-05:00", "internal" : false, "primary_external_id" : "RGD:127285405", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28739975", "RGD:127285403" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily C member 8; TALEN induced mutant 1, Cgen", "display_text" : "ATP binding cassette subfamily C member 8; TALEN induced mutant 1, Cgen", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc8[em1Cgen]", "display_text" : "Abcc8em1Cgen", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127285598", "page_area" : "allele", "display_name" : "RGD:127285598" } }, "date_created" : "2021-06-22T12:09:10.000-05:00", "date_updated" : "2021-06-22T12:09:10.000-05:00", "internal" : false, "primary_external_id" : "RGD:127285598", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This allele carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30616503", "RGD:150573710" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "peroxisome proliferator-activated receptor gamma; ENU induced mutant 1, Kyo", "display_text" : "peroxisome proliferator-activated receptor gamma; ENU induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pparg[m1Kyo]", "display_text" : "Ppargm1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127285617", "page_area" : "allele", "display_name" : "RGD:127285617" } }, "date_created" : "2021-06-22T14:21:01.000-05:00", "date_updated" : "2021-06-22T14:21:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:127285617", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was induced by ENU in F344/NSlc. It is a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg.The Pparg homozygous rats are embryonic lethal.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27381370", "RGD:127285618" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc", "display_text" : "adhesion G protein-coupled receptor L3; CRISPR/Cas9 induced mutant1, Huyc", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adgrl3[em1Huyc]", "display_text" : "Adgrl3em1Huyc", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127285662", "page_area" : "allele", "display_name" : "RGD:127285662" } }, "date_created" : "2021-06-25T15:06:45.000-05:00", "date_updated" : "2021-06-25T15:06:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:127285662", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31176715", "RGD:127285660" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily A, member 1;CRISPR/Cas9 induced mutant 1, Gne", "display_text" : "transient receptor potential cation channel, subfamily A, member 1;CRISPR/Cas9 induced mutant 1, Gne", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpa1[em1Gne]", "display_text" : "Trpa1em1Gne", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127285812", "page_area" : "allele", "display_name" : "RGD:127285812" } }, "date_created" : "2021-07-01T14:53:00.000-05:00", "date_updated" : "2021-07-01T14:53:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:127285812", "note_dtos" : [ { "internal" : false, "free_text" : "This Trpa1-deleted allele was generated by using CRISPR/Cas9. It has a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31969645", "RGD:127285811" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "mucin 1, cell surface associated; TALEN induced mutant 1, Cgen", "display_text" : "mucin 1, cell surface associated; TALEN induced mutant 1, Cgen", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Muc1[em1Cgen]", "display_text" : "Muc1em1Cgen", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127345099", "page_area" : "allele", "display_name" : "RGD:127345099" } }, "date_created" : "2021-07-09T09:50:53.000-05:00", "date_updated" : "2021-07-09T09:50:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:127345099", "note_dtos" : [ { "internal" : false, "free_text" : "This Muc1 allele carrying a deletion in exon 1 of rat Muc1 was created by injecting TALENs to Sprague Dawley embryos. Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5′-CTAGCAAGCCTAAAAGGTGAGAGGT-3′ and reverse primer 5′-ACGAAGAGCATTTGCCTACTC-3′, followed by DNA sequencing analysis.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31425778", "RGD:127345100" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiopoietin-like 8; CRISPR/Cas9 induced mutant 1, Kyo", "display_text" : "angiopoietin-like 8; CRISPR/Cas9 induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Angptl8[em1Kyo]", "display_text" : "Angptl8em1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127345127", "page_area" : "allele", "display_name" : "RGD:127345127" } }, "date_created" : "2021-07-09T12:15:00.000-05:00", "date_updated" : "2021-07-09T12:15:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:127345127", "note_dtos" : [ { "internal" : false, "free_text" : "This Angptl8 allele was generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for this allele. A 7-bp deletion mutation was identified.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30042156", "RGD:38549347" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiopoietin-like 8; CRISPR/Cas9 induced mutant 2, Kyo", "display_text" : "angiopoietin-like 8; CRISPR/Cas9 induced mutant 2, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Angptl8[em2Kyo]", "display_text" : "Angptl8em2Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:127345128", "page_area" : "allele", "display_name" : "RGD:127345128" } }, "date_created" : "2021-07-09T12:22:53.000-05:00", "date_updated" : "2021-07-09T12:22:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:127345128", "note_dtos" : [ { "internal" : false, "free_text" : "This Angptl8 allele was generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense). A 980-bp deletion in the ANGPTL8 gene was identified in this allele, resulting in a premature termination codon.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating 2;TALEN induced mutant 2, Medical College of Wisconsin", "display_text" : "recombination activating 2;TALEN induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag2[em2Mcwi]", "display_text" : "Rag2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag2em2Mcwi", "display_text" : "Rag2em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12738366", "page_area" : "allele", "display_name" : "RGD:12738366" } }, "date_created" : "2017-02-01T14:42:56.000-06:00", "date_updated" : "2017-02-01T14:42:56.000-06:00", "internal" : false, "primary_external_id" : "RGD:12738366", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 2-bp (GA) deletion in the exon2 of Rag2 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "agouti signaling protein, mutant1", "display_text" : "agouti signaling protein, mutant1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Asip[m1]", "display_text" : "Asipm1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Asipm1", "display_text" : "Asipm1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12738467", "page_area" : "allele", "display_name" : "RGD:12738467" } }, "date_created" : "2017-02-06T15:59:12.000-06:00", "date_updated" : "2017-02-06T15:59:12.000-06:00", "internal" : false, "primary_external_id" : "RGD:12738467", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a Spontaneous mutation of agouti (Asip) gene with resultant black coat color.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "matrix metallopeptidase 9; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mmp9[em4Mcwi]", "display_text" : "Mmp9em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12743378", "page_area" : "allele", "display_name" : "RGD:12743378" } }, "date_created" : "2017-02-07T14:17:54.000-06:00", "date_updated" : "2017-02-07T14:17:54.000-06:00", "internal" : false, "primary_external_id" : "RGD:12743378", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "acid sensing ion channel subunit 3; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "display_text" : "acid sensing ion channel subunit 3; CRISPR/Cas9 system induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Asic3[em6Mcwi]", "display_text" : "Asic3em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Asic3em6Mcwi", "display_text" : "Asic3em6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790597", "page_area" : "allele", "display_name" : "RGD:12790597" } }, "date_created" : "2017-02-17T14:55:43.000-06:00", "date_updated" : "2017-02-17T14:55:43.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790597", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Axl[em1Mcwi]", "display_text" : "Axlem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Axlem1Mcwi", "display_text" : "Axlem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790600", "page_area" : "allele", "display_name" : "RGD:12790600" } }, "date_created" : "2017-02-17T15:12:06.000-06:00", "date_updated" : "2017-02-17T15:12:06.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790600", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "Axl receptor tyrosine kinase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Axl[em2Mcwi]", "display_text" : "Axlem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Axlem2Mcwi", "display_text" : "Axlem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790605", "page_area" : "allele", "display_name" : "RGD:12790605" } }, "date_created" : "2017-02-17T15:23:46.000-06:00", "date_updated" : "2017-02-17T15:23:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790605", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CD14 molecule; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "CD14 molecule; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-02-17T16:09:09.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd14[em1Mcwi]", "display_text" : "Cd14em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd14em1Mcwi", "display_text" : "Cd14em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790606", "page_area" : "allele", "display_name" : "RGD:12790606" } }, "date_created" : "2017-02-17T16:06:20.000-06:00", "date_updated" : "2017-02-17T16:06:20.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790606", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in the exon 2 of rat Cd14 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CD14 molecule; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "CD14 molecule; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd14[em2Mcwi]", "display_text" : "Cd14em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd14em2Mcwi", "display_text" : "Cd14em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790611", "page_area" : "allele", "display_name" : "RGD:12790611" } }, "date_created" : "2017-02-17T16:18:44.000-06:00", "date_updated" : "2017-02-17T16:18:44.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790611", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a net 7-bp deletion in the rat Cd14 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "display_text" : "cholinergic receptor, nicotinic, alpha 4 (neuronal); CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna4[em5Mcwi]", "display_text" : "Chrna4em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrna4em5Mcwi", "display_text" : "Chrna4em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790616", "page_area" : "allele", "display_name" : "RGD:12790616" } }, "date_created" : "2017-02-17T16:49:50.000-06:00", "date_updated" : "2017-02-17T16:49:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790616", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 4-bp deletion in the Chrna4 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cybb[em1Mcwi]", "display_text" : "Cybbem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cybbem1Mcwi", "display_text" : "Cybbem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790620", "page_area" : "allele", "display_name" : "RGD:12790620" } }, "date_created" : "2017-02-17T17:00:22.000-06:00", "date_updated" : "2017-02-17T17:00:22.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790620", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cybb[em3Mcwi]", "display_text" : "Cybbem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cybbem3Mcwi", "display_text" : "Cybbem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790624", "page_area" : "allele", "display_name" : "RGD:12790624" } }, "date_created" : "2017-02-17T17:11:50.000-06:00", "date_updated" : "2017-02-17T17:11:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790624", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "display_text" : "immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-02-17T17:29:11.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Igh-6[em1Mcwi]", "display_text" : "Igh-6em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Igh-6em1Mcwi", "display_text" : "Igh-6em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790625", "page_area" : "allele", "display_name" : "RGD:12790625" } }, "date_created" : "2017-02-17T17:27:53.000-06:00", "date_updated" : "2017-02-17T17:28:38.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790625", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion in exon 2 of the Igh-6 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "immunoglobulin heavy chain 6; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Igh-6[em4Mcwi]", "display_text" : "Igh-6em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Igh-6em4Mcwi", "display_text" : "Igh-6em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790630", "page_area" : "allele", "display_name" : "RGD:12790630" } }, "date_created" : "2017-02-17T17:39:02.000-06:00", "date_updated" : "2017-02-17T17:39:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790630", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in exon 2 of the Igh-6 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor, gamma; TALEN induced mutant 1, Medical College of Wisconsin", "display_text" : "interleukin 2 receptor, gamma; TALEN induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em1Mcwi]", "display_text" : "Il2rgem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem1Mcwi", "display_text" : "Il2rgem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790633", "page_area" : "allele", "display_name" : "RGD:12790633" } }, "date_created" : "2017-02-17T17:55:04.000-06:00", "date_updated" : "2017-02-17T17:55:04.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790633", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by TALEN mutagensis. The resulting mutation is a 19-bp deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor, gamma; TALEN induced mutant 3, Medical College of Wisconsin", "display_text" : "interleukin 2 receptor, gamma; TALEN induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em3Mcwi]", "display_text" : "Il2rgem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem3Mcwi", "display_text" : "Il2rgem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790660", "page_area" : "allele", "display_name" : "RGD:12790660" } }, "date_created" : "2017-02-20T09:31:22.000-06:00", "date_updated" : "2017-02-20T09:31:22.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790660", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by TALEN mutagensis. The resulting mutation is a 2-bp deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myoglobin; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin", "display_text" : "myoglobin; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mb[em6Mcwi]", "display_text" : "Mbem6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mbem6Mcwi", "display_text" : "Mbem6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790663", "page_area" : "allele", "display_name" : "RGD:12790663" } }, "date_created" : "2017-02-20T09:54:50.000-06:00", "date_updated" : "2017-02-20T09:54:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790663", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 25-bp deletion in exon 2 of the Mb gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin", "display_text" : "purinergic receptor P2X 1; CRISPR/Cas9 induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx1[em6Mcwi]", "display_text" : "P2rx1em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "P2rx1em6Mcwi", "display_text" : "P2rx1em6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790677", "page_area" : "allele", "display_name" : "RGD:12790677" } }, "date_created" : "2017-02-20T11:40:48.000-06:00", "date_updated" : "2017-02-20T11:40:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790677", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin", "display_text" : "purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-02-20T13:53:12.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx7[em8Mcwi]", "display_text" : "P2rx7em8Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin) Rattus norvegicus", "display_text" : "purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 8, Medical College of Wisconsin) Rattus norvegicus", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "P2rx7em8Mcwi", "display_text" : "P2rx7em8Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790680", "page_area" : "allele", "display_name" : "RGD:12790680" } }, "date_created" : "2017-02-20T13:51:58.000-06:00", "date_updated" : "2017-02-20T13:51:58.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790680", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pon1[em1Mcwi]", "display_text" : "Pon1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pon1em1Mcwi", "display_text" : "Pon1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790693", "page_area" : "allele", "display_name" : "RGD:12790693" } }, "date_created" : "2017-02-20T15:27:16.000-06:00", "date_updated" : "2017-02-20T15:27:16.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790693", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "display_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ ], "allele_secondary_id_dtos" : [ { "internal" : false, "date_updated" : "2017-07-21T13:13:07.000-05:00", "secondary_id" : "RGD:12790704", "date_created" : "2017-02-21T14:01:04.000-06:00", "obsolete" : true } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Pon1[em2Mcwi]", "display_text" : "Pon1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pon1em2Mcwi", "display_text" : "Pon1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790696", "page_area" : "allele", "display_name" : "RGD:12790696" } }, "date_created" : "2017-02-20T15:33:57.000-06:00", "date_updated" : "2017-07-21T13:13:07.000-05:00", "internal" : false, "primary_external_id" : "RGD:12790696", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin", "display_text" : "paraoxonase 1; CRISPR/Cas9 induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ ], "allele_secondary_id_dtos" : [ { "internal" : false, "date_updated" : "2017-07-21T13:03:24.000-05:00", "secondary_id" : "RGD:12790705", "date_created" : "2017-02-21T14:04:15.000-06:00", "obsolete" : true } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Pon1[em3Mcwi]", "display_text" : "Pon1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pon1em3Mcwi", "display_text" : "Pon1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790699", "page_area" : "allele", "display_name" : "RGD:12790699" } }, "date_created" : "2017-02-20T15:42:32.000-06:00", "date_updated" : "2017-07-21T13:03:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:12790699", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paraoxonase 3; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "paraoxonase 3; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pon3[em1Mcwi]", "display_text" : "Pon3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pon3em1Mcwi", "display_text" : "Pon3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790703", "page_area" : "allele", "display_name" : "RGD:12790703" } }, "date_created" : "2017-02-20T15:51:20.000-06:00", "date_updated" : "2017-02-20T15:51:20.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790703", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating 2;TALEN induced mutant 3, Medical College of Wisconsin", "display_text" : "recombination activating 2;TALEN induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag2[em3Mcwi]", "display_text" : "Rag2em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag2em3Mcwi", "display_text" : "Rag2em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790711", "page_area" : "allele", "display_name" : "RGD:12790711" } }, "date_created" : "2017-02-21T15:16:59.000-06:00", "date_updated" : "2017-02-21T15:16:59.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790711", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 10-bp deletion in the exon2 of Rag2 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating 2;mutant 1, Medical College of Wisconsin", "display_text" : "recombination activating 2;mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-02-21T15:34:33.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag2[em1Mcwi]", "display_text" : "Rag2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag2em1Mcwi", "display_text" : "Rag2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790714", "page_area" : "allele", "display_name" : "RGD:12790714" } }, "date_created" : "2017-02-21T15:33:53.000-06:00", "date_updated" : "2017-02-21T15:33:53.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790714", "note_dtos" : [ { "internal" : false, "free_text" : "The mutant allele is a 8-bp deletion in exon 2 of Rag2 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ring finger and WD repeat domain 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "display_text" : "ring finger and WD repeat domain 2; CRISPR/Cas9 induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rfwd2[em1Mcwi]", "display_text" : "Rfwd2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rfwd2em1Mcwi", "display_text" : "Rfwd2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790718", "page_area" : "allele", "display_name" : "RGD:12790718" } }, "date_created" : "2017-02-21T16:06:51.000-06:00", "date_updated" : "2017-02-21T16:06:51.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790718", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "serpin family C member 1; ZFN induced mutant 2, Medical College of Wisconsin", "display_text" : "serpin family C member 1; ZFN induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Serpinc1[em2Mcwi]", "display_text" : "Serpinc1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Serpinc1em2Mcwi", "display_text" : "Serpinc1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790722", "page_area" : "allele", "display_name" : "RGD:12790722" } }, "date_created" : "2017-02-21T16:31:25.000-06:00", "date_updated" : "2017-02-21T16:31:25.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790722", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN system. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26108065", "RGD:11354006" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "display_text" : "salt-inducible kinase 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-10-24T11:00:03.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Sik2[em5Mcwi]", "display_text" : "Sik2em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sik2[em5Mcwi", "display_text" : "Sik2em5Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Sik2em5Mcwi", "display_text" : "Sik2em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790945", "page_area" : "allele", "display_name" : "RGD:12790945" } }, "date_created" : "2017-02-22T11:05:59.000-06:00", "date_updated" : "2017-02-22T11:05:59.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790945", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 6-bp deletion in the genome and 1-bp (T) insertion in the deletion site, net 5-bp deletion in exon 4 of the Sik2 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin", "display_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 7, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sorcs2[em7Mcwi]", "display_text" : "Sorcs2em7Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sorcs2em7Mcwi", "display_text" : "Sorcs2em7Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790948", "page_area" : "allele", "display_name" : "RGD:12790948" } }, "date_created" : "2017-02-22T11:18:28.000-06:00", "date_updated" : "2017-02-22T11:18:28.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790948", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp frameshift deletion in exon 15.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "display_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sorcs2[em9Mcwi]", "display_text" : "Sorcs2em9Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sorcs2em9Mcwi", "display_text" : "Sorcs2em9Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790952", "page_area" : "allele", "display_name" : "RGD:12790952" } }, "date_created" : "2017-02-22T11:25:39.000-06:00", "date_updated" : "2017-02-22T11:25:39.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790952", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 15.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "display_text" : "telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tert[em2Mcwi]", "display_text" : "Tertem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tertem2Mcwi", "display_text" : "Tertem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790955", "page_area" : "allele", "display_name" : "RGD:12790955" } }, "date_created" : "2017-02-22T11:41:51.000-06:00", "date_updated" : "2017-02-22T11:41:51.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790955", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 17-bp deletion in Tert gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paired box gene 6, small eye mutation 2", "display_text" : "paired box gene 6, small eye mutation 2", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-02-23T13:35:06.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Pax6[Sey2]", "display_text" : "Pax6Sey2", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pax6Sey2", "display_text" : "Pax6Sey2", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "rsey2", "display_text" : "rsey2", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12790970", "page_area" : "allele", "display_name" : "RGD:12790970" } }, "date_created" : "2017-02-23T13:31:38.000-06:00", "date_updated" : "2017-02-23T13:31:38.000-06:00", "internal" : false, "primary_external_id" : "RGD:12790970", "note_dtos" : [ { "internal" : false, "free_text" : "Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:16795023", "PMID:21203536", "PMID:9247338", "RGD:12790971", "RGD:731242", "RGD:8552339" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tuberous sclerosis 2;Eker renal cell carcinoma", "display_text" : "tuberous sclerosis 2;Eker renal cell carcinoma", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-10-24T11:01:17.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tsc2[Eker]", "display_text" : "Tsc2Eker", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tsc2Eker", "display_text" : "Tsc2Eker", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12791989", "page_area" : "allele", "display_name" : "RGD:12791989" } }, "date_created" : "2017-03-07T13:02:06.000-06:00", "date_updated" : "2017-03-07T13:02:06.000-06:00", "internal" : false, "primary_external_id" : "RGD:12791989", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneously nonsense mutant found in a renal cell carcinoma diseased Long-Evans rat. The mutation was genome insertion that creates a premature stop coden in the protein sequence.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:7704028", "RGD:625611" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "gap junction protein, alpha 8; mutant 1 Cub", "display_text" : "gap junction protein, alpha 8; mutant 1 Cub", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gja8[m1Cub]", "display_text" : "Gja8m1Cub", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gja8m1Cub", "display_text" : "Gja8m1Cub", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12791992", "page_area" : "allele", "display_name" : "RGD:12791992" } }, "date_created" : "2017-03-07T14:39:49.000-06:00", "date_updated" : "2017-03-07T14:39:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:12791992", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation is derived from SHR where a missense mutation is observed in the NH2-terminal cytosolic domain of Gja8(Cx50). A T to A transversion at codon 7, leading to a substitution of glutamine for leucin (L7Q) was identified.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:18470322", "PMID:27871290", "RGD:150429989", "RGD:2293186" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "APC, WNT signaling pathway regulator; mutant 1, Kyo", "display_text" : "APC, WNT signaling pathway regulator; mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-03-15T16:16:54.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Apc[m1Kyo]", "display_text" : "Apcm1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Apc[KAD]", "display_text" : "ApcKAD", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "APC, WNT signaling pathway regulator;mutant 1", "display_text" : "APC, WNT signaling pathway regulator;mutant 1", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Apc[m1]", "display_text" : "Apcm1", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Apcm1Kyo", "display_text" : "Apcm1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792252", "page_area" : "allele", "display_name" : "RGD:12792252" } }, "date_created" : "2017-03-14T15:17:18.000-05:00", "date_updated" : "2017-03-14T15:17:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792252", "note_dtos" : [ { "internal" : false, "free_text" : "A nonsense mutant, c. 7621C > A (p.S2523X) was induced by ethylnitrosourea mutagenesis (ENU). The truncated APC was deduced to lack part of the basic domain, an EB1-binding domain, and a PDZ domain, but retained an intact beta-catenin binding region.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19694754", "RGD:12792250" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 1; ENU induced mutant1, Kyo", "display_text" : "sodium voltage-gated channel alpha subunit 1; ENU induced mutant1, Kyo", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-03-16T13:25:36.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-03-15T16:08:03.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Scn1a[m1Kyo]", "display_text" : "Scn1am1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 1; mutant1, Kyo", "display_text" : "sodium voltage-gated channel alpha subunit 1; mutant1, Kyo", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Scn1a[Kyo811]", "display_text" : "Scn1aKyo811", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 1; mutant1", "display_text" : "sodium voltage-gated channel alpha subunit 1; mutant1", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Scn1a[m1]", "display_text" : "Scn1am1", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Scn1am1Kyo", "display_text" : "Scn1am1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792283", "page_area" : "allele", "display_name" : "RGD:12792283" } }, "date_created" : "2017-03-15T16:03:05.000-05:00", "date_updated" : "2017-03-15T16:03:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792283", "note_dtos" : [ { "internal" : false, "free_text" : "A missense mutant N1417H (4246A>G) in the third pore region of the sodium channel was induced by ethylnitrosourea (ENU) mutagenesis.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20410126", "RGD:12792282" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 1; ENU induced mutant2, Kyo", "display_text" : "sodium voltage-gated channel alpha subunit 1; ENU induced mutant2, Kyo", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-03-16T13:24:31.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Scn1a[m2Kyo]", "display_text" : "Scn1am2Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 1; mutant2, Kyo", "display_text" : "sodium voltage-gated channel alpha subunit 1; mutant2, Kyo", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Scn1a[Kyo631]", "display_text" : "Scn1aKyo631", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Scn1am2Kyo", "display_text" : "Scn1am2Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792284", "page_area" : "allele", "display_name" : "RGD:12792284" } }, "date_created" : "2017-03-15T16:10:54.000-05:00", "date_updated" : "2017-03-15T16:10:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792284", "note_dtos" : [ { "internal" : false, "free_text" : "A missense mutant E539A (1616A>C) was induced by ethylnitrosourea (ENU) mutagenesis.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20410126", "RGD:12792282" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily C member 2;transport deficient mutant ,", "display_text" : "ATP binding cassette subfamily C member 2;transport deficient mutant ,", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc2[TR-]", "display_text" : "Abcc2TR-", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcc2TR-", "display_text" : "Abcc2TR-", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792941", "page_area" : "allele", "display_name" : "RGD:12792941" } }, "date_created" : "2017-03-16T12:02:51.000-05:00", "date_updated" : "2017-03-16T12:02:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792941", "note_dtos" : [ { "internal" : false, "free_text" : "Spontaneous mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC). It is a nonsense mutation caused by one bp deletion in the coding region of Abcc2.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19525466", "PMID:8599091", "RGD:14985241", "RGD:69812" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dipeptidylpeptidase 4; DPPIV mutant", "display_text" : "dipeptidylpeptidase 4; DPPIV mutant", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-02-09T10:18:52.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Dpp4[DPPIV]", "display_text" : "Dpp4DPPIV", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dpp4DPPIV-", "display_text" : "Dpp4DPPIV-", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Dpp4[DPPIV-]", "display_text" : "Dpp4DPPIV-", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792942", "page_area" : "allele", "display_name" : "RGD:12792942" } }, "date_created" : "2017-03-16T12:24:10.000-05:00", "date_updated" : "2017-03-16T12:24:10.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792942", "note_dtos" : [ { "internal" : false, "free_text" : "The DPP4 mutant allele was a spontaneous mutation found in Fischer 344 rats, which caused a deficiency in Dpp4. The mutant allele has a G to A change at nucleotide 1897 (in exon 22), which results in an amino acid change of Gly (WT; GGA) to Arg (Mut; AGA).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19327106", "RGD:41408336" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tumor protein p53; ENU induced mutant1, Kyo,", "display_text" : "tumor protein p53; ENU induced mutant1, Kyo,", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tp53[m1Kyo]", "display_text" : "Tp53m1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tp53 missense", "display_text" : "Tp53 missense", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Tp53m1Kyo", "display_text" : "Tp53m1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792955", "page_area" : "allele", "display_name" : "RGD:12792955" } }, "date_created" : "2017-03-16T13:28:22.000-05:00", "date_updated" : "2017-03-16T13:28:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792955", "note_dtos" : [ { "internal" : false, "free_text" : "A missense mutation R271C in the rat Tp53 was induced by ethylnitrosourea (ENU) mutagenesis in F344/Nslc.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tumor protein p53; tm1, EGFP-Pac, Qly", "display_text" : "tumor protein p53; tm1, EGFP-Pac, Qly", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tp53[tm1(EGFP-Pac)Qly]", "display_text" : "Tp53tm1(EGFP-Pac)Qly", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tp53tm1(EGFP-Pac)Qly", "display_text" : "Tp53tm1(EGFP-Pac)Qly", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792957", "page_area" : "allele", "display_name" : "RGD:12792957" } }, "date_created" : "2017-03-16T14:01:50.000-05:00", "date_updated" : "2017-03-16T14:01:50.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792957", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5' and 1.6- kb 3' homology arms and a CAG-EGFP-IRES-Pac cassette. Absence of Tp53 protein was confirmed by western blot in homozygous animals.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:20703227", "RGD:2292495", "RGD:6478787" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "synaptic vesicle glycoprotein 2a; ENU induced mutant 1, Kyo,", "display_text" : "synaptic vesicle glycoprotein 2a; ENU induced mutant 1, Kyo,", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sv2a[m1Kyo]", "display_text" : "Sv2am1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sv2a[L174Q]", "display_text" : "Sv2aL174Q", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Sv2am1Kyo", "display_text" : "Sv2am1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792962", "page_area" : "allele", "display_name" : "RGD:12792962" } }, "date_created" : "2017-03-17T09:30:47.000-05:00", "date_updated" : "2017-03-17T09:30:47.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792962", "note_dtos" : [ { "internal" : false, "free_text" : "A missense mutation (L174Q) in the first transmembrane spanning region was induced by N-ethyl-N-nitrosourea (ENU) in F344 rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27265781", "RGD:12792961" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin; ENU induced mutant1, Kyo", "display_text" : "leptin; ENU induced mutant1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lep[m1Kyo]", "display_text" : "Lepm1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lepm1Kyo", "display_text" : "Lepm1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792963", "page_area" : "allele", "display_name" : "RGD:12792963" } }, "date_created" : "2017-03-17T10:23:51.000-05:00", "date_updated" : "2017-03-17T10:23:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792963", "note_dtos" : [ { "internal" : false, "free_text" : "A nonsense mutation (Q92X) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23800849", "RGD:8549777" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "arylsulfatase B; MPR mutant", "display_text" : "arylsulfatase B; MPR mutant", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-04-10T15:28:22.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-03-17T14:43:04.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Arsb[MPR]", "display_text" : "ArsbMPR", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Arsb[MPP]", "display_text" : "ArsbMPP", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Arsb[abd]", "display_text" : "Arsbabd", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "ArsbMPR", "display_text" : "ArsbMPR", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792967", "page_area" : "allele", "display_name" : "RGD:12792967" } }, "date_created" : "2017-03-17T14:41:49.000-05:00", "date_updated" : "2017-03-17T14:41:49.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792967", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneously insertion (507insC) mutant found in the Ishibashi hairless rat strain. This insertion caused a frame shift mutation and premature termination at codon at 258.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:8575749", "RGD:631738" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leucine-rich, glioma inactivated 1; ENU induced mutant1, Kyo", "display_text" : "leucine-rich, glioma inactivated 1; ENU induced mutant1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lgi1[m1Kyo]", "display_text" : "Lgi1m1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lgi1m1Kyo", "display_text" : "Lgi1m1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792970", "page_area" : "allele", "display_name" : "RGD:12792970" } }, "date_created" : "2017-03-17T15:09:50.000-05:00", "date_updated" : "2017-03-17T15:09:50.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792970", "note_dtos" : [ { "internal" : false, "free_text" : "A missense mutation (c.1154 T > G,L385R) was induced by N-ethyl-N-nitrosourea (ENU) in F344/NSlc.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22589250", "PMID:30813600", "RGD:12792971", "RGD:14995940" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tyrosinase; TALEN induced mutant1, Kyo", "display_text" : "tyrosinase; TALEN induced mutant1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tyr[em1Kyo]", "display_text" : "Tyrem1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tyrem1Kyo", "display_text" : "Tyrem1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12792972", "page_area" : "allele", "display_name" : "RGD:12792972" } }, "date_created" : "2017-03-17T16:03:40.000-05:00", "date_updated" : "2017-03-17T16:03:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:12792972", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN system caused a 29-bp deletion in the Tyr gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23409244", "RGD:12792973" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "MRS2 magnesium transporter; demyelination mutant, Kyo", "display_text" : "MRS2 magnesium transporter; demyelination mutant, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mrs2[dmyKyo]", "display_text" : "Mrs2dmyKyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mrs2DMYKyo", "display_text" : "Mrs2DMYKyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12793071", "page_area" : "allele", "display_name" : "RGD:12793071" } }, "date_created" : "2017-03-20T15:46:23.000-05:00", "date_updated" : "2018-05-24T12:49:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:12793071", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneous missense mutation found in a closed colony of Sprague Dawley (SD) rats. A G-to-A mutation in intron was very likely causative of the mutant phenotype.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21253565", "RGD:12793070" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 1, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em1Kyo]", "display_text" : "Il2rgem1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem1Kyo", "display_text" : "Il2rgem1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12798560", "page_area" : "allele", "display_name" : "RGD:12798560" } }, "date_created" : "2017-03-27T11:40:04.000-05:00", "date_updated" : "2017-03-27T11:40:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:12798560", "note_dtos" : [ { "internal" : false, "free_text" : "These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos.A 660-bp deletion mutation was created and resulted no detectable protein expression by western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20111598", "RGD:2316325" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 2, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 2, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em2Kyo]", "display_text" : "Il2rgem2Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem2Kyo", "display_text" : "Il2rgem2Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12798561", "page_area" : "allele", "display_name" : "RGD:12798561" } }, "date_created" : "2017-03-27T12:09:51.000-05:00", "date_updated" : "2017-03-27T12:09:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:12798561", "note_dtos" : [ { "internal" : false, "free_text" : "These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm and TM/Kyo embryos. A 1097-bp deletion mutation was created and resulted no detectable protein expression by western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20111598", "RGD:2316325" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; endonuclease-induced mutant 1, Hina", "display_text" : "interleukin 2 receptor subunit gamma; endonuclease-induced mutant 1, Hina", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em1Hina]", "display_text" : "Il2rgem1Hina", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem1Hina", "display_text" : "Il2rgem1Hina", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12798562", "page_area" : "allele", "display_name" : "RGD:12798562" } }, "date_created" : "2017-03-27T12:30:08.000-05:00", "date_updated" : "2017-03-27T12:30:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:12798562", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat（Crlj:Wistar).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 21, Medical College of Wisconsin", "display_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 21, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Btg2[em21Mcwi]", "display_text" : "Btg2em21Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Btg2em21Mcwi", "display_text" : "Btg2em21Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12798564", "page_area" : "allele", "display_name" : "RGD:12798564" } }, "date_created" : "2017-03-27T14:48:54.000-05:00", "date_updated" : "2017-03-27T14:48:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:12798564", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 24, Medical College of Wisconsin", "display_text" : "BTG family, member 2; CRISPR/Cas9 system induced mutant 24, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Btg2[em24Mcwi]", "display_text" : "Btg2em24Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Btg2em24Mcwi", "display_text" : "Btg2em24Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12798565", "page_area" : "allele", "display_name" : "RGD:12798565" } }, "date_created" : "2017-03-27T14:53:00.000-05:00", "date_updated" : "2017-03-27T14:53:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:12798565", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 2-bp insertion in the exon 1 of Btg2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily Q member 1;deafness Kyoto", "display_text" : "potassium voltage-gated channel subfamily Q member 1;deafness Kyoto", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnq1[dfk]", "display_text" : "Kcnq1dfk", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnq1dfk", "display_text" : "Kcnq1dfk", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12802344", "page_area" : "allele", "display_name" : "RGD:12802344" } }, "date_created" : "2017-04-05T13:29:35.000-05:00", "date_updated" : "2017-04-05T13:29:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:12802344", "note_dtos" : [ { "internal" : false, "free_text" : "A naturally occurring deletion mutation arising on the genetic background of an inbred WTC strain. It is a 2040-bp deletion that included whole exon 7 and its flanking sequences of the Kcnq1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:16368876", "RGD:1581602" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "proteolipid protein 1; Myelin-deficient", "display_text" : "proteolipid protein 1; Myelin-deficient", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plp1[md]", "display_text" : "Plp1md", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plp1md", "display_text" : "Plp1md", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12802346", "page_area" : "allele", "display_name" : "RGD:12802346" } }, "date_created" : "2017-04-05T14:07:19.000-05:00", "date_updated" : "2017-04-05T14:07:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:12802346", "note_dtos" : [ { "internal" : false, "free_text" : "A naturally occurring missense mutation (p.T75P) arising in Wistar rats. It is a transversion(A>C) mutation located on exon 3 of Plp1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:2479544", "RGD:1358781" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myelin basic protein; myelin deficient", "display_text" : "myelin basic protein; myelin deficient", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mbp[md]", "display_text" : "Mbpmd", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mbpmd", "display_text" : "Mbpmd", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12802351", "page_area" : "allele", "display_name" : "RGD:12802351" } }, "date_created" : "2017-04-05T14:47:19.000-05:00", "date_updated" : "2017-04-05T14:47:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:12802351", "note_dtos" : [ { "internal" : false, "free_text" : "A naturally occurring Mbp insertion mutation found in the Long Evans shaker rats. It is caused by the insertion of an endogenous retrotransposon [early transposons (ETn) element] into a noncoding region (intron 3) of the gene. The ETn element alters the normal splicing dynamics of MBP mRNA, leading to a dramatic reduction in the levels of full-length isoforms and the appearance of improperly spliced, chimeric transcripts.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:10212300", "RGD:1358763" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "unc-5 netrin receptor C; hobble mutant", "display_text" : "unc-5 netrin receptor C; hobble mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Unc5c[hob]", "display_text" : "Unc5chob", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Unc5chob", "display_text" : "Unc5chob", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12802353", "page_area" : "allele", "display_name" : "RGD:12802353" } }, "date_created" : "2017-04-05T15:48:22.000-05:00", "date_updated" : "2017-04-05T15:48:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:12802353", "note_dtos" : [ { "internal" : false, "free_text" : "The hobble (HOB) rat has been discovered in a colony of F344/Snk rat with the hobbling gait. A 2-bp insertion was found at nucleotide 1085 resulting in frame shift from codon 312 and a premature termination at codon 385.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:14993736", "PMID:15010202", "RGD:1302461", "RGD:1302733" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "unc-5 netrin receptor C; cerebellar vermis defect", "display_text" : "unc-5 netrin receptor C; cerebellar vermis defect", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Unc5c[cvd]", "display_text" : "Unc5ccvd", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Unc5ccvd", "display_text" : "Unc5ccvd", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12802355", "page_area" : "allele", "display_name" : "RGD:12802355" } }, "date_created" : "2017-04-05T16:01:27.000-05:00", "date_updated" : "2017-04-05T16:01:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:12802355", "note_dtos" : [ { "internal" : false, "free_text" : "In homozygous cvd/cvd (cerebellar vermis defect), conversion of G to T was found at nucleotide 1501 resulting in a premature termination at codon 451 of the UNC5c protein.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:14993736", "PMID:15010202", "RGD:1302461", "RGD:1302733" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATM serine/threonine kinase; ENU induced mutant 1, Kyo", "display_text" : "ATM serine/threonine kinase; ENU induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Atm[m1Kyo]", "display_text" : "Atmm1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Atmm1Kyo", "display_text" : "Atmm1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12879395", "page_area" : "allele", "display_name" : "RGD:12879395" } }, "date_created" : "2017-04-18T12:25:54.000-05:00", "date_updated" : "2017-04-18T12:25:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:12879395", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is an rat Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P)) and was established by ENU mutagenesis using F344/NSlc strain.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27895165", "PMID:28007901", "RGD:12879393", "RGD:12879399" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATM serine/threonine kinase; ZFN induced mutant 1, Kyo", "display_text" : "ATM serine/threonine kinase; ZFN induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-04-18T15:14:15.000-05:00", "nomenclature_event_name" : "data_merged" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-04-18T15:13:27.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Atm[em1Kyo]", "display_text" : "Atmem1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Atm[m1Kyo]", "display_text" : "Atmm1Kyo", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Atmem1Kyo", "display_text" : "Atmem1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12879401", "page_area" : "allele", "display_name" : "RGD:12879401" } }, "date_created" : "2017-04-18T14:41:41.000-05:00", "date_updated" : "2017-04-18T14:45:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:12879401", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28007901", "RGD:12879399" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "intraflagellar transport 140; CRISPR/Cas9 induced mutant 1, Kyo", "display_text" : "intraflagellar transport 140; CRISPR/Cas9 induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ift140[em1Kyo]", "display_text" : "Ift140em1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ift140em1Kyo", "display_text" : "Ift140em1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12879433", "page_area" : "allele", "display_name" : "RGD:12879433" } }, "date_created" : "2017-04-19T13:45:00.000-05:00", "date_updated" : "2017-04-19T13:45:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:12879433", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "intraflagellar transport 140; CRISPR/Cas9 induced mutant 2, Kyo", "display_text" : "intraflagellar transport 140; CRISPR/Cas9 induced mutant 2, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ift140[em2Kyo]", "display_text" : "Ift140em2Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ift140em2Kyo", "display_text" : "Ift140em2Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12879435", "page_area" : "allele", "display_name" : "RGD:12879435" } }, "date_created" : "2017-04-19T13:55:59.000-05:00", "date_updated" : "2017-04-19T13:55:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:12879435", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 2 (em2) has 2-bp deletion (c.23_24del) in the exon 1 of Ift140 (intraflagellar transport 140) gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "thyroglobulin; rdw mutant", "display_text" : "thyroglobulin; rdw mutant", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-04-28T09:11:52.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-04-28T09:11:28.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-04-27T16:13:26.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tg[rdw]", "display_text" : "Tgrdw", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tgrdw", "display_text" : "Tgrdw", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12879860", "page_area" : "allele", "display_name" : "RGD:12879860" } }, "date_created" : "2017-04-27T16:12:56.000-05:00", "date_updated" : "2017-04-27T16:12:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:12879860", "note_dtos" : [ { "internal" : false, "free_text" : "This allele has a spontaneous missense mutation, G2320R, in the thyroglobul gene and this mutation is responsible for the congenital dwarfism in the WIC-TgrdwKts rat strain.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:10760744", "PMID:11089535", "PMID:16365524", "PMID:3366187", "RGD:12880373", "RGD:13605608", "RGD:150429798", "RGD:730133" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "apolipoprotein E; endonuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "apolipoprotein E; endonuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-05-08T16:34:57.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Apoe[em1Sage]", "display_text" : "Apoeem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "apolipoprotein E; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "apolipoprotein E; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Apoeem1Sage", "display_text" : "Apoeem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12880022", "page_area" : "allele", "display_name" : "RGD:12880022" } }, "date_created" : "2017-05-01T16:04:16.000-05:00", "date_updated" : "2017-05-01T16:04:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:12880022", "note_dtos" : [ { "internal" : false, "free_text" : "The mutant allele was created by targeting the exon 3 of rat Apoe. This mutant allele has a 16-bp deletion in the gene and resulted in loss of Apoe protein in homozygotes.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29166645", "RGD:12880024", "RGD:150520219" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "amyloid beta precursor protein; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "amyloid beta precursor protein; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "App[em1Sage]", "display_text" : "Appem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Appem1Sage", "display_text" : "Appem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12880027", "page_area" : "allele", "display_name" : "RGD:12880027" } }, "date_created" : "2017-05-01T16:41:37.000-05:00", "date_updated" : "2017-05-01T16:41:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:12880027", "note_dtos" : [ { "internal" : false, "free_text" : "Homozygous knockout rats exhibit complete loss of protein", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dystrophin; TALEN-induced mutant1, Ang", "display_text" : "dystrophin; TALEN-induced mutant1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dmd[em1Ang]", "display_text" : "Dmdem1Ang", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dmd[mdx[", "display_text" : "Dmdmdx", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Dmdem1Ang", "display_text" : "Dmdem1Ang", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12880032", "page_area" : "allele", "display_name" : "RGD:12880032" } }, "date_created" : "2017-05-02T11:57:17.000-05:00", "date_updated" : "2017-05-02T11:57:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:12880032", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was generated using TALEN targeting exon23 of rat Dmd. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 frame shift and premature stop codon 81 bp after the mutation.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25310701", "RGD:12880034" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Gh1[sdr]", "display_text" : "Gh1sdr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gh1[sdr]", "display_text" : "Gh1sdr", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gh1sdr", "display_text" : "Gh1sdr", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12880380", "page_area" : "allele", "display_name" : "RGD:12880380" } }, "date_created" : "2017-05-04T13:20:11.000-05:00", "date_updated" : "2017-05-04T13:20:11.000-05:00", "internal" : false, "primary_external_id" : "RGD:12880380", "note_dtos" : [ { "internal" : false, "free_text" : "The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype in SDR rats. This spontaneous mutation affected the 3' splice/acceptor site causing 1-bp deletion in mRNA and resulting in pre-mature termination of translation.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:2152867", "PMID:2752987", "RGD:1578505", "RGD:1578506" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "calcium voltage-gated channel subunit alpha1 A; groggy mutant", "display_text" : "calcium voltage-gated channel subunit alpha1 A; groggy mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cacna1a[gry]", "display_text" : "Cacna1agry", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cacna1agry", "display_text" : "Cacna1agry", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12880382", "page_area" : "allele", "display_name" : "RGD:12880382" } }, "date_created" : "2017-05-04T15:35:16.000-05:00", "date_updated" : "2017-05-04T15:35:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:12880382", "note_dtos" : [ { "internal" : false, "free_text" : "Groggy (gry) mutation was found in wistar rats and identified as 752T>A(M251K)in the rat Cacna1a gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17196942", "RGD:1598976" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily A member 1;autosomal dominant myokymia and seizures", "display_text" : "potassium voltage-gated channel subfamily A member 1;autosomal dominant myokymia and seizures", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcna1[Adms]", "display_text" : "Kcna1Adms", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcna1Adms", "display_text" : "Kcna1Adms", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12880383", "page_area" : "allele", "display_name" : "RGD:12880383" } }, "date_created" : "2017-05-04T16:46:38.000-05:00", "date_updated" : "2017-05-04T16:46:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:12880383", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was generated by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in rat Kcna1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22206926", "RGD:10047237" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "growth hormone secretagogue receptor;CRISPR induced mutant 1, Ottc", "display_text" : "growth hormone secretagogue receptor;CRISPR induced mutant 1, Ottc", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ghsr[em1Ottc]", "display_text" : "Ghsrem1Ottc", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ghsrem1Ottc", "display_text" : "Ghsrem1Ottc", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12880435", "page_area" : "allele", "display_name" : "RGD:12880435" } }, "date_created" : "2017-05-08T11:49:06.000-05:00", "date_updated" : "2017-05-08T11:49:06.000-05:00", "internal" : false, "primary_external_id" : "RGD:12880435", "note_dtos" : [ { "internal" : false, "free_text" : "Mutation induced by CRISPR in the Ghsr gene,It is a 843-bp deletion mutation resulting knockout of protein expression.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29453460", "PMID:30456835", "RGD:13825258", "RGD:13825259" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "brain-derived neurotrophic factor; ZFN induced mutant 1, Sage", "display_text" : "brain-derived neurotrophic factor; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:24:54.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Bdnf[em1Sage]", "display_text" : "Bdnfem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "brain-derived neurotrophic factor; endonuclease induced mutant 1, SAGE", "display_text" : "brain-derived neurotrophic factor; endonuclease induced mutant 1, SAGE", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Bdnfem1Sage", "display_text" : "Bdnfem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12902622", "page_area" : "allele", "display_name" : "RGD:12902622" } }, "date_created" : "2017-05-09T14:47:46.000-05:00", "date_updated" : "2017-05-09T14:47:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:12902622", "note_dtos" : [ { "internal" : false, "free_text" : "This is a ZFN induced knockout allele. Homozygous knockout rats exhibit complete loss of BDNF protein and have a lifespan of 2-3 days.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:23583595", "RGD:38501054" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear receptor subfamily 1, group I, member 2; ZFN induced mutant1, Sage", "display_text" : "nuclear receptor subfamily 1, group I, member 2; ZFN induced mutant1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-03-14T13:29:39.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:34:41.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:31:49.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nr1i2[em1Sage]", "display_text" : "Nr1i2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "nuclear receptor subfamily 1, group I, member 2; endonuclease induced mutant1, SAGE", "display_text" : "nuclear receptor subfamily 1, group I, member 2; endonuclease induced mutant1, SAGE", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Nr1i2 em1Sage", "display_text" : "Nr1i2 em1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nr1i2 [em1Sage]", "display_text" : "Nr1i2 em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12902626", "page_area" : "allele", "display_name" : "RGD:12902626" } }, "date_created" : "2017-05-09T15:36:38.000-05:00", "date_updated" : "2017-05-09T15:36:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:12902626", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN induced allele contains a 20-bp deletion within exon 2 of the Nr1i2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27856527", "PMID:28716828", "PMID:29548889", "RGD:127285625", "RGD:13432137", "RGD:38549342" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear receptor subfamily 1, group I, member 3; ZFN induced mutant 1,SAGE", "display_text" : "nuclear receptor subfamily 1, group I, member 3; ZFN induced mutant 1,SAGE", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-03-14T13:30:15.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-10-24T10:58:28.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nr1i3[em1Sage]", "display_text" : "Nr1i3em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nr1i3 [em1Sage", "display_text" : "Nr1i3 em1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nr1i3 em1Sage", "display_text" : "Nr1i3 em1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nr1i3 [em1Sage]", "display_text" : "Nr1i3 em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12903268", "page_area" : "allele", "display_name" : "RGD:12903268" } }, "date_created" : "2017-05-10T13:29:32.000-05:00", "date_updated" : "2017-05-10T13:29:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:12903268", "note_dtos" : [ { "internal" : false, "free_text" : "This is a knockout allele induced by the zinc finger nuclease genome editing system. The allele contains a 10-bp deletion within exon 2 of the rat Nr1i3 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28716828", "RGD:12880024", "RGD:13432137" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aryl hydrocarbon receptor; ZFN induced mutant1, Sage", "display_text" : "aryl hydrocarbon receptor; ZFN induced mutant1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:33:58.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:33:40.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ahr[em1Sage]", "display_text" : "Ahrem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "aryl hydrocarbon receptor; endonuclease induced mutant1, SAGE", "display_text" : "aryl hydrocarbon receptor; endonuclease induced mutant1, SAGE", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Ahrem1Sage", "display_text" : "Ahrem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12903271", "page_area" : "allele", "display_name" : "RGD:12903271" } }, "date_created" : "2017-05-10T13:58:16.000-05:00", "date_updated" : "2017-05-10T13:58:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:12903271", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN allele contains a 760-bp deletion in the rat Ahr gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:12880024" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily B member 1A; ZFN induced mutant 1, Sage", "display_text" : "ATP binding cassette subfamily B member 1A; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-10-24T11:00:41.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:43:01.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcb1a[em1Sage]", "display_text" : "Abcb1aem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcb1a tm1sage", "display_text" : "Abcb1a tm1sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "ATP binding cassette subfamily B member 1A; endonuclease induced mutant 1, Sage", "display_text" : "ATP binding cassette subfamily B member 1A; endonuclease induced mutant 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Abcb1a[em1Sage", "display_text" : "Abcb1aem1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Abcb1aem1Sage", "display_text" : "Abcb1aem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904058", "page_area" : "allele", "display_name" : "RGD:12904058" } }, "date_created" : "2017-05-16T15:12:06.000-05:00", "date_updated" : "2017-05-16T15:12:06.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904058", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN mutant allelic contain a 20-bp deletion within Abcba1 gene, resulting knockout of protein expression via Western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22711747", "PMID:24398459", "RGD:12880024", "RGD:14392811", "RGD:150429695" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily G (WHITE), member 2; ZFN induced mutant 1, Sage", "display_text" : "ATP-binding cassette, subfamily G (WHITE), member 2; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:45:19.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcg2[em1Sage]", "display_text" : "Abcg2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bcrp Knockout", "display_text" : "Bcrp Knockout", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Abcg2 tm1sage", "display_text" : "Abcg2 tm1sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "ATP-binding cassette, subfamily G (WHITE), member 2; endonuclease induced mutatn 1, Sage", "display_text" : "ATP-binding cassette, subfamily G (WHITE), member 2; endonuclease induced mutatn 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Abcg2em1Sage", "display_text" : "Abcg2em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904064", "page_area" : "allele", "display_name" : "RGD:12904064" } }, "date_created" : "2017-05-16T16:19:17.000-05:00", "date_updated" : "2017-05-16T16:19:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904064", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN mutant allelic contain a 588-bp deletion within Abcg2 gene , resulting knockout of protein expression via Western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22711747", "RGD:12880024", "RGD:14392811" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 2, subfamily j, polypeptide 4, ZFN induced mutant 1, Sage", "display_text" : "cytochrome P450, family 2, subfamily j, polypeptide 4, ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp2j4[em1Sage]", "display_text" : "Cyp2j4em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp2j4-KO", "display_text" : "Cyp2j4-KO", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Cyp2j4em1Sage", "display_text" : "Cyp2j4em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904681", "page_area" : "allele", "display_name" : "RGD:12904681" } }, "date_created" : "2017-05-17T15:56:05.000-05:00", "date_updated" : "2017-05-17T15:56:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904681", "note_dtos" : [ { "internal" : false, "free_text" : "ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25840911", "PMID:29656108", "RGD:12904676", "RGD:150520032" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily C member 2; ZFN induced mutant 1, Sage", "display_text" : "ATP binding cassette subfamily C member 2; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:47:47.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcc2[em1Sage]", "display_text" : "Abcc2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "ATP binding cassette subfamily C member 2; endonuclease induced mutant 1, Sage", "display_text" : "ATP binding cassette subfamily C member 2; endonuclease induced mutant 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Abcc2em1Sage", "display_text" : "Abcc2em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904687", "page_area" : "allele", "display_name" : "RGD:12904687" } }, "date_created" : "2017-05-17T16:35:12.000-05:00", "date_updated" : "2017-05-17T16:35:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904687", "note_dtos" : [ { "internal" : false, "free_text" : "This allele contains biallelic 726 bp deletion within Abcc2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22711747", "RGD:12880024", "RGD:14392811" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily B member 11;ZFN induced mutant 1, Sage", "display_text" : "ATP binding cassette subfamily B member 11;ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:09:53.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcb11[em1Sage]", "display_text" : "Abcb11em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BSEP Knockout", "display_text" : "BSEP Knockout", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "ATP binding cassette subfamily B member 11;endonuclease induced mutant 1, Sage", "display_text" : "ATP binding cassette subfamily B member 11;endonuclease induced mutant 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Abcb11em1Sage", "display_text" : "Abcb11em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904731", "page_area" : "allele", "display_name" : "RGD:12904731" } }, "date_created" : "2017-05-19T15:21:14.000-05:00", "date_updated" : "2017-05-19T15:21:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904731", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN induced allele contains 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:12880024" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 22 member 1; ZFN induced mutant 1, Sage", "display_text" : "solute carrier family 22 member 1; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:12:15.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc22a1[em1Sage]", "display_text" : "Slc22a1em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Oct1 Knockout", "display_text" : "Oct1 Knockout", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "solute carrier family 22 member 1; endonuclease induced mutant 1, Sage", "display_text" : "solute carrier family 22 member 1; endonuclease induced mutant 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Slc22a1em1Sage", "display_text" : "Slc22a1em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904734", "page_area" : "allele", "display_name" : "RGD:12904734" } }, "date_created" : "2017-05-19T15:44:41.000-05:00", "date_updated" : "2017-05-19T15:44:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904734", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN induced allele contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:12880024" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tumor protein p53; ZFN induced mutant 1, Sage", "display_text" : "tumor protein p53; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:30:29.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tp53[em1Sage]", "display_text" : "Tp53em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tp53 tm1sage", "display_text" : "Tp53 tm1sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "tumor protein p53; endonuclease induced mutant 1, Sage", "display_text" : "tumor protein p53; endonuclease induced mutant 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Tp53em1Sage", "display_text" : "Tp53em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904898", "page_area" : "allele", "display_name" : "RGD:12904898" } }, "date_created" : "2017-05-24T14:43:51.000-05:00", "date_updated" : "2017-05-24T14:43:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904898", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN allele exhibits a 11 base pair deletion in the rat Tp53 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22917926", "PMID:28834365", "RGD:11075077", "RGD:12880024", "RGD:14995504" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating 1; ZFN induced mutant 1, Sage", "display_text" : "recombination activating 1; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:07:39.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag1[em1Sage]", "display_text" : "Rag1em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag1 tm1sage", "display_text" : "Rag1 tm1sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "recombination activating 1; endonuclease induced mutant 1, Sage", "display_text" : "recombination activating 1; endonuclease induced mutant 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Rag1em1Sage", "display_text" : "Rag1em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904901", "page_area" : "allele", "display_name" : "RGD:12904901" } }, "date_created" : "2017-05-24T15:09:31.000-05:00", "date_updated" : "2017-05-24T15:09:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904901", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN mutant allele has a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:12880024" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating 2; ZFN induced mutant1, Sage", "display_text" : "recombination activating 2; ZFN induced mutant1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-20T13:16:39.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag2[em1Sage]", "display_text" : "Rag2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag2 tm1sage", "display_text" : "Rag2 tm1sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "recombination activating 2; endonuclease induced mutant1, Sage", "display_text" : "recombination activating 2; endonuclease induced mutant1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Rag2em1Sage", "display_text" : "Rag2em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904904", "page_area" : "allele", "display_name" : "RGD:12904904" } }, "date_created" : "2017-05-24T15:31:31.000-05:00", "date_updated" : "2017-05-24T15:31:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904904", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN mutant allele has a 2 bp deletion within exon 3 of the Rag2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:12880024" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "low density lipoprotein receptor; ZFN induced mutant 1, Sage", "display_text" : "low density lipoprotein receptor; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-08T15:24:42.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ldlr[em1Sage]", "display_text" : "Ldlrem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ldlr tm1sage", "display_text" : "Ldlr tm1sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "low density lipoprotein receptor; endonuclease induced mutant 1, Sage", "display_text" : "low density lipoprotein receptor; endonuclease induced mutant 1, Sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Ldlrem1Sage", "display_text" : "Ldlrem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904909", "page_area" : "allele", "display_name" : "RGD:12904909" } }, "date_created" : "2017-05-24T16:06:44.000-05:00", "date_updated" : "2017-05-24T16:06:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904909", "note_dtos" : [ { "internal" : false, "free_text" : "This allele possesses a 337 bp deletion and 4 bp insertion within Exon 4 of rat Ldlr gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28469073", "RGD:12880024", "RGD:12910100" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin; zinc finger nuclease induced mutant1, Sage", "display_text" : "leptin; zinc finger nuclease induced mutant1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lep[em1Sage]", "display_text" : "Lepem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lep tm1sage", "display_text" : "Lep tm1sage", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Lepem1Sage", "display_text" : "Lepem1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12904927", "page_area" : "allele", "display_name" : "RGD:12904927" } }, "date_created" : "2017-05-26T11:28:29.000-05:00", "date_updated" : "2017-05-26T11:28:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:12904927", "note_dtos" : [ { "internal" : false, "free_text" : "This allele possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22948215", "RGD:12904911" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily B member 1A; ZFN induced mutant 2, Sage", "display_text" : "ATP binding cassette subfamily B member 1A; ZFN induced mutant 2, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcb1a[em2Sage]", "display_text" : "Abcb1aem2Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcb1aem2Sage", "display_text" : "Abcb1aem2Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12907569", "page_area" : "allele", "display_name" : "RGD:12907569" } }, "date_created" : "2017-06-07T14:42:24.000-05:00", "date_updated" : "2017-06-07T14:42:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:12907569", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN-induced mutant allele contains 19-bp deletion in exon7 resulting total loss of protein expression.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22049154", "RGD:8657330" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily B member 1A; ZFN induced mutant 3, Sage)", "display_text" : "ATP binding cassette subfamily B member 1A; ZFN induced mutant 3, Sage)", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcb1a[em3Sage]", "display_text" : "Abcb1aem3Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcb1aem3Sage", "display_text" : "Abcb1aem3Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12907571", "page_area" : "allele", "display_name" : "RGD:12907571" } }, "date_created" : "2017-06-07T14:57:46.000-05:00", "date_updated" : "2017-06-07T14:57:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:12907571", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN-induced mutant allele contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22049154", "RGD:8657330" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant1,Kyo", "display_text" : "protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant1,Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prkdc[em1Kyo]", "display_text" : "Prkdcem1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Prkdcem1Kyo", "display_text" : "Prkdcem1Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910095", "page_area" : "allele", "display_name" : "RGD:12910095" } }, "date_created" : "2017-06-08T12:13:22.000-05:00", "date_updated" : "2017-06-08T12:13:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910095", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN induced mutant allele contains a 46-bp deletion in the exon1 of Prkdc gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22981234", "RGD:8696027" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant2,Kyo", "display_text" : "protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant2,Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prkdc[em2Kyo]", "display_text" : "Prkdcem2Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Prkdcem2Kyo", "display_text" : "Prkdcem2Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910096", "page_area" : "allele", "display_name" : "RGD:12910096" } }, "date_created" : "2017-06-08T12:36:21.000-05:00", "date_updated" : "2017-06-08T12:36:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910096", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN induced mutant allele contains a 227-bp deletion in the exon1 of Prkdc gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 6, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 6, Kyo", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-08T12:50:24.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em6Kyo]", "display_text" : "Il2rgem6Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem6Kyo", "display_text" : "Il2rgem6Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910097", "page_area" : "allele", "display_name" : "RGD:12910097" } }, "date_created" : "2017-06-08T12:46:41.000-05:00", "date_updated" : "2017-06-08T12:46:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910097", "note_dtos" : [ { "internal" : false, "free_text" : "These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm. A 332-bp deletion mutation was created.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant4,Kyo", "display_text" : "protein kinase, DNA activated, catalytic polypeptide; ZFN induced mutant4,Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prkdc[em4Kyo]", "display_text" : "Prkdcem4Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Prkdcem4Kyo", "display_text" : "Prkdcem4Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910098", "page_area" : "allele", "display_name" : "RGD:12910098" } }, "date_created" : "2017-06-08T13:02:11.000-05:00", "date_updated" : "2017-06-08T13:02:11.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910098", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN induced mutant allele contains a 20-bp deletion in the exon1 of Prkdc gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em5Kyo]", "display_text" : "Il2rgem5Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem5Kyo", "display_text" : "Il2rgem5Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910099", "page_area" : "allele", "display_name" : "RGD:12910099" } }, "date_created" : "2017-06-08T13:05:43.000-05:00", "date_updated" : "2017-06-08T13:05:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910099", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN induced mutant allele contains a 653-bp deletion in the Il2rg gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "low density lipoprotein receptor; ZFN induced mutant 1", "display_text" : "low density lipoprotein receptor; ZFN induced mutant 1", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-10-24T10:57:20.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ldlr[em1]", "display_text" : "Ldlrem1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ldlr[em1", "display_text" : "Ldlrem1", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Ldlrem1", "display_text" : "Ldlrem1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910102", "page_area" : "allele", "display_name" : "RGD:12910102" } }, "date_created" : "2017-06-08T15:23:14.000-05:00", "date_updated" : "2017-06-08T15:23:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910102", "note_dtos" : [ { "internal" : false, "free_text" : "This allele possesses a 19-bp deletion in the seventh exon of the ldlr gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27378433", "RGD:12910104" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 15; ZFN induced mutant 1, Soar", "display_text" : "interleukin 15; ZFN induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il15[em1Soar]", "display_text" : "Il15em1Soar", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il15em1Soar", "display_text" : "Il15em1Soar", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910491", "page_area" : "allele", "display_name" : "RGD:12910491" } }, "date_created" : "2017-06-16T09:51:51.000-05:00", "date_updated" : "2017-06-16T09:51:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910491", "note_dtos" : [ { "internal" : false, "free_text" : "Zinc finger nuclease mediated 7bp deletion within exon 2 of the rat Il15 gene, resulting in a frameshift and premature stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27999109", "PMID:28395334", "RGD:12910490", "RGD:12910492" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1", "display_text" : "interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ifnar1[em1]", "display_text" : "Ifnar1em1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ifnar1em1", "display_text" : "Ifnar1em1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910495", "page_area" : "allele", "display_name" : "RGD:12910495" } }, "date_created" : "2017-06-16T11:42:22.000-05:00", "date_updated" : "2017-06-16T11:42:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910495", "note_dtos" : [ { "internal" : false, "free_text" : "An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion in the exon 4 of Ifnar1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27999109", "RGD:12910492" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 2", "display_text" : "interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 2", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ifnar1[em2]", "display_text" : "Ifnar1em2", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ifnar1em2", "display_text" : "Ifnar1em2", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910496", "page_area" : "allele", "display_name" : "RGD:12910496" } }, "date_created" : "2017-06-16T11:44:32.000-05:00", "date_updated" : "2017-06-16T11:44:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910496", "note_dtos" : [ { "internal" : false, "free_text" : "An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion and 4-bp insertion in the exon 4 of Ifnar1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27999109", "RGD:12910492" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "matrix metallopeptidase 12; TALEN induced mutant 1,Soar", "display_text" : "matrix metallopeptidase 12; TALEN induced mutant 1,Soar", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-16T15:12:14.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Mmp12[em1Soar]", "display_text" : "Mmp12em1Soar", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mmp12em1Soar", "display_text" : "Mmp12em1Soar", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910500", "page_area" : "allele", "display_name" : "RGD:12910500" } }, "date_created" : "2017-06-16T13:44:46.000-05:00", "date_updated" : "2017-06-16T13:44:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910500", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system caused a 664-bp deletion in the exon 2 of rat Mmp12", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27807143", "RGD:12910498" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "matrix metallopeptidase 12; TALEN induced mutant 2,Soar", "display_text" : "matrix metallopeptidase 12; TALEN induced mutant 2,Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mmp12[em2Soar]", "display_text" : "Mmp12em2Soar", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mmp12em2Soar", "display_text" : "Mmp12em2Soar", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910506", "page_area" : "allele", "display_name" : "RGD:12910506" } }, "date_created" : "2017-06-16T15:11:48.000-05:00", "date_updated" : "2017-06-16T15:11:48.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910506", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system caused a 607-bp deletion in the exon 2 of rat Mmp12", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27807143", "RGD:12910498" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor; TALEN induced mutant 1", "display_text" : "leptin receptor; TALEN induced mutant 1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[em1]", "display_text" : "Leprem1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Leprem1", "display_text" : "Leprem1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910515", "page_area" : "allele", "display_name" : "RGD:12910515" } }, "date_created" : "2017-06-16T17:46:11.000-05:00", "date_updated" : "2017-06-16T17:46:11.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910515", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27225180", "RGD:12910507" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor; TALEN induced mutant 2", "display_text" : "leptin receptor; TALEN induced mutant 2", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[em2]", "display_text" : "Leprem2", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Leprem2", "display_text" : "Leprem2", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910518", "page_area" : "allele", "display_name" : "RGD:12910518" } }, "date_created" : "2017-06-16T17:50:04.000-05:00", "date_updated" : "2017-06-16T17:50:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910518", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27225180", "RGD:12910507" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor; TALEN induced mutant 3", "display_text" : "leptin receptor; TALEN induced mutant 3", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-06-19T14:48:03.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[em3]", "display_text" : "Leprem3", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Leprem3", "display_text" : "Leprem3", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910546", "page_area" : "allele", "display_name" : "RGD:12910546" } }, "date_created" : "2017-06-19T14:46:12.000-05:00", "date_updated" : "2017-06-19T14:46:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910546", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27225180", "RGD:12910507" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "estrogen receptor 1; ZFN induced mutant 1, Soar", "display_text" : "estrogen receptor 1; ZFN induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Esr1[em1Soar]", "display_text" : "Esr1em1Soar", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Esr1em1Soar", "display_text" : "Esr1em1Soar", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910736", "page_area" : "allele", "display_name" : "RGD:12910736" } }, "date_created" : "2017-06-22T15:19:23.000-05:00", "date_updated" : "2017-06-22T15:19:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910736", "note_dtos" : [ { "internal" : false, "free_text" : "zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24506075", "RGD:8552987" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "KIT proto-oncogene receptor tyrosine kinase; mutant 1", "display_text" : "KIT proto-oncogene receptor tyrosine kinase; mutant 1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kit[Ws]", "display_text" : "KitWs", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "KitWs", "display_text" : "KitWs", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910763", "page_area" : "allele", "display_name" : "RGD:12910763" } }, "date_created" : "2017-06-23T14:36:18.000-05:00", "date_updated" : "2017-06-23T14:36:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910763", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous 12-bp deletion mutation in the tyrosine kinase domain of the c-Kit gene was identified in the white spotting rat.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:11112797", "PMID:17322067", "PMID:1912576", "PMID:1912577", "PMID:7542218", "PMID:7694680", "RGD:12910748", "RGD:12910751", "RGD:12910822", "RGD:2292520", "RGD:5133424", "RGD:633170" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "zinc finger and BTB domain containing 16, Lx mutant", "display_text" : "zinc finger and BTB domain containing 16, Lx mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Zbtb16[Lx]", "display_text" : "Zbtb16Lx", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Zbtb16Lx", "display_text" : "Zbtb16Lx", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910834", "page_area" : "allele", "display_name" : "RGD:12910834" } }, "date_created" : "2017-06-26T16:16:51.000-05:00", "date_updated" : "2017-06-26T16:16:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910834", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous 2964 bp deletion mutation was identified in the intron 2 of Zbtb16 gene of SHR-Lx PD5(SHR.PD-(D8Rat42-D8Arb23)/Cub) rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19191224", "RGD:2312786" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cyclin-dependent kinase inhibitor 1B; white eye mutation", "display_text" : "cyclin-dependent kinase inhibitor 1B; white eye mutation", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cdkn1b[we]", "display_text" : "Cdkn1bwe", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "p27-G177fs", "display_text" : "p27-G177fs", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Cdkn1bwe", "display_text" : "Cdkn1bwe", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910941", "page_area" : "allele", "display_name" : "RGD:12910941" } }, "date_created" : "2017-06-28T15:44:08.000-05:00", "date_updated" : "2017-06-28T15:44:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910941", "note_dtos" : [ { "internal" : false, "free_text" : "A tandem duplication of 8 nt in exon 2 of the rat Cdkn1b was identified in the Sprague-Dawley white eye mutant strain. The 8-nt insertion results in a frameshift after codon 177 (p. G177fs), predicting a different C-terminal domain containing 42 p27-unrelated amino acid residues.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:12036912", "PMID:17030811", "RGD:2293616", "RGD:619590" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "colony stimulating factor 1; tooth less mutant", "display_text" : "colony stimulating factor 1; tooth less mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Csf1[tl]", "display_text" : "Csf1tl", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Csf1tl", "display_text" : "Csf1tl", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:12910954", "page_area" : "allele", "display_name" : "RGD:12910954" } }, "date_created" : "2017-06-29T16:01:19.000-05:00", "date_updated" : "2017-06-29T16:01:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:12910954", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:12074592", "PMID:12379742", "RGD:628338", "RGD:70875" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin VIIA; ENU induced tornado mutant, Hubr", "display_text" : "myosin VIIA; ENU induced tornado mutant, Hubr", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-03-14T13:30:54.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Myo7a[tnd]/Hubr", "display_text" : "Myo7atnd/Hubr", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Myo7a[tnd-1Hubr]", "display_text" : "Myo7atnd-1Hubr", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Myo7atnd /Hubr", "display_text" : "Myo7atnd /Hubr", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Myo7a[tnd] /Hubr", "display_text" : "Myo7atnd /Hubr", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13204705", "page_area" : "allele", "display_name" : "RGD:13204705" } }, "date_created" : "2017-07-13T15:57:56.000-05:00", "date_updated" : "2017-07-13T15:57:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:13204705", "note_dtos" : [ { "internal" : false, "free_text" : "ENU induced an A-to-T transversion at position 362 caused a premature stopcodon in exon 5 in the middle of the myosin head encoding sequence and thereby most likely results in a complete loss of function of the rat Myo7a gene.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:15965244", "RGD:1581470" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "pappalysin 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "display_text" : "pappalysin 2; CRISPR/Cas9 system induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pappa2[em4Mcwi]", "display_text" : "Pappa2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pappa2em4Mcwi", "display_text" : "Pappa2em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13204758", "page_area" : "allele", "display_name" : "RGD:13204758" } }, "date_created" : "2017-07-18T15:51:35.000-05:00", "date_updated" : "2017-07-18T15:51:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:13204758", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "pappalysin 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "display_text" : "pappalysin 2; CRISPR/Cas9 system induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pappa2[em5Mcwi]", "display_text" : "Pappa2em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pappa2em5Mcwi", "display_text" : "Pappa2em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13204789", "page_area" : "allele", "display_name" : "RGD:13204789" } }, "date_created" : "2017-07-19T11:55:49.000-05:00", "date_updated" : "2017-07-19T11:55:49.000-05:00", "internal" : false, "primary_external_id" : "RGD:13204789", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "citron rho-interacting serine/threonine kinase; flat head mutant, Jjlo", "display_text" : "citron rho-interacting serine/threonine kinase; flat head mutant, Jjlo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cit[fhJjlo]", "display_text" : "CitfhJjlo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CitfhJjlo", "display_text" : "CitfhJjlo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13204831", "page_area" : "allele", "display_name" : "RGD:13204831" } }, "date_created" : "2017-07-21T11:19:29.000-05:00", "date_updated" : "2017-07-21T11:19:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:13204831", "note_dtos" : [ { "internal" : false, "free_text" : "Spontaneous single G deletion in exon 1 of citron kinase (Cit)confers a premature stop codon and lack of citron kinase protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:10219263", "PMID:11932363", "RGD:13204832", "RGD:13204836" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tyrosinase; sia mutant", "display_text" : "tyrosinase; sia mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tyr[siaKyo]", "display_text" : "TyrsiaKyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "TyrsiaKyo", "display_text" : "TyrsiaKyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207345", "page_area" : "allele", "display_name" : "RGD:13207345" } }, "date_created" : "2017-07-26T15:42:14.000-05:00", "date_updated" : "2017-07-26T15:42:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207345", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous missense mutation in exon 1 of the tyrosinase gene, S79P, was responsible for siamese phenotype in American fancy rat colony.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor nicotinic beta 4 subunit;CRISPR/Cas9 system induced mutant 5, Mcwi", "display_text" : "cholinergic receptor nicotinic beta 4 subunit;CRISPR/Cas9 system induced mutant 5, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrnb4[em5Mcwi]", "display_text" : "Chrnb4em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chrnb4em5Mcwi", "display_text" : "Chrnb4em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207489", "page_area" : "allele", "display_name" : "RGD:13207489" } }, "date_created" : "2017-08-02T11:57:36.000-05:00", "date_updated" : "2017-08-02T11:57:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207489", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant6, Mcwi", "display_text" : "CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant6, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd55[em6Mcwi]", "display_text" : "Cd55em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd55em6Mcwi", "display_text" : "Cd55em6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207493", "page_area" : "allele", "display_name" : "RGD:13207493" } }, "date_created" : "2017-08-02T13:11:50.000-05:00", "date_updated" : "2017-08-02T13:11:50.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207493", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 5-bp deletion and one C insertion, resulting in a net 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant4, Mcwi", "display_text" : "CD55 molecule, decay accelerating factor for complement; CRISPR/Cas9 induced mutant4, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd55[em4Mcwi]", "display_text" : "Cd55em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd55em4Mcwi", "display_text" : "Cd55em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207495", "page_area" : "allele", "display_name" : "RGD:13207495" } }, "date_created" : "2017-08-02T14:07:44.000-05:00", "date_updated" : "2017-08-02T14:07:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207495", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium inwardly-rectifying channel, subfamily J, member 13; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "potassium inwardly-rectifying channel, subfamily J, member 13; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-08-07T15:12:00.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj13[em1Mcwi]", "display_text" : "Kcnj13em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnj13em1Mcwi", "display_text" : "Kcnj13em1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily J member 13; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "potassium voltage-gated channel subfamily J member 13; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207498", "page_area" : "allele", "display_name" : "RGD:13207498" } }, "date_created" : "2017-08-02T14:27:29.000-05:00", "date_updated" : "2017-08-02T14:27:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207498", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant2, Mcwi", "display_text" : "NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nlrp10[em2Mcwi]", "display_text" : "Nlrp10em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nlrp10em2Mcwi", "display_text" : "Nlrp10em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207502", "page_area" : "allele", "display_name" : "RGD:13207502" } }, "date_created" : "2017-08-03T11:26:14.000-05:00", "date_updated" : "2017-08-03T11:26:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207502", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant3, Mcwi", "display_text" : "NLR family, pyrin domain containing 10; CRISPR/Cas9 induced mutant3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nlrp10[em3Mcwi]", "display_text" : "Nlrp10em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nlrp10em3Mcwi", "display_text" : "Nlrp10em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207504", "page_area" : "allele", "display_name" : "RGD:13207504" } }, "date_created" : "2017-08-03T11:33:27.000-05:00", "date_updated" : "2017-08-03T11:33:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207504", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NLR family, pyrin domain containing 12; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "NLR family, pyrin domain containing 12; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nlrp12[em1Mcwi]", "display_text" : "Nlrp12em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nlrp12em1Mcwi", "display_text" : "Nlrp12em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207508", "page_area" : "allele", "display_name" : "RGD:13207508" } }, "date_created" : "2017-08-03T11:58:26.000-05:00", "date_updated" : "2017-08-03T11:58:26.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207508", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2X 1; CRISPR/Cas9 induced mutant7, Medical College of Wisconsin", "display_text" : "purinergic receptor P2X 1; CRISPR/Cas9 induced mutant7, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx1[em7Mcwi]", "display_text" : "P2rx1em7Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "P2rx1em7Mcwi", "display_text" : "P2rx1em7Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207510", "page_area" : "allele", "display_name" : "RGD:13207510" } }, "date_created" : "2017-08-03T13:01:17.000-05:00", "date_updated" : "2017-08-03T13:01:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207510", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "display_text" : "telomerase reverse transcriptase; CRISPR/Cas9 system induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tert[em3Mcwi]", "display_text" : "Tertem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tertem3Mcwi", "display_text" : "Tertem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207523", "page_area" : "allele", "display_name" : "RGD:13207523" } }, "date_created" : "2017-08-04T10:01:59.000-05:00", "date_updated" : "2017-08-04T10:01:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207523", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of Crl:SD rat embryos. The resulting mutation is a 17-bp deletion of exon1 in Tert gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant3, Mcwi", "display_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant3, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-08-04T11:31:25.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "spp1[em3Mcwi]", "display_text" : "spp1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "spp1em3Mcwi", "display_text" : "spp1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207528", "page_area" : "allele", "display_name" : "RGD:13207528" } }, "date_created" : "2017-08-04T11:04:19.000-05:00", "date_updated" : "2017-08-04T11:04:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207528", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant4, Mcwi", "display_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant4, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Spp1[em4Mcwi]", "display_text" : "Spp1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Spp1em4Mcwi", "display_text" : "Spp1em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13207530", "page_area" : "allele", "display_name" : "RGD:13207530" } }, "date_created" : "2017-08-04T11:27:58.000-05:00", "date_updated" : "2017-08-04T11:27:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:13207530", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tph1[em1Mcwi]", "display_text" : "Tph1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tph1em1Mcwi", "display_text" : "Tph1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13208230", "page_area" : "allele", "display_name" : "RGD:13208230" } }, "date_created" : "2017-08-08T13:56:08.000-05:00", "date_updated" : "2017-08-08T13:56:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:13208230", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant3, Mcwi", "display_text" : "tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tph1[em3Mcwi]", "display_text" : "Tph1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tph1em3Mcwi", "display_text" : "Tph1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13208232", "page_area" : "allele", "display_name" : "RGD:13208232" } }, "date_created" : "2017-08-08T14:35:09.000-05:00", "date_updated" : "2017-08-08T14:35:09.000-05:00", "internal" : false, "primary_external_id" : "RGD:13208232", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptgs2[em1Mcwi]", "display_text" : "Ptgs2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ptgs2em1Mcwi", "display_text" : "Ptgs2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13208843", "page_area" : "allele", "display_name" : "RGD:13208843" } }, "date_created" : "2017-08-21T11:27:58.000-05:00", "date_updated" : "2017-08-21T11:27:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:13208843", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant2, Mcwi", "display_text" : "prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptgs2[em2Mcwi]", "display_text" : "Ptgs2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ptgs2em2Mcwi", "display_text" : "Ptgs2em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13208845", "page_area" : "allele", "display_name" : "RGD:13208845" } }, "date_created" : "2017-08-21T11:36:06.000-05:00", "date_updated" : "2017-08-21T11:36:06.000-05:00", "internal" : false, "primary_external_id" : "RGD:13208845", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 4 in the Ptgs2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome b-245 alpha chain;mutant 1,Sdi", "display_text" : "cytochrome b-245 alpha chain;mutant 1,Sdi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-03-31T13:44:40.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-03-31T13:43:45.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-03-31T13:43:33.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-03-31T13:42:57.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyba[mesSdi]", "display_text" : "CybamesSdi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyba[m1Sdi]", "display_text" : "Cybam1Sdi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Cyba[mes]/Sdi", "display_text" : "Cybames/Sdi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Cyba[mes]", "display_text" : "Cybames", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Cybam1Sdi", "display_text" : "Cybam1Sdi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13209000", "page_area" : "allele", "display_name" : "RGD:13209000" } }, "date_created" : "2017-08-28T10:16:51.000-05:00", "date_updated" : "2017-08-28T10:16:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:13209000", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was identified in the MES rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. It carries a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19406829", "PMID:20660993", "PMID:21512270", "RGD:11040542", "RGD:5134976", "RGD:5134988" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin; CRISPR/Cas9 induced mutant 1", "display_text" : "leptin; CRISPR/Cas9 induced mutant 1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lep[em1]", "display_text" : "Lepem1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lepem1", "display_text" : "Lepem1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13210580", "page_area" : "allele", "display_name" : "RGD:13210580" } }, "date_created" : "2017-09-05T14:18:21.000-05:00", "date_updated" : "2017-09-05T14:18:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:13210580", "note_dtos" : [ { "internal" : false, "free_text" : "This allele possesses a 3 bp deletion resulting in the deletion of isoleucine at position 14.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27378381", "RGD:13210573" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "UDP glucuronosyltransferase family 1 member A1, jaundice mutant", "display_text" : "UDP glucuronosyltransferase family 1 member A1, jaundice mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ugt1a1[j]", "display_text" : "Ugt1a1j", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ugt1a1j", "display_text" : "Ugt1a1j", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13432064", "page_area" : "allele", "display_name" : "RGD:13432064" } }, "date_created" : "2017-09-18T09:34:13.000-05:00", "date_updated" : "2017-09-18T09:34:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:13432064", "note_dtos" : [ { "internal" : false, "free_text" : "A single guanosine (G) base deletion within the UGT1A1 gene causes the absence of hepatic UDP-glucuronosyltransferase (UDPGT) activity toward bilirubin in a spontaneous mutant strain of Wistar rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:1127102", "PMID:15753292", "PMID:16337205", "PMID:20323028", "PMID:2512292", "RGD:13432067", "RGD:1354700", "RGD:1354701", "RGD:1354702", "RGD:634455" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor; fa mutant", "display_text" : "leptin receptor; fa mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[fa]", "display_text" : "Leprfa", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Leprfa", "display_text" : "Leprfa", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13432153", "page_area" : "allele", "display_name" : "RGD:13432153" } }, "date_created" : "2017-09-21T15:14:41.000-05:00", "date_updated" : "2017-09-21T15:14:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:13432153", "note_dtos" : [ { "internal" : false, "free_text" : "A missense mutation (an A to C conversion at nucleotide position 806) was found in the extracellular domain of all the isoforms in Zucker fatty (fa/fa) rats, which resulted in an amino acid change from Gln to Pro at + 269 (the Gln269Pro mutation).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:11500530", "PMID:16772326", "PMID:20159938", "PMID:23154293", "PMID:8769097", "PMID:9032111", "PMID:9843879", "RGD:11570540", "RGD:11570563", "RGD:13432147", "RGD:1599258", "RGD:628581", "RGD:628910", "RGD:7365117" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj", "display_text" : "ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-10-24T10:59:15.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adamts16[em1Bj]", "display_text" : "Adamts16em1Bj", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adamts16[em1Bj", "display_text" : "Adamts16em1Bj", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Adamts16em1Bj", "display_text" : "Adamts16em1Bj", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13437613", "page_area" : "allele", "display_name" : "RGD:13437613" } }, "date_created" : "2017-10-10T10:47:32.000-05:00", "date_updated" : "2017-10-10T10:47:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:13437613", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was induced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23185005", "PMID:24983376", "PMID:32037220", "RGD:13434925", "RGD:38548917", "RGD:9685162" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "crumbs 1, cell polarity complex component, mutant 1", "display_text" : "crumbs 1, cell polarity complex component, mutant 1", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-05-03T16:07:19.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Crb1[m1]", "display_text" : "Crb1m1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Crb1m1", "display_text" : "Crb1m1", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "crumbs 1, cell polarity complex component;mutant 1", "display_text" : "crumbs 1, cell polarity complex component;mutant 1", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13451133", "page_area" : "allele", "display_name" : "RGD:13451133" } }, "date_created" : "2017-11-15T16:33:02.000-06:00", "date_updated" : "2017-11-15T16:33:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:13451133", "note_dtos" : [ { "internal" : false, "free_text" : "A deletion insertion mutation (c.1685_1698delinsCAAGATGG) in exon 6 of the rat crb1 was identified to be responsible for the retinal phenotype of BN-Crb1m1 (RGD:13451132).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25878282", "RGD:13451131" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dual specificity phosphatase 5; ZFN induced mutant1, Mcwi", "display_text" : "dual specificity phosphatase 5; ZFN induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dusp5[em1Mcwi]", "display_text" : "Dusp5em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dusp5em1Mcwi", "display_text" : "Dusp5em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13451539", "page_area" : "allele", "display_name" : "RGD:13451539" } }, "date_created" : "2017-11-16T15:33:19.000-06:00", "date_updated" : "2017-11-16T15:33:19.000-06:00", "internal" : false, "primary_external_id" : "RGD:13451539", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was induced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC- CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449¿464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid (AA) 121.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25397684", "RGD:13446412" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas", "display_text" : "interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-01-02T12:11:18.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em1Iexas]", "display_text" : "Il2rgem1Iexas", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem1Iexas", "display_text" : "Il2rgem1Iexas", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13464264", "page_area" : "allele", "display_name" : "RGD:13464264" } }, "date_created" : "2018-01-02T12:06:46.000-06:00", "date_updated" : "2018-01-02T12:06:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:13464264", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; A354V mutant", "display_text" : "hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; A354V mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hcn1[A354V]", "display_text" : "Hcn1A354V", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "tm2", "display_text" : "tm2", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Hcn1A354V", "display_text" : "Hcn1A354V", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "trm2", "display_text" : "trm2", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13464319", "page_area" : "allele", "display_name" : "RGD:13464319" } }, "date_created" : "2018-01-03T11:44:40.000-06:00", "date_updated" : "2018-01-03T11:44:40.000-06:00", "internal" : false, "primary_external_id" : "RGD:13464319", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous mutation occurred in the Kyo:Wistar stock that causes essential tremor in the TRM/Kyo rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25970616", "RGD:11060746" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Fras1 related extracellular matrix protein 2;fpl mutant", "display_text" : "Fras1 related extracellular matrix protein 2;fpl mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Frem2[fpl]", "display_text" : "Frem2fpl", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Frem2fpl", "display_text" : "Frem2fpl", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13464330", "page_area" : "allele", "display_name" : "RGD:13464330" } }, "date_created" : "2018-01-03T16:00:21.000-06:00", "date_updated" : "2018-01-03T16:00:21.000-06:00", "internal" : false, "primary_external_id" : "RGD:13464330", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous, nonsense mutation that introduced a stop codon at serine 2005 in the rat Frem2. The original fused pulmonary lobes was identified in a colony of Jcl:Wistar.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21756877", "PMID:23336369", "RGD:126781714", "RGD:13464328" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 4, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 4, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em4Kyo]", "display_text" : "Il2rgem4Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il2rgem4Kyo", "display_text" : "Il2rgem4Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13464339", "page_area" : "allele", "display_name" : "RGD:13464339" } }, "date_created" : "2018-01-04T10:46:42.000-06:00", "date_updated" : "2018-01-04T10:46:42.000-06:00", "internal" : false, "primary_external_id" : "RGD:13464339", "note_dtos" : [ { "internal" : false, "free_text" : "The mutant allele has a zinc finger nuclease-induced 162-bp deletion mutation in the Il2rg gene of the the TM/Kyo embryo.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 3, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 3, Kyo", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-01-04T11:39:20.000-06:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em3Kyo]", "display_text" : "Il2rgem3Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; ZFN induced mutant 5, Kyo", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Il2rg[em5Kyo]", "display_text" : "Il2rgem5Kyo", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Il2rgem3Kyo", "display_text" : "Il2rgem3Kyo", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13464340", "page_area" : "allele", "display_name" : "RGD:13464340" } }, "date_created" : "2018-01-04T11:08:13.000-06:00", "date_updated" : "2018-01-04T11:39:24.000-06:00", "internal" : false, "primary_external_id" : "RGD:13464340", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was generated by a zinc finger nuclease induced 332-bp deletion in Il2rg gene of F344/TM embryo.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:1302502" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "gap junction protein, alpha 8; mutant 1 Cas", "display_text" : "gap junction protein, alpha 8; mutant 1 Cas", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gja8[m1Cas]", "display_text" : "Gja8m1Cas", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13524999", "page_area" : "allele", "display_name" : "RGD:13524999" } }, "date_created" : "2018-05-02T13:16:56.000-05:00", "date_updated" : "2018-05-02T13:17:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:13524999", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation is identified in the UPL rat originally derived from Sprague-Dawley rats. It is a missense mutation (R340W) of the Cx50 (Gja8. )", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:12356818", "RGD:629571" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "arginine vasopressin; diabetes insipidus mutant", "display_text" : "arginine vasopressin; diabetes insipidus mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Avp[di]", "display_text" : "Avpdi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13627261", "page_area" : "allele", "display_name" : "RGD:13627261" } }, "date_created" : "2018-06-12T10:54:31.000-05:00", "date_updated" : "2018-06-12T10:54:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:13627261", "note_dtos" : [ { "internal" : false, "free_text" : "This spontaneous deletion was identified in Brattleboro rats. It consists of a single nucleotide deletion (c.delG316) in exon 2 of the vasopressin gene which results in an altered vasopressin precursor.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:10919858", "PMID:13995944", "PMID:5692127", "PMID:6717565", "PMID:9396613", "PMID:9703389", "RGD:13627260", "RGD:150429657", "RGD:150429658", "RGD:2314654", "RGD:2314661", "RGD:632128" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang", "display_text" : "interleukin 2 receptor subunit gamma;TALEN induced mutant1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em1Ang]", "display_text" : "Il2rgem1Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13628731", "page_area" : "allele", "display_name" : "RGD:13628731" } }, "date_created" : "2018-06-20T12:06:05.000-05:00", "date_updated" : "2018-06-20T12:06:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:13628731", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was created by TALEN targeting the exon2 of rat Il2rg gene. The TALEN mRNA was microinjected into SD/Crl embyo and created an 80bp deletion in the gene and caused a premature stop codon in the 3rd exon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29688994", "RGD:13628403" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 2 receptor subunit gamma; TALEN induced mutant 7, Kyo", "display_text" : "interleukin 2 receptor subunit gamma; TALEN induced mutant 7, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il2rg[em7Kyo]", "display_text" : "Il2rgem7Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13628732", "page_area" : "allele", "display_name" : "RGD:13628732" } }, "date_created" : "2018-06-20T12:25:50.000-05:00", "date_updated" : "2018-06-20T12:25:50.000-05:00", "internal" : false, "primary_external_id" : "RGD:13628732", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele has a 7 bp deletion in the 2nd exon of the rat Il2rg gene created by TALEN.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar", "display_text" : "aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ahr[em1Soar]", "display_text" : "Ahrem1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13702081", "page_area" : "allele", "display_name" : "RGD:13702081" } }, "date_created" : "2018-07-16T10:05:34.000-05:00", "date_updated" : "2018-07-16T10:05:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:13702081", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:34256052", "PMID:34747641", "RGD:405878088", "RGD:407420268" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lysosomal-associated membrane protein 2; TALEN induced mutant1", "display_text" : "lysosomal-associated membrane protein 2; TALEN induced mutant1", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-08-03T13:00:33.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Lamp2[em1]", "display_text" : "Lamp2em1", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13703121", "page_area" : "allele", "display_name" : "RGD:13703121" } }, "date_created" : "2018-08-02T16:40:35.000-05:00", "date_updated" : "2018-08-02T16:40:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:13703121", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was generated by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28124283", "PMID:29720683", "RGD:13703117", "RGD:13703118" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ribonuclease T2; CRISPR/Cas9 induced mutant 1, Sage", "display_text" : "ribonuclease T2; CRISPR/Cas9 induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rnaset2[em1Sage]", "display_text" : "Rnaset2em1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13781891", "page_area" : "allele", "display_name" : "RGD:13781891" } }, "date_created" : "2018-08-10T14:24:20.000-05:00", "date_updated" : "2018-08-10T14:24:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:13781891", "note_dtos" : [ { "internal" : false, "free_text" : "Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:29752287", "RGD:13781889" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 4B; ZFN induced mutant1, Sage", "display_text" : "phosphodiesterase 4B; ZFN induced mutant1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde4b[em1Sage]", "display_text" : "Pde4bem1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13782129", "page_area" : "allele", "display_name" : "RGD:13782129" } }, "date_created" : "2018-08-22T10:44:33.000-05:00", "date_updated" : "2018-08-22T10:44:33.000-05:00", "internal" : false, "primary_external_id" : "RGD:13782129", "note_dtos" : [ { "internal" : false, "free_text" : "These gene was generated using a pair of zinc finger nucleases targeting exon 1 of the rat PDE4B gene, and the 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 was verified by genomic DNA sequencing.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29693432", "RGD:13782127" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Bace1[em1Sage]", "display_text" : "Bace1em1Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bace1[em1Sage]", "display_text" : "Bace1em1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13782148", "page_area" : "allele", "display_name" : "RGD:13782148" } }, "date_created" : "2018-08-23T10:18:49.000-05:00", "date_updated" : "2018-08-23T10:18:49.000-05:00", "internal" : false, "primary_external_id" : "RGD:13782148", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28281673", "RGD:13782149" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily J member 1; ZFN induced mutant 1,Kasu", "display_text" : "potassium voltage-gated channel subfamily J member 1; ZFN induced mutant 1,Kasu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj1[em1Kasu]", "display_text" : "Kcnj1em1Kasu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13782352", "page_area" : "allele", "display_name" : "RGD:13782352" } }, "date_created" : "2018-09-06T13:46:18.000-05:00", "date_updated" : "2018-09-06T13:46:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:13782352", "note_dtos" : [ { "internal" : false, "free_text" : "Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA).The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23753405", "RGD:13782272" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "calcium voltage-gated channel subunit alpha1 F; congenital stationary night blindness mutant", "display_text" : "calcium voltage-gated channel subunit alpha1 F; congenital stationary night blindness mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cacna1f [csnb]", "display_text" : "Cacna1f csnb", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13782372", "page_area" : "allele", "display_name" : "RGD:13782372" } }, "date_created" : "2018-09-07T16:05:21.000-05:00", "date_updated" : "2018-09-07T16:05:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:13782372", "note_dtos" : [ { "internal" : false, "free_text" : "A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:18246026", "PMID:22634626", "PMID:22800190", "PMID:23425697", "PMID:25748727", "RGD:13782191", "RGD:13782369", "RGD:13782370", "RGD:13782386", "RGD:13792551" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "opioid related nociceptin receptor 1; ENU induced mutant1, Hubr", "display_text" : "opioid related nociceptin receptor 1; ENU induced mutant1, Hubr", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-05-17T12:16:17.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-02-18T11:59:26.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Oprl1[m1Hubr]", "display_text" : "Oprl1m1Hubr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792571", "page_area" : "allele", "display_name" : "RGD:13792571" } }, "date_created" : "2018-09-13T14:34:39.000-05:00", "date_updated" : "2018-09-13T14:34:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792571", "note_dtos" : [ { "internal" : false, "free_text" : "The original mutation was created by target-selected ENU-induced mutagenesis in a Brown Norway background.Then they were subsequently backcrossed on a Wistar (Crl:WI) background. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19527777", "PMID:21095077", "PMID:21184763", "PMID:23594365", "PMID:25704616", "PMID:27562376", "PMID:34854073", "RGD:126925219", "RGD:13792568", "RGD:13792569", "RGD:14348962", "RGD:14349028", "RGD:616572755", "RGD:616572759" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily V, member 1; ZFN induced mutant 1, Sage", "display_text" : "transient receptor potential cation channel, subfamily V, member 1; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpv1[em1Sage]", "display_text" : "Trpv1em1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792702", "page_area" : "allele", "display_name" : "RGD:13792702" } }, "date_created" : "2018-09-21T14:00:43.000-05:00", "date_updated" : "2018-09-21T14:00:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792702", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN mutation was produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27335281", "PMID:27671317", "RGD:13792689", "RGD:13792700" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CD59 molecule; CRISPR/Cas9 induced mutant1, Ask", "display_text" : "CD59 molecule; CRISPR/Cas9 induced mutant1, Ask", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-09-24T09:53:08.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-09-24T09:49:45.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd59[em1Ask]", "display_text" : "Cd59em1Ask", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792720", "page_area" : "allele", "display_name" : "RGD:13792720" } }, "date_created" : "2018-09-24T09:49:27.000-05:00", "date_updated" : "2018-09-24T09:49:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792720", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28212662", "RGD:13792592" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fumarate hydratase; TALEN induced mutant 1", "display_text" : "fumarate hydratase; TALEN induced mutant 1", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-09-28T14:37:54.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fh[em1]", "display_text" : "Fhem1", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792797", "page_area" : "allele", "display_name" : "RGD:13792797" } }, "date_created" : "2018-09-28T14:35:16.000-05:00", "date_updated" : "2018-09-28T14:35:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792797", "note_dtos" : [ { "internal" : false, "free_text" : "A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27556703", "RGD:13792708" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nlrp3[em2Mcwi]", "display_text" : "Nlrp3em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792799", "page_area" : "allele", "display_name" : "RGD:13792799" } }, "date_created" : "2018-09-28T14:54:29.000-05:00", "date_updated" : "2018-09-28T14:54:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792799", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 14-bp deletion in exon 1 of the Nlrp3 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:10054229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 12, Mcwi", "display_text" : "purinergic receptor P2X 7; CRISPR/Cas9 induced mutant 12, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx7[em12Mcwi]", "display_text" : "P2rx7em12Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792802", "page_area" : "allele", "display_name" : "RGD:13792802" } }, "date_created" : "2018-09-28T15:36:01.000-05:00", "date_updated" : "2018-09-28T15:36:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792802", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 10, Mcwi", "display_text" : "purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 10, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-09-28T16:15:07.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx7[em10Mcwi]", "display_text" : "P2rx7em10Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "purinergic receptor P2rx 7; CRISPR/Cas9 induced mutant 10, Mcwi", "display_text" : "purinergic receptor P2rx 7; CRISPR/Cas9 induced mutant 10, Mcwi", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792805", "page_area" : "allele", "display_name" : "RGD:13792805" } }, "date_created" : "2018-09-28T16:09:32.000-05:00", "date_updated" : "2018-09-28T16:09:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792805", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 13, Mcwi", "display_text" : "purinergic receptor P2x 7; CRISPR/Cas9 induced mutant 13, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx7[em13Mcwi]", "display_text" : "P2rx7em13Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792806", "page_area" : "allele", "display_name" : "RGD:13792806" } }, "date_created" : "2018-09-28T16:17:38.000-05:00", "date_updated" : "2018-09-28T16:17:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792806", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 1, Mcwi", "display_text" : "protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptk2b[em1Mcwi]", "display_text" : "Ptk2bem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792810", "page_area" : "allele", "display_name" : "RGD:13792810" } }, "date_created" : "2018-10-01T11:19:26.000-05:00", "date_updated" : "2018-10-01T11:19:26.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792810", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 3, Mcwi", "display_text" : "protein tyrosine kinase 2 beta;CRISPR/Cas9 system induced mutant 3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptk2b[em3Mcwi]", "display_text" : "Ptk2bem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792812", "page_area" : "allele", "display_name" : "RGD:13792812" } }, "date_created" : "2018-10-01T11:37:19.000-05:00", "date_updated" : "2018-10-01T11:37:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792812", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a12-bp deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "secreted phosphoprotein 1; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Spp1[em2Mcwi]", "display_text" : "Spp1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13792814", "page_area" : "allele", "display_name" : "RGD:13792814" } }, "date_created" : "2018-10-01T12:03:01.000-05:00", "date_updated" : "2018-10-01T12:03:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:13792814", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "toll-like receptor 4; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "toll-like receptor 4; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tlr4[em1Mcwi]", "display_text" : "Tlr4em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13793373", "page_area" : "allele", "display_name" : "RGD:13793373" } }, "date_created" : "2018-10-03T14:25:15.000-05:00", "date_updated" : "2018-10-03T14:25:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:13793373", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant4, Mcwi", "display_text" : "tryptophan hydroxylase 1; CRISPR/Cas9 induced mutant4, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tph1[em4Mcwi]", "display_text" : "Tph1em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13793375", "page_area" : "allele", "display_name" : "RGD:13793375" } }, "date_created" : "2018-10-03T14:47:28.000-05:00", "date_updated" : "2018-10-03T14:47:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:13793375", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 4, Mcwi", "display_text" : "arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 4, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Avpr2[em4Mcwi]", "display_text" : "Avpr2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13793377", "page_area" : "allele", "display_name" : "RGD:13793377" } }, "date_created" : "2018-10-03T15:07:21.000-05:00", "date_updated" : "2018-10-03T15:07:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:13793377", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 5, Mcwi", "display_text" : "arginine vasopressin receptor 2;CRISPR/Cas9 induced mutant 5, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Avpr2[em5Mcwi]", "display_text" : "Avpr2em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13793379", "page_area" : "allele", "display_name" : "RGD:13793379" } }, "date_created" : "2018-10-03T15:18:56.000-05:00", "date_updated" : "2018-10-03T15:18:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:13793379", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cingulin-like 1; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "cingulin-like 1; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cgnl1[em1Mcwi]", "display_text" : "Cgnl1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13799347", "page_area" : "allele", "display_name" : "RGD:13799347" } }, "date_created" : "2018-10-10T15:23:40.000-05:00", "date_updated" : "2018-10-10T15:23:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:13799347", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 80-bp deletion of exon 2 of SS/JrHsdMcwi embryos", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cingulin-like 1; CRISPR/Cas9 induced mutant2, Mcwi", "display_text" : "cingulin-like 1; CRISPR/Cas9 induced mutant2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cgnl1[em2Mcwi]", "display_text" : "Cgnl1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13799349", "page_area" : "allele", "display_name" : "RGD:13799349" } }, "date_created" : "2018-10-10T15:38:57.000-05:00", "date_updated" : "2018-10-10T15:38:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:13799349", "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coagulation factor II (thrombin) receptor; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "coagulation factor II (thrombin) receptor; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "F2r[em1Mcwi]", "display_text" : "F2rem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13799351", "page_area" : "allele", "display_name" : "RGD:13799351" } }, "date_created" : "2018-10-10T16:15:07.000-05:00", "date_updated" : "2018-10-10T16:15:07.000-05:00", "internal" : false, "primary_external_id" : "RGD:13799351", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hydroxysteroid 11-beta dehydrogenase 2; ZFN induced mutant1, Jmul", "display_text" : "hydroxysteroid 11-beta dehydrogenase 2; ZFN induced mutant1, Jmul", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hsd11b2[em1Jmul]", "display_text" : "Hsd11b2em1Jmul", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800560", "page_area" : "allele", "display_name" : "RGD:13800560" } }, "date_created" : "2018-10-15T17:05:06.000-05:00", "date_updated" : "2018-10-15T17:05:06.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800560", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26077568", "RGD:13800514" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coagulation factor VIII, procoagulant component; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "coagulation factor VIII, procoagulant component; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "F8[em1Mcwi]", "display_text" : "F8em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800747", "page_area" : "allele", "display_name" : "RGD:13800747" } }, "date_created" : "2018-10-17T15:48:52.000-05:00", "date_updated" : "2018-10-17T15:48:52.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800747", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31899798", "RGD:150520060" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Glp1r[em1Mcwi]", "display_text" : "Glp1rem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800750", "page_area" : "allele", "display_name" : "RGD:13800750" } }, "date_created" : "2018-10-17T16:06:12.000-05:00", "date_updated" : "2018-10-17T16:06:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800750", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily Q member 1; CRISPR/Cas9 induced mutant 5, Mcwi", "display_text" : "potassium voltage-gated channel subfamily Q member 1; CRISPR/Cas9 induced mutant 5, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2018-10-30T09:46:08.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2018-10-30T09:37:03.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnq1[em5Mcwi]", "display_text" : "Kcnq1em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnq1em5Mcwi", "display_text" : "Kcnq1em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800813", "page_area" : "allele", "display_name" : "RGD:13800813" } }, "date_created" : "2018-10-18T11:45:29.000-05:00", "date_updated" : "2018-10-18T11:45:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800813", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "mucin 1, cell surface associated; CRISPR/Cas9 induced mutant 1, Mcwi.", "display_text" : "mucin 1, cell surface associated; CRISPR/Cas9 induced mutant 1, Mcwi.", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Muc1[em1Mcwi]", "display_text" : "Muc1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800827", "page_area" : "allele", "display_name" : "RGD:13800827" } }, "date_created" : "2018-10-18T12:08:39.000-05:00", "date_updated" : "2018-10-18T12:08:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800827", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin binding protein H-like; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "myosin binding protein H-like; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mybphl[em1Mcwi]", "display_text" : "Mybphlem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800841", "page_area" : "allele", "display_name" : "RGD:13800841" } }, "date_created" : "2018-10-18T12:34:44.000-05:00", "date_updated" : "2018-10-18T12:34:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800841", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin binding protein H-like; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "myosin binding protein H-like; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mybphl[em2Mcwi]", "display_text" : "Mybphlem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800846", "page_area" : "allele", "display_name" : "RGD:13800846" } }, "date_created" : "2018-10-18T12:43:44.000-05:00", "date_updated" : "2018-10-18T12:43:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800846", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "NLR family, pyrin domain containing 3;CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nlrp3[em1Mcwi]", "display_text" : "Nlrp3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800850", "page_area" : "allele", "display_name" : "RGD:13800850" } }, "date_created" : "2018-10-18T13:22:23.000-05:00", "date_updated" : "2018-10-18T13:22:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800850", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 6, Mcwi", "display_text" : "purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 6, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2ry2[em6Mcwi]", "display_text" : "P2ry2em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800870", "page_area" : "allele", "display_name" : "RGD:13800870" } }, "date_created" : "2018-10-18T14:21:58.000-05:00", "date_updated" : "2018-10-18T14:21:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800870", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 7, Mcwi", "display_text" : "purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 7, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2ry2[em7Mcwi]", "display_text" : "P2ry2em7Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800873", "page_area" : "allele", "display_name" : "RGD:13800873" } }, "date_created" : "2018-10-18T14:33:13.000-05:00", "date_updated" : "2018-10-18T14:33:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800873", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "similar to human chromosome 6 open reading frame 52; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "C17h6orf52[em2Mcwi]", "display_text" : "C17h6orf52em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13800878", "page_area" : "allele", "display_name" : "RGD:13800878" } }, "date_created" : "2018-10-18T16:30:02.000-05:00", "date_updated" : "2018-10-18T16:30:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:13800878", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 editing excised one C nucleotide from position Chr17:23,767,016 and inserted eleven nucleotides resulting in a net insertion of 10 nucleotides in exon 2 of rat C17h6orf52.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "gap junction protein, alpha 5; CRISPR/Cas9 induced mutant1, Mcwi", "display_text" : "gap junction protein, alpha 5; CRISPR/Cas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gja5[em1Mcwi]", "display_text" : "Gja5em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13825144", "page_area" : "allele", "display_name" : "RGD:13825144" } }, "date_created" : "2018-11-19T11:51:57.000-06:00", "date_updated" : "2021-03-09T12:17:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:13825144", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "period circadian regulator 1; CRISPR/Cas9 induced mutant 3, Mcwi", "display_text" : "period circadian regulator 1; CRISPR/Cas9 induced mutant 3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Per1[em3Mcwi]", "display_text" : "Per1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13825148", "page_area" : "allele", "display_name" : "RGD:13825148" } }, "date_created" : "2018-11-19T12:18:49.000-06:00", "date_updated" : "2018-11-19T12:18:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:13825148", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "melanocortin 4 receptor; ENU induced mutation 1, Hubr", "display_text" : "melanocortin 4 receptor; ENU induced mutation 1, Hubr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mc4r[m1Hubr]", "display_text" : "Mc4rm1Hubr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13825200", "page_area" : "allele", "display_name" : "RGD:13825200" } }, "date_created" : "2018-11-29T13:19:38.000-06:00", "date_updated" : "2018-11-29T13:19:38.000-06:00", "internal" : false, "primary_external_id" : "RGD:13825200", "note_dtos" : [ { "internal" : false, "free_text" : "The Mc4r mutation was generated by target-selected ENU-driven mutagenesis and high-throughput resequencing of genomic sequences in Crl:Wistar background. The mutation was identified as revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20531371", "PMID:21527895", "PMID:24400148", "RGD:13825198", "RGD:13825242", "RGD:6478803" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dedicator of cytokinesis 8;mutant 1, Ztm", "display_text" : "dedicator of cytokinesis 8;mutant 1, Ztm", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dock8[m1Ztm]", "display_text" : "Dock8m1Ztm", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13830868", "page_area" : "allele", "display_name" : "RGD:13830868" } }, "date_created" : "2018-12-06T12:12:00.000-06:00", "date_updated" : "2018-12-06T12:12:00.000-06:00", "internal" : false, "primary_external_id" : "RGD:13830868", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous mutation from C to G in Dock8 in exon 44 at position 228, 622, 763 (RGSC Genome Assembly v3.4) on RNO1 was identified. This mutation caused the change of glutamine to glutamate (Q1864E). The mutation is located in β4 of the DOCK homology region (DHR)-2 involved in CDC42 binding.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26363782", "RGD:11532657" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BSCL2, seipin lipid droplet biogenesis associated; ENU induced mutant1, Kyo", "display_text" : "BSCL2, seipin lipid droplet biogenesis associated; ENU induced mutant1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bscl2[m1Kyo]", "display_text" : "Bscl2m1Kyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bscl2[sko]", "display_text" : "Bscl2sko", "name_type_name" : "unspecified" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:13838727", "page_area" : "allele", "display_name" : "RGD:13838727" } }, "date_created" : "2019-01-09T14:29:22.000-06:00", "date_updated" : "2019-01-09T14:29:22.000-06:00", "internal" : false, "primary_external_id" : "RGD:13838727", "note_dtos" : [ { "internal" : false, "free_text" : "This ENU induced Bscl2 mutation was T to A transition at nucleotide 239 in the third exon of Bscl2 gene, resulted in a substitution of leucine at codon 20 by the stop codon (L20X), which is upstream of the first transmembrane domain.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25934999", "RGD:11085488" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 6 member 4; ZFN induced mutant1, Hubr", "display_text" : "solute carrier family 6 member 4; ZFN induced mutant1, Hubr", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-02-18T11:57:15.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc6a4[m1Hubr]", "display_text" : "Slc6a4m1Hubr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14390068", "page_area" : "allele", "display_name" : "RGD:14390068" } }, "date_created" : "2019-02-18T11:53:22.000-06:00", "date_updated" : "2019-02-18T11:53:22.000-06:00", "internal" : false, "primary_external_id" : "RGD:14390068", "note_dtos" : [ { "internal" : false, "free_text" : "An ENU-induced C to A transversion at position 3924 (relative to the start codon in ENSRNOG0000003476) in the slc6a4 gene, resulting in a premature stop codon (TGC>TGA) in the third exon encoding the second extracellular loop and thereby most likely resulting in a non-functional protein product.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:17467186", "PMID:18295409", "PMID:18581099", "PMID:30144237", "RGD:1624310", "RGD:401938631", "RGD:4889490", "RGD:4889509" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystic fibrosis transmembrane conductance regulator; ZFN induced mutant 1 Sage", "display_text" : "cystic fibrosis transmembrane conductance regulator; ZFN induced mutant 1 Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cftr[em1Sage]", "display_text" : "Cftrem1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14392814", "page_area" : "allele", "display_name" : "RGD:14392814" } }, "date_created" : "2019-03-04T15:22:14.000-06:00", "date_updated" : "2019-03-04T15:22:14.000-06:00", "internal" : false, "primary_external_id" : "RGD:14392814", "note_dtos" : [ { "internal" : false, "free_text" : "A 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (CFTR) was induced in Sprague Dawley rats (Ntac:SD), resulting in loss of protein expression.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24608905", "PMID:29190650", "RGD:11566051", "RGD:151347176" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Glp1r[em2Mcwi]", "display_text" : "Glp1rem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394489", "page_area" : "allele", "display_name" : "RGD:14394489" } }, "date_created" : "2019-03-22T13:29:35.000-05:00", "date_updated" : "2019-03-22T13:29:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394489", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 3, Mcwi", "display_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 3, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-03-29T15:43:10.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Glp1r[em3Mcwi]", "display_text" : "Glp1rem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "glucagon-like peptide 1 receptor; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394492", "page_area" : "allele", "display_name" : "RGD:14394492" } }, "date_created" : "2019-03-22T13:42:59.000-05:00", "date_updated" : "2019-03-22T13:42:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394492", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 2, Mcwi", "display_text" : "potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-08-07T15:14:22.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-03-22T14:42:17.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj2[em2Mcwi]", "display_text" : "Kcnj2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily J member 2;CRISPR/Cas9 system induced mutant 2, Mcwi", "display_text" : "potassium voltage-gated channel subfamily J member 2;CRISPR/Cas9 system induced mutant 2, Mcwi", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 2, Mcwi", "display_text" : "potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 2, Mcwi", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394495", "page_area" : "allele", "display_name" : "RGD:14394495" } }, "date_created" : "2019-03-22T14:41:39.000-05:00", "date_updated" : "2019-03-22T14:41:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394495", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 4, Mcwi", "display_text" : "potassium inwardly-rectifying channel, subfamily J, member 2; CRISPR/Cas9 system induced mutant 4, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-08-07T15:15:34.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj2[em4Mcwi]", "display_text" : "Kcnj2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 4, Mcwi", "display_text" : "potassium voltage-gated channel subfamily J member 2; CRISPR/Cas9 system induced mutant 4, Mcwi", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394497", "page_area" : "allele", "display_name" : "RGD:14394497" } }, "date_created" : "2019-03-22T15:01:27.000-05:00", "date_updated" : "2019-03-22T15:01:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394497", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Klrb1a[em1Mcwi]", "display_text" : "Klrb1aem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394503", "page_area" : "allele", "display_name" : "RGD:14394503" } }, "date_created" : "2019-03-25T12:26:23.000-05:00", "date_updated" : "2019-03-25T12:26:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394503", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "killer cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Klrb1a[em2Mcwi]", "display_text" : "Klrb1aem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394505", "page_area" : "allele", "display_name" : "RGD:14394505" } }, "date_created" : "2019-03-25T12:44:09.000-05:00", "date_updated" : "2019-03-25T12:44:09.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394505", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 5, Mcwi", "display_text" : "purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 5, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2ry2[em5Mcwi]", "display_text" : "P2ry2em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394507", "page_area" : "allele", "display_name" : "RGD:14394507" } }, "date_created" : "2019-03-25T13:03:51.000-05:00", "date_updated" : "2019-03-25T13:03:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394507", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "toll-like receptor 4; CRISPR/Cas9 induced mutant 5, Mcwi", "display_text" : "toll-like receptor 4; CRISPR/Cas9 induced mutant 5, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tlr4[em5Mcwi]", "display_text" : "Tlr4em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394509", "page_area" : "allele", "display_name" : "RGD:14394509" } }, "date_created" : "2019-03-25T15:06:22.000-05:00", "date_updated" : "2019-03-25T15:06:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394509", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutamate ionotropic receptor NMDA type subunit 2B; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "glutamate ionotropic receptor NMDA type subunit 2B; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-03-26T14:18:46.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Grin2b[em1Mcwi]", "display_text" : "Grin2bem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394517", "page_area" : "allele", "display_name" : "RGD:14394517" } }, "date_created" : "2019-03-26T14:15:36.000-05:00", "date_updated" : "2019-03-26T14:15:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394517", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "AT-rich interaction domain 1B; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "AT-rich interaction domain 1B; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Arid1b[em1Mcwi]", "display_text" : "Arid1bem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394519", "page_area" : "allele", "display_name" : "RGD:14394519" } }, "date_created" : "2019-03-26T14:36:38.000-05:00", "date_updated" : "2019-03-26T14:36:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394519", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SH2B adaptor protein 3; CRISPR/Cas9 induced target mutant 1, Mcwi", "display_text" : "SH2B adaptor protein 3; CRISPR/Cas9 induced target mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sh2b3[tm1Mcwi]", "display_text" : "Sh2b3tm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14394610", "page_area" : "allele", "display_name" : "RGD:14394610" } }, "date_created" : "2019-03-27T09:49:32.000-05:00", "date_updated" : "2019-03-27T09:49:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:14394610", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exons", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CD40 molecule; ZFN induced mutant 1, Uthal", "display_text" : "CD40 molecule; ZFN induced mutant 1, Uthal", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd40[em1Uthal]", "display_text" : "Cd40em1Uthal", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398461", "page_area" : "allele", "display_name" : "RGD:14398461" } }, "date_created" : "2019-04-18T15:03:30.000-05:00", "date_updated" : "2019-04-18T15:03:30.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398461", "note_dtos" : [ { "internal" : false, "free_text" : "Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27692815", "RGD:14398462" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "xanthine dehydrogenase; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "xanthine dehydrogenase; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Xdh[em1Mcwi]", "display_text" : "Xdhem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398480", "page_area" : "allele", "display_name" : "RGD:14398480" } }, "date_created" : "2019-04-19T13:58:11.000-05:00", "date_updated" : "2019-04-19T13:58:11.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398480", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "xanthine dehydrogenase; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "xanthine dehydrogenase; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Xdh[em2Mcwi]", "display_text" : "Xdhem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398482", "page_area" : "allele", "display_name" : "RGD:14398482" } }, "date_created" : "2019-04-19T14:03:41.000-05:00", "date_updated" : "2019-04-19T14:03:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398482", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dopamine receptor D1; CRISPR induced targeted mutant 1, Berke", "display_text" : "dopamine receptor D1; CRISPR induced targeted mutant 1, Berke", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-04-25T14:24:08.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Drd1[em1(iCre)Berke]", "display_text" : "Drd1em1(iCre)Berke", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Drd1[tm1(Cre)Berke]", "display_text" : "Drd1tm1(Cre)Berke", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398500", "page_area" : "allele", "display_name" : "RGD:14398500" } }, "date_created" : "2019-04-23T16:45:33.000-05:00", "date_updated" : "2019-04-23T16:45:33.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398500", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2a receptor;CRISPR induced targeted mutant 1, Berke", "display_text" : "adenosine A2a receptor;CRISPR induced targeted mutant 1, Berke", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-04-25T14:27:04.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2a[em1(iCre)Berke]", "display_text" : "Adora2aem1(iCre)Berke", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2a[tm1(P2A-Cre)Berke]", "display_text" : "Adora2atm1(P2A-Cre)Berke", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398735", "page_area" : "allele", "display_name" : "RGD:14398735" } }, "date_created" : "2019-04-24T14:25:05.000-05:00", "date_updated" : "2019-04-24T14:25:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398735", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR system was used to created target insertion of iCre recombinase immediately after Adora2a gene, with P2A linker, of the embryos of BluHsd:LE.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EDAR-associated death domain;swh Kyo mutant", "display_text" : "EDAR-associated death domain;swh Kyo mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Edaradd[swhKyo]", "display_text" : "EdaraddswhKyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398765", "page_area" : "allele", "display_name" : "RGD:14398765" } }, "date_created" : "2019-04-30T13:30:07.000-05:00", "date_updated" : "2019-04-30T13:30:07.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398765", "note_dtos" : [ { "internal" : false, "free_text" : "A spontaneous sparse-and-wavy (swh) mutation was identified in WTC-swh/Kyo rats. A missense mutation (C to T) in exon 6 of the swh/swh Edaradd gene was identified in the mutant rat.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:15829729", "PMID:22013926", "PMID:31028034", "RGD:14398762", "RGD:14398763", "RGD:2304219" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 15, Dlli", "display_text" : "fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 15, Dlli", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fah[em15Dlli-/-]", "display_text" : "Fahem15Dlli-/-", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398826", "page_area" : "allele", "display_name" : "RGD:14398826" } }, "date_created" : "2019-05-02T13:21:47.000-05:00", "date_updated" : "2019-05-02T13:21:47.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398826", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27510266", "RGD:14398823" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 10, Dlli", "display_text" : "fumarylacetoacetate hydrolase; CRISPR/Cas9 induced mutant 10, Dlli", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fah[em10Dlli-/-]", "display_text" : "Fahem10Dlli-/-", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14398829", "page_area" : "allele", "display_name" : "RGD:14398829" } }, "date_created" : "2019-05-02T14:58:19.000-05:00", "date_updated" : "2019-05-02T14:58:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:14398829", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29507093", "RGD:14398827" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 18,Pas", "display_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 18,Pas", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-06-04T10:50:50.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna5[em18Pas]", "display_text" : "Chrna5em18Pas", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14402420", "page_area" : "allele", "display_name" : "RGD:14402420" } }, "date_created" : "2019-06-04T10:48:57.000-05:00", "date_updated" : "2019-06-18T15:32:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:14402420", "note_dtos" : [ { "internal" : false, "free_text" : "The Zinc Finger Nuclease system was used to created184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30293722", "PMID:32841724", "RGD:14694852", "RGD:150530292" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 20,Pas", "display_text" : "cholinergic receptor, nicotinic, alpha 5 (neuronal); ZFN induced mutant 20,Pas", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna5[em20(D398N)Pas]", "display_text" : "Chrna5em20(D398N)Pas", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14402422", "page_area" : "allele", "display_name" : "RGD:14402422" } }, "date_created" : "2019-06-04T11:18:41.000-05:00", "date_updated" : "2019-06-18T15:38:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:14402422", "note_dtos" : [ { "internal" : false, "free_text" : "The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30293722", "PMID:31288250", "PMID:32841724", "RGD:14694852", "RGD:150530288", "RGD:150530292" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "parvalbumin; CRISPR/Cas9 induced flpo knock in mutant1, Berke", "display_text" : "parvalbumin; CRISPR/Cas9 induced flpo knock in mutant1, Berke", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pvalb[em1(flpo)Berke]", "display_text" : "Pvalbem1(flpo)Berke", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14694849", "page_area" : "allele", "display_name" : "RGD:14694849" } }, "date_created" : "2019-06-17T16:51:29.000-05:00", "date_updated" : "2019-06-17T16:51:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:14694849", "note_dtos" : [ { "internal" : false, "free_text" : "A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. )", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Geh", "display_text" : "5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Geh", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-07-18T15:52:31.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Htr7[em1Geh]", "display_text" : "Htr7em1Geh", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "5-hydroxytryptamine receptor 7", "display_text" : "5-hydroxytryptamine receptor 7", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14696714", "page_area" : "allele", "display_name" : "RGD:14696714" } }, "date_created" : "2019-07-18T15:51:16.000-05:00", "date_updated" : "2019-07-18T15:51:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:14696714", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutation in Wistar (CRL:WI) embryos; this editing induced 89 base pair deletion in exon 1 of the Htr7 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Msu", "display_text" : "5-hydroxytryptamine receptor 7; CRISPR/Cas9 induced mutant 1, Msu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Htr7[em1Msu]", "display_text" : "Htr7em1Msu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14696716", "page_area" : "allele", "display_name" : "RGD:14696716" } }, "date_created" : "2019-07-18T16:10:21.000-05:00", "date_updated" : "2019-07-18T16:10:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:14696716", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31125290", "PMID:31125292", "RGD:14696717", "RGD:14696718" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 3, subfamily a, polypeptide 23-polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu", "display_text" : "cytochrome P450, family 3, subfamily a, polypeptide 23-polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2020-04-16T11:20:30.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp3a23-3a1[em1Myliu]", "display_text" : "Cyp3a23-3a1em1Myliu", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "cytochrome P450, family 3, subfamily a, polypeptide 23/polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu", "display_text" : "cytochrome P450, family 3, subfamily a, polypeptide 23/polypeptide 1; CRISPR/Cas9 induced mutant 1, Myliu", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Cyp3a23/3a1[em1Myliu]", "display_text" : "Cyp3a23/3a1em1Myliu", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14696724", "page_area" : "allele", "display_name" : "RGD:14696724" } }, "date_created" : "2019-07-19T14:19:26.000-05:00", "date_updated" : "2019-07-19T14:19:26.000-05:00", "internal" : false, "primary_external_id" : "RGD:14696724", "note_dtos" : [ { "internal" : false, "free_text" : "A 22-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a23/3a1gene in the Sprague Dawley embryo.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28218310", "RGD:13838839" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 3, subfamily a, polypeptide 2; CRISPR/Cas9 induced mutant 1, Myliu", "display_text" : "cytochrome P450, family 3, subfamily a, polypeptide 2; CRISPR/Cas9 induced mutant 1, Myliu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp3a2[em1Myliu]", "display_text" : "Cyp3a2em1Myliu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14696725", "page_area" : "allele", "display_name" : "RGD:14696725" } }, "date_created" : "2019-07-19T14:26:20.000-05:00", "date_updated" : "2019-07-19T14:26:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:14696725", "note_dtos" : [ { "internal" : false, "free_text" : "A 10-bp deletion was induced by CRISPR/Cas9 system targeting exon 2 of rat Cyp3a2 gene in the Sprague Dawley embryo", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28218310", "RGD:13838839" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "L1 cell adhesion molecule;CRISPR/Cas9 induced mutant2,JGN", "display_text" : "L1 cell adhesion molecule;CRISPR/Cas9 induced mutant2,JGN", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2020-09-08T16:26:11.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "L1cam[em2Jgn]", "display_text" : "L1camem2Jgn", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14696788", "page_area" : "allele", "display_name" : "RGD:14696788" } }, "date_created" : "2019-07-25T14:34:12.000-05:00", "date_updated" : "2019-07-25T14:34:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:14696788", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30738385", "RGD:14695001" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "tripartite motif containing 63; ZFN targeted mutation 1", "display_text" : "tripartite motif containing 63; ZFN targeted mutation 1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trim63[em1(hiLuc)]", "display_text" : "Trim63em1(hiLuc)", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14696789", "page_area" : "allele", "display_name" : "RGD:14696789" } }, "date_created" : "2019-07-25T15:16:22.000-05:00", "date_updated" : "2019-07-25T15:16:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:14696789", "note_dtos" : [ { "internal" : false, "free_text" : "The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression,", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:24710205", "RGD:14695084" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium calcium-activated channel subfamily N member 2; Trdk mutant", "display_text" : "potassium calcium-activated channel subfamily N member 2; Trdk mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnn2[Trdk]", "display_text" : "Kcnn2Trdk", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735330", "page_area" : "allele", "display_name" : "RGD:149735330" } }, "date_created" : "2021-07-15T11:50:05.000-05:00", "date_updated" : "2021-07-15T11:50:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735330", "note_dtos" : [ { "internal" : false, "free_text" : "This is a mutant allele identified in F344/NSlc rats mutagenized with N-ethyl-N-nitrosourea (ENU). The rats exhibited a tremor that was especially evident around weaning but persisted throughout life. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28917524", "RGD:38508907" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "wolframin ER transmembrane glycoprotein; ZFN induced mutant 1", "display_text" : "wolframin ER transmembrane glycoprotein; ZFN induced mutant 1", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-07-29T10:25:42.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Wfs1[em1Ptsn]", "display_text" : "Wfs1em1Ptsn", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Wfs1[em1]", "display_text" : "Wfs1em1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735335", "page_area" : "allele", "display_name" : "RGD:149735335" } }, "date_created" : "2021-07-15T15:33:51.000-05:00", "date_updated" : "2021-07-15T15:33:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735335", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28860598", "PMID:29976929", "RGD:149735331", "RGD:150519890" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "wolframin ER transmembrane glycoprotein; ZFN induced mutant 2", "display_text" : "wolframin ER transmembrane glycoprotein; ZFN induced mutant 2", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-07-30T09:47:06.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Wfs1[em2Ptsn]", "display_text" : "Wfs1em2Ptsn", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Wfs1[em2]", "display_text" : "Wfs1em2", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735337", "page_area" : "allele", "display_name" : "RGD:149735337" } }, "date_created" : "2021-07-15T15:41:57.000-05:00", "date_updated" : "2021-07-15T15:41:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735337", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). A 27 amino acid deletion in exon 5 (aa212-238) was identified.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28860598", "RGD:149735331" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "wolframin ER transmembrane glycoprotein; ZFN induced mutant 3", "display_text" : "wolframin ER transmembrane glycoprotein; ZFN induced mutant 3", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-07-29T10:30:43.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Wfs1[em3Ptsn]", "display_text" : "Wfs1em3Ptsn", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Wfs1[em3]", "display_text" : "Wfs1em3", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735339", "page_area" : "allele", "display_name" : "RGD:149735339" } }, "date_created" : "2021-07-15T16:04:15.000-05:00", "date_updated" : "2021-07-15T16:04:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735339", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was created in embryos from Sprague-Dawley rats (Crl: CD(SD). This allele carrys a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226) into YCMNTI in the WFS1 protein.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:28860598", "RGD:149735331" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "complement C3; ZFN induced mutant 1, Kyo", "display_text" : "complement C3; ZFN induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "C3[em1Kyo]", "display_text" : "C3em1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735372", "page_area" : "allele", "display_name" : "RGD:149735372" } }, "date_created" : "2021-07-20T13:51:48.000-05:00", "date_updated" : "2021-07-20T13:51:48.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735372", "note_dtos" : [ { "internal" : false, "free_text" : "ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The pups were identified by primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'--AATAGAGGCCACCAATGCAC-3'). This mutant allele revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutamate decarboxylase 1; CRISPR/Cas9 induced mutant 15, Yyan", "display_text" : "glutamate decarboxylase 1; CRISPR/Cas9 induced mutant 15, Yyan", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gad1[em15Yyan]", "display_text" : "Gad1em15Yyan", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735561", "page_area" : "allele", "display_name" : "RGD:149735561" } }, "date_created" : "2021-07-22T13:32:48.000-05:00", "date_updated" : "2021-07-22T13:32:48.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735561", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele carries a 291 bp deletion, including exon-6, of Gad1 gene using the CRISPR/Cas9.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:33293518", "PMID:37830095", "RGD:158012686", "RGD:405855846" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutamate decarboxylase 2; TALEN induced mutant 24, Yyan", "display_text" : "glutamate decarboxylase 2; TALEN induced mutant 24, Yyan", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gad2[em24Yyan]", "display_text" : "Gad2em24Yyan", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735563", "page_area" : "allele", "display_name" : "RGD:149735563" } }, "date_created" : "2021-07-22T13:53:44.000-05:00", "date_updated" : "2021-07-22T13:53:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735563", "note_dtos" : [ { "internal" : false, "free_text" : "This Gad2 allele was created by TALEN.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "N-glycanase 1; CRISPR/Cas9 induced mutant 1, Ta", "display_text" : "N-glycanase 1; CRISPR/Cas9 induced mutant 1, Ta", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-07-22T15:40:56.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ngly1[em1Ta]", "display_text" : "Ngly1em1Ta", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735565", "page_area" : "allele", "display_name" : "RGD:149735565" } }, "date_created" : "2021-07-22T15:39:49.000-05:00", "date_updated" : "2021-07-22T15:39:49.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735565", "note_dtos" : [ { "internal" : false, "free_text" : "The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32259258", "RGD:39457703" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "autophagy related 16-like 1; CRISPR/Cas9 induced mutant 8, RRRC", "display_text" : "autophagy related 16-like 1; CRISPR/Cas9 induced mutant 8, RRRC", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Atg16l1[em8Rrrc]", "display_text" : "Atg16l1em8Rrrc", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:149735571", "page_area" : "allele", "display_name" : "RGD:149735571" } }, "date_created" : "2021-07-23T14:05:45.000-05:00", "date_updated" : "2021-07-23T14:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:149735571", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Sage", "display_text" : "bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-10-08T13:27:57.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Bmpr2[em1Sage]", "display_text" : "Bmpr2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bmpr2[em1Sage+/-]", "display_text" : "Bmpr2em1Sage+/-", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14981587", "page_area" : "allele", "display_name" : "RGD:14981587" } }, "date_created" : "2019-10-08T13:20:02.000-05:00", "date_updated" : "2019-10-08T13:20:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:14981587", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31462075", "RGD:14975304" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "bone morphogenetic protein receptor type 2; ZFN induced mutant 2, Sage", "display_text" : "bone morphogenetic protein receptor type 2; ZFN induced mutant 2, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bmpr2[em2Sage]", "display_text" : "Bmpr2em2Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14981589", "page_area" : "allele", "display_name" : "RGD:14981589" } }, "date_created" : "2019-10-08T13:29:45.000-05:00", "date_updated" : "2019-10-08T13:29:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:14981589", "note_dtos" : [ { "internal" : false, "free_text" : "This ZFN mutant rats was produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31462075", "RGD:14975304" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage", "display_text" : "cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyfip1[em1Sage]", "display_text" : "Cyfip1em1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14985211", "page_area" : "allele", "display_name" : "RGD:14985211" } }, "date_created" : "2019-10-09T10:22:55.000-05:00", "date_updated" : "2019-10-09T10:22:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:14985211", "note_dtos" : [ { "internal" : false, "free_text" : "The guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1) was injected to Long Evans one cell embryos. The resultant mutation is 4 bp out of frame deletion in exon 7 of the rat Cyfip1, resulting an early stop codon in exon 8.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31371763", "RGD:14981598" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transmembrane protein 67; wpk mutant", "display_text" : "transmembrane protein 67; wpk mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tmem67[wpk]", "display_text" : "Tmem67wpk", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:14995943", "page_area" : "allele", "display_name" : "RGD:14995943" } }, "date_created" : "2019-11-01T14:55:56.000-05:00", "date_updated" : "2019-11-21T09:26:12.000-06:00", "internal" : false, "primary_external_id" : "RGD:14995943", "note_dtos" : [ { "internal" : false, "free_text" : "A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:11095650", "PMID:15052665", "PMID:16415887", "PMID:30705305", "RGD:11535082", "RGD:1300514", "RGD:14995942", "RGD:15014788" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "DND microRNA-mediated repression inhibitor 1, ter mutant", "display_text" : "DND microRNA-mediated repression inhibitor 1, ter mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dnd1[ter]", "display_text" : "Dnd1ter", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150340622", "page_area" : "allele", "display_name" : "RGD:150340622" } }, "date_created" : "2021-08-20T11:57:15.000-05:00", "date_updated" : "2021-08-20T11:57:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:150340622", "note_dtos" : [ { "internal" : false, "free_text" : "This is a spontaneous mutation (ter) allele leading to the formation of congenital ovarian and testicular tumorsin the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22655094", "RGD:40924659" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "zinc finger and BTB domain containing 16; TALEN induced mutant 1, Ipcv", "display_text" : "zinc finger and BTB domain containing 16; TALEN induced mutant 1, Ipcv", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Zbtb16[em1Ipcv]", "display_text" : "Zbtb16em1Ipcv", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150340624", "page_area" : "allele", "display_name" : "RGD:150340624" } }, "date_created" : "2021-08-20T12:20:13.000-05:00", "date_updated" : "2021-08-20T12:20:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:150340624", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28396530", "RGD:150340623" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin XVA; ci2 mutant", "display_text" : "myosin XVA; ci2 mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Myo15a[ci2]", "display_text" : "Myo15aci2", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150404269", "page_area" : "allele", "display_name" : "RGD:150404269" } }, "date_created" : "2021-09-03T15:40:07.000-05:00", "date_updated" : "2021-09-03T15:43:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:150404269", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneous mutation of Myo15a containing a base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21479269", "RGD:150429616" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 4, Mcwi", "display_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 4, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Vwf[em4Mcwi]", "display_text" : "Vwfem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429599", "page_area" : "allele", "display_name" : "RGD:150429599" } }, "date_created" : "2021-09-08T09:24:27.000-05:00", "date_updated" : "2021-09-08T09:24:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429599", "note_dtos" : [ { "internal" : false, "free_text" : "The deletion allele was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting mutation is a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:150429600" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adducin 3; ZFN induced mutant1, Mcwi", "display_text" : "adducin 3; ZFN induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Add3[em1Mcwi]", "display_text" : "Add3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429617", "page_area" : "allele", "display_name" : "RGD:150429617" } }, "date_created" : "2021-09-09T13:45:36.000-05:00", "date_updated" : "2021-09-09T13:45:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429617", "note_dtos" : [ { "internal" : false, "free_text" : "ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32029431", "RGD:150340736" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adducin 3; ZFN induced mutant2, Mcwi", "display_text" : "adducin 3; ZFN induced mutant2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Add3[em2Mcwi]", "display_text" : "Add3em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429619", "page_area" : "allele", "display_name" : "RGD:150429619" } }, "date_created" : "2021-09-09T14:24:30.000-05:00", "date_updated" : "2021-09-09T14:24:30.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429619", "note_dtos" : [ { "internal" : false, "free_text" : "ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32029431", "RGD:150340736" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; TALEN induced mutant 1, Kyo", "display_text" : "hyperpolarization-activated cyclic nucleotide-gated potassium channel 1; TALEN induced mutant 1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hcn1[em1Kyo]", "display_text" : "Hcn1em1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429632", "page_area" : "allele", "display_name" : "RGD:150429632" } }, "date_created" : "2021-09-10T11:23:42.000-05:00", "date_updated" : "2021-09-10T11:23:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429632", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30408474", "PMID:32507787", "RGD:150429620", "RGD:26923909" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, subfamily 2, polypeptide 11; CRISPR/Cas9 induced mutant 1, Nju", "display_text" : "cytochrome P450, subfamily 2, polypeptide 11; CRISPR/Cas9 induced mutant 1, Nju", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp2c11[em1Nju]", "display_text" : "Cyp2c11em1Nju", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429708", "page_area" : "allele", "display_name" : "RGD:150429708" } }, "date_created" : "2021-09-17T15:46:39.000-05:00", "date_updated" : "2021-09-17T15:46:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429708", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was created by CRISPR/Cas9 system in the Sprague-Dawley embryo. The mutant allele carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29444903", "RGD:150429710" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein subunit alpha L; CRISPR/Cas9 induced mutant 1, Hpng", "display_text" : "G protein subunit alpha L; CRISPR/Cas9 induced mutant 1, Hpng", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gnal[em1Hpng]", "display_text" : "Gnalem1Hpng", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gnaldel34-46", "display_text" : "Gnaldel34-46", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429816", "page_area" : "allele", "display_name" : "RGD:150429816" } }, "date_created" : "2021-09-30T14:19:28.000-05:00", "date_updated" : "2021-09-30T14:19:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429816", "note_dtos" : [ { "internal" : false, "free_text" : "The Gnal mutant allele was created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids .", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31678405", "RGD:150429833" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 9;ZFN induced target mutant1, Amgn", "display_text" : "sodium voltage-gated channel alpha subunit 9;ZFN induced target mutant1, Amgn", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Scn9a*[tm1Amgn]", "display_text" : "Scn9a*tm1Amgn", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429827", "page_area" : "allele", "display_name" : "RGD:150429827" } }, "date_created" : "2021-10-01T14:39:53.000-05:00", "date_updated" : "2021-10-01T14:39:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429827", "note_dtos" : [ { "internal" : false, "free_text" : "Exon 25 of the rat Scn9a gene was replaced with the human SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase).", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31550995", "RGD:150429745" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "translocator protein; ZFN induced mutant1, Vpl", "display_text" : "translocator protein; ZFN induced mutant1, Vpl", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tspo[em1Vpl]", "display_text" : "Tspoem1Vpl", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429831", "page_area" : "allele", "display_name" : "RGD:150429831" } }, "date_created" : "2021-10-01T16:15:56.000-05:00", "date_updated" : "2021-10-01T16:15:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429831", "note_dtos" : [ { "internal" : false, "free_text" : "Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and 273 bp for the mutant,(89 bp deletion).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29074640", "RGD:150429771" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "translocator protein; ZFN induced mutant2, Vpl", "display_text" : "translocator protein; ZFN induced mutant2, Vpl", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tspo[em2Vpl]", "display_text" : "Tspoem2Vpl", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429832", "page_area" : "allele", "display_name" : "RGD:150429832" } }, "date_created" : "2021-10-01T16:18:46.000-05:00", "date_updated" : "2021-10-01T16:18:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429832", "note_dtos" : [ { "internal" : false, "free_text" : "Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30.; Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29074640", "RGD:150429771" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "WW domain-containing oxidoreductase; lde mutant", "display_text" : "WW domain-containing oxidoreductase; lde mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Wwox[lde]", "display_text" : "Wwoxlde", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429961", "page_area" : "allele", "display_name" : "RGD:150429961" } }, "date_created" : "2021-10-07T14:30:45.000-05:00", "date_updated" : "2021-10-07T14:30:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429961", "note_dtos" : [ { "internal" : false, "free_text" : "This spontaneous lethal dwarfism with epilepsy (LDE) allele carries a 13-bp deletion in exon 9 of rat Wwox gene . This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17803050", "PMID:18676360", "PMID:19500159", "RGD:150429974", "RGD:150429978", "RGD:150429979" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "pro-melanin-concentrating hormone; ENU induced mutant1, Hubr", "display_text" : "pro-melanin-concentrating hormone; ENU induced mutant1, Hubr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pmch[m1Hubr]", "display_text" : "Pmchm1Hubr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429964", "page_area" : "allele", "display_name" : "RGD:150429964" } }, "date_created" : "2021-10-07T16:03:39.000-05:00", "date_updated" : "2021-10-07T16:03:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429964", "note_dtos" : [ { "internal" : false, "free_text" : "The Pmch mutant allele was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19934402", "PMID:23555928", "RGD:150429944", "RGD:150429945" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "apolipoprotein A4; TALEN induced mutant 1, Bcgn", "display_text" : "apolipoprotein A4; TALEN induced mutant 1, Bcgn", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Apoa4[em1Bcgen]", "display_text" : "Apoa4em1Bcgen", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150429966", "page_area" : "allele", "display_name" : "RGD:150429966" } }, "date_created" : "2021-10-07T16:48:04.000-05:00", "date_updated" : "2021-10-07T16:48:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:150429966", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31303888", "RGD:150429948" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lipase A, lysosomal acid type; mutant1, Hyo", "display_text" : "lipase A, lysosomal acid type; mutant1, Hyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lipa[m1Hyo]", "display_text" : "Lipam1Hyo", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "WRLAL", "display_text" : "WRLAL", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150519893", "page_area" : "allele", "display_name" : "RGD:150519893" } }, "date_created" : "2021-10-14T09:58:58.000-05:00", "date_updated" : "2021-10-14T09:58:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:150519893", "note_dtos" : [ { "internal" : false, "free_text" : "This spontaneous mutant allele was identified in the ALD/Hyo rat which is a rat model for Wolman's disease.The Wolman rat Lipa cDNA had the same sequence as the wild type cDNA from the 5'-untranslated region to nt 1101, followed by a 60 bp replacement from nt 1102 to nt 1161 with poly A signal and a 3' 1.8 kb deletion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:8576647", "RGD:729052" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 1, Tua", "display_text" : "protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 1, Tua", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prkar1b[em1Tua]", "display_text" : "Prkar1bem1Tua", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150519902", "page_area" : "allele", "display_name" : "RGD:150519902" } }, "date_created" : "2021-10-15T10:44:08.000-05:00", "date_updated" : "2021-10-15T10:44:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:150519902", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:33479380", "RGD:150519900" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 2, Tua", "display_text" : "protein kinase cAMP-dependent type I regulatory subunit beta; CRISPR/Cas9 induced mutant 2, Tua", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prkar1b[em2Tua]", "display_text" : "Prkar1bem2Tua", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150519903", "page_area" : "allele", "display_name" : "RGD:150519903" } }, "date_created" : "2021-10-15T10:49:02.000-05:00", "date_updated" : "2021-10-15T10:49:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:150519903", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant allele carried a 13-bp frameshift ideletion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:33479380", "RGD:150519900" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 1,Mes", "display_text" : "glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 1,Mes", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gfap[em1Mes]", "display_text" : "Gfapem1Mes", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150519905", "page_area" : "allele", "display_name" : "RGD:150519905" } }, "date_created" : "2021-10-15T11:45:50.000-05:00", "date_updated" : "2021-10-15T11:45:50.000-05:00", "internal" : false, "primary_external_id" : "RGD:150519905", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human Alexander disease.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:150519894" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 2,Mes", "display_text" : "glial fibrillary acidic protein; CRISPR/Cas9 induced mutant 2,Mes", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gfap[em2Mes]", "display_text" : "Gfapem2Mes", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150519906", "page_area" : "allele", "display_name" : "RGD:150519906" } }, "date_created" : "2021-10-15T11:51:07.000-05:00", "date_updated" : "2021-10-15T11:51:07.000-05:00", "internal" : false, "primary_external_id" : "RGD:150519906", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 mediated single nucleotide deletion resulting in a frameshift that creates a premature stop and generates a null allele.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:150519894" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "apolipoprotein E; TALEN induced mutant 1, Ejt", "display_text" : "apolipoprotein E; TALEN induced mutant 1, Ejt", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Apoe[em1Ejt]", "display_text" : "Apoeem1Ejt", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150520190", "page_area" : "allele", "display_name" : "RGD:150520190" } }, "date_created" : "2021-11-04T11:40:58.000-05:00", "date_updated" : "2021-11-04T11:40:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:150520190", "note_dtos" : [ { "internal" : false, "free_text" : "The mutant rat strain was produced by injecting TALEN system targeting the exon 4 of rat Apoe into Sprague Dawley (Hsd:SD) embryos. This mutant rat has a 16-bp deletion in the gene third coding exon) located on chromosome 1; frameshift mutation resulted (p.Glu178fs)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29166645", "RGD:150520219" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "low density lipoprotein receptor; CRISPR/Cas9 induced mutant 1, Dlli", "display_text" : "low density lipoprotein receptor; CRISPR/Cas9 induced mutant 1, Dlli", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ldlr[em1Dlli]", "display_text" : "Ldlrem1Dlli", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150520193", "page_area" : "allele", "display_name" : "RGD:150520193" } }, "date_created" : "2021-11-04T13:14:43.000-05:00", "date_updated" : "2021-11-04T13:14:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:150520193", "note_dtos" : [ { "internal" : false, "free_text" : "Zygotes of SD rats were microinjected with CRISPR/Cas9 system targeting Ldlr . This mutant possesses a 118-bp deletion from No.22759599bp to 22759716bp in the Ldlr gene (NC_005107.4), resulting in a termination codon TAG, and deletion of 768 amino acids of Ldlr.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29459263", "RGD:13703129" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier organic anion transporter family member 1B2; CRISPR/Case9 induced mutant 1, Myliu", "display_text" : "solute carrier organic anion transporter family member 1B2; CRISPR/Case9 induced mutant 1, Myliu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slco1b2[em1Myliu]", "display_text" : "Slco1b2em1Myliu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150521524", "page_area" : "allele", "display_name" : "RGD:150521524" } }, "date_created" : "2021-11-09T09:28:00.000-06:00", "date_updated" : "2021-11-09T09:28:00.000-06:00", "internal" : false, "primary_external_id" : "RGD:150521524", "note_dtos" : [ { "internal" : false, "free_text" : "The Sprague Dawley embryos were injected with CRISPR/Case9 system targeting the first exon of the rat Slco1b2 gene. A Slco1b2 knockout was created with 11-bp deletion.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32528832", "RGD:150521535" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coiled-coil domain containing 39; CRISPR/Cas9 induced mutant 1, Jgn", "display_text" : "coiled-coil domain containing 39; CRISPR/Cas9 induced mutant 1, Jgn", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ccdc39[em1Jgn]", "display_text" : "Ccdc39em1Jgn", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150521525", "page_area" : "allele", "display_name" : "RGD:150521525" } }, "date_created" : "2021-11-09T09:38:40.000-06:00", "date_updated" : "2021-11-09T09:38:40.000-06:00", "internal" : false, "primary_external_id" : "RGD:150521525", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31771992", "RGD:150521527" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "urate oxidase; CRISPR/Cas9 induced mutant1, Cya", "display_text" : "urate oxidase; CRISPR/Cas9 induced mutant1, Cya", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Uox[em1Cya]", "display_text" : "Uoxem1Cya", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150521540", "page_area" : "allele", "display_name" : "RGD:150521540" } }, "date_created" : "2021-11-09T14:06:28.000-06:00", "date_updated" : "2021-11-09T14:06:28.000-06:00", "internal" : false, "primary_external_id" : "RGD:150521540", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system targeting exons 2 to 4 was injected into Sprague Dawley embryos. The resulting mutation was complete deletion of exons 2, 3 and 4.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32368418", "RGD:150521544" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "centrobin, centriole duplication and spindle assembly protein; hypodacty mutant", "display_text" : "centrobin, centriole duplication and spindle assembly protein; hypodacty mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cntrob[hd]", "display_text" : "Cntrobhd", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150521554", "page_area" : "allele", "display_name" : "RGD:150521554" } }, "date_created" : "2021-11-10T12:22:59.000-06:00", "date_updated" : "2021-11-10T12:22:59.000-06:00", "internal" : false, "primary_external_id" : "RGD:150521554", "note_dtos" : [ { "internal" : false, "free_text" : "The hd (hypodacty) mutation is caused by an insertion of an endogenous retrovirus (ERV-K8e family) into intron 10 of the Cntrob gene. The insertion disrupts the normal splicing of Cntrob transcripts and results in the expression of a truncated protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19710508", "RGD:150521555" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "thyroid stimulating hormone receptor; CRISPR/Cas9 induced mutant 1, Mlit", "display_text" : "thyroid stimulating hormone receptor; CRISPR/Cas9 induced mutant 1, Mlit", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tshr[em1Mlit]", "display_text" : "Tshrem1Mlit", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150521600", "page_area" : "allele", "display_name" : "RGD:150521600" } }, "date_created" : "2021-11-11T11:15:35.000-06:00", "date_updated" : "2021-11-11T11:15:35.000-06:00", "internal" : false, "primary_external_id" : "RGD:150521600", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29507327", "RGD:150521601" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "desmoglein 4; hairless mutant", "display_text" : "desmoglein 4; hairless mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dsg4[hr]", "display_text" : "Dsg4hr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150521603", "page_area" : "allele", "display_name" : "RGD:150521603" } }, "date_created" : "2021-11-11T12:39:43.000-06:00", "date_updated" : "2021-11-11T12:39:43.000-06:00", "internal" : false, "primary_external_id" : "RGD:150521603", "note_dtos" : [ { "internal" : false, "free_text" : "This Iffa Credo ( IC) hairless mutation was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:15606503", "RGD:150521560" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "TBC1 domain family member 1; Sleeping Beauty induced mutant 1, Fkh", "display_text" : "TBC1 domain family member 1; Sleeping Beauty induced mutant 1, Fkh", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tbc1d1[Tn(sb)1Fkh]", "display_text" : "Tbc1d1Tn(sb)1Fkh", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150521709", "page_area" : "allele", "display_name" : "RGD:150521709" } }, "date_created" : "2021-11-16T15:14:06.000-06:00", "date_updated" : "2021-11-16T15:14:06.000-06:00", "internal" : false, "primary_external_id" : "RGD:150521709", "note_dtos" : [ { "internal" : false, "free_text" : "The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28177704", "PMID:28808062", "RGD:150521563", "RGD:150521607" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "immunoglobulin heavy constant mu; ZFN induced mutant1, Ang", "display_text" : "immunoglobulin heavy constant mu; ZFN induced mutant1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ighm[em1Ang]", "display_text" : "Ighmem1Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150523756", "page_area" : "allele", "display_name" : "RGD:150523756" } }, "date_created" : "2021-11-18T13:11:07.000-06:00", "date_updated" : "2021-11-18T13:11:07.000-06:00", "internal" : false, "primary_external_id" : "RGD:150523756", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN induced mutation in this rat allele comprised a 64 bp deletion of the IgM CH1 domain and resulted of a stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21038471", "RGD:150523760" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "immunoglobulin heavy constant mu; ZFN induced mutant2, Ang", "display_text" : "immunoglobulin heavy constant mu; ZFN induced mutant2, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ighm[em2Ang]", "display_text" : "Ighmem2Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150523758", "page_area" : "allele", "display_name" : "RGD:150523758" } }, "date_created" : "2021-11-18T13:21:41.000-06:00", "date_updated" : "2021-11-18T13:21:41.000-06:00", "internal" : false, "primary_external_id" : "RGD:150523758", "note_dtos" : [ { "internal" : false, "free_text" : "Microinjection of Sprague-Dawley rat zygotes with ZFN mRNA specific for the JH locus resulted in the generation of a mutant animal with a 2465 bp DNA deletion, spanning the entire locus", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21038471", "RGD:150523760" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NK3 homeobox 1; TALEN induced mutant 1, Pjhak", "display_text" : "NK3 homeobox 1; TALEN induced mutant 1, Pjhak", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nkx3-1[em1Pjhak]", "display_text" : "Nkx3-1em1Pjhak", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:150573819", "page_area" : "allele", "display_name" : "RGD:150573819" } }, "date_created" : "2022-01-12T17:27:06.000-06:00", "date_updated" : "2022-01-12T17:27:06.000-06:00", "internal" : false, "primary_external_id" : "RGD:150573819", "note_dtos" : [ { "internal" : false, "free_text" : "A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:33368416", "RGD:150573817" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aryl hydrocarbon receptor; TALEN induced mutant1, Hyama", "display_text" : "aryl hydrocarbon receptor; TALEN induced mutant1, Hyama", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-12-19T16:26:45.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ahr[em1Hyama]", "display_text" : "Ahrem1Hyama", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:15090818", "page_area" : "allele", "display_name" : "RGD:15090818" } }, "date_created" : "2019-12-19T16:26:30.000-06:00", "date_updated" : "2019-12-19T16:26:30.000-06:00", "internal" : false, "primary_external_id" : "RGD:15090818", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' was injected to embryos of JclKud:WI to delete part of exon 2 of the rat Ahr gene.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:28487374", "RGD:13204751" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein kinase, DNA-activated, catalytic subunit; ZFN induced mutant 1, Sage", "display_text" : "protein kinase, DNA-activated, catalytic subunit; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prkdc[em1Sage]", "display_text" : "Prkdcem1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151232284", "page_area" : "allele", "display_name" : "RGD:151232284" } }, "date_created" : "2022-01-13T09:50:56.000-06:00", "date_updated" : "2022-01-13T09:50:56.000-06:00", "internal" : false, "primary_external_id" : "RGD:151232284", "note_dtos" : [ { "internal" : false, "free_text" : "The ZFN induced mutation was identified by a 872-bp PCR fragment vs 1627-bp in wild type animals.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30485360", "RGD:39938998" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myostatin; ZFN induced mutant 1, Cqin", "display_text" : "myostatin; ZFN induced mutant 1, Cqin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mstn[em1Cqin]", "display_text" : "Mstnem1Cqin", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151347430", "page_area" : "allele", "display_name" : "RGD:151347430" } }, "date_created" : "2022-01-20T17:16:21.000-06:00", "date_updated" : "2022-01-20T17:16:21.000-06:00", "internal" : false, "primary_external_id" : "RGD:151347430", "note_dtos" : [ { "internal" : false, "free_text" : "A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27289021", "RGD:13831345" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dimethylarginine dimethylaminohydrolase 1; CRISPR/Cas9 induced mutant 1, Ywxu", "display_text" : "dimethylarginine dimethylaminohydrolase 1; CRISPR/Cas9 induced mutant 1, Ywxu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ddah1[em1Ywxu]", "display_text" : "Ddah1em1Ywxu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151347606", "page_area" : "allele", "display_name" : "RGD:151347606" } }, "date_created" : "2022-01-28T11:31:36.000-06:00", "date_updated" : "2022-01-28T11:31:36.000-06:00", "internal" : false, "primary_external_id" : "RGD:151347606", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3').", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31402164", "RGD:151347602" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein-coupled estrogen receptor 1; CRISPR/Cas 9 induced mutant 1, Bj", "display_text" : "G protein-coupled estrogen receptor 1; CRISPR/Cas 9 induced mutant 1, Bj", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-02-04T16:18:37.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Gper1[em1Bj]", "display_text" : "Gper1em1Bj", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gper1[em1Bj-/-]", "display_text" : "Gper1em1Bj-/-", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151347865", "page_area" : "allele", "display_name" : "RGD:151347865" } }, "date_created" : "2022-02-04T16:16:29.000-06:00", "date_updated" : "2022-02-04T16:16:29.000-06:00", "internal" : false, "primary_external_id" : "RGD:151347865", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. RNA validation performed via deletion PCR using a sense primer at the 5' end and an antisense primer at the 3' end showed a deletion PCR product of 544 bps versus wild-type PCR product of 1484 bps.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:30354811", "RGD:39939000" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Apb", "display_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 1, Apb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cftr[em1Apb]", "display_text" : "Cftrem1Apb", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151660342", "page_area" : "allele", "display_name" : "RGD:151660342" } }, "date_created" : "2022-03-03T15:04:47.000-06:00", "date_updated" : "2022-03-03T15:04:47.000-06:00", "internal" : false, "primary_external_id" : "RGD:151660342", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to target exon 11 to create a deletion at codon F508 which was injected into Sprague-Dawley one-cell embryos. One rat had this allele that contained the desired homology-directed repair edited TTT deletion and was designated the Phe508del founder (c.1522_1524delTTT).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Apb", "display_text" : "cystic fibrosis transmembrane conductance regulator; CRISPR/Cas9 induced mutant 2, Apb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cftr[em2Apb]", "display_text" : "Cftrem2Apb", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151660343", "page_area" : "allele", "display_name" : "RGD:151660343" } }, "date_created" : "2022-03-03T15:09:08.000-06:00", "date_updated" : "2022-03-03T15:09:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:151660343", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell embryos . This allele with an 8-bp deletion upstream of the TTT site (c.1514_1521delATATCATC) was used to establish the KO strain.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 9 member A6;CRISPR/Cas9 induced mutant1, Moro", "display_text" : "solute carrier family 9 member A6;CRISPR/Cas9 induced mutant1, Moro", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc9a6 [em1Moro]", "display_text" : "Slc9a6 em1Moro", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151664749", "page_area" : "allele", "display_name" : "RGD:151664749" } }, "date_created" : "2022-03-09T16:20:31.000-06:00", "date_updated" : "2022-03-09T16:20:31.000-06:00", "internal" : false, "primary_external_id" : "RGD:151664749", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:34928329", "RGD:151664747" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "uncoupling protein 2; CRIPSR/Cas9 induced mutant 1, MCWi", "display_text" : "uncoupling protein 2; CRIPSR/Cas9 induced mutant 1, MCWi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ucp2[em1Mcwi]", "display_text" : "Ucp2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151665326", "page_area" : "allele", "display_name" : "RGD:151665326" } }, "date_created" : "2022-03-18T14:04:05.000-05:00", "date_updated" : "2022-03-18T14:04:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:151665326", "note_dtos" : [ { "internal" : false, "free_text" : "Generated by CRISPR/Cas9 mutagenesis of SS/JrHsdMcwi rats by Aron Geurts. The resulting mutation is a 23-bp deletion (rn7: chr1:154,842,967-154,842,989)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:8661229" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transcription factor AP-2 epsilon; CRISPR/Cas9 induced mutant 1, Nips", "display_text" : "transcription factor AP-2 epsilon; CRISPR/Cas9 induced mutant 1, Nips", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tfap2c[em1(tdTomato)Nips]", "display_text" : "Tfap2cem1(tdTomato)Nips", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:151665773", "page_area" : "allele", "display_name" : "RGD:151665773" } }, "date_created" : "2022-04-01T10:22:11.000-05:00", "date_updated" : "2022-04-01T10:22:11.000-05:00", "internal" : false, "primary_external_id" : "RGD:151665773", "note_dtos" : [ { "internal" : false, "free_text" : "The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "microRNA 146b; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "microRNA 146b; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mir146b[em1Mcwi]", "display_text" : "Mir146bem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:152600899", "page_area" : "allele", "display_name" : "RGD:152600899" } }, "date_created" : "2022-05-25T15:01:03.000-05:00", "date_updated" : "2022-05-25T15:01:03.000-05:00", "internal" : false, "primary_external_id" : "RGD:152600899", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31668631", "RGD:127285407" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "frataxin; CRISPR/Cas9 induced mutant 1,Fara", "display_text" : "frataxin; CRISPR/Cas9 induced mutant 1,Fara", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fxn[ em1Fara]", "display_text" : "Fxn em1Fara", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:152999004", "page_area" : "allele", "display_name" : "RGD:152999004" } }, "date_created" : "2022-07-15T16:52:05.000-05:00", "date_updated" : "2022-07-15T16:52:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:152999004", "note_dtos" : [ { "internal" : false, "free_text" : "Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "frataxin; CRISPR/Cas9 induced mutant 2,Fara", "display_text" : "frataxin; CRISPR/Cas9 induced mutant 2,Fara", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fxn[ em2Fara]", "display_text" : "Fxn em2Fara", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:152999006", "page_area" : "allele", "display_name" : "RGD:152999006" } }, "date_created" : "2022-07-15T16:58:54.000-05:00", "date_updated" : "2022-07-15T16:58:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:152999006", "note_dtos" : [ { "internal" : false, "free_text" : "Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "allograft inflammatory factor 1; target mutant 1,Apps", "display_text" : "allograft inflammatory factor 1; target mutant 1,Apps", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Aif1[tm(EGFP)Apps]", "display_text" : "Aif1tm(EGFP)Apps", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:152999024", "page_area" : "allele", "display_name" : "RGD:152999024" } }, "date_created" : "2022-07-18T16:26:44.000-05:00", "date_updated" : "2022-07-18T16:26:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:152999024", "note_dtos" : [ { "internal" : false, "free_text" : "Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:34417284", "RGD:150429758" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "APC, WNT signaling pathway regulator; polyposis in the rat colon", "display_text" : "APC, WNT signaling pathway regulator; polyposis in the rat colon", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-04-03T11:17:21.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-04-03T11:00:15.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Apc[Pirc]", "display_text" : "ApcPirc", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "apc[am1137]", "display_text" : "apcam1137", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "ApcPirc", "display_text" : "ApcPirc", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "adenomatous polyposis coli", "display_text" : "adenomatous polyposis coli", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "APC, WNT signaling pathway regulator", "display_text" : "APC, WNT signaling pathway regulator", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1554322", "page_area" : "allele", "display_name" : "RGD:1554322" } }, "date_created" : "2005-10-19T00:00:00.000-05:00", "date_updated" : "2005-10-19T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:1554322", "note_dtos" : [ { "internal" : false, "free_text" : "Pirc allele of the adenomatous polyposis coli gene; associated with Pirc-polyposis in colon. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam).", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:17360473", "RGD:1601201" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "basic helix-loop-helix ARNT like 1;CRISPR/Cas9 induced mutant 1,Mcwi", "display_text" : "basic helix-loop-helix ARNT like 1;CRISPR/Cas9 induced mutant 1,Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bmal1[em1Mcwi]", "display_text" : "Bmal1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155598603", "page_area" : "allele", "display_name" : "RGD:155598603" } }, "date_created" : "2022-10-18T15:49:28.000-05:00", "date_updated" : "2022-10-18T15:49:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:155598603", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32306766", "RGD:155598602" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 2, Vjupk", "display_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 2, Vjupk", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ctns[em2Vjupk]", "display_text" : "Ctnsem2Vjupk", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CtnsE3N-2Vjupk/Vju", "display_text" : "CtnsE3N-2Vjupk/Vju", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155630632", "page_area" : "allele", "display_name" : "RGD:155630632" } }, "date_created" : "2022-10-26T14:52:15.000-05:00", "date_updated" : "2022-10-26T14:52:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:155630632", "note_dtos" : [ { "internal" : false, "free_text" : "This 2-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:35695380", "RGD:155630629" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 3, Vjupk", "display_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 3, Vjupk", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ctns[em3Vjupk]", "display_text" : "Ctnsem3Vjupk", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CtnsE3N-3Vjupk/Vju", "display_text" : "CtnsE3N-3Vjupk/Vju", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155630634", "page_area" : "allele", "display_name" : "RGD:155630634" } }, "date_created" : "2022-10-26T15:01:31.000-05:00", "date_updated" : "2022-10-26T15:01:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:155630634", "note_dtos" : [ { "internal" : false, "free_text" : "This 8-bp insertion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:35695380", "RGD:155630629" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 4, Vjupk", "display_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 4, Vjupk", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ctns[em4Vjupk]", "display_text" : "Ctnsem4Vjupk", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155630636", "page_area" : "allele", "display_name" : "RGD:155630636" } }, "date_created" : "2022-10-26T15:09:01.000-05:00", "date_updated" : "2022-10-26T15:09:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:155630636", "note_dtos" : [ { "internal" : false, "free_text" : "This 7-bp deletion in the Crl:CD(SD) embryo was induced by CRISPR/Cas9 system targeting exon3 of the rat Ctns gene. The insertion causes frameshift mutation and results in pre-mature stop truncated protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:35695380", "RGD:155630629" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BRCA1, DNA repair associated; CRISPR/Cas9 induced mutation 1,Kyo", "display_text" : "BRCA1, DNA repair associated; CRISPR/Cas9 induced mutation 1,Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Brca1[em1Kyo]", "display_text" : "Brca1em1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155631262", "page_area" : "allele", "display_name" : "RGD:155631262" } }, "date_created" : "2022-10-27T13:52:43.000-05:00", "date_updated" : "2022-10-27T13:52:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:155631262", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate c.188T>A (p.L63X) mutation on exon 4 of rat Brca1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:35851737", "RGD:155631263" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "filamin A; CRISPRs/Cas9 induced mutant 1, Ang", "display_text" : "filamin A; CRISPRs/Cas9 induced mutant 1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Flna[em1Ang]", "display_text" : "Flnaem1Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155631280", "page_area" : "allele", "display_name" : "RGD:155631280" } }, "date_created" : "2022-10-31T12:49:06.000-05:00", "date_updated" : "2022-10-31T12:49:06.000-05:00", "internal" : false, "primary_external_id" : "RGD:155631280", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:36001550", "RGD:155631279" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Cgen", "display_text" : "phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Cgen", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde6b[em1Cgen]", "display_text" : "Pde6bem1Cgen", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155631290", "page_area" : "allele", "display_name" : "RGD:155631290" } }, "date_created" : "2022-10-31T14:49:22.000-05:00", "date_updated" : "2022-10-31T14:49:22.000-05:00", "internal" : false, "primary_external_id" : "RGD:155631290", "note_dtos" : [ { "internal" : false, "free_text" : "The rat Pde6b knock out allele was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:36175490", "RGD:155631288" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 3A; Cas9/Cas9 induced mutant 1, Bdr", "display_text" : "phosphodiesterase 3A; Cas9/Cas9 induced mutant 1, Bdr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde3a[em1Bdr]", "display_text" : "Pde3aem1Bdr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155631294", "page_area" : "allele", "display_name" : "RGD:155631294" } }, "date_created" : "2022-10-31T15:47:51.000-05:00", "date_updated" : "2022-10-31T15:47:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:155631294", "note_dtos" : [ { "internal" : false, "free_text" : "The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 3A; Cas9/Cas9 induced mutant 2, Bdr", "display_text" : "phosphodiesterase 3A; Cas9/Cas9 induced mutant 2, Bdr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde3a[em2Bdr]", "display_text" : "Pde3aem2Bdr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155631296", "page_area" : "allele", "display_name" : "RGD:155631296" } }, "date_created" : "2022-10-31T15:56:55.000-05:00", "date_updated" : "2022-10-31T15:56:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:155631296", "note_dtos" : [ { "internal" : false, "free_text" : "The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32524868", "RGD:155631291" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 3A; Cas9/Cas9 induced mutant 3, Bdr", "display_text" : "phosphodiesterase 3A; Cas9/Cas9 induced mutant 3, Bdr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde3a[em3Bdr]", "display_text" : "Pde3aem3Bdr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155631299", "page_area" : "allele", "display_name" : "RGD:155631299" } }, "date_created" : "2022-10-31T16:44:55.000-05:00", "date_updated" : "2022-10-31T16:44:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:155631299", "note_dtos" : [ { "internal" : false, "free_text" : "The rat mutant allele was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGT missense mutation and results in R862C substitutions in the protein", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:36259389", "RGD:155631300" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 1, Slot", "display_text" : "cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 1, Slot", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2023-05-16T13:59:06.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna6[em1Slot]", "display_text" : "Chrna6em1Slot", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155900756", "page_area" : "allele", "display_name" : "RGD:155900756" } }, "date_created" : "2023-02-09T14:48:21.000-06:00", "date_updated" : "2023-02-09T14:48:21.000-06:00", "internal" : false, "primary_external_id" : "RGD:155900756", "note_dtos" : [ { "internal" : false, "free_text" : "Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR.", "note_type_name" : "comment" } ], "reference_curies" : [ "RGD:151665774" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 2, Slot", "display_text" : "cholinergic receptor nicotinic alpha 6 subunit, CRISPR/Cas9 induced mutant 2, Slot", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2023-05-16T14:00:02.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Chrna6[em2Slot]", "display_text" : "Chrna6em2Slot", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:155900759", "page_area" : "allele", "display_name" : "RGD:155900759" } }, "date_created" : "2023-02-09T16:09:58.000-06:00", "date_updated" : "2023-02-09T16:09:58.000-06:00", "internal" : false, "primary_external_id" : "RGD:155900759", "note_dtos" : [ { "internal" : false, "free_text" : "Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G allele carries homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "egl-9 family hypoxia-inducible factor 3; mutation 1, Medical College of Wisconsin", "display_text" : "egl-9 family hypoxia-inducible factor 3; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Egln3[m1Mcwi]", "display_text" : "Egln3m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Egln3m1Mcwi", "display_text" : "Egln3m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578781", "page_area" : "allele", "display_name" : "RGD:1578781" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578781", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "Low complexity region within Intermediate filament head (DNA binding) region", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); E60G mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transforming growth factor, beta receptor 2; mutation 2, Medical College of Wisconsin", "display_text" : "transforming growth factor, beta receptor 2; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tgfbr2[m2Mcwi]", "display_text" : "Tgfbr2m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tgfbr2m2Mcwi", "display_text" : "Tgfbr2m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578782", "page_area" : "allele", "display_name" : "RGD:1578782" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578782", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Protein kinase", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); E311K mutation is generated from the codon change GAG/AAG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coagulation factor X; mutation 1, Medical College of Wisconsin", "display_text" : "coagulation factor X; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "F10[m1Mcwi]", "display_text" : "F10m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "F10m1Mcwi", "display_text" : "F10m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578783", "page_area" : "allele", "display_name" : "RGD:1578783" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578783", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Trypsin", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); V453G mutation is generated from the codon change GTC/GGC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiotensin II receptor, type 1b; mutation 1, Medical College of Wisconsin", "display_text" : "angiotensin II receptor, type 1b; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-03-31T11:27:53.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated_at_request_of_researcher" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T11:05:51.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Agtr1b[m1Mcwi]", "display_text" : "Agtr1bm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Agtr1bm1Mcwi", "display_text" : "Agtr1bm1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Agtr1[m1Mcwi]", "display_text" : "Agtr1m1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Angiotensin receptor, type1", "display_text" : "Angiotensin receptor, type1", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "mutation 1, Medical College of Wisconsin", "display_text" : "mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578784", "page_area" : "allele", "display_name" : "RGD:1578784" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578784", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: 7TM domain; 6th of 7", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); a 3bp deletion generates a mutation at TTC (del251F)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "toll-like receptor 4; mutation 1, Medical College of Wisconsin", "display_text" : "toll-like receptor 4; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tlr4[m1Mcwi]", "display_text" : "Tlr4m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tlr4m1Mcwi", "display_text" : "Tlr4m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578785", "page_area" : "allele", "display_name" : "RGD:1578785" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578785", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Low complexity region within Leucine-rich repeat region", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); V489A mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 8 member A2; mutation 1, Medical College of Wisconsin", "display_text" : "solute carrier family 8 member A2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc8a2[m1Mcwi]", "display_text" : "Slc8a2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc8a2m1Mcwi", "display_text" : "Slc8a2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578786", "page_area" : "allele", "display_name" : "RGD:1578786" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578786", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "Del AA213-921; 1 1/2 Na-Ca Exchange and both Calx-beta", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Y213Stop mutation is generated from the codon change TAT/TAA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adiponectin, C1Q and collagen domain containing; mutation 1, Medical College of Wisconsin", "display_text" : "adiponectin, C1Q and collagen domain containing; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adipoq[m1Mcwi]", "display_text" : "Adipoqm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adipoqm1Mcwi", "display_text" : "Adipoqm1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Acrp30[m1Mcwi]", "display_text" : "Acrp30m1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "adipocyte complement related protein of 30 kDa", "display_text" : "adipocyte complement related protein of 30 kDa", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "mutation 1, Medical College of Wisconsin", "display_text" : "mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578787", "page_area" : "allele", "display_name" : "RGD:1578787" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578787", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: C1q", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Y162C mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "baculoviral IAP repeat-containing 3; mutation 1, Medical College of Wisconsin", "display_text" : "baculoviral IAP repeat-containing 3; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Birc3[m1Mcwi]", "display_text" : "Birc3m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Birc3m1Mcwi", "display_text" : "Birc3m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578788", "page_area" : "allele", "display_name" : "RGD:1578788" } }, "date_created" : "2006-05-02T11:05:44.000-05:00", "date_updated" : "2006-05-02T11:05:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578788", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: baculoviral inhibition of apoptosis protein repeat domain", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); W76G mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "KLF transcription factor 6; mutation 1, Medical College of Wisconsin", "display_text" : "KLF transcription factor 6; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Klf6[m1Mcwi]", "display_text" : "Klf6m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Klf6m1Mcwi", "display_text" : "Klf6m1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Copeb[m1Mcwi]", "display_text" : "Copebm1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "core promoter element binding protein, mutation 1, Medical College of Wisconsin", "display_text" : "core promoter element binding protein, mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578789", "page_area" : "allele", "display_name" : "RGD:1578789" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578789", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Low complexity region", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); V135G mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein C, inactivator of coagulation factors Va and VIIIa; mutation 1, Medical College of Wisconsin", "display_text" : "protein C, inactivator of coagulation factors Va and VIIIa; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Proc[m1Mcwi]", "display_text" : "Procm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Procm1Mcwi", "display_text" : "Procm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578790", "page_area" : "allele", "display_name" : "RGD:1578790" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578790", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Trypsin", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); L312P mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear receptor subfamily 4, group A, member 1; mutation 1, Medical College of Wisconsin", "display_text" : "nuclear receptor subfamily 4, group A, member 1; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nr4a1[m1Mcwi]", "display_text" : "Nr4a1m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nr4a1m1Mcwi", "display_text" : "Nr4a1m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578791", "page_area" : "allele", "display_name" : "RGD:1578791" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578791", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "Del AA130-597; Hormone receptor DNA binding and ligand binding", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Y130Stop mutation is generated from the codon change TAC/TAA.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24722447", "PMID:29530712", "RGD:12910103", "RGD:40924655", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adrenoceptor alpha 1A; mutation 1, Medical College of Wisconsin", "display_text" : "adrenoceptor alpha 1A; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adra1a[m1Mcwi]", "display_text" : "Adra1am1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adra1am1Mcwi", "display_text" : "Adra1am1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578792", "page_area" : "allele", "display_name" : "RGD:1578792" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578792", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: 6th of 6 Prints Motif; C-ter; Alpha-1A adrenergic receptor signature", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); G393V mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lecithin cholesterol acyltransferase; mutation 1, Medical College of Wisconsin", "display_text" : "lecithin cholesterol acyltransferase; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Lcat[m1Mcwi]", "display_text" : "Lcatm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lcatm1Mcwi", "display_text" : "Lcatm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578793", "page_area" : "allele", "display_name" : "RGD:1578793" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578793", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Lecithin cholesterol acyltransferase", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); H353L mutation is generated from the codon change CAC/CTC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "growth hormone secretagogue receptor; mutation 1, Medical College of Wisconsin", "display_text" : "growth hormone secretagogue receptor; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ghsr[m1Mcwi]", "display_text" : "Ghsrm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ghsrm1Mcwi", "display_text" : "Ghsrm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578794", "page_area" : "allele", "display_name" : "RGD:1578794" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578794", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "Del AA343-364; 10th Prints Motif; multiple sites of PKC phosphorylation", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); codon CAG/TAG mutation is generated which changes the AA Q343Stop", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21258824", "PMID:21790898", "PMID:27129673", "RGD:150429661", "RGD:150520012", "RGD:150520013", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nitric oxide synthase 1; mutation 1, Medical College of Wisconsin", "display_text" : "nitric oxide synthase 1; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nos1[m1Mcwi]", "display_text" : "Nos1m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nos1m1Mcwi", "display_text" : "Nos1m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578795", "page_area" : "allele", "display_name" : "RGD:1578795" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578795", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); L72Stop mutation is generated.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "MAP-kinase activating death domain; mutation 1, Medical College of Wisconsin", "display_text" : "MAP-kinase activating death domain; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Madd[m1Mcwi]", "display_text" : "Maddm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Maddm1Mcwi", "display_text" : "Maddm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578796", "page_area" : "allele", "display_name" : "RGD:1578796" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578796", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); G120R mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adiponectin, C1Q and collagen domain containing; mutation 2, Medical College of Wisconsin", "display_text" : "adiponectin, C1Q and collagen domain containing; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adipoq[m2Mcwi]", "display_text" : "Adipoqm2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adipoqm2Mcwi", "display_text" : "Adipoqm2Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Acrp30[m2Mcwi]", "display_text" : "Acrp30m2Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "adipocyte complement related protein of 30 kDa", "display_text" : "adipocyte complement related protein of 30 kDa", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "mutation 2, Medical College of Wisconsin", "display_text" : "mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578797", "page_area" : "allele", "display_name" : "RGD:1578797" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578797", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: C1q", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); I164N mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear receptor subfamily 0, group B, member 2; mutation 1, Medical College of Wisconsin", "display_text" : "nuclear receptor subfamily 0, group B, member 2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nr0b2[m1Mcwi]", "display_text" : "Nr0b2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nr0b2m1Mcwi", "display_text" : "Nr0b2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578798", "page_area" : "allele", "display_name" : "RGD:1578798" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578798", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Steroid Hormone Receptor", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); G96R mutation is generated from the codon change GGC/CGC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 27 member 5; mutation 1, Medical College of Wisconsin", "display_text" : "solute carrier family 27 member 5; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc27a5[m1Mcwi]", "display_text" : "Slc27a5m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc27a5m1Mcwi", "display_text" : "Slc27a5m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578799", "page_area" : "allele", "display_name" : "RGD:1578799" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578799", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); K196Stop is generated.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transforming growth factor, beta receptor 2; mutation 1, Medical College of Wisconsin", "display_text" : "transforming growth factor, beta receptor 2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tgfbr2[m1Mcwi]", "display_text" : "Tgfbr2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tgfbr2m1Mcwi", "display_text" : "Tgfbr2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578800", "page_area" : "allele", "display_name" : "RGD:1578800" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578800", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Protein kinase", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); T289M mutation is generated from the codon change ACG/ATG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "desmin; mutation 1, Medical College of Wisconsin", "display_text" : "desmin; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-02T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Des[m1Mcwi]", "display_text" : "Desm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Desm1Mcwi", "display_text" : "Desm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1578801", "page_area" : "allele", "display_name" : "RGD:1578801" } }, "date_created" : "2006-05-02T11:05:45.000-05:00", "date_updated" : "2006-05-02T11:05:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:1578801", "note_dtos" : [ { "internal" : false, "free_text" : "Mutation generated by ENU (N-ethyl-N-nitrourea); S25T mutation is generated.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fibrinogen-like 2; mutation 1, Medical College of Wisconsin", "display_text" : "fibrinogen-like 2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-24T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fgl2[m1Mcwi]", "display_text" : "Fgl2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fgl2m1Mcwi", "display_text" : "Fgl2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1579885", "page_area" : "allele", "display_name" : "RGD:1579885" } }, "date_created" : "2006-05-24T13:26:24.000-05:00", "date_updated" : "2006-05-24T13:26:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:1579885", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Fibrin_AG_C", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); A301S mutation is generated from the codon change GCA/TCA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coagulation factor X; mutation 2, Medical College of Wisconsin", "display_text" : "coagulation factor X; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-24T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "F10[m2Mcwi]", "display_text" : "F10m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "F10m2Mcwi", "display_text" : "F10m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1579886", "page_area" : "allele", "display_name" : "RGD:1579886" } }, "date_created" : "2006-05-24T13:26:24.000-05:00", "date_updated" : "2006-05-24T13:26:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:1579886", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Trypsin-like serine protease", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); C388Stop mutation is generated from the codon change TGC/TGA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adiponectin, C1Q and collagen domain containing; mutation 3, Medical College of Wisconsin", "display_text" : "adiponectin, C1Q and collagen domain containing; mutation 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-24T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adipoq[m3Mcwi]", "display_text" : "Adipoqm3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adipoqm3Mcwi", "display_text" : "Adipoqm3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1579887", "page_area" : "allele", "display_name" : "RGD:1579887" } }, "date_created" : "2006-05-24T13:26:24.000-05:00", "date_updated" : "2006-05-24T13:26:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:1579887", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Complement component C1q domain", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); L119P mutation is generated from the codon change CTG/CCG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "C-C motif chemokine receptor 2; mutation 1, Medical College of Wisconsin", "display_text" : "C-C motif chemokine receptor 2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-24T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ccr2[m1Mcwi]", "display_text" : "Ccr2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ccr2m1Mcwi", "display_text" : "Ccr2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1579888", "page_area" : "allele", "display_name" : "RGD:1579888" } }, "date_created" : "2006-05-24T13:26:24.000-05:00", "date_updated" : "2006-05-24T13:26:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:1579888", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Putative Extracellular", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "Mutation generated by ENU (N-ethyl-N-nitrourea); N117S mutation is generated from the codon change AAT/AGT.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "bradykinin receptor B2; mutation 1, Medical College of Wisconsin", "display_text" : "bradykinin receptor B2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2006-05-24T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Bdkrb2[m1Mcwi]", "display_text" : "Bdkrb2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bdkrb2m1Mcwi", "display_text" : "Bdkrb2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1579889", "page_area" : "allele", "display_name" : "RGD:1579889" } }, "date_created" : "2006-05-24T13:26:24.000-05:00", "date_updated" : "2006-05-24T13:26:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:1579889", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); I214T mutation is generated", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "AKT serine/threonine kinase 1; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "AKT serine/threonine kinase 1; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Akt1[em1Soar]", "display_text" : "Akt1em1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:158013767", "page_area" : "allele", "display_name" : "RGD:158013767" } }, "date_created" : "2023-03-16T11:26:37.000-05:00", "date_updated" : "2023-03-16T11:26:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:158013767", "note_dtos" : [ { "internal" : false, "free_text" : "This Akt mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:36607602", "RGD:158013768" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2a receptor; mutation 1, Medical College of Wisconsin", "display_text" : "adenosine A2a receptor; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2a[m1Mcwi]", "display_text" : "Adora2am1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2am1Mcwi", "display_text" : "Adora2am1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1581476", "page_area" : "allele", "display_name" : "RGD:1581476" } }, "date_created" : "2006-10-06T09:21:17.000-05:00", "date_updated" : "2006-10-06T09:21:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:1581476", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); C249S mutation is generated from the codon change TGT/AGT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hyaluronan synthase 1; mutation 1, Medical College of Wisconsin", "display_text" : "hyaluronan synthase 1; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Has1[m1Mcwi]", "display_text" : "Has1m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Has1m1Mcwi", "display_text" : "Has1m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1581477", "page_area" : "allele", "display_name" : "RGD:1581477" } }, "date_created" : "2006-10-06T09:21:17.000-05:00", "date_updated" : "2006-10-06T09:21:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:1581477", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); F55L mutation is generated from the codon change TTT/TTG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "C-C motif chemokine receptor 4; mutation 1, Medical College of Wisconsin", "display_text" : "C-C motif chemokine receptor 4; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ccr4[m1Mcwi]", "display_text" : "Ccr4m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ccr4m1Mcwi", "display_text" : "Ccr4m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1581492", "page_area" : "allele", "display_name" : "RGD:1581492" } }, "date_created" : "2006-10-06T09:22:16.000-05:00", "date_updated" : "2006-10-06T09:22:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:1581492", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: 7 transmembrane receptor (rhodopsin family)", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "Mutation generated by ENU (N-ethyl-N-nitrourea); I133V mutation is generated from the codon change ATA/GTA.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "heart and neural crest derivatives expressed 1; mutation 1, Medical College of Wisconsin", "display_text" : "heart and neural crest derivatives expressed 1; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hand1[m1Mcwi]", "display_text" : "Hand1m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Hand1m1Mcwi", "display_text" : "Hand1m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1581493", "page_area" : "allele", "display_name" : "RGD:1581493" } }, "date_created" : "2006-10-06T09:22:17.000-05:00", "date_updated" : "2006-10-06T09:22:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:1581493", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Helix-loop-helix domain, found in specific DNA- binding proteins that act as transcription factors", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); S109G mutation is generated from the codon change AGC/GGC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CCAAT/enhancer binding protein epsilon; mutation 1, Medical College of Wisconsin", "display_text" : "CCAAT/enhancer binding protein epsilon; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cebpe[m1Mcwi]", "display_text" : "Cebpem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cebpem1Mcwi", "display_text" : "Cebpem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1581494", "page_area" : "allele", "display_name" : "RGD:1581494" } }, "date_created" : "2006-10-06T09:22:17.000-05:00", "date_updated" : "2006-10-06T09:22:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:1581494", "note_dtos" : [ { "internal" : false, "free_text" : "Mutation generated by ENU (N-ethyl-N-nitrourea); E37G mutation is generated from the codon change GAG/GGG.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lipase E, hormone sensitive type; mutation 1, Medical College of Wisconsin", "display_text" : "lipase E, hormone sensitive type; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lipe[m1Mcwi]", "display_text" : "Lipem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lipem1Mcwi", "display_text" : "Lipem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1581495", "page_area" : "allele", "display_name" : "RGD:1581495" } }, "date_created" : "2006-10-06T09:22:17.000-05:00", "date_updated" : "2006-10-06T09:22:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:1581495", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Hormone-sensitive lipase (HSL) N-terminus", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); L347P mutation is generated from the codon change CTA/CCA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "5-hydroxytryptamine receptor 1A; mutation 1, Medical College of Wisconsin", "display_text" : "5-hydroxytryptamine receptor 1A; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Htr1a[m1Mcwi]", "display_text" : "Htr1am1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Htr1am1Mcwi", "display_text" : "Htr1am1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1581496", "page_area" : "allele", "display_name" : "RGD:1581496" } }, "date_created" : "2006-10-06T09:22:17.000-05:00", "date_updated" : "2006-10-06T09:22:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:1581496", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); C266Y mutation is generated from the codon change TGT/TAT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "KLF transcription factor 4; mutation 2, Medical College of Wisconsin", "display_text" : "KLF transcription factor 4; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Klf4[m2Mcwi]", "display_text" : "Klf4m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Klf4m2Mcwi", "display_text" : "Klf4m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599559", "page_area" : "allele", "display_name" : "RGD:1599559" } }, "date_created" : "2007-02-07T14:26:46.000-06:00", "date_updated" : "2007-02-07T14:26:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599559", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); I150N mutation is generated from the codon change ATC/AAC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2a receptor; mutation 2, Medical College of Wisconsin", "display_text" : "adenosine A2a receptor; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2a[m2Mcwi]", "display_text" : "Adora2am2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2am2Mcwi", "display_text" : "Adora2am2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599561", "page_area" : "allele", "display_name" : "RGD:1599561" } }, "date_created" : "2007-02-07T14:26:47.000-06:00", "date_updated" : "2007-02-07T14:26:47.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599561", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Q310L mutation is generated from the codon change CAG/CTG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "5-hydroxytryptamine receptor 1A; mutation 2, Medical College of Wisconsin", "display_text" : "5-hydroxytryptamine receptor 1A; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Htr1a[m2Mcwi]", "display_text" : "Htr1am2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Htr1am2Mcwi", "display_text" : "Htr1am2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599562", "page_area" : "allele", "display_name" : "RGD:1599562" } }, "date_created" : "2007-02-07T14:26:47.000-06:00", "date_updated" : "2007-02-07T14:26:47.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599562", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domian: 7tm_1", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); G76R mutation is generated from the codon change GGC/CGC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; mutation 1, Medical College of Wisconsin", "display_text" : "HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hps6[m1Mcwi]", "display_text" : "Hps6m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Hps6m1Mcwi", "display_text" : "Hps6m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599564", "page_area" : "allele", "display_name" : "RGD:1599564" } }, "date_created" : "2007-02-07T14:26:47.000-06:00", "date_updated" : "2007-02-07T14:26:47.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599564", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); L67R mutation is generated from the codon change CTG/CGG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hyaluronan synthase 2; mutation 1, Medical College of Wisconsin", "display_text" : "hyaluronan synthase 2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Has2[m1Mcwi]", "display_text" : "Has2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Has2m1Mcwi", "display_text" : "Has2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599566", "page_area" : "allele", "display_name" : "RGD:1599566" } }, "date_created" : "2007-02-07T14:26:48.000-06:00", "date_updated" : "2007-02-07T14:26:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599566", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Y344Stop mutation is generated from the codon change TAT/TAA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "superoxide dismutase 3; mutation 1, Medical College of Wisconsin", "display_text" : "superoxide dismutase 3; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sod3[m1Mcwi]", "display_text" : "Sod3m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sod3m1Mcwi", "display_text" : "Sod3m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599567", "page_area" : "allele", "display_name" : "RGD:1599567" } }, "date_created" : "2007-02-07T14:26:48.000-06:00", "date_updated" : "2007-02-07T14:26:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599567", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Cu-Zn_Superoxide_Dismutase", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); E124D mutation is generated from the codon change GAG/GAT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21730301", "PMID:24322611", "PMID:31972339", "RGD:14369425", "RGD:150573712", "RGD:38548929", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "bradykinin receptor B2; mutation 2, Medical College of Wisconsin", "display_text" : "bradykinin receptor B2; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bdkrb2[m2Mcwi]", "display_text" : "Bdkrb2m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bdkrb2m2Mcwi", "display_text" : "Bdkrb2m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599568", "page_area" : "allele", "display_name" : "RGD:1599568" } }, "date_created" : "2007-02-07T14:26:48.000-06:00", "date_updated" : "2007-02-07T14:26:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599568", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: 7tm_1", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); E178V mutation is generated from the codon change GAA/GTA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "KLF transcription factor 4; mutation 1, Medical College of Wisconsin", "display_text" : "KLF transcription factor 4; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Klf4[m1Mcwi]", "display_text" : "Klf4m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Klf4m1Mcwi", "display_text" : "Klf4m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599569", "page_area" : "allele", "display_name" : "RGD:1599569" } }, "date_created" : "2007-02-07T14:26:49.000-06:00", "date_updated" : "2007-02-07T14:26:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599569", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); V243I mutation is generated from the codon change GTC/ATC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lecithin cholesterol acyltransferase; mutation 2, Medical College of Wisconsin", "display_text" : "lecithin cholesterol acyltransferase; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lcat[m2Mcwi]", "display_text" : "Lcatm2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lcatm2Mcwi", "display_text" : "Lcatm2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1599570", "page_area" : "allele", "display_name" : "RGD:1599570" } }, "date_created" : "2007-02-07T14:26:49.000-06:00", "date_updated" : "2007-02-07T14:26:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:1599570", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: LACT", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); D359E mutation is generated from the codon change GAC/GAG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Rab38, member of RAS oncogene family, ruby allele", "display_text" : "Rab38, member of RAS oncogene family, ruby allele", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rab38[ru]", "display_text" : "Rab38ru", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "R_mapped", "display_text" : "R_mapped", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "R", "display_text" : "R", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "red eyed dilution", "display_text" : "red eyed dilution", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Ruby", "display_text" : "Ruby", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Ruby or red eyed dilution", "display_text" : "Ruby or red eyed dilution", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "ruby or red eyed dilution (mapped)", "display_text" : "ruby or red eyed dilution (mapped)", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "IMAGE:7099841", "display_text" : "IMAGE:7099841", "name_type_name" : "unspecified" }, { "internal" : false, "format_text" : "MGC:91458", "display_text" : "MGC:91458", "name_type_name" : "unspecified" }, { "internal" : false, "format_text" : "Rab38ru", "display_text" : "Rab38ru", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1600311", "page_area" : "allele", "display_name" : "RGD:1600311" } }, "date_created" : "2007-03-07T09:46:46.000-06:00", "date_updated" : "2007-03-07T09:46:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:1600311", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:1300411", "PMID:15112108" ], "free_text" : "exon1 - mutation in translation initiation codon ATG > ATA, Met:Ile", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "The Met1Ile mutation in the Rab38 gene abolishes the translation of the gene resulting in a hypopigmentation phenotype", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:15112108", "PMID:18983523", "PMID:19897744", "PMID:28438206", "PMID:9250486", "RGD:1300411", "RGD:1302447", "RGD:13524861", "RGD:2324690", "RGD:2324691" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2a receptor; mutation 3, Medical College of Wisconsin", "display_text" : "adenosine A2a receptor; mutation 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2a[m3Mcwi]", "display_text" : "Adora2am3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2am3Mcwi", "display_text" : "Adora2am3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642070", "page_area" : "allele", "display_name" : "RGD:1642070" } }, "date_created" : "2007-08-31T11:06:18.000-05:00", "date_updated" : "2007-08-31T11:06:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642070", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: 7tm_1", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); E207K mutation is generated from the codon change GAG/AAG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "serpin family A member 5; mutation 1, Medical College of Wisconsin", "display_text" : "serpin family A member 5; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Serpina5[m1Mcwi]", "display_text" : "Serpina5m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Serpina5m1Mcwi", "display_text" : "Serpina5m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642167", "page_area" : "allele", "display_name" : "RGD:1642167" } }, "date_created" : "2007-09-06T14:11:51.000-05:00", "date_updated" : "2007-09-06T14:11:51.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642167", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); H24R mutation is generated from the codon change CAT/CGT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "calcium voltage-gated channel subunit alpha1 G; mutation 1, Medical College of Wisconsin", "display_text" : "calcium voltage-gated channel subunit alpha1 G; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cacna1g[m1Mcwi]", "display_text" : "Cacna1gm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cacna1gm1Mcwi", "display_text" : "Cacna1gm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642168", "page_area" : "allele", "display_name" : "RGD:1642168" } }, "date_created" : "2007-09-06T14:11:52.000-05:00", "date_updated" : "2007-09-06T14:11:52.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642168", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); S490T mutation is generated from the codon change TCT/ACT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lipase E, hormone sensitive type; mutation 2, Medical College of Wisconsin", "display_text" : "lipase E, hormone sensitive type; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lipe[m2Mcwi]", "display_text" : "Lipem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lipem2Mcwi", "display_text" : "Lipem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642169", "page_area" : "allele", "display_name" : "RGD:1642169" } }, "date_created" : "2007-09-06T14:11:52.000-05:00", "date_updated" : "2007-09-06T14:11:52.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642169", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Q52L mutation is generated from the codon change CTG/CAG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 27 member 5; mutation 2, Medical College of Wisconsin", "display_text" : "solute carrier family 27 member 5; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc27a5[m2Mcwi]", "display_text" : "Slc27a5m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc27a5m2Mcwi", "display_text" : "Slc27a5m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642170", "page_area" : "allele", "display_name" : "RGD:1642170" } }, "date_created" : "2007-09-06T14:11:53.000-05:00", "date_updated" : "2007-09-06T14:11:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642170", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: CaiC", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); K160E mutation is generated from the codon change AAA/GAA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hyaluronan synthase 1; mutation 2, Medical College of Wisconsin", "display_text" : "hyaluronan synthase 1; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Has1[m2Mcwi]", "display_text" : "Has1m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Has1m2Mcwi", "display_text" : "Has1m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642171", "page_area" : "allele", "display_name" : "RGD:1642171" } }, "date_created" : "2007-09-06T14:11:54.000-05:00", "date_updated" : "2007-09-06T14:11:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642171", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); V155L mutation is generated from the codon change GTC/CTC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "oxytocin receptor; mutation 1, Medical College of Wisconsin", "display_text" : "oxytocin receptor; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Oxtr[m1Mcwi]", "display_text" : "Oxtrm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Oxtrm1Mcwi", "display_text" : "Oxtrm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642173", "page_area" : "allele", "display_name" : "RGD:1642173" } }, "date_created" : "2007-09-06T14:11:57.000-05:00", "date_updated" : "2007-09-06T14:11:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642173", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: 7tm_1", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); F225Y mutation is generated from the codon change TTC/TAC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "carnitine palmitoyltransferase 2; mutation 1, Medical College of Wisconsin", "display_text" : "carnitine palmitoyltransferase 2; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cpt2[m1Mcwi]", "display_text" : "Cpt2m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cpt2m1Mcwi", "display_text" : "Cpt2m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642174", "page_area" : "allele", "display_name" : "RGD:1642174" } }, "date_created" : "2007-09-06T14:11:58.000-05:00", "date_updated" : "2007-09-06T14:11:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642174", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); F475L mutation is generated from the codon change TTC/CTC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lecithin cholesterol acyltransferase; mutation 3, Medical College of Wisconsin", "display_text" : "lecithin cholesterol acyltransferase; mutation 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lcat[m3Mcwi]", "display_text" : "Lcatm3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lcatm3Mcwi", "display_text" : "Lcatm3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642175", "page_area" : "allele", "display_name" : "RGD:1642175" } }, "date_created" : "2007-09-06T14:11:58.000-05:00", "date_updated" : "2007-09-06T14:11:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642175", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: LACT", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); H316N mutation is generated from the codon change CAC/AAC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "podocalyxin-like; mutation 1, Medical College of Wisconsin", "display_text" : "podocalyxin-like; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Podxl[m1Mcwi]", "display_text" : "Podxlm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Podxlm1Mcwi", "display_text" : "Podxlm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642176", "page_area" : "allele", "display_name" : "RGD:1642176" } }, "date_created" : "2007-09-06T14:11:59.000-05:00", "date_updated" : "2007-09-06T14:11:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642176", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); T154A mutation is generated from the codon change ACA/GCA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel subfamily A member 5; mutation 1, Medical College of Wisconsin", "display_text" : "potassium voltage-gated channel subfamily A member 5; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcna5[m1Mcwi]", "display_text" : "Kcna5m1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcna5m1Mcwi", "display_text" : "Kcna5m1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642177", "page_area" : "allele", "display_name" : "RGD:1642177" } }, "date_created" : "2007-09-06T14:11:59.000-05:00", "date_updated" : "2007-09-06T14:11:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642177", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: K_tetra", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); N152K mutation is generated from the codon change AAT/AAA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "baculoviral IAP repeat-containing 3; mutation 2, Medical College of Wisconsin", "display_text" : "baculoviral IAP repeat-containing 3; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Birc3[m2Mcwi]", "display_text" : "Birc3m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Birc3m2Mcwi", "display_text" : "Birc3m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642178", "page_area" : "allele", "display_name" : "RGD:1642178" } }, "date_created" : "2007-09-06T14:12:00.000-05:00", "date_updated" : "2007-09-06T14:12:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642178", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: BIR", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); K170E mutation is generated from the codon change AAG/GAG", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "KLF transcription factor 4; mutation 3, Medical College of Wisconsin", "display_text" : "KLF transcription factor 4; mutation 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Klf4[m3Mcwi]", "display_text" : "Klf4m3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Klf4m3Mcwi", "display_text" : "Klf4m3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642179", "page_area" : "allele", "display_name" : "RGD:1642179" } }, "date_created" : "2007-09-06T14:12:00.000-05:00", "date_updated" : "2007-09-06T14:12:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642179", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); H344L mutation is generated from the codon change CAT/CTT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "growth hormone secretagogue receptor; mutation 2, Medical College of Wisconsin", "display_text" : "growth hormone secretagogue receptor; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ghsr[m2Mcwi]", "display_text" : "Ghsrm2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ghsrm2Mcwi", "display_text" : "Ghsrm2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642180", "page_area" : "allele", "display_name" : "RGD:1642180" } }, "date_created" : "2007-09-06T14:12:01.000-05:00", "date_updated" : "2007-09-06T14:12:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642180", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); S342P mutation is generated from the codon change TCC/CCC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fibrinogen-like 2; mutation 2, Medical College of Wisconsin", "display_text" : "fibrinogen-like 2; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fgl2[m2Mcwi]", "display_text" : "Fgl2m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fgl2m2Mcwi", "display_text" : "Fgl2m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642181", "page_area" : "allele", "display_name" : "RGD:1642181" } }, "date_created" : "2007-09-06T14:12:01.000-05:00", "date_updated" : "2007-09-06T14:12:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642181", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: Tektin", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); K129N mutation is generated from the codon change AAG/AAT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "thrombomodulin; mutation 1, Medical College of Wisconsin", "display_text" : "thrombomodulin; mutation 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Thbd[m1Mcwi]", "display_text" : "Thbdm1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Thbdm1Mcwi", "display_text" : "Thbdm1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642182", "page_area" : "allele", "display_name" : "RGD:1642182" } }, "date_created" : "2007-09-06T14:12:02.000-05:00", "date_updated" : "2007-09-06T14:12:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642182", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); N256K mutation is generated from the codon change AAC/AAA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fibrinogen-like 2; mutation 4, Medical College of Wisconsin", "display_text" : "fibrinogen-like 2; mutation 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fgl2[m4Mcwi]", "display_text" : "Fgl2m4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fgl2m4Mcwi", "display_text" : "Fgl2m4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642354", "page_area" : "allele", "display_name" : "RGD:1642354" } }, "date_created" : "2007-09-13T13:28:07.000-05:00", "date_updated" : "2007-09-13T13:28:07.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642354", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: FReD", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); H338P mutation is generated from the codon change CAT/CCT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fibrinogen-like 2; mutation 3, Medical College of Wisconsin", "display_text" : "fibrinogen-like 2; mutation 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fgl2[m3Mcwi]", "display_text" : "Fgl2m3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fgl2m3Mcwi", "display_text" : "Fgl2m3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642355", "page_area" : "allele", "display_name" : "RGD:1642355" } }, "date_created" : "2007-09-13T13:28:09.000-05:00", "date_updated" : "2007-09-13T13:28:09.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642355", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: FReD", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "Mutation generated by ENU (N-ethyl-N-nitrourea); N353H mutation is generated from the codon change AAT/CAT.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "C-C motif chemokine receptor 2; mutation 2, Medical College of Wisconsin", "display_text" : "C-C motif chemokine receptor 2; mutation 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ccr2[m2Mcwi]", "display_text" : "Ccr2m2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ccr2m2Mcwi", "display_text" : "Ccr2m2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642356", "page_area" : "allele", "display_name" : "RGD:1642356" } }, "date_created" : "2007-09-13T13:28:10.000-05:00", "date_updated" : "2007-09-13T13:28:10.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642356", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: 7tm_1", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "Mutation generated by ENU (N-ethyl-N-nitrourea); I99T mutation is generated from the codon change ATC/ACC.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "growth hormone secretagogue receptor; mutation 3, Medical College of Wisconsin", "display_text" : "growth hormone secretagogue receptor; mutation 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ghsr[m3Mcwi]", "display_text" : "Ghsrm3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ghsrm3Mcwi", "display_text" : "Ghsrm3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642357", "page_area" : "allele", "display_name" : "RGD:1642357" } }, "date_created" : "2007-09-13T13:28:12.000-05:00", "date_updated" : "2007-09-13T13:28:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642357", "note_dtos" : [ { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); N26K mutation is generated from the codon change AAC/AAA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lecithin cholesterol acyltransferase; mutation 4, Medical College of Wisconsin", "display_text" : "lecithin cholesterol acyltransferase; mutation 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lcat[m4Mcwi]", "display_text" : "Lcatm4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lcatm4Mcwi", "display_text" : "Lcatm4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642358", "page_area" : "allele", "display_name" : "RGD:1642358" } }, "date_created" : "2007-09-13T13:28:12.000-05:00", "date_updated" : "2007-09-13T13:28:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642358", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: LACT", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Y336N mutation is generated from the codon change TAT/AAT", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hyaluronan synthase 1; mutation 4, Medical College of Wisconsin", "display_text" : "hyaluronan synthase 1; mutation 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Has1[m3Mcwi]", "display_text" : "Has1m3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Has1m3Mcwi", "display_text" : "Has1m3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642359", "page_area" : "allele", "display_name" : "RGD:1642359" } }, "date_created" : "2007-09-13T13:28:13.000-05:00", "date_updated" : "2007-09-13T13:28:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642359", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: COG1215", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); D167D mutation is generated from the codon change GAT/GAC", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lecithin cholesterol acyltransferase; mutation 5, Medical College of Wisconsin", "display_text" : "lecithin cholesterol acyltransferase; mutation 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lcat[m5Mcwi]", "display_text" : "Lcatm5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lcatm5Mcwi", "display_text" : "Lcatm5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:1642438", "page_area" : "allele", "display_name" : "RGD:1642438" } }, "date_created" : "2007-09-17T13:29:29.000-05:00", "date_updated" : "2007-09-17T13:29:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:1642438", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:629526" ], "free_text" : "affected domain: LACT", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "mutation generated by ENU (N-ethyl-N-nitrourea); Y297Stop mutation is generated from the codon change TAC/TAA", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 2, Mcwi", "display_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2020-01-14T12:28:24.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Vwf[em2Mcwi]", "display_text" : "Vwfem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:18182945", "page_area" : "allele", "display_name" : "RGD:18182945" } }, "date_created" : "2020-01-14T12:14:10.000-06:00", "date_updated" : "2020-01-14T12:14:10.000-06:00", "internal" : false, "primary_external_id" : "RGD:18182945", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 3, Mcwi", "display_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Vwf[em3Mcwi]", "display_text" : "Vwfem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:18182947", "page_area" : "allele", "display_name" : "RGD:18182947" } }, "date_created" : "2020-01-14T12:30:38.000-06:00", "date_updated" : "2020-01-14T12:30:38.000-06:00", "internal" : false, "primary_external_id" : "RGD:18182947", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "complement C3; CRISPR/Cas9 system induced mutant 1, Linf", "display_text" : "complement C3; CRISPR/Cas9 system induced mutant 1, Linf", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "C3[em1Linf]", "display_text" : "C3em1Linf", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:19165134", "page_area" : "allele", "display_name" : "RGD:19165134" } }, "date_created" : "2020-01-31T14:51:20.000-06:00", "date_updated" : "2020-01-31T14:51:20.000-06:00", "internal" : false, "primary_external_id" : "RGD:19165134", "note_dtos" : [ { "internal" : false, "free_text" : "This knock out mutation was induced by injecting two single-guide RNA (sgRNA) targets and protospacer adjacent motifs (PAM) in rat C3 exon 2, to rat zygotes. The result mutation was an insertion of a premature stop codon and no protein was produced in the mutants.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29695418", "RGD:19165124" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "keratinocyte associated protein 3; CRISPR/Cas9 induced mutant 3, Mcwi", "display_text" : "keratinocyte associated protein 3; CRISPR/Cas9 induced mutant 3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Krtcap3[em3Mcwi]", "display_text" : "Krtcap3em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:19165363", "page_area" : "allele", "display_name" : "RGD:19165363" } }, "date_created" : "2020-02-05T13:48:30.000-06:00", "date_updated" : "2024-05-29T10:06:33.000-05:00", "internal" : false, "primary_external_id" : "RGD:19165363", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/Ncrlrat embryos. The resulting mutation is a net 2-bp deletion in the exon 2 of the targeted gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenylate cyclase 3; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "adenylate cyclase 3; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adcy3[em2Mcwi]", "display_text" : "Adcy3em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:19165365", "page_area" : "allele", "display_name" : "RGD:19165365" } }, "date_created" : "2020-02-05T14:03:05.000-06:00", "date_updated" : "2025-06-06T16:01:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:19165365", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Adcy3 gene of WKY/Ncrl rat embryos. The resulting mutation is a 3-bp deletion in the exon 2 of the targeted gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "calcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, Tja", "display_text" : "calcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, Tja", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Camk2n1[em1Tja]", "display_text" : "Camk2n1em1Tja", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:19259465", "page_area" : "allele", "display_name" : "RGD:19259465" } }, "date_created" : "2020-02-06T17:23:45.000-06:00", "date_updated" : "2020-02-06T17:23:45.000-06:00", "internal" : false, "primary_external_id" : "RGD:19259465", "note_dtos" : [ { "internal" : false, "free_text" : "This 38-bp deletion mutant allele was generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31327268", "RGD:18899561" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor; CRISPR/Cas9 induced mutant 4, Lizh", "display_text" : "leptin receptor; CRISPR/Cas9 induced mutant 4, Lizh", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[em4Lizh]", "display_text" : "Leprem4Lizh", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:21079476", "page_area" : "allele", "display_name" : "RGD:21079476" } }, "date_created" : "2020-02-18T16:30:32.000-06:00", "date_updated" : "2020-02-18T16:30:32.000-06:00", "internal" : false, "primary_external_id" : "RGD:21079476", "note_dtos" : [ { "internal" : false, "free_text" : "The Lepr knockout mutation were generated by CRISPR/Cas9. The resulting mutaion is a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26537785", "RGD:12911216" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RNA binding motif and ELMO domain 1; transposon insertion 1.42, Medical College of Wisconsin", "display_text" : "RNA binding motif and ELMO domain 1; transposon insertion 1.42, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Elmod3[Tn(sb-T2/Bart3)2.42Mcwi]", "display_text" : "Elmod3Tn(sb-T2/Bart3)2.42Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rbed1[Tn(sb-T2/Bart3)1.42Mcwi]", "display_text" : "Rbed1Tn(sb-T2/Bart3)1.42Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Elmod3Tn(sb-T2/Bart3)2.42Mcwi", "display_text" : "Elmod3Tn(sb-T2/Bart3)2.42Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290055", "page_area" : "allele", "display_name" : "RGD:2290055" } }, "date_created" : "2008-02-26T13:47:38.000-06:00", "date_updated" : "2008-02-26T13:47:38.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290055", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST CA338503; transposon insertion 2.196, Medical College of Wisconsin", "display_text" : "EST CA338503; transposon insertion 2.196, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "CA338503[Tn(sb-T2/Bart3)2.196Mcwi]", "display_text" : "CA338503Tn(sb-T2/Bart3)2.196Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CA338503Tn(sb-T2/Bart3)2.196Mcwi", "display_text" : "CA338503Tn(sb-T2/Bart3)2.196Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290059", "page_area" : "allele", "display_name" : "RGD:2290059" } }, "date_created" : "2008-02-26T13:55:52.000-06:00", "date_updated" : "2008-02-26T13:55:52.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290059", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CA338503", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily C, member 4; transposon insertion 2.192, Medical College of Wisconsin", "display_text" : "transient receptor potential cation channel, subfamily C, member 4; transposon insertion 2.192, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpc4[Tn(sb-T2/Bart3)2.192Mcwi]", "display_text" : "Trpc4Tn(sb-T2/Bart3)2.192Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trpc4Tn(sb-T2/Bart3)2.192Mcwi", "display_text" : "Trpc4Tn(sb-T2/Bart3)2.192Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290060", "page_area" : "allele", "display_name" : "RGD:2290060" } }, "date_created" : "2008-02-26T13:55:52.000-06:00", "date_updated" : "2008-02-26T13:55:52.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290060", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "PMID:24388923", "RGD:13825245", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NEL-like 1 (chicken); transposon insertion 2.195, Medical College of Wisconsin", "display_text" : "NEL-like 1 (chicken); transposon insertion 2.195, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nell1[Tn(sb-T2/Bart3)2.195Mcwi]", "display_text" : "Nell1Tn(sb-T2/Bart3)2.195Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nell1Tn(sb-T2/Bart3)2.195Mcwi", "display_text" : "Nell1Tn(sb-T2/Bart3)2.195Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290061", "page_area" : "allele", "display_name" : "RGD:2290061" } }, "date_created" : "2008-02-26T13:55:53.000-06:00", "date_updated" : "2008-02-26T13:55:53.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290061", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Nell1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BI285226; transposon insertion 2.193, Medical College of Wisconsin", "display_text" : "EST BI285226; transposon insertion 2.193, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BI285226[Tn(sb-T2/Bart3)2.193Mcwi]", "display_text" : "BI285226Tn(sb-T2/Bart3)2.193Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BI285226Tn(sb-T2/Bart3)2.193Mcwi", "display_text" : "BI285226Tn(sb-T2/Bart3)2.193Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290062", "page_area" : "allele", "display_name" : "RGD:2290062" } }, "date_created" : "2008-02-26T13:55:54.000-06:00", "date_updated" : "2008-02-26T13:55:54.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290062", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI285226", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin IXA; transposon insertion 2.186, Medical College of Wisconsin", "display_text" : "myosin IXA; transposon insertion 2.186, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Myo9a[Tn(sb-T2/Bart3)2.186Mcwi]", "display_text" : "Myo9aTn(sb-T2/Bart3)2.186Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Myo9aTn(sb-T2/Bart3)2.186Mcwi", "display_text" : "Myo9aTn(sb-T2/Bart3)2.186Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290068", "page_area" : "allele", "display_name" : "RGD:2290068" } }, "date_created" : "2008-02-26T14:14:26.000-06:00", "date_updated" : "2008-02-26T14:14:26.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290068", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BI285226; transposon insertion 2.194, Medical College of Wisconsin", "display_text" : "EST BI285226; transposon insertion 2.194, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BI285226[Tn(sb-T2/Bart3)2.194Mcwi]", "display_text" : "BI285226Tn(sb-T2/Bart3)2.194Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BI285226Tn(sb-T2/Bart3)2.194Mcwi", "display_text" : "BI285226Tn(sb-T2/Bart3)2.194Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290069", "page_area" : "allele", "display_name" : "RGD:2290069" } }, "date_created" : "2008-02-26T14:14:27.000-06:00", "date_updated" : "2008-02-26T14:14:27.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290069", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI285226", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BQ195794; transposon insertion 2.182, Medical College of Wisconsin", "display_text" : "EST BQ195794; transposon insertion 2.182, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BQ195794[Tn(sb-T2/Bart3)2.182Mcwi]", "display_text" : "BQ195794Tn(sb-T2/Bart3)2.182Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BQ195794Tn(sb-T2/Bart3)2.182Mcwi", "display_text" : "BQ195794Tn(sb-T2/Bart3)2.182Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290070", "page_area" : "allele", "display_name" : "RGD:2290070" } }, "date_created" : "2008-02-26T14:14:29.000-06:00", "date_updated" : "2008-02-26T14:14:29.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290070", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BQ195794", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BMP/retinoic acid-inducible neural-specific protein 3; transposon insertion 2.189, Medical College of Wisconsin", "display_text" : "BMP/retinoic acid-inducible neural-specific protein 3; transposon insertion 2.189, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-08-03T11:38:56.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Brinp3[Tn(sb-T2/Bart3)2.189Mcwi]", "display_text" : "Brinp3Tn(sb-T2/Bart3)2.189Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fam5c[Tn(sb-T2/Bart3)2.189Mcwi]", "display_text" : "Fam5cTn(sb-T2/Bart3)2.189Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Brinp3Tn(sb-T2/Bart3)2.189Mcwi", "display_text" : "Brinp3Tn(sb-T2/Bart3)2.189Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290071", "page_area" : "allele", "display_name" : "RGD:2290071" } }, "date_created" : "2008-02-26T14:14:30.000-06:00", "date_updated" : "2008-02-26T14:14:30.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290071", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BI284934; transposon insertion 2.185, Medical College of Wisconsin", "display_text" : "EST BI284934; transposon insertion 2.185, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BI284934[Tn(sb-T2/Bart3)2.185Mcwi]", "display_text" : "BI284934Tn(sb-T2/Bart3)2.185Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BI284934Tn(sb-T2/Bart3)2.185Mcwi", "display_text" : "BI284934Tn(sb-T2/Bart3)2.185Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290072", "page_area" : "allele", "display_name" : "RGD:2290072" } }, "date_created" : "2008-02-26T14:14:31.000-06:00", "date_updated" : "2008-02-26T14:14:31.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290072", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI284934", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.188, Medical College of Wisconsin", "display_text" : "solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.188, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc24a3[Tn(sb-T2/Bart3)2.188Mcwi]", "display_text" : "Slc24a3Tn(sb-T2/Bart3)2.188Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc24a3Tn(sb-T2/Bart3)2.188Mcwi", "display_text" : "Slc24a3Tn(sb-T2/Bart3)2.188Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290073", "page_area" : "allele", "display_name" : "RGD:2290073" } }, "date_created" : "2008-02-26T14:14:32.000-06:00", "date_updated" : "2008-02-26T14:14:32.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290073", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BI284938; transposon insertion 2.187, Medical College of Wisconsin", "display_text" : "EST BI284938; transposon insertion 2.187, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BI284938[Tn(sb-T2/Bart3)2.187Mcwi]", "display_text" : "BI284938Tn(sb-T2/Bart3)2.187Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BI284938Tn(sb-T2/Bart3)2.187Mcwi", "display_text" : "BI284938Tn(sb-T2/Bart3)2.187Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290074", "page_area" : "allele", "display_name" : "RGD:2290074" } }, "date_created" : "2008-02-26T14:14:33.000-06:00", "date_updated" : "2008-02-26T14:14:33.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290074", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI284938", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "kelch-like 13 (Drosophila); transposon insertion 2.176, Medical College of Wisconsin", "display_text" : "kelch-like 13 (Drosophila); transposon insertion 2.176, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Klhl13[Tn(sb-T2/Bart3)2.176Mcwi]", "display_text" : "Klhl13Tn(sb-T2/Bart3)2.176Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Klhl13Tn(sb-T2/Bart3)2.176Mcwi", "display_text" : "Klhl13Tn(sb-T2/Bart3)2.176Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290085", "page_area" : "allele", "display_name" : "RGD:2290085" } }, "date_created" : "2008-02-26T14:47:43.000-06:00", "date_updated" : "2008-02-26T14:47:43.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290085", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ectonucleoside triphosphate diphosphohydrolase 6; transposon insertion 2.174, Medical College of Wisconsin", "display_text" : "ectonucleoside triphosphate diphosphohydrolase 6; transposon insertion 2.174, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Entpd6[Tn(sb-T2/Bart3)2.174Mcwi]", "display_text" : "Entpd6Tn(sb-T2/Bart3)2.174Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Entpd6Tn(sb-T2/Bart3)2.174Mcwi", "display_text" : "Entpd6Tn(sb-T2/Bart3)2.174Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290086", "page_area" : "allele", "display_name" : "RGD:2290086" } }, "date_created" : "2008-02-26T14:47:44.000-06:00", "date_updated" : "2008-02-26T14:47:44.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290086", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST CA338503; transposon insertion 2.168, Medical College of Wisconsin", "display_text" : "EST CA338503; transposon insertion 2.168, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "CA338503[Tn(sb-T2/Bart3)2.168Mcwi]", "display_text" : "CA338503Tn(sb-T2/Bart3)2.168Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CA338503Tn(sb-T2/Bart3)2.168Mcwi", "display_text" : "CA338503Tn(sb-T2/Bart3)2.168Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290087", "page_area" : "allele", "display_name" : "RGD:2290087" } }, "date_created" : "2008-02-26T14:47:46.000-06:00", "date_updated" : "2008-02-26T14:47:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290087", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CA338503", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "immunoglobulin superfamily, member 4 ; transposon insertion 2.180, Medical College of Wisconsin", "display_text" : "immunoglobulin superfamily, member 4 ; transposon insertion 2.180, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:2292626" ], "date_created" : "2008-04-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cadm2[Tn(sb-T2/Bart3)2.180Mcwi]", "display_text" : "Cadm2Tn(sb-T2/Bart3)2.180Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Igsf4d[Tn(sb-T2/Bart3)2.180Mcwi]", "display_text" : "Igsf4dTn(sb-T2/Bart3)2.180Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Cadm2Tn(sb-T2/Bart3)2.180Mcwi", "display_text" : "Cadm2Tn(sb-T2/Bart3)2.180Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290088", "page_area" : "allele", "display_name" : "RGD:2290088" } }, "date_created" : "2008-02-26T14:47:47.000-06:00", "date_updated" : "2008-02-26T14:47:47.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290088", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to RIKEN cDNA A430107P09 gene; transposon insertion 2.170, Medical College of Wisconsin", "display_text" : "similar to RIKEN cDNA A430107P09 gene; transposon insertion 2.170, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "LOC290071[Tn(sb-T2/Bart3)2.170Mcwi]", "display_text" : "LOC290071Tn(sb-T2/Bart3)2.170Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LOC290071Tn(sb-T2/Bart3)2.170Mcwi", "display_text" : "LOC290071Tn(sb-T2/Bart3)2.170Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290089", "page_area" : "allele", "display_name" : "RGD:2290089" } }, "date_created" : "2008-02-26T14:47:50.000-06:00", "date_updated" : "2008-02-26T14:47:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290089", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neuregulin 1; transposon insertion 2.183, Medical College of Wisconsin", "display_text" : "neuregulin 1; transposon insertion 2.183, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nrg1[Tn(sb-T2/Bart3)2.183Mcwi]", "display_text" : "Nrg1Tn(sb-T2/Bart3)2.183Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nrg1Tn(sb-T2/Bart3)2.183Mcwi", "display_text" : "Nrg1Tn(sb-T2/Bart3)2.183Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290090", "page_area" : "allele", "display_name" : "RGD:2290090" } }, "date_created" : "2008-02-26T14:47:52.000-06:00", "date_updated" : "2008-02-26T14:47:52.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290090", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "PMID:21092742", "PMID:21620900", "PMID:23022220", "RGD:10449008", "RGD:2290040", "RGD:39128254", "RGD:405650204", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.178, Medical College of Wisconsin", "display_text" : "solute carrier family 24 (sodium/potassium/calcium exchanger), member 3; transposon insertion 2.178, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc24a3[Tn(sb-T2/Bart3)2.178Mcwi]", "display_text" : "Slc24a3Tn(sb-T2/Bart3)2.178Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc24a3Tn(sb-T2/Bart3)2.178Mcwi", "display_text" : "Slc24a3Tn(sb-T2/Bart3)2.178Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290091", "page_area" : "allele", "display_name" : "RGD:2290091" } }, "date_created" : "2008-02-26T14:47:53.000-06:00", "date_updated" : "2008-02-26T14:47:53.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290091", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST CB706876; transposon insertion 2.181, Medical College of Wisconsin", "display_text" : "EST CB706876; transposon insertion 2.181, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "CB706876[Tn(sb-T2/Bart3)2.181Mcwi]", "display_text" : "CB706876Tn(sb-T2/Bart3)2.181Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CB706876Tn(sb-T2/Bart3)2.181Mcwi", "display_text" : "CB706876Tn(sb-T2/Bart3)2.181Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290092", "page_area" : "allele", "display_name" : "RGD:2290092" } }, "date_created" : "2008-02-26T14:47:55.000-06:00", "date_updated" : "2008-02-26T14:47:55.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290092", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CB706876", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystatin C; transposon insertion 2.172, Medical College of Wisconsin", "display_text" : "cystatin C; transposon insertion 2.172, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cst3[Tn(sb-T2/Bart3)2.172Mcwi]", "display_text" : "Cst3Tn(sb-T2/Bart3)2.172Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cst3Tn(sb-T2/Bart3)2.172Mcwi", "display_text" : "Cst3Tn(sb-T2/Bart3)2.172Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290093", "page_area" : "allele", "display_name" : "RGD:2290093" } }, "date_created" : "2008-02-26T14:47:56.000-06:00", "date_updated" : "2008-02-26T14:47:56.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290093", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST CA338503; transposon insertion 2.175, Medical College of Wisconsin", "display_text" : "EST CA338503; transposon insertion 2.175, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "CA338503[Tn(sb-T2/Bart3)2.175Mcwi]", "display_text" : "CA338503Tn(sb-T2/Bart3)2.175Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CA338503Tn(sb-T2/Bart3)2.175Mcwi", "display_text" : "CA338503Tn(sb-T2/Bart3)2.175Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290094", "page_area" : "allele", "display_name" : "RGD:2290094" } }, "date_created" : "2008-02-26T14:47:57.000-06:00", "date_updated" : "2008-02-26T14:47:57.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290094", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST CA338503", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystatin S; transposon insertion 2.173, Medical College of Wisconsin", "display_text" : "cystatin S; transposon insertion 2.173, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyss[Tn(sb-T2/Bart3)2.173Mcwi]", "display_text" : "CyssTn(sb-T2/Bart3)2.173Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "CyssTn(sb-T2/Bart3)2.173Mcwi", "display_text" : "CyssTn(sb-T2/Bart3)2.173Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290095", "page_area" : "allele", "display_name" : "RGD:2290095" } }, "date_created" : "2008-02-26T14:47:59.000-06:00", "date_updated" : "2008-02-26T14:47:59.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290095", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "LIM zinc finger domain containing 1; transposon insertion 2.169, Medical College of Wisconsin", "display_text" : "LIM zinc finger domain containing 1; transposon insertion 2.169, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-05-05T13:02:28.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:2292626" ], "date_created" : "2008-04-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Lims1[Tn(sb-T2/Bart3)2.169Mcwi]", "display_text" : "Lims1Tn(sb-T2/Bart3)2.169Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "transposon insertion 2.169, Medical College of Wisconsin", "display_text" : "transposon insertion 2.169, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "RGD1560732[Tn(sb-T2/Bart3)2.169Mcwi]", "display_text" : "RGD1560732Tn(sb-T2/Bart3)2.169Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "similar to LIM and senescent cell antigen-like domains 1", "display_text" : "similar to LIM and senescent cell antigen-like domains 1", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Lims1Tn(sb-T2/Bart3)2.169Mcwi", "display_text" : "Lims1Tn(sb-T2/Bart3)2.169Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "similar to LIM and senescent cell antigen-like domains 1 ; transposon insertion 2.169, Medical College of Wisconsin", "display_text" : "similar to LIM and senescent cell antigen-like domains 1 ; transposon insertion 2.169, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290096", "page_area" : "allele", "display_name" : "RGD:2290096" } }, "date_created" : "2008-02-26T14:48:00.000-06:00", "date_updated" : "2008-02-26T14:48:00.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290096", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spectrin beta 4; transposon insertion 2.179, Medical College of Wisconsin", "display_text" : "spectrin beta 4; transposon insertion 2.179, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Sptbn4[Tn(sb-T2/Bart3)2.179Mcwi]", "display_text" : "Sptbn4Tn(sb-T2/Bart3)2.179Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Spnb4[Tn(sb-T2/Bart3)2.179Mcwi]", "display_text" : "Spnb4Tn(sb-T2/Bart3)2.179Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Sptbn4Tn(sb-T2/Bart3)2.179Mcwi", "display_text" : "Sptbn4Tn(sb-T2/Bart3)2.179Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290097", "page_area" : "allele", "display_name" : "RGD:2290097" } }, "date_created" : "2008-02-26T14:48:01.000-06:00", "date_updated" : "2008-02-26T14:48:01.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290097", "note_dtos" : [ { "internal" : false, "free_text" : "These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to TAFA2 protein; transposon insertion 2.184, Medical College of Wisconsin", "display_text" : "similar to TAFA2 protein; transposon insertion 2.184, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fam19a2[Tn(sb-T2/Bart3)2.184Mcwi]", "display_text" : "Fam19a2Tn(sb-T2/Bart3)2.184Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LOC680647[Tn(sb-T2/Bart3)2.184Mcwi]", "display_text" : "LOC680647Tn(sb-T2/Bart3)2.184Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Fam19a2Tn(sb-T2/Bart3)2.184Mcwi", "display_text" : "Fam19a2Tn(sb-T2/Bart3)2.184Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290098", "page_area" : "allele", "display_name" : "RGD:2290098" } }, "date_created" : "2008-02-26T14:48:02.000-06:00", "date_updated" : "2008-02-26T14:48:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290098", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BI285110; transposon insertion 2.167, Medical College of Wisconsin", "display_text" : "EST BI285110; transposon insertion 2.167, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BI285110[Tn(sb-T2/Bart3)2.167Mcwi]", "display_text" : "BI285110Tn(sb-T2/Bart3)2.167Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BI285110Tn(sb-T2/Bart3)2.167Mcwi", "display_text" : "BI285110Tn(sb-T2/Bart3)2.167Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290115", "page_area" : "allele", "display_name" : "RGD:2290115" } }, "date_created" : "2008-02-26T15:16:11.000-06:00", "date_updated" : "2008-02-26T15:16:11.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290115", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI285110", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to N-ethylmaleimide sensitive fusion protein attachment protein beta; transposon insertion 2.162, Medical College of Wisconsin", "display_text" : "similar to N-ethylmaleimide sensitive fusion protein attachment protein beta; transposon insertion 2.162, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Napb[Tn(sb-T2/Bart3)2.162Mcwi]", "display_text" : "NapbTn(sb-T2/Bart3)2.162Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LOC499903[Tn(sb-T2/Bart3)2.162Mcwi]", "display_text" : "LOC499903Tn(sb-T2/Bart3)2.162Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "NapbTn(sb-T2/Bart3)2.162Mcwi", "display_text" : "NapbTn(sb-T2/Bart3)2.162Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290116", "page_area" : "allele", "display_name" : "RGD:2290116" } }, "date_created" : "2008-02-26T15:16:12.000-06:00", "date_updated" : "2008-02-26T15:16:12.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290116", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "mitogen activated protein kinase kinase 5; transposon insertion 2.150, Medical College of Wisconsin", "display_text" : "mitogen activated protein kinase kinase 5; transposon insertion 2.150, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Map2k5[Tn(sb-T2/Bart3)2.150Mcwi]", "display_text" : "Map2k5Tn(sb-T2/Bart3)2.150Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Map2k5Tn(sb-T2/Bart3)2.150Mcwi", "display_text" : "Map2k5Tn(sb-T2/Bart3)2.150Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290117", "page_area" : "allele", "display_name" : "RGD:2290117" } }, "date_created" : "2008-02-26T15:16:14.000-06:00", "date_updated" : "2008-02-26T15:16:14.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290117", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002); transposon insertion 2.161, Medical College of Wisconsin", "display_text" : "similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002); transposon insertion 2.161, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "LOC681893[Tn(sb-T2/Bart3)2.161Mcwi]", "display_text" : "LOC681893Tn(sb-T2/Bart3)2.161Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LOC681893Tn(sb-T2/Bart3)2.161Mcwi", "display_text" : "LOC681893Tn(sb-T2/Bart3)2.161Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290118", "page_area" : "allele", "display_name" : "RGD:2290118" } }, "date_created" : "2008-02-26T15:16:18.000-06:00", "date_updated" : "2008-02-26T15:16:18.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290118", "note_dtos" : [ { "internal" : false, "free_text" : "trap construct into the LOC681893 gene", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002); transposon insertion 2.159, Medical College of Wisconsin", "display_text" : "similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template-activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002); transposon insertion 2.159, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "LOC681893[Tn(sb-T2/Bart3)2.159Mcwi]", "display_text" : "LOC681893Tn(sb-T2/Bart3)2.159Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LOC681893Tn(sb-T2/Bart3)2.159Mcwi", "display_text" : "LOC681893Tn(sb-T2/Bart3)2.159Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290119", "page_area" : "allele", "display_name" : "RGD:2290119" } }, "date_created" : "2008-02-26T15:16:21.000-06:00", "date_updated" : "2008-02-26T15:16:21.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290119", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BI284938; transposon insertion 2.155, Medical College of Wisconsin", "display_text" : "EST BI284938; transposon insertion 2.155, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BI284938[Tn(sb-T2/Bart3)2.155Mcwi]", "display_text" : "BI284938Tn(sb-T2/Bart3)2.155Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BI284938Tn(sb-T2/Bart3)2.155Mcwi", "display_text" : "BI284938Tn(sb-T2/Bart3)2.155Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290120", "page_area" : "allele", "display_name" : "RGD:2290120" } }, "date_created" : "2008-02-26T15:16:24.000-06:00", "date_updated" : "2008-02-26T15:16:24.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290120", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BI284938", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "4-aminobutyrate aminotransferase; transposon insertion 2.163, Medical College of Wisconsin", "display_text" : "4-aminobutyrate aminotransferase; transposon insertion 2.163, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abat[Tn(sb-T2/Bart3)2.163Mcwi]", "display_text" : "AbatTn(sb-T2/Bart3)2.163Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "AbatTn(sb-T2/Bart3)2.163Mcwi", "display_text" : "AbatTn(sb-T2/Bart3)2.163Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290121", "page_area" : "allele", "display_name" : "RGD:2290121" } }, "date_created" : "2008-02-26T15:16:27.000-06:00", "date_updated" : "2008-02-26T15:16:27.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290121", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST AW527406; transposon insertion 2.156, Medical College of Wisconsin", "display_text" : "EST AW527406; transposon insertion 2.156, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "AW527406[Tn(sb-T2/Bart3)2.156Mcwi]", "display_text" : "AW527406Tn(sb-T2/Bart3)2.156Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "AW527406Tn(sb-T2/Bart3)2.156Mcwi", "display_text" : "AW527406Tn(sb-T2/Bart3)2.156Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290122", "page_area" : "allele", "display_name" : "RGD:2290122" } }, "date_created" : "2008-02-26T15:16:30.000-06:00", "date_updated" : "2008-02-26T15:16:30.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290122", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW527406", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "carbohydrate (chondroitin) synthase 1 ; transposon insertion 2.165, Medical College of Wisconsin", "display_text" : "carbohydrate (chondroitin) synthase 1 ; transposon insertion 2.165, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:2292626" ], "date_created" : "2008-04-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Chsy1[Tn(sb-T2/Bart3)2.165Mcwi]", "display_text" : "Chsy1Tn(sb-T2/Bart3)2.165Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Chsy1Tn(sb-T2/Bart3)2.165Mcwi", "display_text" : "Chsy1Tn(sb-T2/Bart3)2.165Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290123", "page_area" : "allele", "display_name" : "RGD:2290123" } }, "date_created" : "2008-02-26T15:16:34.000-06:00", "date_updated" : "2008-02-26T15:16:34.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290123", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to RIKEN cDNA C130053K05 gene; similar to dJ718P11.1.1 (novel class II aminotransferase similar to serine palmotyltransferase (isoform 1)) ; transposon insertion 2.147, Medical College of Wisconsin", "display_text" : "similar to RIKEN cDNA C130053K05 gene; similar to dJ718P11.1.1 (novel class II aminotransferase similar to serine palmotyltransferase (isoform 1)) ; transposon insertion 2.147, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:2292626" ], "date_created" : "2008-04-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Sptlc3[Tn(sb-T2/Bart3)2.147Mcwi]", "display_text" : "Sptlc3Tn(sb-T2/Bart3)2.147Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "RGD1310030[Tn(sb-T2/Bart3)2.147Mcwi]", "display_text" : "RGD1310030Tn(sb-T2/Bart3)2.147Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Sptlc3Tn(sb-T2/Bart3)2.147Mcwi", "display_text" : "Sptlc3Tn(sb-T2/Bart3)2.147Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290124", "page_area" : "allele", "display_name" : "RGD:2290124" } }, "date_created" : "2008-02-26T15:16:37.000-06:00", "date_updated" : "2008-02-26T15:16:37.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290124", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phospholipase C, epsilon 1; transposon insertion 2.146, Medical College of Wisconsin", "display_text" : "phospholipase C, epsilon 1; transposon insertion 2.146, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plce1[Tn(sb-T2/Bart3)2.146Mcwi]", "display_text" : "Plce1Tn(sb-T2/Bart3)2.146Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plce1Tn(sb-T2/Bart3)2.146Mcwi", "display_text" : "Plce1Tn(sb-T2/Bart3)2.146Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290125", "page_area" : "allele", "display_name" : "RGD:2290125" } }, "date_created" : "2008-02-26T15:16:40.000-06:00", "date_updated" : "2008-02-26T15:16:40.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290125", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BF522453; transposon insertion 2.166, Medical College of Wisconsin", "display_text" : "EST BF522453; transposon insertion 2.166, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BF522453[Tn(sb-T2/Bart3)2.166Mcwi]", "display_text" : "BF522453Tn(sb-T2/Bart3)2.166Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BF522453Tn(sb-T2/Bart3)2.166Mcwi", "display_text" : "BF522453Tn(sb-T2/Bart3)2.166Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290126", "page_area" : "allele", "display_name" : "RGD:2290126" } }, "date_created" : "2008-02-26T15:16:44.000-06:00", "date_updated" : "2008-02-26T15:16:44.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290126", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BF522453", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 ; transposon insertion 2.145, Medical College of Wisconsin", "display_text" : "solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 ; transposon insertion 2.145, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:2292626" ], "date_created" : "2008-04-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc24a4[Tn(sb-T2/Bart3)2.145Mcwi]", "display_text" : "Slc24a4Tn(sb-T2/Bart3)2.145Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc24a4Tn(sb-T2/Bart3)2.145Mcwi", "display_text" : "Slc24a4Tn(sb-T2/Bart3)2.145Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290127", "page_area" : "allele", "display_name" : "RGD:2290127" } }, "date_created" : "2008-02-26T15:16:46.000-06:00", "date_updated" : "2008-02-26T15:16:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290127", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "GLIS family zinc finger 1 ; transposon insertion 2.149, Medical College of Wisconsin", "display_text" : "GLIS family zinc finger 1 ; transposon insertion 2.149, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:2292626" ], "date_created" : "2008-04-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Glis1[Tn(sb-T2/Bart3)2.149Mcwi]", "display_text" : "Glis1Tn(sb-T2/Bart3)2.149Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Glis1Tn(sb-T2/Bart3)2.149Mcwi", "display_text" : "Glis1Tn(sb-T2/Bart3)2.149Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290128", "page_area" : "allele", "display_name" : "RGD:2290128" } }, "date_created" : "2008-02-26T15:16:48.000-06:00", "date_updated" : "2008-02-26T15:16:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290128", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adhesion G protein-coupled receptor L3; transposon insertion 2.151, Medical College of Wisconsin", "display_text" : "adhesion G protein-coupled receptor L3; transposon insertion 2.151, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-04-01T17:10:27.000-05:00", "nomenclature_event_name" : "name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2019-04-01T16:30:51.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Adgrl3[Tn(sb-T2/Bart3)2.151Mcwi]", "display_text" : "Adgrl3Tn(sb-T2/Bart3)2.151Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lphn3Tn(sb-T2/Bart3)2.151Mcwi", "display_text" : "Lphn3Tn(sb-T2/Bart3)2.151Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Lphn3[Tn(sb-T2/Bart3)2.151Mcwi]", "display_text" : "Lphn3Tn(sb-T2/Bart3)2.151Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "latrophilin 3; transposon insertion 2.151, Medical College of Wisconsin", "display_text" : "latrophilin 3; transposon insertion 2.151, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290129", "page_area" : "allele", "display_name" : "RGD:2290129" } }, "date_created" : "2008-02-26T15:16:51.000-06:00", "date_updated" : "2008-02-26T15:16:51.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290129", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 (formerly Lphn3) gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.143, Medical College of Wisconsin", "display_text" : "inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.143, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Inpp4b[Tn(sb-T2/Bart3)2.143Mcwi]", "display_text" : "Inpp4bTn(sb-T2/Bart3)2.143Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Inpp4bTn(sb-T2/Bart3)2.143Mcwi", "display_text" : "Inpp4bTn(sb-T2/Bart3)2.143Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290149", "page_area" : "allele", "display_name" : "RGD:2290149" } }, "date_created" : "2008-02-26T16:09:41.000-06:00", "date_updated" : "2008-02-26T16:09:41.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290149", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Spetex-2H protein; transposon insertion 2.136, Medical College of Wisconsin", "display_text" : "Spetex-2H protein; transposon insertion 2.136, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Spetex-2H[Tn(sb-T2/Bart3)2.136Mcwi]", "display_text" : "Spetex-2HTn(sb-T2/Bart3)2.136Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Spetex-2HTn(sb-T2/Bart3)2.136Mcwi", "display_text" : "Spetex-2HTn(sb-T2/Bart3)2.136Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290150", "page_area" : "allele", "display_name" : "RGD:2290150" } }, "date_created" : "2008-02-26T16:09:42.000-06:00", "date_updated" : "2008-02-26T16:09:42.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290150", "note_dtos" : [ { "internal" : false, "free_text" : "trap construct into the 1st intron of the Spetex-2H gene", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 5A, cGMP-specific; transposon insertion 2.144, Medical College of Wisconsin", "display_text" : "phosphodiesterase 5A, cGMP-specific; transposon insertion 2.144, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde5a[Tn(sb-T2/Bart3)2.144Mcwi]", "display_text" : "Pde5aTn(sb-T2/Bart3)2.144Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pde5aTn(sb-T2/Bart3)2.144Mcwi", "display_text" : "Pde5aTn(sb-T2/Bart3)2.144Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290151", "page_area" : "allele", "display_name" : "RGD:2290151" } }, "date_created" : "2008-02-26T16:09:42.000-06:00", "date_updated" : "2008-02-26T16:09:42.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290151", "note_dtos" : [ { "internal" : false, "free_text" : "trap construct into the 4th intron of the Pde5a gene", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "discs, large homolog 1 (Drosophila); transposon insertion 2.133, Medical College of Wisconsin", "display_text" : "discs, large homolog 1 (Drosophila); transposon insertion 2.133, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dlg1[Tn(sb-T2/Bart3)2.133Mcwi]", "display_text" : "Dlg1Tn(sb-T2/Bart3)2.133Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dlg1Tn(sb-T2/Bart3)2.133Mcwi", "display_text" : "Dlg1Tn(sb-T2/Bart3)2.133Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290152", "page_area" : "allele", "display_name" : "RGD:2290152" } }, "date_created" : "2008-02-26T16:09:43.000-06:00", "date_updated" : "2008-02-26T16:09:43.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290152", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spectrin repeat containing, nuclear envelope 1; transposon insertion 2.68, Medical College of Wisconsin", "display_text" : "spectrin repeat containing, nuclear envelope 1; transposon insertion 2.68, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Syne1[Tn(sb-T2/Bart3)2.68Mcwi]", "display_text" : "Syne1Tn(sb-T2/Bart3)2.68Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Syne1Tn(sb-T2/Bart3)2.68Mcwi", "display_text" : "Syne1Tn(sb-T2/Bart3)2.68Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290153", "page_area" : "allele", "display_name" : "RGD:2290153" } }, "date_created" : "2008-02-26T16:09:44.000-06:00", "date_updated" : "2008-02-26T16:09:44.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290153", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "rabphilin 3A; transposon insertion 2.104, Medical College of Wisconsin", "display_text" : "rabphilin 3A; transposon insertion 2.104, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rph3a[Tn(sb-T2/Bart3)2.104Mcwi]", "display_text" : "Rph3aTn(sb-T2/Bart3)2.104Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rph3aTn(sb-T2/Bart3)2.104Mcwi", "display_text" : "Rph3aTn(sb-T2/Bart3)2.104Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290154", "page_area" : "allele", "display_name" : "RGD:2290154" } }, "date_created" : "2008-02-26T16:09:45.000-06:00", "date_updated" : "2008-02-26T16:09:45.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290154", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phospholipase C, beta 3; transposon insertion 2.69, Medical College of Wisconsin", "display_text" : "phospholipase C, beta 3; transposon insertion 2.69, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plcb3[Tn(sb-T2/Bart3)2.69Mcwi]", "display_text" : "Plcb3Tn(sb-T2/Bart3)2.69Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plcb3Tn(sb-T2/Bart3)2.69Mcwi", "display_text" : "Plcb3Tn(sb-T2/Bart3)2.69Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290155", "page_area" : "allele", "display_name" : "RGD:2290155" } }, "date_created" : "2008-02-26T16:09:46.000-06:00", "date_updated" : "2008-02-26T16:09:46.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290155", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transmembrane and coiled-coil domains 1; transposon insertion 2.135, Medical College of Wisconsin", "display_text" : "transmembrane and coiled-coil domains 1; transposon insertion 2.135, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tmco1[Tn(sb-T2/Bart3)2.135Mcwi]", "display_text" : "Tmco1Tn(sb-T2/Bart3)2.135Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tmco1Tn(sb-T2/Bart3)2.135Mcwi", "display_text" : "Tmco1Tn(sb-T2/Bart3)2.135Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290156", "page_area" : "allele", "display_name" : "RGD:2290156" } }, "date_created" : "2008-02-26T16:09:47.000-06:00", "date_updated" : "2008-02-26T16:09:47.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290156", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neurotrimin; transposon insertion 2.130, Medical College of Wisconsin", "display_text" : "neurotrimin; transposon insertion 2.130, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ntm[Tn(sb-T2/Bart3)2.130Mcwi]", "display_text" : "NtmTn(sb-T2/Bart3)2.130Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Hnt[Tn(sb-T2/Bart3)2.130Mcwi]", "display_text" : "HntTn(sb-T2/Bart3)2.130Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "HntTn(sb-T2/Bart3)2.130Mcwi", "display_text" : "HntTn(sb-T2/Bart3)2.130Mcwi", "name_type_name" : "unspecified" }, { "internal" : false, "format_text" : "NtmTn(sb-T2/Bart3)2.130Mcwi", "display_text" : "NtmTn(sb-T2/Bart3)2.130Mcwi", "name_type_name" : "unspecified" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290157", "page_area" : "allele", "display_name" : "RGD:2290157" } }, "date_created" : "2008-02-26T16:09:48.000-06:00", "date_updated" : "2008-02-26T16:09:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290157", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CD226 antigen; transposon insertion 2.141, Medical College of Wisconsin", "display_text" : "CD226 antigen; transposon insertion 2.141, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2008-04-18T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd226[Tn(sb-T2/Bart3)2.141Mcwi]", "display_text" : "Cd226Tn(sb-T2/Bart3)2.141Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd226Tn(sb-T2/Bart3)2.141Mcwi", "display_text" : "Cd226Tn(sb-T2/Bart3)2.141Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2290158", "page_area" : "allele", "display_name" : "RGD:2290158" } }, "date_created" : "2008-02-26T16:09:49.000-06:00", "date_updated" : "2008-02-26T16:09:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:2290158", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "double zinc ribbon and ankyrin repeat domains 1; transposon insertion 2.164, Medical College of Wisconsin", "display_text" : "double zinc ribbon and ankyrin repeat domains 1; transposon insertion 2.164, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-10-17T14:56:07.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:2292626" ], "date_created" : "2008-04-30T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Dzank1[Tn(sb-T2/Bart3)2.164Mcwi]", "display_text" : "Dzank1Tn(sb-T2/Bart3)2.164Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "transposon insertion 2.164, Medical College of Wisconsin", "display_text" : "transposon insertion 2.164, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "RGD1311344[Tn(sb-T2/Bart3)2.164Mcwi]", "display_text" : "RGD1311344Tn(sb-T2/Bart3)2.164Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "similar to RIKEN cDNA 2810039F03", "display_text" : "similar to RIKEN cDNA 2810039F03", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Dzank1Tn(sb-T2/Bart3)2.164Mcwi", "display_text" : "Dzank1Tn(sb-T2/Bart3)2.164Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2291839", "page_area" : "allele", "display_name" : "RGD:2291839" } }, "date_created" : "2008-04-01T10:01:43.000-05:00", "date_updated" : "2008-04-01T10:01:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:2291839", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RGD1564304; transposon insertion 2.201, Medical College of Wisconsin", "display_text" : "RGD1564304; transposon insertion 2.201, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "RGD1564304[Tn(sb-T2/Bart3)2.201Mcwi]", "display_text" : "RGD1564304Tn(sb-T2/Bart3)2.201Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "RGD1564304Tn(sb-T2/Bart3)2.201Mcwi", "display_text" : "RGD1564304Tn(sb-T2/Bart3)2.201Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2292447", "page_area" : "allele", "display_name" : "RGD:2292447" } }, "date_created" : "2008-04-18T12:40:53.000-05:00", "date_updated" : "2008-04-18T12:40:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:2292447", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST BE329202; transposon insertion 2.198, Medical College of Wisconsin", "display_text" : "EST BE329202; transposon insertion 2.198, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "BE329202[Tn(sb-T2/Bart3)2.198Mcwi]", "display_text" : "BE329202Tn(sb-T2/Bart3)2.198Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BE329202Tn(sb-T2/Bart3)2.198Mcwi", "display_text" : "BE329202Tn(sb-T2/Bart3)2.198Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2292448", "page_area" : "allele", "display_name" : "RGD:2292448" } }, "date_created" : "2008-04-18T12:40:53.000-05:00", "date_updated" : "2008-04-18T12:40:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:2292448", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST BE329202", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "synapse differentiation inducing 1; transposon insertion 2.171, Medical College of Wisconsin", "display_text" : "synapse differentiation inducing 1; transposon insertion 2.171, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Syndig1[Tn(sb-T2/Bart3)2.171Mcwi]", "display_text" : "Syndig1Tn(sb-T2/Bart3)2.171Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "RGD1310753[Tn(sb-T2/Bart3)2.171Mcwi]", "display_text" : "RGD1310753Tn(sb-T2/Bart3)2.171Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "similar to chromosome 20 open reading frame 39", "display_text" : "similar to chromosome 20 open reading frame 39", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "RGD1310753Tn(sb-T2/Bart3)2.171Mcwi", "display_text" : "RGD1310753Tn(sb-T2/Bart3)2.171Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Syndig1Tn(sb-T2/Bart3)2.171Mcwi", "display_text" : "Syndig1Tn(sb-T2/Bart3)2.171Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "transposon insertion 2.171, Medical College of Wisconsin", "display_text" : "transposon insertion 2.171, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2292449", "page_area" : "allele", "display_name" : "RGD:2292449" } }, "date_created" : "2008-04-18T12:40:54.000-05:00", "date_updated" : "2008-04-18T12:40:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:2292449", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "syntaxin binding protein 5-like; transposon insertion 2.202, Medical College of Wisconsin", "display_text" : "syntaxin binding protein 5-like; transposon insertion 2.202, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Stxbp5l[Tn(sb-T2/Bart3)2.202Mcwi]", "display_text" : "Stxbp5lTn(sb-T2/Bart3)2.202Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Stxbp5lTn(sb-T2/Bart3)2.202Mcwi", "display_text" : "Stxbp5lTn(sb-T2/Bart3)2.202Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2292450", "page_area" : "allele", "display_name" : "RGD:2292450" } }, "date_created" : "2008-04-18T12:40:54.000-05:00", "date_updated" : "2008-04-18T12:40:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:2292450", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "deleted in colorectal carcinoma; transposon insertion 2.205, Medical College of Wisconsin", "display_text" : "deleted in colorectal carcinoma; transposon insertion 2.205, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dcc[Tn(sb-T2/Bart3)2.205Mcwi]", "display_text" : "DccTn(sb-T2/Bart3)2.205Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "DccTn(sb-T2/Bart3)2.205Mcwi", "display_text" : "DccTn(sb-T2/Bart3)2.205Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2298938", "page_area" : "allele", "display_name" : "RGD:2298938" } }, "date_created" : "2008-08-04T13:29:55.000-05:00", "date_updated" : "2008-08-04T13:29:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:2298938", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine deaminase; transposon insertion 2.237, Medical College of Wisconsin", "display_text" : "adenosine deaminase; transposon insertion 2.237, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ada[Tn(sb-T2/Bart3)2.237Mcwi]", "display_text" : "AdaTn(sb-T2/Bart3)2.237Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "AdaTn(sb-T2/Bart3)2.237Mcwi", "display_text" : "AdaTn(sb-T2/Bart3)2.237Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299093", "page_area" : "allele", "display_name" : "RGD:2299093" } }, "date_created" : "2008-08-12T16:10:34.000-05:00", "date_updated" : "2008-08-12T16:10:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299093", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "eva-1 homolog A, regulator of programmed cell death; transposon insertion 2.233, Medical College of Wisconsin", "display_text" : "eva-1 homolog A, regulator of programmed cell death; transposon insertion 2.233, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2016-12-08T14:15:15.000-06:00", "nomenclature_event_name" : "symbol_and_name_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Eva1a[Tn(sb-T2/Bart3)2.233Mcwi]", "display_text" : "Eva1aTn(sb-T2/Bart3)2.233Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tmem166[Tn(sb-T2/Bart3)2.233Mcwi]", "display_text" : "Tmem166Tn(sb-T2/Bart3)2.233Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Fam176a[Tn(sb-T2/Bart3)2.233Mcwi]", "display_text" : "Fam176aTn(sb-T2/Bart3)2.233Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Eva1aTn(sb-T2/Bart3)2.233Mcwi", "display_text" : "Eva1aTn(sb-T2/Bart3)2.233Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299094", "page_area" : "allele", "display_name" : "RGD:2299094" } }, "date_created" : "2008-08-12T16:10:34.000-05:00", "date_updated" : "2008-08-12T16:10:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299094", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.232, Medical College of Wisconsin", "display_text" : "inositol polyphosphate-4-phosphatase, type II; transposon insertion 2.232, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Inpp4b[Tn(sb-T2/Bart3)2.232Mcwi]", "display_text" : "Inpp4bTn(sb-T2/Bart3)2.232Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Inpp4bTn(sb-T2/Bart3)2.232Mcwi", "display_text" : "Inpp4bTn(sb-T2/Bart3)2.232Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299095", "page_area" : "allele", "display_name" : "RGD:2299095" } }, "date_created" : "2008-08-12T16:10:34.000-05:00", "date_updated" : "2008-08-12T16:10:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299095", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cyclin-dependent kinase 2B-inhibitor-related protein; transposon insertion 2.247, Medical College of Wisconsin", "display_text" : "cyclin-dependent kinase 2B-inhibitor-related protein; transposon insertion 2.247, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2009-04-09T00:00:00.000-05:00", "nomenclature_event_name" : "gene_nomenclature_extended_to_allele" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rprd1a[Tn(sb-T2/Bart3)2.247Mcwi]", "display_text" : "Rprd1aTn(sb-T2/Bart3)2.247Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "P15rs[Tn(sb-T2/Bart3)2.247Mcwi]", "display_text" : "P15rsTn(sb-T2/Bart3)2.247Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Rprd1aTn(sb-T2/Bart3)2.247Mcwi", "display_text" : "Rprd1aTn(sb-T2/Bart3)2.247Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299096", "page_area" : "allele", "display_name" : "RGD:2299096" } }, "date_created" : "2008-08-12T16:10:34.000-05:00", "date_updated" : "2008-08-12T16:10:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299096", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein tyrosine phosphatase, receptor type, E; transposon insertion 2.236, Medical College of Wisconsin", "display_text" : "protein tyrosine phosphatase, receptor type, E; transposon insertion 2.236, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptpre[Tn(sb-T2/Bart3)236Mcwi]", "display_text" : "PtpreTn(sb-T2/Bart3)236Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "PtpreTn(sb-T2/Bart3)236Mcwi", "display_text" : "PtpreTn(sb-T2/Bart3)236Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299097", "page_area" : "allele", "display_name" : "RGD:2299097" } }, "date_created" : "2008-08-12T16:10:34.000-05:00", "date_updated" : "2008-08-12T16:10:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299097", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RAP1, GTP-GDP dissociation stimulator 1; transposon insertion 2.251, Medical College of Wisconsin", "display_text" : "RAP1, GTP-GDP dissociation stimulator 1; transposon insertion 2.251, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rap1gds1[Tn(sb-T2/Bart3)2.251Mcwi]", "display_text" : "Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi", "display_text" : "Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299098", "page_area" : "allele", "display_name" : "RGD:2299098" } }, "date_created" : "2008-08-12T16:10:35.000-05:00", "date_updated" : "2008-08-12T16:10:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299098", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "triadin; transposon insertion 2.238, Medical College of Wisconsin", "display_text" : "triadin; transposon insertion 2.238, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trdn[Tn(sb-T2/Bart3)2.238Mcwi]", "display_text" : "TrdnTn(sb-T2/Bart3)2.238Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "TrdnTn(sb-T2/Bart3)2.238Mcwi", "display_text" : "TrdnTn(sb-T2/Bart3)2.238Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299099", "page_area" : "allele", "display_name" : "RGD:2299099" } }, "date_created" : "2008-08-12T16:10:35.000-05:00", "date_updated" : "2008-08-12T16:10:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299099", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Kv channel interacting protein 4; transposon insertion 2.225, Medical College of Wisconsin", "display_text" : "Kv channel interacting protein 4; transposon insertion 2.225, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnip4[Tn(sb-T2/Bart3)2.225Mcwi]", "display_text" : "Kcnip4Tn(sb-T2/Bart3)2.225Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnip4Tn(sb-T2/Bart3)2.225Mcwi", "display_text" : "Kcnip4Tn(sb-T2/Bart3)2.225Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299100", "page_area" : "allele", "display_name" : "RGD:2299100" } }, "date_created" : "2008-08-12T16:10:35.000-05:00", "date_updated" : "2008-08-12T16:10:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299100", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "taspase, threonine aspartase 1; transposon insertion 2.219, Medical College of Wisconsin", "display_text" : "taspase, threonine aspartase 1; transposon insertion 2.219, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tasp1[Tn(sb-T2/Bart3)2.219Mcwi]", "display_text" : "Tasp1Tn(sb-T2/Bart3)2.219Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tasp1Tn(sb-T2/Bart3)2.219Mcwi", "display_text" : "Tasp1Tn(sb-T2/Bart3)2.219Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299101", "page_area" : "allele", "display_name" : "RGD:2299101" } }, "date_created" : "2008-08-12T16:10:35.000-05:00", "date_updated" : "2008-08-12T16:10:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299101", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae); transposon insertion 2.246, Medical College of Wisconsin", "display_text" : "IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae); transposon insertion 2.246, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Immp1l[Tn(sb-T2/Bart3)2.246Mcwi]", "display_text" : "Immp1lTn(sb-T2/Bart3)2.246Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Immp1lTn(sb-T2/Bart3)2.246Mcwi", "display_text" : "Immp1lTn(sb-T2/Bart3)2.246Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299102", "page_area" : "allele", "display_name" : "RGD:2299102" } }, "date_created" : "2008-08-12T16:10:35.000-05:00", "date_updated" : "2008-08-12T16:10:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299102", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "laminin, alpha 2; transposon insertion 2.213, Medical College of Wisconsin", "display_text" : "laminin, alpha 2; transposon insertion 2.213, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lama2[Tn(sb-T2/Bart3)2.2013Mcwi]", "display_text" : "Lama2Tn(sb-T2/Bart3)2.2013Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lama2Tn(sb-T2/Bart3)2.2013Mcwi", "display_text" : "Lama2Tn(sb-T2/Bart3)2.2013Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299103", "page_area" : "allele", "display_name" : "RGD:2299103" } }, "date_created" : "2008-08-12T16:10:35.000-05:00", "date_updated" : "2008-08-12T16:10:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299103", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform; transposon insertion 2.239, Medical College of Wisconsin", "display_text" : "protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform; transposon insertion 2.239, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ppp2r2b[Tn(sb-T2/Bart3)2.239Mcwi]", "display_text" : "Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi", "display_text" : "Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299104", "page_area" : "allele", "display_name" : "RGD:2299104" } }, "date_created" : "2008-08-12T16:10:36.000-05:00", "date_updated" : "2008-08-12T16:10:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299104", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphatidic acid phosphatase type 2 domain containing 1A; transposon insertion 2.207, Medical College of Wisconsin", "display_text" : "phosphatidic acid phosphatase type 2 domain containing 1A; transposon insertion 2.207, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ppapdc1a[Tn(sb-T2/Bart3)2.207Mcwi]", "display_text" : "Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi", "display_text" : "Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299105", "page_area" : "allele", "display_name" : "RGD:2299105" } }, "date_created" : "2008-08-12T16:10:36.000-05:00", "date_updated" : "2008-08-12T16:10:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299105", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative); transposon insertion 2.244, Medical College of Wisconsin", "display_text" : "mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative); transposon insertion 2.244, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mgat4c[Tn(sb-T2/Bart3)2.244Mcwi]", "display_text" : "Mgat4cTn(sb-T2/Bart3)2.244Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mgat4cTn(sb-T2/Bart3)2.244Mcwi", "display_text" : "Mgat4cTn(sb-T2/Bart3)2.244Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299106", "page_area" : "allele", "display_name" : "RGD:2299106" } }, "date_created" : "2008-08-12T16:10:36.000-05:00", "date_updated" : "2008-08-12T16:10:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299106", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin", "display_text" : "leucine rich repeat containing 4C; transposon insertion 2.224, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrrc4c[Tn(sb-T2/Bart3)2.224Mcwi]", "display_text" : "Lrrc4cTn(sb-T2/Bart3)2.224Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lrrc4cTn(sb-T2/Bart3)2.224Mcwi", "display_text" : "Lrrc4cTn(sb-T2/Bart3)2.224Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299107", "page_area" : "allele", "display_name" : "RGD:2299107" } }, "date_created" : "2008-08-12T16:10:36.000-05:00", "date_updated" : "2008-08-12T16:10:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299107", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST AW921689; transposon insertion 2.209, Medical College of Wisconsin", "display_text" : "EST AW921689; transposon insertion 2.209, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "AW921689[Tn(sb-T2/Bart3)2.209Mcwi]", "display_text" : "AW921689Tn(sb-T2/Bart3)2.209Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "AW921689Tn(sb-T2/Bart3)2.209Mcwi", "display_text" : "AW921689Tn(sb-T2/Bart3)2.209Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299108", "page_area" : "allele", "display_name" : "RGD:2299108" } }, "date_created" : "2008-08-12T16:10:36.000-05:00", "date_updated" : "2008-08-12T16:10:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299108", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW921689", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ubiquilin 4; transposon insertion 2.230, Medical College of Wisconsin", "display_text" : "ubiquilin 4; transposon insertion 2.230, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ubqln4[Tn(sb-T2/Bart3)2.230Mcwi]", "display_text" : "Ubqln4Tn(sb-T2/Bart3)2.230Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ubqln4Tn(sb-T2/Bart3)2.230Mcwi", "display_text" : "Ubqln4Tn(sb-T2/Bart3)2.230Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299109", "page_area" : "allele", "display_name" : "RGD:2299109" } }, "date_created" : "2008-08-12T16:10:36.000-05:00", "date_updated" : "2008-08-12T16:10:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299109", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian); transposon insertion 2.208, Medical College of Wisconsin", "display_text" : "v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian); transposon insertion 2.208, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Erbb4[Tn(sb-T2/Bart3)2.208Mcwi]", "display_text" : "Erbb4Tn(sb-T2/Bart3)2.208Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Erbb4Tn(sb-T2/Bart3)2.208Mcwi", "display_text" : "Erbb4Tn(sb-T2/Bart3)2.208Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299110", "page_area" : "allele", "display_name" : "RGD:2299110" } }, "date_created" : "2008-08-12T16:10:36.000-05:00", "date_updated" : "2008-08-12T16:10:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299110", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "kinesin family member 16B; transposon insertion 2.200, Medical College of Wisconsin", "display_text" : "kinesin family member 16B; transposon insertion 2.200, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kif16b[Tn(sb-T2/Bart3)2.200Mcwi]", "display_text" : "Kif16bTn(sb-T2/Bart3)2.200Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kif16bTn(sb-T2/Bart3)2.200Mcwi", "display_text" : "Kif16bTn(sb-T2/Bart3)2.200Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299111", "page_area" : "allele", "display_name" : "RGD:2299111" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299111", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "proline rich 5 like; transposon insertion 2.228, Medical College of Wisconsin", "display_text" : "proline rich 5 like; transposon insertion 2.228, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prr5l[Tn(sb-T2/Bart3)2.228Mcwi]", "display_text" : "Prr5lTn(sb-T2/Bart3)2.228Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "RGD1309969[Tn(sb-T2/Bart3)2.228Mcwi]", "display_text" : "RGD1309969Tn(sb-T2/Bart3)2.228Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "RGD1309969Tn(sb-T2/Bart3)2.228Mcwi", "display_text" : "RGD1309969Tn(sb-T2/Bart3)2.228Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Prr5lTn(sb-T2/Bart3)2.228Mcwi", "display_text" : "Prr5lTn(sb-T2/Bart3)2.228Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299112", "page_area" : "allele", "display_name" : "RGD:2299112" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299112", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coiled-coil domain containing 85A; transposon insertion 2.248, Medical College of Wisconsin", "display_text" : "coiled-coil domain containing 85A; transposon insertion 2.248, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ccdc85a[Tn(sb-T2/Bart3)2.248Mcwi]", "display_text" : "Ccdc85aTn(sb-T2/Bart3)2.248Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ccdc85aTn(sb-T2/Bart3)2.248Mcwi", "display_text" : "Ccdc85aTn(sb-T2/Bart3)2.248Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299113", "page_area" : "allele", "display_name" : "RGD:2299113" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299113", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dynein heavy chain domain 1; transposon insertion 2.243, Medical College of Wisconsin", "display_text" : "dynein heavy chain domain 1; transposon insertion 2.243, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2014-06-20T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Dnhd1[Tn(sb-T2/Bart3)2.243Mcwi]", "display_text" : "Dnhd1Tn(sb-T2/Bart3)2.243Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "transposon insertion 2.243, Medical College of Wisconsin", "display_text" : "transposon insertion 2.243, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "similar to Dynein heavy chain at 36C CG5526-PA", "display_text" : "similar to Dynein heavy chain at 36C CG5526-PA", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "LOC686729[Tn(sb-T2/Bart3)2.243Mcwi]", "display_text" : "LOC686729Tn(sb-T2/Bart3)2.243Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Dnhd1Tn(sb-T2/Bart3)2.243Mcwi", "display_text" : "Dnhd1Tn(sb-T2/Bart3)2.243Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299114", "page_area" : "allele", "display_name" : "RGD:2299114" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299114", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein-coupled receptor kinase 1; transposon insertion 2.234, Medical College of Wisconsin", "display_text" : "G protein-coupled receptor kinase 1; transposon insertion 2.234, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Grk1[Tn(sb-T2/Bart3)2.234Mcwi]", "display_text" : "Grk1Tn(sb-T2/Bart3)2.234Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Grk1Tn(sb-T2/Bart3)2.234Mcwi", "display_text" : "Grk1Tn(sb-T2/Bart3)2.234Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299115", "page_area" : "allele", "display_name" : "RGD:2299115" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299115", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cell adhesion molecule 1; transposon insertion 2.229, Medical College of Wisconsin", "display_text" : "cell adhesion molecule 1; transposon insertion 2.229, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cadm1[Tn(sb-T2/Bart3)2.229Mcwi]", "display_text" : "Cadm1Tn(sb-T2/Bart3)2.229Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cadm1Tn(sb-T2/Bart3)2.229Mcwi", "display_text" : "Cadm1Tn(sb-T2/Bart3)2.229Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299116", "page_area" : "allele", "display_name" : "RGD:2299116" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299116", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "syntaphilin; transposon insertion 2.214, Medical College of Wisconsin", "display_text" : "syntaphilin; transposon insertion 2.214, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Snph[Tn(sb-T2/Bart3)2.214Mcwi]", "display_text" : "SnphTn(sb-T2/Bart3)2.214Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "SnphTn(sb-T2/Bart3)2.214Mcwi", "display_text" : "SnphTn(sb-T2/Bart3)2.214Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299117", "page_area" : "allele", "display_name" : "RGD:2299117" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299117", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neurexin 2; transposon insertion 2.250, Medical College of Wisconsin", "display_text" : "neurexin 2; transposon insertion 2.250, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nrxn2[Tn(sb-T2/Bart3)2.250Mcwi]", "display_text" : "Nrxn2Tn(sb-T2/Bart3)2.250Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nrxn2Tn(sb-T2/Bart3)2.250Mcwi", "display_text" : "Nrxn2Tn(sb-T2/Bart3)2.250Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2299118", "page_area" : "allele", "display_name" : "RGD:2299118" } }, "date_created" : "2008-08-12T16:10:37.000-05:00", "date_updated" : "2008-08-12T16:10:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2299118", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin", "display_text" : "leucine rich repeat containing 4C; transposon insertion 2.254, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrrc4c[Tn(sb-T2/Bart3)2.254Mcwi]", "display_text" : "Lrrc4cTn(sb-T2/Bart3)2.254Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lrrc4cTn(sb-T2/Bart3)2.254Mcwi", "display_text" : "Lrrc4cTn(sb-T2/Bart3)2.254Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2301076", "page_area" : "allele", "display_name" : "RGD:2301076" } }, "date_created" : "2008-09-25T14:54:36.000-05:00", "date_updated" : "2008-09-25T14:54:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:2301076", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "membrane metallo-endopeptidase-like 1; transposon insertion 2.255, Medical College of Wisconsin", "display_text" : "membrane metallo-endopeptidase-like 1; transposon insertion 2.255, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mmel1[Tn(sb-T2/Bart3)2.255Mcwi]", "display_text" : "Mmel1Tn(sb-T2/Bart3)2.255Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mmel1Tn(sb-T2/Bart3)2.255Mcwi", "display_text" : "Mmel1Tn(sb-T2/Bart3)2.255Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2301077", "page_area" : "allele", "display_name" : "RGD:2301077" } }, "date_created" : "2008-09-25T14:54:37.000-05:00", "date_updated" : "2008-09-25T14:54:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2301077", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leucine rich repeat containing 7; transposon insertion 2.253, Medical College of Wisconsin", "display_text" : "leucine rich repeat containing 7; transposon insertion 2.253, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrrc7[Tn(sb-T2/Bart3)2.253Mcwi]", "display_text" : "Lrrc7Tn(sb-T2/Bart3)2.253Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lrrc7Tn(sb-T2/Bart3)2.253Mcwi", "display_text" : "Lrrc7Tn(sb-T2/Bart3)2.253Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2301078", "page_area" : "allele", "display_name" : "RGD:2301078" } }, "date_created" : "2008-09-25T14:54:37.000-05:00", "date_updated" : "2008-09-25T14:54:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:2301078", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "splicing factor 4; transposon insertion 2.264, Medical College of Wisconsin", "display_text" : "splicing factor 4; transposon insertion 2.264, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sf4[Tn(sb-T2/Bart3)2.264Mcwi]", "display_text" : "Sf4Tn(sb-T2/Bart3)2.264Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sf4Tn(sb-T2/Bart3)2.264Mcwi", "display_text" : "Sf4Tn(sb-T2/Bart3)2.264Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2301696", "page_area" : "allele", "display_name" : "RGD:2301696" } }, "date_created" : "2008-10-29T12:30:15.000-05:00", "date_updated" : "2008-10-29T12:30:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:2301696", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spermatogenesis associated 13; transposon insertion 2.267, Medical College of Wisconsin", "display_text" : "spermatogenesis associated 13; transposon insertion 2.267, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Spata13[Tn(sb-T2/Bart3)2.267Mcwi]", "display_text" : "Spata13Tn(sb-T2/Bart3)2.267Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Spata13Tn(sb-T2/Bart3)2.267Mcwi", "display_text" : "Spata13Tn(sb-T2/Bart3)2.267Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2301697", "page_area" : "allele", "display_name" : "RGD:2301697" } }, "date_created" : "2008-10-29T12:30:15.000-05:00", "date_updated" : "2008-10-29T12:30:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:2301697", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein tyrosine phosphatase, receptor type, A; transposon insertion 2.261, Medical College of Wisconsin", "display_text" : "protein tyrosine phosphatase, receptor type, A; transposon insertion 2.261, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptpra[Tn(sb-T2/Bart3)2.261Mcwi]", "display_text" : "PtpraTn(sb-T2/Bart3)2.261Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "PtpraTn(sb-T2/Bart3)2.261Mcwi", "display_text" : "PtpraTn(sb-T2/Bart3)2.261Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2301698", "page_area" : "allele", "display_name" : "RGD:2301698" } }, "date_created" : "2008-10-29T12:30:16.000-05:00", "date_updated" : "2008-10-29T12:30:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:2301698", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "GRAM domain containing 1B; transposon insertion 2.287, Medical College of Wisconsin", "display_text" : "GRAM domain containing 1B; transposon insertion 2.287, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gramd1b[Tn(sb-T2/Bart3)2.287Mcwi]", "display_text" : "Gramd1bTn(sb-T2/Bart3)2.287Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gramd1bTn(sb-T2/Bart3)2.287Mcwi", "display_text" : "Gramd1bTn(sb-T2/Bart3)2.287Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302635", "page_area" : "allele", "display_name" : "RGD:2302635" } }, "date_created" : "2009-01-06T11:57:06.000-06:00", "date_updated" : "2009-01-06T11:57:06.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302635", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sorting nexin 25; transposon insertion 2.270, Medical College of Wisconsin", "display_text" : "sorting nexin 25; transposon insertion 2.270, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Snx25[Tn(sb-T2/Bart3)2.270Mcwi]", "display_text" : "Snx25Tn(sb-T2/Bart3)2.270Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Snx25Tn(sb-T2/Bart3)2.270Mcwi", "display_text" : "Snx25Tn(sb-T2/Bart3)2.270Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302636", "page_area" : "allele", "display_name" : "RGD:2302636" } }, "date_created" : "2009-01-06T11:57:07.000-06:00", "date_updated" : "2009-01-06T11:57:07.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302636", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "CUB and Sushi multiple domains 3; transposon insertion 2.288, Medical College of Wisconsin", "display_text" : "CUB and Sushi multiple domains 3; transposon insertion 2.288, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Csmd3[Tn(sb-T2/Bart3)2.288Mcwi]", "display_text" : "Csmd3Tn(sb-T2/Bart3)2.288Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Csmd3Tn(sb-T2/Bart3)2.288Mcwi", "display_text" : "Csmd3Tn(sb-T2/Bart3)2.288Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302637", "page_area" : "allele", "display_name" : "RGD:2302637" } }, "date_created" : "2009-01-06T11:57:08.000-06:00", "date_updated" : "2009-01-06T11:57:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302637", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "killer cell lectin-like receptor, subfamily A, member 1; transposon insertion 2.279, Medical College of Wisconsin", "display_text" : "killer cell lectin-like receptor, subfamily A, member 1; transposon insertion 2.279, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Klra1[Tn(sb-T2/Bart3)2.279Mcwi]", "display_text" : "Klra1Tn(sb-T2/Bart3)2.279Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Klra2[Tn(sb-T2/Bart3)2.279Mcwi]", "display_text" : "Klra2Tn(sb-T2/Bart3)2.279Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Klra1Tn(sb-T2/Bart3)2.279Mcwi", "display_text" : "Klra1Tn(sb-T2/Bart3)2.279Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302638", "page_area" : "allele", "display_name" : "RGD:2302638" } }, "date_created" : "2009-01-06T11:57:08.000-06:00", "date_updated" : "2009-01-06T11:57:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302638", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nectin cell adhesion molecule 1; transposon insertion 2.284, Medical College of Wisconsin", "display_text" : "nectin cell adhesion molecule 1; transposon insertion 2.284, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-08-01T14:58:23.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nectin1[Tn(sb-T2/Bart3)2.284Mcwi]", "display_text" : "Nectin1Tn(sb-T2/Bart3)2.284Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pvrl1[Tn(sb-T2/Bart3)2.284Mcwi]", "display_text" : "Pvrl1Tn(sb-T2/Bart3)2.284Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "poliovirus receptor-related 1; transposon insertion 2.284, Medical College of Wisconsin", "display_text" : "poliovirus receptor-related 1; transposon insertion 2.284, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Nectin1Tn(sb-T2/Bart3)2.284Mcwi", "display_text" : "Nectin1Tn(sb-T2/Bart3)2.284Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302639", "page_area" : "allele", "display_name" : "RGD:2302639" } }, "date_created" : "2009-01-06T11:57:08.000-06:00", "date_updated" : "2009-01-06T11:57:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302639", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "bobby sox homolog (Drosophila); transposon insertion 2.291, Medical College of Wisconsin", "display_text" : "bobby sox homolog (Drosophila); transposon insertion 2.291, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bbx[Tn(sb-T2/Bart3)2.291Mcwi]", "display_text" : "BbxTn(sb-T2/Bart3)2.291Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "BbxTn(sb-T2/Bart3)2.291Mcwi", "display_text" : "BbxTn(sb-T2/Bart3)2.291Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302640", "page_area" : "allele", "display_name" : "RGD:2302640" } }, "date_created" : "2009-01-06T11:57:08.000-06:00", "date_updated" : "2009-01-06T11:57:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302640", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ecto-NOX disulfide-thiol exchanger 1; transposon insertion 2.282, Medical College of Wisconsin", "display_text" : "ecto-NOX disulfide-thiol exchanger 1; transposon insertion 2.282, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Enox1[Tn(sb-T2/Bart3)2.282Mcwi]", "display_text" : "Enox1Tn(sb-T2/Bart3)2.282Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Enox1Tn(sb-T2/Bart3)2.282Mcwi", "display_text" : "Enox1Tn(sb-T2/Bart3)2.282Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302641", "page_area" : "allele", "display_name" : "RGD:2302641" } }, "date_created" : "2009-01-06T11:57:08.000-06:00", "date_updated" : "2009-01-06T11:57:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302641", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "caspase 7; transposon insertion 2.280, Medical College of Wisconsin", "display_text" : "caspase 7; transposon insertion 2.280, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Casp7[Tn(sb-T2/Bart3)2.280Mcwi]", "display_text" : "Casp7Tn(sb-T2/Bart3)2.280Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Casp7Tn(sb-T2/Bart3)2.280Mcwi", "display_text" : "Casp7Tn(sb-T2/Bart3)2.280Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302642", "page_area" : "allele", "display_name" : "RGD:2302642" } }, "date_created" : "2009-01-06T11:57:08.000-06:00", "date_updated" : "2009-01-06T11:57:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302642", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 7 (cationic amino acid transporter, y+ system), member 11; transposon insertion 2.266, Medical College of Wisconsin", "display_text" : "solute carrier family 7 (cationic amino acid transporter, y+ system), member 11; transposon insertion 2.266, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc7a11[Tn(sb-T2/Bart3)2.266Mcwi]", "display_text" : "Slc7a11Tn(sb-T2/Bart3)2.266Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc7a11Tn(sb-T2/Bart3)2.266Mcwi", "display_text" : "Slc7a11Tn(sb-T2/Bart3)2.266Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302643", "page_area" : "allele", "display_name" : "RGD:2302643" } }, "date_created" : "2009-01-06T11:57:09.000-06:00", "date_updated" : "2009-01-06T11:57:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302643", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); transposon insertion 2.285, Medical College of Wisconsin", "display_text" : "phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila); transposon insertion 2.285, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde4d[Tn(sb-T2/Bart3)2.285Mcwi]", "display_text" : "Pde4dTn(sb-T2/Bart3)2.285Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pde4dTn(sb-T2/Bart3)2.285Mcwi", "display_text" : "Pde4dTn(sb-T2/Bart3)2.285Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302644", "page_area" : "allele", "display_name" : "RGD:2302644" } }, "date_created" : "2009-01-06T11:57:09.000-06:00", "date_updated" : "2009-01-06T11:57:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302644", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NOL1/NOP2/Sun domain family, member 4; transposon insertion 2.286, Medical College of Wisconsin", "display_text" : "NOL1/NOP2/Sun domain family, member 4; transposon insertion 2.286, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nsun4[Tn(sb-T2/Bart3)2.286Mcwi]", "display_text" : "Nsun4Tn(sb-T2/Bart3)2.286Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nsun4Tn(sb-T2/Bart3)2.286Mcwi", "display_text" : "Nsun4Tn(sb-T2/Bart3)2.286Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302645", "page_area" : "allele", "display_name" : "RGD:2302645" } }, "date_created" : "2009-01-06T11:57:09.000-06:00", "date_updated" : "2009-01-06T11:57:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302645", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transmembrane and tetratricopeptide repeat containing 2; transposon insertion 2.276, Medical College of Wisconsin", "display_text" : "transmembrane and tetratricopeptide repeat containing 2; transposon insertion 2.276, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tmtc2[Tn(sb-T2/Bart3)2.276Mcwi]", "display_text" : "Tmtc2Tn(sb-T2/Bart3)2.276Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tmtc2Tn(sb-T2/Bart3)2.276Mcwi", "display_text" : "Tmtc2Tn(sb-T2/Bart3)2.276Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302646", "page_area" : "allele", "display_name" : "RGD:2302646" } }, "date_created" : "2009-01-06T11:57:09.000-06:00", "date_updated" : "2009-01-06T11:57:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302646", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Moloney leukemia virus 10; transposon insertion 2.281, Medical College of Wisconsin", "display_text" : "Moloney leukemia virus 10; transposon insertion 2.281, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mov10[Tn(sb-T2/Bart3)2.281Mcwi]", "display_text" : "Mov10Tn(sb-T2/Bart3)2.281Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mov10Tn(sb-T2/Bart3)2.281Mcwi", "display_text" : "Mov10Tn(sb-T2/Bart3)2.281Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302647", "page_area" : "allele", "display_name" : "RGD:2302647" } }, "date_created" : "2009-01-06T11:57:09.000-06:00", "date_updated" : "2009-01-06T11:57:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302647", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "origin recognition complex, subunit 3-like (yeast); transposon insertion 2.275, Medical College of Wisconsin", "display_text" : "origin recognition complex, subunit 3-like (yeast); transposon insertion 2.275, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Orc3[Tn(sb-T2/Bart3)2.275Mcwi]", "display_text" : "Orc3Tn(sb-T2/Bart3)2.275Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Orc3l[Tn(sb-T2/Bart3)2.275Mcwi]", "display_text" : "Orc3lTn(sb-T2/Bart3)2.275Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Orc3Tn(sb-T2/Bart3)2.275Mcwi", "display_text" : "Orc3Tn(sb-T2/Bart3)2.275Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Orc3lTn(sb-T2/Bart3)2.275Mcwi", "display_text" : "Orc3lTn(sb-T2/Bart3)2.275Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2302648", "page_area" : "allele", "display_name" : "RGD:2302648" } }, "date_created" : "2009-01-06T11:57:09.000-06:00", "date_updated" : "2009-01-06T11:57:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:2302648", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel, shaker-related subfamily, beta member 1; transposon insertion 2.300, Medical College of Wisconsin", "display_text" : "potassium voltage-gated channel, shaker-related subfamily, beta member 1; transposon insertion 2.300, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnab1[Tn(sb-T2/Bart3)2.300Mcwi]", "display_text" : "Kcnab1Tn(sb-T2/Bart3)2.300Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "kcnb1[tn(sb-t2/bart3)2.300mcwi]", "display_text" : "kcnb1tn(sb-t2/bart3)2.300mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "potassium voltage gated channel, shab-related subfamily, member 1", "display_text" : "potassium voltage gated channel, shab-related subfamily, member 1", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "transposon insertion 2.300, medical college of wisconsin", "display_text" : "transposon insertion 2.300, medical college of wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Kcnab1Tn(sb-T2/Bart3)2.300Mcwi", "display_text" : "Kcnab1Tn(sb-T2/Bart3)2.300Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2303094", "page_area" : "allele", "display_name" : "RGD:2303094" } }, "date_created" : "2009-02-02T14:26:08.000-06:00", "date_updated" : "2009-02-02T14:26:08.000-06:00", "internal" : false, "primary_external_id" : "RGD:2303094", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel, subfamily H (eag-related), member 7; transposon insertion 2.295, Medical College of Wisconsin", "display_text" : "potassium voltage-gated channel, subfamily H (eag-related), member 7; transposon insertion 2.295, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnh7[Tn(sb-T2/Bart3)2.295Mcwi]", "display_text" : "Kcnh7Tn(sb-T2/Bart3)2.295Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnh7Tn(sb-T2/Bart3)2.295Mcwi", "display_text" : "Kcnh7Tn(sb-T2/Bart3)2.295Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2303095", "page_area" : "allele", "display_name" : "RGD:2303095" } }, "date_created" : "2009-02-02T14:26:09.000-06:00", "date_updated" : "2009-02-02T14:26:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:2303095", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphatidylethanolamine binding protein 4; transposon insertion 2.299, Medical College of Wisconsin", "display_text" : "phosphatidylethanolamine binding protein 4; transposon insertion 2.299, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pebp4[Tn(sb-T2/Bart3)2.299Mcwi]", "display_text" : "Pebp4Tn(sb-T2/Bart3)2.299Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pebp4Tn(sb-T2/Bart3)2.299Mcwi", "display_text" : "Pebp4Tn(sb-T2/Bart3)2.299Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2303096", "page_area" : "allele", "display_name" : "RGD:2303096" } }, "date_created" : "2009-02-02T14:26:10.000-06:00", "date_updated" : "2009-02-02T14:26:10.000-06:00", "internal" : false, "primary_external_id" : "RGD:2303096", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 16, member 12 (monocarboxylic acid transporter 12); transposon insertion 2.298, Medical College of Wisconsin", "display_text" : "solute carrier family 16, member 12 (monocarboxylic acid transporter 12); transposon insertion 2.298, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc16a12[Tn(sb-T2/Bart3)2.298Mcwi]", "display_text" : "Slc16a12Tn(sb-T2/Bart3)2.298Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc16a12Tn(sb-T2/Bart3)2.298Mcwi", "display_text" : "Slc16a12Tn(sb-T2/Bart3)2.298Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2303097", "page_area" : "allele", "display_name" : "RGD:2303097" } }, "date_created" : "2009-02-02T14:26:10.000-06:00", "date_updated" : "2009-02-02T14:26:10.000-06:00", "internal" : false, "primary_external_id" : "RGD:2303097", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dynein, axonemal, heavy chain 11; transposon insertion 2.293, Medical College of Wisconsin", "display_text" : "dynein, axonemal, heavy chain 11; transposon insertion 2.293, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dnah11[Tn(sb-T2/Bart3)2.293Mcwi]", "display_text" : "Dnah11Tn(sb-T2/Bart3)2.293Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dnah11Tn(sb-T2/Bart3)2.293Mcwi", "display_text" : "Dnah11Tn(sb-T2/Bart3)2.293Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2303098", "page_area" : "allele", "display_name" : "RGD:2303098" } }, "date_created" : "2009-02-02T14:26:11.000-06:00", "date_updated" : "2009-02-02T14:26:11.000-06:00", "internal" : false, "primary_external_id" : "RGD:2303098", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 7, subfamily b, polypeptide 1; transposon insertion 2.306, Medical College of Wisconsin", "display_text" : "cytochrome P450, family 7, subfamily b, polypeptide 1; transposon insertion 2.306, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp7b1[Tn(sb-T2/Bart3)2.306Mcwi]", "display_text" : "Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi", "display_text" : "Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2303974", "page_area" : "allele", "display_name" : "RGD:2303974" } }, "date_created" : "2009-03-03T09:25:35.000-06:00", "date_updated" : "2009-03-03T09:25:35.000-06:00", "internal" : false, "primary_external_id" : "RGD:2303974", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "anoctamin 3; transposon insertion 2.307, Medical College of Wisconsin", "display_text" : "anoctamin 3; transposon insertion 2.307, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ano3[Tn(sb-T2/Bart3)2.307Mcwi]", "display_text" : "Ano3Tn(sb-T2/Bart3)2.307Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "transmembrane protein 16C", "display_text" : "transmembrane protein 16C", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Tmem16c[Tn(sb-T2/Bart3)2.307Mcwi]", "display_text" : "Tmem16cTn(sb-T2/Bart3)2.307Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "transposon insertion 2.307, Medical College of Wisconsin", "display_text" : "transposon insertion 2.307, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Ano3Tn(sb-T2/Bart3)2.307Mcwi", "display_text" : "Ano3Tn(sb-T2/Bart3)2.307Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2303975", "page_area" : "allele", "display_name" : "RGD:2303975" } }, "date_created" : "2009-03-03T09:25:36.000-06:00", "date_updated" : "2009-03-03T09:25:36.000-06:00", "internal" : false, "primary_external_id" : "RGD:2303975", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to OTTMUSP00000000621; transposon insertion 2.312, Medical College of Wisconsin", "display_text" : "similar to OTTMUSP00000000621; transposon insertion 2.312, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "RGD1565323[Tn(sb-T2/Bart3)2.312Mcwi]", "display_text" : "RGD1565323Tn(sb-T2/Bart3)2.312Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "RGD1565323Tn(sb-T2/Bart3)2.312Mcwi", "display_text" : "RGD1565323Tn(sb-T2/Bart3)2.312Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2304193", "page_area" : "allele", "display_name" : "RGD:2304193" } }, "date_created" : "2009-03-10T14:21:17.000-05:00", "date_updated" : "2009-03-10T14:21:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:2304193", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6; transposon insertion 2.309, Medical College of Wisconsin", "display_text" : "UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6; transposon insertion 2.309, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Galntl6[Tn(sb-T2/Bart3)2.311Mcwi]", "display_text" : "Galntl6Tn(sb-T2/Bart3)2.311Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Galntl6Tn(sb-T2/Bart3)2.311Mcwi", "display_text" : "Galntl6Tn(sb-T2/Bart3)2.311Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2304194", "page_area" : "allele", "display_name" : "RGD:2304194" } }, "date_created" : "2009-03-10T14:21:17.000-05:00", "date_updated" : "2009-03-10T14:21:17.000-05:00", "internal" : false, "primary_external_id" : "RGD:2304194", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prolyl 3-hydroxylase 3; transposon insertion 2.310, Medical College of Wisconsin", "display_text" : "prolyl 3-hydroxylase 3; transposon insertion 2.310, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-08-01T15:05:14.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "P3h3[Tn(sb-T2/Bart3)2.310Mcwi]", "display_text" : "P3h3Tn(sb-T2/Bart3)2.310Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Leprel2Tn(sb-T2/Bart3)2.310Mcwi", "display_text" : "Leprel2Tn(sb-T2/Bart3)2.310Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "leprecan-like 2; transposon insertion 2.310, Medical College of Wisconsin", "display_text" : "leprecan-like 2; transposon insertion 2.310, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Leprel2[Tn(sb-T2/Bart3)2.310Mcwi]", "display_text" : "Leprel2Tn(sb-T2/Bart3)2.310Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "P3h3Tn(sb-T2/Bart3)2.310Mcwi", "display_text" : "P3h3Tn(sb-T2/Bart3)2.310Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2304195", "page_area" : "allele", "display_name" : "RGD:2304195" } }, "date_created" : "2009-03-10T14:21:18.000-05:00", "date_updated" : "2009-03-10T14:21:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:2304195", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leucine zipper and CTNNBIP1 domain containing; transposon insertion 2.309, Medical College of Wisconsin", "display_text" : "leucine zipper and CTNNBIP1 domain containing; transposon insertion 2.309, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lzic[Tn(sb-T2/Bart3)2.309Mcwi]", "display_text" : "LzicTn(sb-T2/Bart3)2.309Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LzicTn(sb-T2/Bart3)2.309Mcwi", "display_text" : "LzicTn(sb-T2/Bart3)2.309Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2304196", "page_area" : "allele", "display_name" : "RGD:2304196" } }, "date_created" : "2009-03-10T14:21:18.000-05:00", "date_updated" : "2009-03-10T14:21:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:2304196", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Rap guanine nucleotide exchange factor (GEF) 4; transposon insertion 2.314, Medical College of Wisconsin", "display_text" : "Rap guanine nucleotide exchange factor (GEF) 4; transposon insertion 2.314, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rapgef4[Tn(sb-T2/Bart3)2.314Mcwi]", "display_text" : "Rapgef4Tn(sb-T2/Bart3)2.314Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rapgef4Tn(sb-T2/Bart3)2.314Mcwi", "display_text" : "Rapgef4Tn(sb-T2/Bart3)2.314Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2304197", "page_area" : "allele", "display_name" : "RGD:2304197" } }, "date_created" : "2009-03-10T14:21:18.000-05:00", "date_updated" : "2009-03-10T14:21:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:2304197", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "similar to ribosomal protein L6; transposon insertion 2.313, Medical College of Wisconsin", "display_text" : "similar to ribosomal protein L6; transposon insertion 2.313, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "RGD1563503[Tn(sb-T2/Bart3)2.313Mcwi]", "display_text" : "RGD1563503Tn(sb-T2/Bart3)2.313Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "RGD1563503Tn(sb-T2/Bart3)2.313Mcwi", "display_text" : "RGD1563503Tn(sb-T2/Bart3)2.313Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2304198", "page_area" : "allele", "display_name" : "RGD:2304198" } }, "date_created" : "2009-03-10T14:21:18.000-05:00", "date_updated" : "2009-03-10T14:21:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:2304198", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RAR-related orphan receptor B; transposon insertion 2.304, Medical College of Wisconsin", "display_text" : "RAR-related orphan receptor B; transposon insertion 2.304, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rorb[Tn(sb-T2/Bart3)2.304Mcwi]", "display_text" : "RorbTn(sb-T2/Bart3)2.304Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "RorbTn(sb-T2/Bart3)2.304Mcwi", "display_text" : "RorbTn(sb-T2/Bart3)2.304Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2304199", "page_area" : "allele", "display_name" : "RGD:2304199" } }, "date_created" : "2009-03-10T14:21:18.000-05:00", "date_updated" : "2009-03-10T14:21:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:2304199", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spectrin, alpha, erythrocytic 1 (elliptocytosis 2); transposon insertion 2.315, Medical College of Wisconsin", "display_text" : "spectrin, alpha, erythrocytic 1 (elliptocytosis 2); transposon insertion 2.315, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Spta1[Tn(sb-T2/Bart3)2.315Mcwi]", "display_text" : "Spta1Tn(sb-T2/Bart3)2.315Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Spta1Tn(sb-T2/Bart3)2.315Mcwi", "display_text" : "Spta1Tn(sb-T2/Bart3)2.315Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2305932", "page_area" : "allele", "display_name" : "RGD:2305932" } }, "date_created" : "2009-03-16T13:31:11.000-05:00", "date_updated" : "2009-03-16T13:31:11.000-05:00", "internal" : false, "primary_external_id" : "RGD:2305932", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "reticulon 4; transposon insertion 2.316, Medical College of Wisconsin", "display_text" : "reticulon 4; transposon insertion 2.316, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rtn4[Tn(sb-T2/Bart3)2.316Mcwi]", "display_text" : "Rtn4Tn(sb-T2/Bart3)2.316Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rtn4Tn(sb-T2/Bart3)2.316Mcwi", "display_text" : "Rtn4Tn(sb-T2/Bart3)2.316Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2305933", "page_area" : "allele", "display_name" : "RGD:2305933" } }, "date_created" : "2009-03-16T13:31:12.000-05:00", "date_updated" : "2009-03-16T13:31:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:2305933", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST AW915325; transposon insertion 2.319, Medical College of Wisconsin", "display_text" : "EST AW915325; transposon insertion 2.319, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "AW915325[Tn(sb-T2/Bart3)2.319Mcwi]", "display_text" : "AW915325Tn(sb-T2/Bart3)2.319Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "AW915325Tn(sb-T2/Bart3)2.319Mcwi", "display_text" : "AW915325Tn(sb-T2/Bart3)2.319Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306272", "page_area" : "allele", "display_name" : "RGD:2306272" } }, "date_created" : "2009-04-01T14:56:54.000-05:00", "date_updated" : "2009-04-01T14:56:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306272", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "exocyst complex component 4; transposon insertion 2.317, Medical College of Wisconsin", "display_text" : "exocyst complex component 4; transposon insertion 2.317, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Exoc4[Tn(sb-T2/Bart3)2.317Mcwi]", "display_text" : "Exoc4Tn(sb-T2/Bart3)2.317Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Exoc4Tn(sb-T2/Bart3)2.317Mcwi", "display_text" : "Exoc4Tn(sb-T2/Bart3)2.317Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306273", "page_area" : "allele", "display_name" : "RGD:2306273" } }, "date_created" : "2009-04-01T14:56:54.000-05:00", "date_updated" : "2009-04-01T14:56:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306273", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "guanine nucleotide binding protein (G protein), gamma 12; transposon insertion 2.320, Medical College of Wisconsin", "display_text" : "guanine nucleotide binding protein (G protein), gamma 12; transposon insertion 2.320, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gng12[Tn(sb-T2/Bart3)2.320Mcwi]", "display_text" : "Gng12Tn(sb-T2/Bart3)2.320Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gng12Tn(sb-T2/Bart3)2.320Mcwi", "display_text" : "Gng12Tn(sb-T2/Bart3)2.320Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306274", "page_area" : "allele", "display_name" : "RGD:2306274" } }, "date_created" : "2009-04-01T14:56:54.000-05:00", "date_updated" : "2009-04-01T14:56:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306274", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "diaphanous homolog 3 (Drosophila); transposon insertion 2.318, Medical College of Wisconsin", "display_text" : "diaphanous homolog 3 (Drosophila); transposon insertion 2.318, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Diaph3[Tn(sb-T2/Bart3)2.318Mcwi]", "display_text" : "Diaph3Tn(sb-T2/Bart3)2.318Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Diaph3Tn(sb-T2/Bart3)2.318Mcwi", "display_text" : "Diaph3Tn(sb-T2/Bart3)2.318Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306275", "page_area" : "allele", "display_name" : "RGD:2306275" } }, "date_created" : "2009-04-01T14:56:55.000-05:00", "date_updated" : "2009-04-01T14:56:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306275", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leishmanolysin-like (metallopeptidase M8 family); transposon insertion 2.322, Medical College of Wisconsin", "display_text" : "leishmanolysin-like (metallopeptidase M8 family); transposon insertion 2.322, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lmln[Tn(sb-T2/Bart3)2.322Mcwi]", "display_text" : "LmlnTn(sb-T2/Bart3)2.322Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LmlnTn(sb-T2/Bart3)2.322Mcwi", "display_text" : "LmlnTn(sb-T2/Bart3)2.322Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306701", "page_area" : "allele", "display_name" : "RGD:2306701" } }, "date_created" : "2009-04-30T15:41:20.000-05:00", "date_updated" : "2009-04-30T15:41:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306701", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EST FM117003; transposon insertion 2.321, Medical College of Wisconsin", "display_text" : "EST FM117003; transposon insertion 2.321, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "FM117003[Tn(sb-T2/Bart3)2.321Mcwi]", "display_text" : "FM117003Tn(sb-T2/Bart3)2.321Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "FM117003Tn(sb-T2/Bart3)2.321Mcwi", "display_text" : "FM117003Tn(sb-T2/Bart3)2.321Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306703", "page_area" : "allele", "display_name" : "RGD:2306703" } }, "date_created" : "2009-04-30T15:41:21.000-05:00", "date_updated" : "2009-04-30T15:41:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306703", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron EST FM117003", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Fas ligand (TNF superfamily, member 6); transposon insertion 2.324, Medical College of Wisconsin", "display_text" : "Fas ligand (TNF superfamily, member 6); transposon insertion 2.324, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Faslg[Tn(sb-T2/Bart3)2.325Mcwi]", "display_text" : "FaslgTn(sb-T2/Bart3)2.325Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "FaslgTn(sb-T2/Bart3)2.325Mcwi", "display_text" : "FaslgTn(sb-T2/Bart3)2.325Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306872", "page_area" : "allele", "display_name" : "RGD:2306872" } }, "date_created" : "2009-05-11T11:18:55.000-05:00", "date_updated" : "2009-05-11T11:18:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306872", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "inturned planar cell polarity effector homolog (Drosophila); transposon insertion 2.324, Medical College of Wisconsin", "display_text" : "inturned planar cell polarity effector homolog (Drosophila); transposon insertion 2.324, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Intu[Tn(sb-T2/Bart3)2.324Mcwi]", "display_text" : "IntuTn(sb-T2/Bart3)2.324Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "IntuTn(sb-T2/Bart3)2.324Mcwi", "display_text" : "IntuTn(sb-T2/Bart3)2.324Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2306873", "page_area" : "allele", "display_name" : "RGD:2306873" } }, "date_created" : "2009-05-11T11:18:55.000-05:00", "date_updated" : "2009-05-11T11:18:55.000-05:00", "internal" : false, "primary_external_id" : "RGD:2306873", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "roundabout homolog 1 (Drosophila); transposon insertion 2.327, Medical College of Wisconsin", "display_text" : "roundabout homolog 1 (Drosophila); transposon insertion 2.327, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Robo1[Tn(sb-T2/Bart3)2.327Mcwi]", "display_text" : "Robo1Tn(sb-T2/Bart3)2.327Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Robo1Tn(sb-T2/Bart3)2.327Mcwi", "display_text" : "Robo1Tn(sb-T2/Bart3)2.327Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2307439", "page_area" : "allele", "display_name" : "RGD:2307439" } }, "date_created" : "2009-06-05T14:48:31.000-05:00", "date_updated" : "2009-06-05T14:48:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:2307439", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cysteine/tyrosine-rich 1; transposon insertion 2.328, Medical College of Wisconsin", "display_text" : "cysteine/tyrosine-rich 1; transposon insertion 2.328, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyyr1[Tn(sb-T2/Bart3)2.328Mcwi]", "display_text" : "Cyyr1Tn(sb-T2/Bart3)2.328Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyyr1Tn(sb-T2/Bart3)2.328Mcwi", "display_text" : "Cyyr1Tn(sb-T2/Bart3)2.328Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2307440", "page_area" : "allele", "display_name" : "RGD:2307440" } }, "date_created" : "2009-06-05T14:48:31.000-05:00", "date_updated" : "2009-06-05T14:48:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:2307440", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "family with sequence similarity 227, member A; transposon insertion 2.333, Medical College of Wisconsin", "display_text" : "family with sequence similarity 227, member A; transposon insertion 2.333, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2014-06-20T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Fam227a[Tn(sb-T2/Bart3)2.333Mcwi]", "display_text" : "Fam227aTn(sb-T2/Bart3)2.333Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "hypothetical protein LOC685444", "display_text" : "hypothetical protein LOC685444", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "transposon insertion 2.333, Medical College of Wisconsin", "display_text" : "transposon insertion 2.333, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "LOC685444[Tn(sb-T2/Bart3)2.333Mcwi]", "display_text" : "LOC685444Tn(sb-T2/Bart3)2.333Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Fam227aTn(sb-T2/Bart3)2.333Mcwi", "display_text" : "Fam227aTn(sb-T2/Bart3)2.333Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2311687", "page_area" : "allele", "display_name" : "RGD:2311687" } }, "date_created" : "2009-07-30T13:21:15.000-05:00", "date_updated" : "2009-07-30T13:21:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:2311687", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transmembrane protein 22; transposon insertion 2.332 Medical College of Wisconsin", "display_text" : "transmembrane protein 22; transposon insertion 2.332 Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tmem22[Tn(sb-T2/Bart3)2.332Mcwi]", "display_text" : "Tmem22Tn(sb-T2/Bart3)2.332Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tmem22Tn(sb-T2/Bart3)2.332Mcwi", "display_text" : "Tmem22Tn(sb-T2/Bart3)2.332Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2311689", "page_area" : "allele", "display_name" : "RGD:2311689" } }, "date_created" : "2009-07-30T13:21:15.000-05:00", "date_updated" : "2009-07-30T13:21:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:2311689", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin ID; transposon insertion 2.334, Medical College of Wisconsin", "display_text" : "myosin ID; transposon insertion 2.334, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Myo1d[Tn(sb-T2/Bart3)2.334Mcwi]", "display_text" : "Myo1dTn(sb-T2/Bart3)2.334Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Myo1dTn(sb-T2/Bart3)2.334Mcwi", "display_text" : "Myo1dTn(sb-T2/Bart3)2.334Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2311691", "page_area" : "allele", "display_name" : "RGD:2311691" } }, "date_created" : "2009-07-30T13:21:15.000-05:00", "date_updated" : "2009-07-30T13:21:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:2311691", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2; transposon insertion 2.339, Medical College of Wisconsin", "display_text" : "protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2; transposon insertion 2.339, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ppfia2[Tn(sb-T2/Bart3)2.339Mcwi]", "display_text" : "Ppfia2Tn(sb-T2/Bart3)2.339Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ppfia2Tn(sb-T2/Bart3)2.339Mcwi", "display_text" : "Ppfia2Tn(sb-T2/Bart3)2.339Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2313459", "page_area" : "allele", "display_name" : "RGD:2313459" } }, "date_created" : "2009-09-28T12:39:52.000-05:00", "date_updated" : "2009-09-28T12:39:52.000-05:00", "internal" : false, "primary_external_id" : "RGD:2313459", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "like-glycosyltransferase; transposon insertion 2.336, Medical College of Wisconsin", "display_text" : "like-glycosyltransferase; transposon insertion 2.336, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Large[Tn(sb-T2/Bart3)2.336Mcwi]", "display_text" : "LargeTn(sb-T2/Bart3)2.336Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LargeTn(sb-T2/Bart3)2.336Mcwi", "display_text" : "LargeTn(sb-T2/Bart3)2.336Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2313460", "page_area" : "allele", "display_name" : "RGD:2313460" } }, "date_created" : "2009-09-28T12:39:53.000-05:00", "date_updated" : "2009-09-28T12:39:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:2313460", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP/GTP binding protein-like 4; transposon insertion 2.337, Medical College of Wisconsin", "display_text" : "ATP/GTP binding protein-like 4; transposon insertion 2.337, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Agbl4[Tn(sb-T2/Bart3)2.337Mcwi]", "display_text" : "Agbl4Tn(sb-T2/Bart3)2.337Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Agbl4Tn(sb-T2/Bart3)2.337Mcwi", "display_text" : "Agbl4Tn(sb-T2/Bart3)2.337Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2313461", "page_area" : "allele", "display_name" : "RGD:2313461" } }, "date_created" : "2009-09-28T12:39:53.000-05:00", "date_updated" : "2009-09-28T12:39:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:2313461", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phospholipase D family, member 5; transposon insertion 2.340, Medical College of Wisconsin", "display_text" : "phospholipase D family, member 5; transposon insertion 2.340, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pld5[Tn(sb-T2/Bart3)2.340Mcwi]", "display_text" : "Pld5Tn(sb-T2/Bart3)2.340Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pld5Tn(sb-T2/Bart3)2.340Mcwi", "display_text" : "Pld5Tn(sb-T2/Bart3)2.340Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2313462", "page_area" : "allele", "display_name" : "RGD:2313462" } }, "date_created" : "2009-09-28T12:39:54.000-05:00", "date_updated" : "2009-09-28T12:39:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:2313462", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "PATJ, crumbs cell polarity complex component; transposon insertion 2.343, Medical College of Wisconsin", "display_text" : "PATJ, crumbs cell polarity complex component; transposon insertion 2.343, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-08-01T15:12:31.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Patj[Tn(sb-T2/Bart3)2.343Mcwi]", "display_text" : "PatjTn(sb-T2/Bart3)2.343Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "InadlTn(sb-T2/Bart3)2.343Mcwi", "display_text" : "InadlTn(sb-T2/Bart3)2.343Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "InaD-like (Drosophila); transposon insertion 2.343, Medical College of Wisconsin", "display_text" : "InaD-like (Drosophila); transposon insertion 2.343, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Inadl[Tn(sb-T2/Bart3)2.343Mcwi]", "display_text" : "InadlTn(sb-T2/Bart3)2.343Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "PatjTn(sb-T2/Bart3)2.343Mcwi", "display_text" : "PatjTn(sb-T2/Bart3)2.343Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2314335", "page_area" : "allele", "display_name" : "RGD:2314335" } }, "date_created" : "2009-11-11T13:06:38.000-06:00", "date_updated" : "2009-11-11T13:06:38.000-06:00", "internal" : false, "primary_external_id" : "RGD:2314335", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "palladin, cytoskeletal associated protein; transposon insertion 2.341, Medical College of Wisconsin", "display_text" : "palladin, cytoskeletal associated protein; transposon insertion 2.341, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2013-03-26T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Palld[Tn(sb-T2/Bart3)2.341Mcwi]", "display_text" : "PalldTn(sb-T2/Bart3)2.341Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "transposon insertion 2.341, Medical College of Wisconsin", "display_text" : "transposon insertion 2.341, Medical College of Wisconsin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "LOC290704[Tn(sb-T2/Bart3)2.341Mcwi]", "display_text" : "LOC290704Tn(sb-T2/Bart3)2.341Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "similar to palladin", "display_text" : "similar to palladin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "PalldTn(sb-T2/Bart3)2.341Mcwi", "display_text" : "PalldTn(sb-T2/Bart3)2.341Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2314336", "page_area" : "allele", "display_name" : "RGD:2314336" } }, "date_created" : "2009-11-11T13:06:39.000-06:00", "date_updated" : "2009-11-11T13:06:39.000-06:00", "internal" : false, "primary_external_id" : "RGD:2314336", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "acyl-Coenzyme A oxidase-like; transposon insertion 2.342, Medical College of Wisconsin", "display_text" : "acyl-Coenzyme A oxidase-like; transposon insertion 2.342, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Acoxl[Tn(sb-T2/Bart3)2.342Mcwi]", "display_text" : "AcoxlTn(sb-T2/Bart3)2.342Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "AcoxlTn(sb-T2/Bart3)2.342Mcwi", "display_text" : "AcoxlTn(sb-T2/Bart3)2.342Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2314337", "page_area" : "allele", "display_name" : "RGD:2314337" } }, "date_created" : "2009-11-11T13:06:39.000-06:00", "date_updated" : "2009-11-11T13:06:39.000-06:00", "internal" : false, "primary_external_id" : "RGD:2314337", "note_dtos" : [ { "internal" : false, "free_text" : "this mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "autism susceptibility candidate 2; transposon insertion 2.344, Medical College of Wisconsin", "display_text" : "autism susceptibility candidate 2; transposon insertion 2.344, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Auts2[Tn(sb-T2/Bart3)2.344Mcwi]", "display_text" : "Auts2Tn(sb-T2/Bart3)2.344Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Auts2Tn(sb-T2/Bart3)2.344Mcwi", "display_text" : "Auts2Tn(sb-T2/Bart3)2.344Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2314338", "page_area" : "allele", "display_name" : "RGD:2314338" } }, "date_created" : "2009-11-11T13:06:39.000-06:00", "date_updated" : "2009-11-11T13:06:39.000-06:00", "internal" : false, "primary_external_id" : "RGD:2314338", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:17557177", "RGD:2290040", "RGD:629526" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "coagulation factor VIII, procoagulant component; mutation 1, Ycb", "display_text" : "coagulation factor VIII, procoagulant component; mutation 1, Ycb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "F8[m1Ycb]", "display_text" : "F8m1Ycb", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "F8m1Ycb", "display_text" : "F8m1Ycb", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:2314903", "page_area" : "allele", "display_name" : "RGD:2314903" } }, "date_created" : "2009-12-08T00:00:00.000-06:00", "date_updated" : "2013-06-17T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:2314903", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a naturally occurring missense mutation found in an inherited coagulopathy arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:20626616", "RGD:2314860", "RGD:7245964" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "chromodomain helicase DNA binding protein 8; CRISPR/Cas9 system induced mutant 1, Mcwi", "display_text" : "chromodomain helicase DNA binding protein 8; CRISPR/Cas9 system induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Chd8[em1Mcwi]", "display_text" : "Chd8em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:25330100", "page_area" : "allele", "display_name" : "RGD:25330100" } }, "date_created" : "2020-04-07T16:29:27.000-05:00", "date_updated" : "2020-04-07T16:29:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:25330100", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/Cas9 system. It introduced a 5-bp deletion in exon 3 of rat Chd8gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "contactin associated protein 2; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "contactin associated protein 2; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cntnap2[em1Mcwi]", "display_text" : "Cntnap2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:25330101", "page_area" : "allele", "display_name" : "RGD:25330101" } }, "date_created" : "2020-04-07T16:37:58.000-05:00", "date_updated" : "2020-04-07T16:37:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:25330101", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 was used to introduce a 1-bp deletion in exon 6 of rat Cntnap2 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "dual specificity tyrosine phosphorylation regulated kinase 1A; CRISPR/Cas9 induced mutant 3, Mcwi", "display_text" : "dual specificity tyrosine phosphorylation regulated kinase 1A; CRISPR/Cas9 induced mutant 3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dyrk1a[em3Mcwi]", "display_text" : "Dyrk1aem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:25394527", "page_area" : "allele", "display_name" : "RGD:25394527" } }, "date_created" : "2020-04-09T11:13:14.000-05:00", "date_updated" : "2020-04-09T11:13:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:25394527", "note_dtos" : [ { "internal" : false, "free_text" : "The mutated allele was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "epoxide hydrolase 2;CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "epoxide hydrolase 2;CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ephx2[em2Mcwi]", "display_text" : "Ephx2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:25394529", "page_area" : "allele", "display_name" : "RGD:25394529" } }, "date_created" : "2020-04-09T13:26:52.000-05:00", "date_updated" : "2020-05-28T17:18:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:25394529", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Scn2a[em1Mcwi]", "display_text" : "Scn2aem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:25394531", "page_area" : "allele", "display_name" : "RGD:25394531" } }, "date_created" : "2020-04-09T13:40:46.000-05:00", "date_updated" : "2020-04-09T13:40:46.000-05:00", "internal" : false, "primary_external_id" : "RGD:25394531", "note_dtos" : [ { "internal" : false, "free_text" : "The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 2, Mcwi", "display_text" : "sodium voltage-gated channel alpha subunit 2; CRISPR/Cas9 induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Scn2a[em2Mcwi]", "display_text" : "Scn2aem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:25394533", "page_area" : "allele", "display_name" : "RGD:25394533" } }, "date_created" : "2020-04-09T13:49:23.000-05:00", "date_updated" : "2020-04-09T13:49:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:25394533", "note_dtos" : [ { "internal" : false, "free_text" : "The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 4-bp deletion in exon 5 of the gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "renin; ZFN induced mutant 2, MCWi", "display_text" : "renin; ZFN induced mutant 2, MCWi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ren[em2Mcwi]", "display_text" : "Renem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:27095886", "page_area" : "allele", "display_name" : "RGD:27095886" } }, "date_created" : "2020-05-14T15:28:14.000-05:00", "date_updated" : "2020-05-14T15:28:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:27095886", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Hmgc23)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "spondin 2; TALEN induced mutant1, Holi", "display_text" : "spondin 2; TALEN induced mutant1, Holi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Spon2[em1Holi]", "display_text" : "Spon2em1Holi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:329333021", "page_area" : "allele", "display_name" : "RGD:329333021" } }, "date_created" : "2023-04-26T10:46:39.000-05:00", "date_updated" : "2023-04-26T10:46:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:329333021", "note_dtos" : [ { "internal" : false, "free_text" : "This Spon2 deleted mutationt was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25751394", "RGD:329328927" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "izumo sperm-oocyte fusion 1;CRISPR/Cas9 induced mutant 1,Osb", "display_text" : "izumo sperm-oocyte fusion 1;CRISPR/Cas9 induced mutant 1,Osb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Izumo1[em1Osb]", "display_text" : "Izumo1em1Osb", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:329845587", "page_area" : "allele", "display_name" : "RGD:329845587" } }, "date_created" : "2023-05-30T14:08:56.000-05:00", "date_updated" : "2023-05-30T14:08:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:329845587", "note_dtos" : [ { "internal" : false, "free_text" : "This CRISPR/Cas9 induced mutant allele carries a 7-bp deletion（CTTTGGA）after start codon (Met) in exon2 of Izumo1 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "serpin family A member 6; CRISPR/cas9 induced mutant 1, Glha", "display_text" : "serpin family A member 6; CRISPR/cas9 induced mutant 1, Glha", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Serpina6[em1Glha]", "display_text" : "Serpina6em1Glha", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:329955453", "page_area" : "allele", "display_name" : "RGD:329955453" } }, "date_created" : "2023-07-12T11:56:14.000-05:00", "date_updated" : "2023-07-12T11:56:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:329955453", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by CRISPR/cas9 in Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "purinergic receptor P2X 7; ZFN induced mutant 1, Tja", "display_text" : "purinergic receptor P2X 7; ZFN induced mutant 1, Tja", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "P2rx7[em1Tja]", "display_text" : "P2rx7em1Tja", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:329955460", "page_area" : "allele", "display_name" : "RGD:329955460" } }, "date_created" : "2023-07-12T14:13:34.000-05:00", "date_updated" : "2023-07-12T14:13:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:329955460", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was created by ZFN technology to generate a 2-bp ,AT, insertion in exon 10", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:35239186", "RGD:329901932" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 1, Matsu", "display_text" : "collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 1, Matsu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Col4a5[em1Matsu]", "display_text" : "Col4a5em1Matsu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:329969888", "page_area" : "allele", "display_name" : "RGD:329969888" } }, "date_created" : "2023-07-26T13:34:43.000-05:00", "date_updated" : "2023-07-26T13:34:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:329969888", "note_dtos" : [ { "internal" : false, "free_text" : "Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:34675305", "RGD:329845598" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 2, Matsu", "display_text" : "collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 2, Matsu", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2024-01-11T10:26:40.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Col4a5[em2Matsu]", "display_text" : "Col4a5em2Matsu", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "WKY-Col4a5[em2Matsu]", "display_text" : "WKY-Col4a5em2Matsu", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:329969892", "page_area" : "allele", "display_name" : "RGD:329969892" } }, "date_created" : "2023-07-26T13:41:20.000-05:00", "date_updated" : "2023-07-26T13:41:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:329969892", "note_dtos" : [ { "internal" : false, "free_text" : "Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:34675305", "RGD:329845598" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 3, Matsu", "display_text" : "collagen type IV alpha 5 chain; CRISPR/Cas9 induced mutant 3, Matsu", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2023-07-26T13:58:33.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Col4a5[em3Matsu]", "display_text" : "Col4a5em3Matsu", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "WKY-Col4a5[em3Matsu]", "display_text" : "WKY-Col4a5em3Matsu", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:329969893", "page_area" : "allele", "display_name" : "RGD:329969893" } }, "date_created" : "2023-07-26T13:47:20.000-05:00", "date_updated" : "2023-07-26T13:47:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:329969893", "note_dtos" : [ { "internal" : false, "free_text" : "Genome editing was performed using the rGONAD method to produce three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene. This em3 mutant carries a deletion of 56 base pairs containing the first methioine.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:34675305", "RGD:329845598" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 1, Jfco", "display_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 1, Jfco", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hamp[ em1Jfcol ]", "display_text" : "Hamp em1Jfcol ", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38455987", "page_area" : "allele", "display_name" : "RGD:38455987" } }, "date_created" : "2020-08-07T11:39:40.000-05:00", "date_updated" : "2020-08-07T11:39:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:38455987", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 169-bp deletion between exons 2 & 3 of rat Hamp gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 2, Jfco", "display_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 2, Jfco", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hamp[ em2Jfcol ]", "display_text" : "Hamp em2Jfcol ", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38455989", "page_area" : "allele", "display_name" : "RGD:38455989" } }, "date_created" : "2020-08-07T12:00:00.000-05:00", "date_updated" : "2020-08-07T12:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:38455989", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 3, Jfco", "display_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 3, Jfco", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hamp[ em3Jfcol ]", "display_text" : "Hamp em3Jfcol ", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38455990", "page_area" : "allele", "display_name" : "RGD:38455990" } }, "date_created" : "2020-08-07T12:14:13.000-05:00", "date_updated" : "2020-08-07T12:14:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:38455990", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 4, Jfco", "display_text" : "hepcidin antimicrobial peptide; TALEN induced mutant 4, Jfco", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hamp[ em4Jfcol ]", "display_text" : "Hamp em4Jfcol ", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38455991", "page_area" : "allele", "display_name" : "RGD:38455991" } }, "date_created" : "2020-08-07T12:24:39.000-05:00", "date_updated" : "2020-08-07T12:27:52.000-05:00", "internal" : false, "primary_external_id" : "RGD:38455991", "note_dtos" : [ { "internal" : false, "free_text" : "The TALEN genome editing system was used to generate this mutant allele in the outbred Sprague Dawley embryo. . The TALEN system created a 15-bp deletion in exon 2 of the rat Hamp gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ceruloplasmin; CRISPR/Cas9 induced mutant1, Ang", "display_text" : "ceruloplasmin; CRISPR/Cas9 induced mutant1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cp[em1Ang]", "display_text" : "Cpem1Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38501062", "page_area" : "allele", "display_name" : "RGD:38501062" } }, "date_created" : "2020-08-14T14:42:41.000-05:00", "date_updated" : "2020-08-14T14:42:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:38501062", "note_dtos" : [ { "internal" : false, "free_text" : "The mutations created by CRISPR/Cas9 in the Crl:SD embryos contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31560858", "RGD:38549582" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Ang", "display_text" : "bone morphogenetic protein receptor type 2; ZFN induced mutant 1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bmpr2[em1Ang]", "display_text" : "Bmpr2em1Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38501087", "page_area" : "allele", "display_name" : "RGD:38501087" } }, "date_created" : "2020-08-17T10:53:02.000-05:00", "date_updated" : "2020-08-17T10:53:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:38501087", "note_dtos" : [ { "internal" : false, "free_text" : "The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25593290", "RGD:38500244" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "TBC1 domain family, member 4; CRISPR/Cas9 system induced mutant 1,", "display_text" : "TBC1 domain family, member 4; CRISPR/Cas9 system induced mutant 1,", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2020-09-03T14:03:09.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tbc1d4[em1]", "display_text" : "Tbc1d4em1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tbc1d4[em1M]", "display_text" : "Tbc1d4em1M", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38596330", "page_area" : "allele", "display_name" : "RGD:38596330" } }, "date_created" : "2020-09-03T13:59:54.000-05:00", "date_updated" : "2020-09-03T13:59:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:38596330", "note_dtos" : [ { "internal" : false, "free_text" : "A 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) in the rat Tbc1d4 gene was created in outbred Wistar zygotes with CRISPR/Cas9 system.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31034517", "PMID:32053588", "RGD:38596323", "RGD:38596332" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "retinoic acid receptor responder 2; CRISPR/Cas9 induced mutant 1, Msu", "display_text" : "retinoic acid receptor responder 2; CRISPR/Cas9 induced mutant 1, Msu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rarres2[em1Msu]", "display_text" : "Rarres2em1Msu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38596341", "page_area" : "allele", "display_name" : "RGD:38596341" } }, "date_created" : "2020-09-04T12:35:37.000-05:00", "date_updated" : "2020-09-04T12:35:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:38596341", "note_dtos" : [ { "internal" : false, "free_text" : "Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:29906243", "RGD:38596340" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "defensin beta 23;CRISPR/Cas9 induced mutant1, Mlit", "display_text" : "defensin beta 23;CRISPR/Cas9 induced mutant1, Mlit", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Defb23[em1Mlit]", "display_text" : "Defb23em1Mlit", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599011", "page_area" : "allele", "display_name" : "RGD:38599011" } }, "date_created" : "2020-09-08T16:05:49.000-05:00", "date_updated" : "2020-09-08T16:05:49.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599011", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "defensin beta 26; CRISPR/Cas9 induced mutant1, Mlit", "display_text" : "defensin beta 26; CRISPR/Cas9 induced mutant1, Mlit", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Defb26[em1Mlit]", "display_text" : "Defb26em1Mlit", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599012", "page_area" : "allele", "display_name" : "RGD:38599012" } }, "date_created" : "2020-09-08T16:09:47.000-05:00", "date_updated" : "2020-09-08T16:09:47.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599012", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "defensin beta 42; CRISPR/Cas9 induced mutant1, Mlit", "display_text" : "defensin beta 42; CRISPR/Cas9 induced mutant1, Mlit", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Defb42[em1Mlit]", "display_text" : "Defb42em1Mlit", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599013", "page_area" : "allele", "display_name" : "RGD:38599013" } }, "date_created" : "2020-09-08T16:13:24.000-05:00", "date_updated" : "2020-09-08T16:13:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599013", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "defensin beta 23, defensin beta 26; CRISPR/Cas9 induced mutant2, Mlit", "display_text" : "defensin beta 23, defensin beta 26; CRISPR/Cas9 induced mutant2, Mlit", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Defb23[em2Mlit]Defb26[em2Mlit]", "display_text" : "Defb23em2MlitDefb26em2Mlit", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599014", "page_area" : "allele", "display_name" : "RGD:38599014" } }, "date_created" : "2020-09-08T16:18:12.000-05:00", "date_updated" : "2020-09-08T16:18:12.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599014", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate this double-gene knockout. The Slc:SD zygotes were injected with sgRNAs that containing 4 sgRNAs (5 ng/ml each) targeting 2 adjacent sites (target sites 1 and 2) of each of the 2 genes. The resulting mutations are 317 bp (Defb23) and 380 bp (Defb26) fragments which were deleted in the Defb23/Defb26 double-mutant strain.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29141997", "RGD:13782190" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "L1 cell adhesion molecule;CRISPR/Cas9 induced mutant1,JGN", "display_text" : "L1 cell adhesion molecule;CRISPR/Cas9 induced mutant1,JGN", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "L1cam[em1Jgn]", "display_text" : "L1camem1Jgn", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599015", "page_area" : "allele", "display_name" : "RGD:38599015" } }, "date_created" : "2020-09-08T16:27:53.000-05:00", "date_updated" : "2020-09-08T16:27:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599015", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "eukaryotic translation initiation factor 2 alpha kinase 4; CRISPR/Cas9 induced mutant1", "display_text" : "eukaryotic translation initiation factor 2 alpha kinase 4; CRISPR/Cas9 induced mutant1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Eif2ak4[em1]", "display_text" : "Eif2ak4em1", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599016", "page_area" : "allele", "display_name" : "RGD:38599016" } }, "date_created" : "2020-09-08T16:38:09.000-05:00", "date_updated" : "2020-09-08T16:38:09.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599016", "note_dtos" : [ { "internal" : false, "free_text" : "The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "autoimmune regulator; ZFN induced mutant1, Ang", "display_text" : "autoimmune regulator; ZFN induced mutant1, Ang", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Aire[em1Ang]", "display_text" : "Aireem1Ang", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599148", "page_area" : "allele", "display_name" : "RGD:38599148" } }, "date_created" : "2020-09-09T14:33:08.000-05:00", "date_updated" : "2020-09-09T14:33:08.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599148", "note_dtos" : [ { "internal" : false, "free_text" : "The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29959280", "RGD:38599145" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lipin 1; ENU induced mutant 1, Hubr", "display_text" : "lipin 1; ENU induced mutant 1, Hubr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lpin1[m1Hubr]", "display_text" : "Lpin1m1Hubr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599153", "page_area" : "allele", "display_name" : "RGD:38599153" } }, "date_created" : "2020-09-11T09:24:21.000-05:00", "date_updated" : "2020-09-11T09:24:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599153", "note_dtos" : [ { "internal" : false, "free_text" : "The mutation in Crl: Wistar was created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5′-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:21715287", "RGD:38599010" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "thymocyte selection associated; mutant1, Adej", "display_text" : "thymocyte selection associated; mutant1, Adej", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Themis[m1Adej]", "display_text" : "Themism1Adej", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599156", "page_area" : "allele", "display_name" : "RGD:38599156" } }, "date_created" : "2020-09-11T10:15:15.000-05:00", "date_updated" : "2020-09-11T10:15:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599156", "note_dtos" : [ { "internal" : false, "free_text" : "This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22275874", "RGD:38599149" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas", "display_text" : "recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag2[em1Iexas]", "display_text" : "Rag2em1Iexas", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599191", "page_area" : "allele", "display_name" : "RGD:38599191" } }, "date_created" : "2020-09-14T15:27:56.000-05:00", "date_updated" : "2020-09-14T15:27:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599191", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant1, Kyo", "display_text" : "DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Depdc5[em1Kyo]", "display_text" : "Depdc5em1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599194", "page_area" : "allele", "display_name" : "RGD:38599194" } }, "date_created" : "2020-09-14T16:41:53.000-05:00", "date_updated" : "2020-09-14T16:41:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599194", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26873552", "RGD:11573213" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant2, Kyo", "display_text" : "DEP domain containing 5, GATOR1 subcomplex subunit; TALEN induced mutant2, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Depdc5[em2Kyo]", "display_text" : "Depdc5em2Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38599195", "page_area" : "allele", "display_name" : "RGD:38599195" } }, "date_created" : "2020-09-14T16:45:45.000-05:00", "date_updated" : "2020-09-14T16:45:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:38599195", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26873552", "RGD:11573213" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily A, member 1; ZFN induced mutant 1, Kcrd", "display_text" : "transient receptor potential cation channel, subfamily A, member 1; ZFN induced mutant 1, Kcrd", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpa1[em1Kcrd]", "display_text" : "Trpa1em1Kcrd", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38676449", "page_area" : "allele", "display_name" : "RGD:38676449" } }, "date_created" : "2020-09-17T13:25:58.000-05:00", "date_updated" : "2020-09-17T13:25:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:38676449", "note_dtos" : [ { "internal" : false, "free_text" : "This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "crystallin, beta A1; HiSER mutant", "display_text" : "crystallin, beta A1; HiSER mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cryba1[Hiser]", "display_text" : "Cryba1Hiser", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:38676462", "page_area" : "allele", "display_name" : "RGD:38676462" } }, "date_created" : "2020-09-18T13:04:40.000-05:00", "date_updated" : "2020-09-18T13:04:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:38676462", "note_dtos" : [ { "internal" : false, "free_text" : "HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:26303524", "RGD:38676460" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transient receptor potential cation channel, subfamily V, member 4; ZFN induced mutant1, Sage", "display_text" : "transient receptor potential cation channel, subfamily V, member 4; ZFN induced mutant1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trpv4[em1Sage]", "display_text" : "Trpv4em1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:39456109", "page_area" : "allele", "display_name" : "RGD:39456109" } }, "date_created" : "2020-10-02T14:53:42.000-05:00", "date_updated" : "2020-10-02T14:53:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:39456109", "note_dtos" : [ { "internal" : false, "free_text" : "This Trpv4 allele has a 899-bp deletion which completely removes exon 13, plus parts of intron 12-13 and intron 13-14 .", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 1, Mcwi", "display_text" : "von Willebrand factor; CRISPR/Cas9 system induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Vwf[em1Mcwi]", "display_text" : "Vwfem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:39457948", "page_area" : "allele", "display_name" : "RGD:39457948" } }, "date_created" : "2020-10-09T11:03:06.000-05:00", "date_updated" : "2020-10-09T11:03:06.000-05:00", "internal" : false, "primary_external_id" : "RGD:39457948", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon in the Sprague Dawley embryos .", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myeloperoxidase; CRISPR/SpCas9 induced mutant1, Mcwi", "display_text" : "myeloperoxidase; CRISPR/SpCas9 induced mutant1, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2023-08-07T14:26:36.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Mpo[em1Mcwi]", "display_text" : "Mpoem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mpo[ em1Mcwi]", "display_text" : "Mpo em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401717573", "page_area" : "allele", "display_name" : "RGD:401717573" } }, "date_created" : "2023-08-07T14:21:07.000-05:00", "date_updated" : "2023-08-07T14:21:07.000-05:00", "internal" : false, "primary_external_id" : "RGD:401717573", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/SpCas9 system was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in the Crl:SD embryo.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:151665774" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nanos C2HC-type zinc finger 3; CRISPR/Cas9 induced mutant 1, Nips", "display_text" : "nanos C2HC-type zinc finger 3; CRISPR/Cas9 induced mutant 1, Nips", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nanos3[em1(tdTomato)Nips]", "display_text" : "Nanos3em1(tdTomato)Nips", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401795483", "page_area" : "allele", "display_name" : "RGD:401795483" } }, "date_created" : "2023-09-11T15:31:52.000-05:00", "date_updated" : "2023-09-11T15:31:52.000-05:00", "internal" : false, "primary_external_id" : "RGD:401795483", "note_dtos" : [ { "internal" : false, "free_text" : "The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats.", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:35389778", "RGD:401795482" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 30, member 10; CRISPR/Cas9 induced mutant 1, Sommu", "display_text" : "solute carrier family 30, member 10; CRISPR/Cas9 induced mutant 1, Sommu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc30a10[em1Sommu]", "display_text" : "Slc30a10em1Sommu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401795485", "page_area" : "allele", "display_name" : "RGD:401795485" } }, "date_created" : "2023-09-11T16:34:57.000-05:00", "date_updated" : "2023-09-11T16:34:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:401795485", "note_dtos" : [ { "internal" : false, "free_text" : "Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prolactin family 7, subfamily B, member 1; CRISPR/Cas9 induced mutant1, Soar", "display_text" : "prolactin family 7, subfamily B, member 1; CRISPR/Cas9 induced mutant1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prl7b1[em1Soar]", "display_text" : "Prl7b1em1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401900751", "page_area" : "allele", "display_name" : "RGD:401900751" } }, "date_created" : "2023-11-21T15:12:50.000-06:00", "date_updated" : "2023-11-21T15:12:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:401900751", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prolactin family 7, subfamily B, member 1; CRISPR/Cas9 target mutant1, Soar", "display_text" : "prolactin family 7, subfamily B, member 1; CRISPR/Cas9 target mutant1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prl7b1[tm1(cre)Soar]", "display_text" : "Prl7b1tm1(cre)Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401900752", "page_area" : "allele", "display_name" : "RGD:401900752" } }, "date_created" : "2023-11-21T15:18:35.000-06:00", "date_updated" : "2023-11-21T15:18:35.000-06:00", "internal" : false, "primary_external_id" : "RGD:401900752", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site.", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 1, Odev", "display_text" : "cystinosin, lysosomal cystine transporter; CRISPR/Cas9 induced mutant 1, Odev", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ctns[em1Odev]", "display_text" : "Ctnsem1Odev", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401938654", "page_area" : "allele", "display_name" : "RGD:401938654" } }, "date_created" : "2023-12-19T11:56:56.000-06:00", "date_updated" : "2023-12-19T11:56:56.000-06:00", "internal" : false, "primary_external_id" : "RGD:401938654", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was produced by targeting Ctns gene in Sprague Dawley rats (PolyGene AG, Zurich,Switzer-land). Two single guide RNAs (sgRNAs) targeting exon3 o fCtns were selected:CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG),CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resulting in a premature stop codon in the exon3 of Ctns.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Iexas", "display_text" : "aryl hydrocarbon receptor; CRISPR/Cas9 induced mutant1, Iexas", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ahr[em1Iexas]", "display_text" : "Ahrem1Iexas", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401940199", "page_area" : "allele", "display_name" : "RGD:401940199" } }, "date_created" : "2024-01-08T13:08:04.000-06:00", "date_updated" : "2024-01-08T13:08:04.000-06:00", "internal" : false, "primary_external_id" : "RGD:401940199", "note_dtos" : [ { "internal" : false, "free_text" : "The allele was created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:33836606", "RGD:401940192" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Crh[tm1(Cre)Kji]", "display_text" : "Crhtm1(Cre)Kji", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Crh[tm1(Cre)Kji]", "display_text" : "Crhtm1(Cre)Kji", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:401976373", "page_area" : "allele", "display_name" : "RGD:401976373" } }, "date_created" : "2024-02-21T09:42:19.000-06:00", "date_updated" : "2024-02-21T09:42:19.000-06:00", "internal" : false, "primary_external_id" : "RGD:401976373", "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "estrogen receptor 1; CRISPR/Cas9 induced mutant 1, Bra", "display_text" : "estrogen receptor 1; CRISPR/Cas9 induced mutant 1, Bra", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Esr1[em1Bra]", "display_text" : "Esr1em1Bra", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:405649861", "page_area" : "allele", "display_name" : "RGD:405649861" } }, "date_created" : "2024-04-17T14:46:09.000-05:00", "date_updated" : "2024-04-17T14:46:09.000-05:00", "internal" : false, "primary_external_id" : "RGD:405649861", "note_dtos" : [ { "internal" : false, "free_text" : "This CRISPR/Cas9 system was used to generate a 25 bp deletion in the rat Esr1, resulting lost of function for Esr1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:33497359", "RGD:405649859" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "microRNA 500", "display_text" : "microRNA 500", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mir500 [em1Cgen]", "display_text" : "Mir500 em1Cgen", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:405850242", "page_area" : "allele", "display_name" : "RGD:405850242" } }, "date_created" : "2024-06-04T11:13:52.000-05:00", "date_updated" : "2024-06-04T11:13:52.000-05:00", "internal" : false, "primary_external_id" : "RGD:405850242", "note_dtos" : [ { "internal" : false, "free_text" : "This Mir500 allele carrying a 8-bp deletion (GCACCTGG) was generated in the Sprague Dawley embryo using TALENs system.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:27277808", "RGD:405850240" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "forkhead box O4; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Foxo4[em1Soar]", "display_text" : "Foxo4em1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:405855878", "page_area" : "allele", "display_name" : "RGD:405855878" } }, "date_created" : "2024-06-18T15:01:56.000-05:00", "date_updated" : "2024-06-18T15:01:56.000-05:00", "internal" : false, "primary_external_id" : "RGD:405855878", "note_dtos" : [ { "internal" : false, "free_text" : "This Foxo4 mutant allele was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:36607602", "RGD:158013768" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 6; CRISPR/Cas9 induced mutant 1, Yona", "display_text" : "interleukin 6; CRISPR/Cas9 induced mutant 1, Yona", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Il6[em1Yona]", "display_text" : "Il6em1Yona", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il6[em1Yona-/-]", "display_text" : "Il6em1Yona-/-", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:407450416", "page_area" : "allele", "display_name" : "RGD:407450416" } }, "date_created" : "2024-09-06T10:46:19.000-05:00", "date_updated" : "2024-09-06T10:46:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:407450416", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This allele carries a118 bp deleted in the second exon of IL-6", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:38602915", "RGD:407450417" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RPTOR independent companion of MTOR, complex 2; CRISPR/Cas9 system induced mutant 4, Mcwi", "display_text" : "RPTOR independent companion of MTOR, complex 2; CRISPR/Cas9 system induced mutant 4, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rictor[em4Mcwi]", "display_text" : "Rictorem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40818254", "page_area" : "allele", "display_name" : "RGD:40818254" } }, "date_created" : "2020-11-16T11:24:54.000-06:00", "date_updated" : "2020-11-16T11:24:54.000-06:00", "internal" : false, "primary_external_id" : "RGD:40818254", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was injected to the SS/JrHsdMcwi embryo to introduce a 11-bp deletion in exon 19 of rat Rictor gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "proline rich 5;CRISPR/Cas9 system induced mutant 2, Mcwi", "display_text" : "proline rich 5;CRISPR/Cas9 system induced mutant 2, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prr5[em2Mcwi]", "display_text" : "Prr5em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40818255", "page_area" : "allele", "display_name" : "RGD:40818255" } }, "date_created" : "2020-11-16T11:32:29.000-06:00", "date_updated" : "2020-11-16T11:32:29.000-06:00", "internal" : false, "primary_external_id" : "RGD:40818255", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "proline rich 5;CRISPR/Cas9 system induced mutant 1, Mcwi", "display_text" : "proline rich 5;CRISPR/Cas9 system induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prr5[em1Mcwi]", "display_text" : "Prr5em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40818256", "page_area" : "allele", "display_name" : "RGD:40818256" } }, "date_created" : "2020-11-16T11:36:05.000-06:00", "date_updated" : "2020-11-16T11:36:05.000-06:00", "internal" : false, "primary_external_id" : "RGD:40818256", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 3,Hfd", "display_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 3,Hfd", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2024-11-05T16:18:23.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Vdr[em3Hfd]", "display_text" : "Vdrem3Hfd", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:408364962", "page_area" : "allele", "display_name" : "RGD:408364962" } }, "date_created" : "2024-11-05T15:24:09.000-06:00", "date_updated" : "2024-11-05T15:24:09.000-06:00", "internal" : false, "primary_external_id" : "RGD:408364962", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele carries 5-bp deletion (CCCCG) in exon 3 of Vdr gene induced by CRISPR/Cas9 system in the embryos of F344-ApcPirc/Uwm rats (RGD:1641862).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 1,Hfd", "display_text" : "vitamin D receptor; CRISPR/Cas9 induced mutant 1,Hfd", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Vdr[em1Hfd]", "display_text" : "Vdrem1Hfd", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:408364972", "page_area" : "allele", "display_name" : "RGD:408364972" } }, "date_created" : "2024-11-06T10:57:55.000-06:00", "date_updated" : "2024-11-06T10:57:55.000-06:00", "internal" : false, "primary_external_id" : "RGD:408364972", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to introduce a net 12-bp deletion in exon 3 of the Vdr gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGcccccggatctgtgGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGt----- GAGTGTGTGGAGACCGAGCCAC", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 1,Hfd", "display_text" : "cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 1,Hfd", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp27b1[em1Hfd]", "display_text" : "Cyp27b1em1Hfd", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:408364974", "page_area" : "allele", "display_name" : "RGD:408364974" } }, "date_created" : "2024-11-06T15:28:42.000-06:00", "date_updated" : "2024-11-06T15:28:42.000-06:00", "internal" : false, "primary_external_id" : "RGD:408364974", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCAAAGGGGG KO: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCAAAGGGGG", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 2,Hfd", "display_text" : "cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 2,Hfd", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp27b1[em2Hfd]", "display_text" : "Cyp27b1em2Hfd", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:408364975", "page_area" : "allele", "display_name" : "RGD:408364975" } }, "date_created" : "2024-11-06T15:44:20.000-06:00", "date_updated" : "2024-11-06T15:44:20.000-06:00", "internal" : false, "primary_external_id" : "RGD:408364975", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG KO: CTCGCCTCCA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "complement C1q like 3; CRISPR/Cas9 induced mutant1,Lian", "display_text" : "complement C1q like 3; CRISPR/Cas9 induced mutant1,Lian", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "C1ql3[em1Lian]", "display_text" : "C1ql3em1Lian", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:408364987", "page_area" : "allele", "display_name" : "RGD:408364987" } }, "date_created" : "2024-11-08T15:44:33.000-06:00", "date_updated" : "2024-11-08T15:44:33.000-06:00", "internal" : false, "primary_external_id" : "RGD:408364987", "note_dtos" : [ { "internal" : false, "free_text" : "This C1ql3 knock out allele was induced in Wistar embryos.The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "attractin;zitter mutant", "display_text" : "attractin;zitter mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Atrn[zi]", "display_text" : "Atrnzi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40902832", "page_area" : "allele", "display_name" : "RGD:40902832" } }, "date_created" : "2020-12-14T14:01:01.000-06:00", "date_updated" : "2020-12-14T14:01:01.000-06:00", "internal" : false, "primary_external_id" : "RGD:40902832", "note_dtos" : [ { "internal" : false, "free_text" : "An 8-bp deletion at the splice donor site of intron 12 was identified in ZI/Kyo rats, which was expected to result in aberrant and unstable transcripts.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "attractin; myelin vacuolation mutant", "display_text" : "attractin; myelin vacuolation mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Atrn[mv]", "display_text" : "Atrnmv", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40902835", "page_area" : "allele", "display_name" : "RGD:40902835" } }, "date_created" : "2020-12-14T15:21:31.000-06:00", "date_updated" : "2020-12-14T15:21:31.000-06:00", "internal" : false, "primary_external_id" : "RGD:40902835", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is a spontaneous tremor mutant identified in an outbred colony of Sprague-Dawley rats. A genomic deletion of rat Atrn gene, including exon 1 was identified in the MV/Opu rats (RGD:1559043)' This is a null mutation where no Atrn transcript was detected.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:12379762", "RGD:1299186" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "MER proto-oncogene, tyrosine kinase; retinal dystrophy mutant", "display_text" : "MER proto-oncogene, tyrosine kinase; retinal dystrophy mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mertk[rdy]", "display_text" : "Mertkrdy", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40902839", "page_area" : "allele", "display_name" : "RGD:40902839" } }, "date_created" : "2020-12-14T16:44:22.000-06:00", "date_updated" : "2020-12-14T16:44:22.000-06:00", "internal" : false, "primary_external_id" : "RGD:40902839", "note_dtos" : [ { "internal" : false, "free_text" : "A small deletion of DNA that disrupts the gene encoding the receptor tyrosine kinase Mertk was detected in the retinal dystrophy RCS/LavRrrc. The deletion includes the splice acceptor site upstream of the second coding exon of Mertk and results in a shortened transcript that lacks this exon. The aberrant transcript joins the first and third coding exons, leading to a frameshift and a translation termination signal 20 codons after the AUG.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:10699188", "PMID:11592982", "RGD:61793", "RGD:69668" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "estrogen receptor 2; ZFN induced mutant 1, Soar", "display_text" : "estrogen receptor 2; ZFN induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Esr2[em1Soar]", "display_text" : "Esr2em1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40902840", "page_area" : "allele", "display_name" : "RGD:40902840" } }, "date_created" : "2020-12-14T16:59:33.000-06:00", "date_updated" : "2020-12-14T16:59:33.000-06:00", "internal" : false, "primary_external_id" : "RGD:40902840", "note_dtos" : [ { "internal" : false, "free_text" : "Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 4", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28520870", "PMID:29580824", "RGD:38548924", "RGD:38548925" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "KiSS-1 metastasis-suppressor; targeted mutant 1, Nips", "display_text" : "KiSS-1 metastasis-suppressor; targeted mutant 1, Nips", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kiss1[tm1Nips]", "display_text" : "Kiss1tm1Nips", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:40902862", "page_area" : "allele", "display_name" : "RGD:40902862" } }, "date_created" : "2020-12-15T13:52:10.000-06:00", "date_updated" : "2020-12-15T13:52:10.000-06:00", "internal" : false, "primary_external_id" : "RGD:40902862", "note_dtos" : [ { "internal" : false, "free_text" : "This mutation was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:25582792", "RGD:10059342" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ets1[em1Mcwi]", "display_text" : "Ets1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ets1em1Mcwi", "display_text" : "Ets1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139856", "page_area" : "allele", "display_name" : "RGD:4139856" } }, "date_created" : "2010-08-19T16:18:35.000-05:00", "date_updated" : "2010-08-19T16:18:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139856", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 515-522).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:31932071", "RGD:150429812", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "natriuretic peptide precursor A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nppa[em4Mcwi]", "display_text" : "Nppaem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nppaem4Mcwi", "display_text" : "Nppaem4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139857", "page_area" : "allele", "display_name" : "RGD:4139857" } }, "date_created" : "2010-08-19T16:18:35.000-05:00", "date_updated" : "2010-08-19T16:18:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139857", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 22-bp frameshift deletion in exon 2 (del 252-273).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SH2B adaptor protein 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "SH2B adaptor protein 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sh2b3[em1Mcwi]", "display_text" : "Sh2b3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sh2b3em1Mcwi", "display_text" : "Sh2b3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139858", "page_area" : "allele", "display_name" : "RGD:4139858" } }, "date_created" : "2010-08-19T16:18:35.000-05:00", "date_updated" : "2010-08-19T16:18:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139858", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an in-frame 6-bp deletion in exon 2 (del 847-852).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:25776069", "RGD:13442483", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nckap5[em1Mcwi]", "display_text" : "Nckap5em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nap5em1Mcwi", "display_text" : "Nap5em1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nckap5em1Mcwi", "display_text" : "Nckap5em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139859", "page_area" : "allele", "display_name" : "RGD:4139859" } }, "date_created" : "2010-08-19T16:18:36.000-05:00", "date_updated" : "2010-08-19T16:18:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139859", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 1559-1568).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "matrix metallopeptidase 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "matrix metallopeptidase 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mmp2[em1Mcwi]", "display_text" : "Mmp2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mmp2em1Mcwi", "display_text" : "Mmp2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139860", "page_area" : "allele", "display_name" : "RGD:4139860" } }, "date_created" : "2010-08-19T16:18:36.000-05:00", "date_updated" : "2025-08-14T15:08:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139860", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 7 (del 1434-1443).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nckap5[em3Mcwi]", "display_text" : "Nckap5em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nap5em3Mcwi", "display_text" : "Nap5em3Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nckap5em3Mcwi", "display_text" : "Nckap5em3Mcwi", "name_type_name" : "unspecified" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139861", "page_area" : "allele", "display_name" : "RGD:4139861" } }, "date_created" : "2010-08-19T16:18:36.000-05:00", "date_updated" : "2010-08-19T16:18:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139861", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nckap5[em2Mcwi]", "display_text" : "Nckap5em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nap5em2Mcwi", "display_text" : "Nap5em2Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Nckap5em2Mcwi", "display_text" : "Nckap5em2Mcwi", "name_type_name" : "unspecified" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139862", "page_area" : "allele", "display_name" : "RGD:4139862" } }, "date_created" : "2010-08-19T16:18:36.000-05:00", "date_updated" : "2010-08-19T16:18:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139862", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 6 (del 1560-1563).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "renin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "renin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ren[em1Mcwi]", "display_text" : "Renem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "renin", "display_text" : "renin", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Renem1Mcwi", "display_text" : "Renem1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "ren[em2mcwi]", "display_text" : "renem2mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "zinc-finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "zinc-finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139863", "page_area" : "allele", "display_name" : "RGD:4139863" } }, "date_created" : "2010-08-19T16:18:37.000-05:00", "date_updated" : "2010-08-19T16:18:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139863", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 578-587); this causes a truncation of the message from 1451 to 1441 bp leading to a frameshift and premature truncation of the normal open reading frame after codon 185.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:21242461", "RGD:4131263", "RGD:4139871", "RGD:7771614" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sortilin-related VPS10 domain containing receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "sortilin-related VPS10 domain containing receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sorcs1[em1Mcwi]", "display_text" : "Sorcs1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sorcs1em1Mcwi", "display_text" : "Sorcs1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139864", "page_area" : "allele", "display_name" : "RGD:4139864" } }, "date_created" : "2010-08-19T16:18:37.000-05:00", "date_updated" : "2010-08-19T16:18:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139864", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20 (del 1109-1122).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:23780848", "RGD:12910977", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag1[em1Mcwi]", "display_text" : "Rag1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag1em1Mcwi", "display_text" : "Rag1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139865", "page_area" : "allele", "display_name" : "RGD:4139865" } }, "date_created" : "2010-08-19T16:18:37.000-05:00", "date_updated" : "2010-08-19T16:18:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139865", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 681-693).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:23364523", "RGD:4131263", "RGD:4139871", "RGD:7207429" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag1[em2Mcwi]", "display_text" : "Rag1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag1em2Mcwi", "display_text" : "Rag1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139866", "page_area" : "allele", "display_name" : "RGD:4139866" } }, "date_created" : "2010-08-19T16:18:37.000-05:00", "date_updated" : "2010-08-19T16:18:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139866", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 1 (del 687-703).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:23364523", "RGD:4131263", "RGD:629526", "RGD:7207429" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RAB38, member RAS oncogene family; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "RAB38, member RAS oncogene family; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rab38[em1Mcwi]", "display_text" : "Rab38em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rab38em1Mcwi", "display_text" : "Rab38em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139867", "page_area" : "allele", "display_name" : "RGD:4139867" } }, "date_created" : "2010-08-19T16:18:38.000-05:00", "date_updated" : "2010-08-19T16:18:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139867", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 1-bp frameshift deletion in exon 1 (del 155).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:23291471", "RGD:13782139", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NADPH oxidase 4; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "NADPH oxidase 4; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nox4[em2Mcwi]", "display_text" : "Nox4em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nox4em2Mcwi", "display_text" : "Nox4em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139868", "page_area" : "allele", "display_name" : "RGD:4139868" } }, "date_created" : "2010-08-19T16:18:38.000-05:00", "date_updated" : "2010-08-19T16:18:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:4139868", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 7 (del 586-593).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:26644237", "PMID:27279484", "RGD:11085830", "RGD:151347625", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "matrix metallopeptidase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "matrix metallopeptidase 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mmp2[em2Mcwi]", "display_text" : "Mmp2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mmp2em2Mcwi", "display_text" : "Mmp2em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:4139869", "page_area" : "allele", "display_name" : "RGD:4139869" } }, "date_created" : "2010-08-19T16:18:38.000-05:00", "date_updated" : "2020-11-16T11:20:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:4139869", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 8-bp frameshift deletion in exon 7 (del 1433-1440).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:37643020", "RGD:401827835", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "LDL receptor related protein 5;CRISPR/Cas9 induced mutant 1, Vari", "display_text" : "LDL receptor related protein 5;CRISPR/Cas9 induced mutant 1, Vari", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrp5[em1Vari]", "display_text" : "Lrp5em1Vari", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41404647", "page_area" : "allele", "display_name" : "RGD:41404647" } }, "date_created" : "2021-01-29T14:31:58.000-06:00", "date_updated" : "2021-01-29T14:31:58.000-06:00", "internal" : false, "primary_external_id" : "RGD:41404647", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32833527", "RGD:40902996" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "LDL receptor related protein 5; CRISPR/Cas9 induced mutant 2, Vari", "display_text" : "LDL receptor related protein 5; CRISPR/Cas9 induced mutant 2, Vari", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-01-29T14:44:21.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrp5[em2Vari]", "display_text" : "Lrp5em2Vari", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "LDL receptor related protein 5;CRISPR/Cas9 induced mutant 2, Vari", "display_text" : "LDL receptor related protein 5;CRISPR/Cas9 induced mutant 2, Vari", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41404650", "page_area" : "allele", "display_name" : "RGD:41404650" } }, "date_created" : "2021-01-29T14:43:30.000-06:00", "date_updated" : "2021-01-29T14:43:30.000-06:00", "internal" : false, "primary_external_id" : "RGD:41404650", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32833527", "RGD:40902996" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "LDL receptor related protein 5; CRISPR/Cas9 induced mutant 3, Vari", "display_text" : "LDL receptor related protein 5; CRISPR/Cas9 induced mutant 3, Vari", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrp5[em3Vari]", "display_text" : "Lrp5em3Vari", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41404652", "page_area" : "allele", "display_name" : "RGD:41404652" } }, "date_created" : "2021-01-29T15:01:16.000-06:00", "date_updated" : "2021-01-29T15:01:16.000-06:00", "internal" : false, "primary_external_id" : "RGD:41404652", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32833527", "RGD:40902996" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SH3 and multiple ankyrin repeat domains 3; ZFN induced mutant 1, Bux", "display_text" : "SH3 and multiple ankyrin repeat domains 3; ZFN induced mutant 1, Bux", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-02-04T15:11:45.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Shank3[em1Bux]", "display_text" : "Shank3em1Bux", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Shank3[em1Bux", "display_text" : "Shank3em1Bux", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41404706", "page_area" : "allele", "display_name" : "RGD:41404706" } }, "date_created" : "2021-02-04T15:08:13.000-06:00", "date_updated" : "2021-02-04T15:08:13.000-06:00", "internal" : false, "primary_external_id" : "RGD:41404706", "note_dtos" : [ { "internal" : false, "free_text" : "The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28139198", "RGD:41404704" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neutrophil cytosolic factor 1, wistar mutant , Rhd", "display_text" : "neutrophil cytosolic factor 1, wistar mutant , Rhd", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ncf1[W]", "display_text" : "Ncf1W", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41404724", "page_area" : "allele", "display_name" : "RGD:41404724" } }, "date_created" : "2021-02-08T13:43:21.000-06:00", "date_updated" : "2021-02-08T13:43:21.000-06:00", "internal" : false, "primary_external_id" : "RGD:41404724", "note_dtos" : [ { "internal" : false, "free_text" : "The Wistar Ncf1 (Ncf1W) allele identified with M153T missense mutation.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "presynaptic cytomatrix protein; sleeping beauty transposon induced mutant, Fkh", "display_text" : "presynaptic cytomatrix protein; sleeping beauty transposon induced mutant, Fkh", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-02-10T10:41:03.000-06:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Pclo[Tn(sb-B-Geo)Fkh]", "display_text" : "PcloTn(sb-B-Geo)Fkh", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pclo[Tn(sb)Fkh]", "display_text" : "PcloTn(sb)Fkh", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41408340", "page_area" : "allele", "display_name" : "RGD:41408340" } }, "date_created" : "2021-02-09T16:24:58.000-06:00", "date_updated" : "2021-02-09T16:24:58.000-06:00", "internal" : false, "primary_external_id" : "RGD:41408340", "note_dtos" : [ { "internal" : false, "free_text" : "Transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rats. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame,", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31074746", "RGD:41408338" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutamate metabotropic receptor 2; endonuclease induced mutant 1", "display_text" : "glutamate metabotropic receptor 2; endonuclease induced mutant 1", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Grm2[em1]", "display_text" : "Grm2em1", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41410882", "page_area" : "allele", "display_name" : "RGD:41410882" } }, "date_created" : "2021-02-17T10:45:34.000-06:00", "date_updated" : "2021-02-17T10:45:34.000-06:00", "internal" : false, "primary_external_id" : "RGD:41410882", "note_dtos" : [ { "internal" : false, "free_text" : "The genome modification technology created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:28700935", "PMID:30283001", "RGD:38501063", "RGD:38501064" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "PR/SET domain 14; CRISPR/Cas9 system induced mutant 1, Nips", "display_text" : "PR/SET domain 14; CRISPR/Cas9 system induced mutant 1, Nips", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-05-24T08:55:27.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Prdm14[em10Nips]", "display_text" : "Prdm14em10Nips", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Prdm14[em1Nips]", "display_text" : "Prdm14em1Nips", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:41457453", "page_area" : "allele", "display_name" : "RGD:41457453" } }, "date_created" : "2021-02-24T09:26:19.000-06:00", "date_updated" : "2021-02-25T09:22:05.000-06:00", "internal" : false, "primary_external_id" : "RGD:41457453", "note_dtos" : [ { "internal" : false, "free_text" : "Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32001439", "RGD:38549154" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin VA; mutant 1, Stc", "display_text" : "myosin VA; mutant 1, Stc", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Myo5a[m1Stc]", "display_text" : "Myo5am1Stc", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:42721971", "page_area" : "allele", "display_name" : "RGD:42721971" } }, "date_created" : "2021-02-25T12:01:31.000-06:00", "date_updated" : "2021-02-25T12:01:31.000-06:00", "internal" : false, "primary_external_id" : "RGD:42721971", "note_dtos" : [ { "internal" : false, "free_text" : "Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NIMA-related kinase 8; lpk mutant, Arc", "display_text" : "NIMA-related kinase 8; lpk mutant, Arc", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-02-25T13:53:27.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nek8[lpkArc]", "display_text" : "Nek8lpkArc", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "NIMA-related kinase 8; lpk mutant ,Arc", "display_text" : "NIMA-related kinase 8; lpk mutant ,Arc", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:42721975", "page_area" : "allele", "display_name" : "RGD:42721975" } }, "date_created" : "2021-02-25T13:52:59.000-06:00", "date_updated" : "2021-02-25T13:52:59.000-06:00", "internal" : false, "primary_external_id" : "RGD:42721975", "note_dtos" : [ { "internal" : false, "free_text" : "The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:22899815", "RGD:40924667" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Baek", "display_text" : "phosphodiesterase 6B; Cpf1-CRISPR induced mutant1, Baek", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2021-02-25T14:48:34.000-06:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Pde6b[em1Baek]", "display_text" : "Pde6bem1Baek", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:42721979", "page_area" : "allele", "display_name" : "RGD:42721979" } }, "date_created" : "2021-02-25T14:47:15.000-06:00", "date_updated" : "2021-02-25T14:47:15.000-06:00", "internal" : false, "primary_external_id" : "RGD:42721979", "note_dtos" : [ { "internal" : false, "free_text" : "Cpf1-CRISPR system was injected to SD embryos to induced an 11-bp deletion in exon 1 of rat Pde6b.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:31009522", "RGD:40924664" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NADPH oxidase 4; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "NADPH oxidase 4; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nox4[em1Mcwi]", "display_text" : "Nox4em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nox4em1Mcwi", "display_text" : "Nox4em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131428", "page_area" : "allele", "display_name" : "RGD:5131428" } }, "date_created" : "2011-04-27T10:42:05.000-05:00", "date_updated" : "2011-04-27T10:42:05.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131428", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 7 (del 586-590).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "acyl-Coenzyme A dehydrogenase family, member 10; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "acyl-Coenzyme A dehydrogenase family, member 10; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Acad10[em2Mcwi]", "display_text" : "Acad10em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Acad10em2Mcwi", "display_text" : "Acad10em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131905", "page_area" : "allele", "display_name" : "RGD:5131905" } }, "date_created" : "2011-05-16T12:35:23.000-05:00", "date_updated" : "2011-05-16T12:35:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131905", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 2 (del 2040-2049).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Alstrom syndrome 1 homolog (human); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "Alstrom syndrome 1 homolog (human); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Alms1[em1Mcwi]", "display_text" : "Alms1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Alms1em1Mcwi", "display_text" : "Alms1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131906", "page_area" : "allele", "display_name" : "RGD:5131906" } }, "date_created" : "2011-05-16T12:35:23.000-05:00", "date_updated" : "2011-05-16T12:35:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131906", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 1 (del 429-445).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:30385718", "RGD:151361229", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "aldehyde dehydrogenase 2 family (mitochondrial); zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "aldehyde dehydrogenase 2 family (mitochondrial); zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Aldh2[em2Mcwi]", "display_text" : "Aldh2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Aldh2em2Mcwi", "display_text" : "Aldh2em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131907", "page_area" : "allele", "display_name" : "RGD:5131907" } }, "date_created" : "2011-05-16T12:35:23.000-05:00", "date_updated" : "2011-05-16T12:35:23.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131907", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 7-bp frameshift deletion in exon 4 (del 431-437).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "apolipoprotein E; zinc finger nuclease induced mutant 8, Medical College of Wisconsin", "display_text" : "apolipoprotein E; zinc finger nuclease induced mutant 8, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Apoe[em8Mcwi]", "display_text" : "Apoeem8Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Apoeem8Mcwi", "display_text" : "Apoeem8Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131915", "page_area" : "allele", "display_name" : "RGD:5131915" } }, "date_created" : "2011-05-16T13:06:16.000-05:00", "date_updated" : "2011-05-16T13:06:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131915", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 24-bp frameshift deletion in exon 2 (del 148-171).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "apolipoprotein E; zinc finger nuclease induced mutant 7, Medical College of Wisconsin", "display_text" : "apolipoprotein E; zinc finger nuclease induced mutant 7, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Apoe[em7Mcwi]", "display_text" : "Apoeem7Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Apoeem7Mcwi", "display_text" : "Apoeem7Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131918", "page_area" : "allele", "display_name" : "RGD:5131918" } }, "date_created" : "2011-05-16T13:06:16.000-05:00", "date_updated" : "2011-05-16T13:06:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131918", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 15-bp frameshift deletion in exon 2 (del 161-175).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cadherin 13; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "cadherin 13; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cdh13[em1Mcwi]", "display_text" : "Cdh13em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cdh13em1Mcwi", "display_text" : "Cdh13em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131919", "page_area" : "allele", "display_name" : "RGD:5131919" } }, "date_created" : "2011-05-16T13:06:16.000-05:00", "date_updated" : "2011-05-16T13:06:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131919", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 104-111).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:28387990", "RGD:13503340", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp1a1[em1Mcwi]", "display_text" : "Cyp1a1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp1a1em1Mcwi", "display_text" : "Cyp1a1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131928", "page_area" : "allele", "display_name" : "RGD:5131928" } }, "date_created" : "2011-05-16T13:57:58.000-05:00", "date_updated" : "2011-05-16T13:57:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131928", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 19-bp frameshift deletion in exon 4 (del 1098-1116).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp1a1[em5Mcwi]", "display_text" : "Cyp1a1em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp1a1em5Mcwi", "display_text" : "Cyp1a1em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131929", "page_area" : "allele", "display_name" : "RGD:5131929" } }, "date_created" : "2011-05-16T13:57:58.000-05:00", "date_updated" : "2011-05-16T13:57:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131929", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 4 (del 1099-1106).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "cytochrome b-245 alpha chain; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-08-28T09:57:55.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyba[em1Mcwi]", "display_text" : "Cybaem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cybaem1Mcwi", "display_text" : "Cybaem1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "cytochrome b-245, alpha polypeptide; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "cytochrome b-245, alpha polypeptide; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131930", "page_area" : "allele", "display_name" : "RGD:5131930" } }, "date_created" : "2011-05-16T13:57:58.000-05:00", "date_updated" : "2011-05-16T13:57:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131930", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 36-bp frameshift deletion in exon 1 (del 54-89).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "methionine sulfoxide reductase A; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "methionine sulfoxide reductase A; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Msra[em3Mcwi]", "display_text" : "Msraem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Msraem1Mcwi", "display_text" : "Msraem1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Msraem3Mcwi", "display_text" : "Msraem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131945", "page_area" : "allele", "display_name" : "RGD:5131945" } }, "date_created" : "2011-05-17T10:42:45.000-05:00", "date_updated" : "2011-05-17T10:42:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131945", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 1 (del 85-102).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "MAS1 oncogene; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "MAS1 oncogene; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mas1[em1Mcwi]", "display_text" : "Mas1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mas1em1Mcwi", "display_text" : "Mas1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131946", "page_area" : "allele", "display_name" : "RGD:5131946" } }, "date_created" : "2011-05-17T10:42:45.000-05:00", "date_updated" : "2011-05-17T10:42:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131946", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 601-610).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prokineticin receptor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "prokineticin receptor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prokr1[em2Mcwi]", "display_text" : "Prokr1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Prokr1em2Mcwi", "display_text" : "Prokr1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131947", "page_area" : "allele", "display_name" : "RGD:5131947" } }, "date_created" : "2011-05-17T10:42:45.000-05:00", "date_updated" : "2011-05-17T10:42:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131947", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 126-bp frameshift deletion in exon 2 (del 636-761).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prokineticin receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "prokineticin receptor 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prokr1[em1Mcwi]", "display_text" : "Prokr1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Prokr1em1Mcwi", "display_text" : "Prokr1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131948", "page_area" : "allele", "display_name" : "RGD:5131948" } }, "date_created" : "2011-05-17T10:42:45.000-05:00", "date_updated" : "2011-05-17T10:42:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131948", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 2 (del 748-758).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myostatin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "myostatin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mstn[em2Mcwi]", "display_text" : "Mstnem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mstnem2Mcwi", "display_text" : "Mstnem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131949", "page_area" : "allele", "display_name" : "RGD:5131949" } }, "date_created" : "2011-05-17T10:42:45.000-05:00", "date_updated" : "2011-05-17T10:42:45.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131949", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 18-bp frameshift deletion in exon 2 (del 381-398).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plod1[em1Mcwi]", "display_text" : "Plod1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plod1em1Mcwi", "display_text" : "Plod1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131960", "page_area" : "allele", "display_name" : "RGD:5131960" } }, "date_created" : "2011-05-17T12:54:43.000-05:00", "date_updated" : "2011-05-17T12:54:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131960", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 10-bp frameshift deletion in exon 4 (del 764-773).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mthfr[em1Mcwi]", "display_text" : "Mthfrem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mthfrem1Mcwi", "display_text" : "Mthfrem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131961", "page_area" : "allele", "display_name" : "RGD:5131961" } }, "date_created" : "2011-05-17T12:54:43.000-05:00", "date_updated" : "2011-05-17T12:54:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131961", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 28-bp frameshift deletion in exon 2 (del 165-192).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myostatin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "myostatin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mstn[em3Mcwi]", "display_text" : "Mstnem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mstnem3Mcwi", "display_text" : "Mstnem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131962", "page_area" : "allele", "display_name" : "RGD:5131962" } }, "date_created" : "2011-05-17T12:54:43.000-05:00", "date_updated" : "2011-05-17T12:54:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131962", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 381-388).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rasgrp3[em1Mcwi]", "display_text" : "Rasgrp3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rasgrp3em1Mcwi", "display_text" : "Rasgrp3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131968", "page_area" : "allele", "display_name" : "RGD:5131968" } }, "date_created" : "2011-05-17T13:24:29.000-05:00", "date_updated" : "2011-05-17T13:24:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131968", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 12 (del 1501-1503, ins. Ttaggtgg).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptpn11[em4Mcwi]", "display_text" : "Ptpn11em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ptpn11em4Mcwi", "display_text" : "Ptpn11em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131969", "page_area" : "allele", "display_name" : "RGD:5131969" } }, "date_created" : "2011-05-17T13:24:29.000-05:00", "date_updated" : "2011-05-17T13:24:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131969", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 84-bp frameshift deletion in exon 4 (del 570-653).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "protein tyrosine phosphatase, non-receptor type 11; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ptpn11[em1Mcwi]", "display_text" : "Ptpn11em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ptpn11em1Mcwi", "display_text" : "Ptpn11em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131970", "page_area" : "allele", "display_name" : "RGD:5131970" } }, "date_created" : "2011-05-17T13:24:29.000-05:00", "date_updated" : "2011-05-17T13:24:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131970", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 4 (del 624-640).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "WD repeat domain 72; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "WD repeat domain 72; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Wdr72[em2Mcwi]", "display_text" : "Wdr72em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Wdr72em2Mcwi", "display_text" : "Wdr72em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131978", "page_area" : "allele", "display_name" : "RGD:5131978" } }, "date_created" : "2011-05-17T14:20:39.000-05:00", "date_updated" : "2011-05-17T14:20:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131978", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 5-bp frameshift deletion in exon 3 (del 329-336).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc30a8[em1Mcwi]", "display_text" : "Slc30a8em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc30a8em1Mcwi", "display_text" : "Slc30a8em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131979", "page_area" : "allele", "display_name" : "RGD:5131979" } }, "date_created" : "2011-05-17T14:20:39.000-05:00", "date_updated" : "2011-05-17T14:20:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131979", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 464-480).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transforming growth factor, beta 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "transforming growth factor, beta 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tgfb1[em3Mcwi]", "display_text" : "Tgfb1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tgfb1em3Mcwi", "display_text" : "Tgfb1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131980", "page_area" : "allele", "display_name" : "RGD:5131980" } }, "date_created" : "2011-05-17T14:20:39.000-05:00", "date_updated" : "2011-05-17T14:20:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131980", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 22-bp frameshift deletion in exon 3 (del 191-212).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:23249995", "RGD:13446413", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "solute carrier family 30 (zinc transporter), member 8; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc30a8[em2Mcwi]", "display_text" : "Slc30a8em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc30a8em2Mcwi", "display_text" : "Slc30a8em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131981", "page_area" : "allele", "display_name" : "RGD:5131981" } }, "date_created" : "2011-05-17T14:33:24.000-05:00", "date_updated" : "2011-05-17T14:33:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131981", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 17-bp frameshift deletion in exon 2 (del 462-478).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transforming growth factor, beta 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "transforming growth factor, beta 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tgfb1[em1Mcwi]", "display_text" : "Tgfb1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tgfb1em1Mcwi", "display_text" : "Tgfb1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5131986", "page_area" : "allele", "display_name" : "RGD:5131986" } }, "date_created" : "2011-05-17T16:05:16.000-05:00", "date_updated" : "2011-05-17T16:05:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:5131986", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 12-bp frameshift deletion in exon 3 (del 193-204).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "RAS guanyl releasing protein 3 (calcium and DAG-regulated); zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rasgrp3[em3Mcwi]", "display_text" : "Rasgrp3em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rasgrp3em3Mcwi", "display_text" : "Rasgrp3em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143946", "page_area" : "allele", "display_name" : "RGD:5143946" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143946", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made using ZFN mutagenesis. The resulting mutation is a 20-bp frameshift deletion in exon 12 (del 1494-1513)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phospholipase C, delta 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "phospholipase C, delta 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plcd3[em4Mcwi]", "display_text" : "Plcd3em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plcd3em4Mcwi", "display_text" : "Plcd3em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143954", "page_area" : "allele", "display_name" : "RGD:5143954" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143954", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor (del 92275081-92275241)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein-coupled receptor 183; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "G protein-coupled receptor 183; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gpr183[em2Mcwi]", "display_text" : "Gpr183em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gpr183em2Mcwi", "display_text" : "Gpr183em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143955", "page_area" : "allele", "display_name" : "RGD:5143955" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143955", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 2 (del 567-570)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein-coupled receptor 183; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "G protein-coupled receptor 183; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gpr183[em1Mcwi]", "display_text" : "Gpr183em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gpr183em1Mcwi", "display_text" : "Gpr183em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143957", "page_area" : "allele", "display_name" : "RGD:5143957" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143957", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 2 (del 550-556)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein-coupled receptor 183; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "G protein-coupled receptor 183; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gpr183[em3Mcwi]", "display_text" : "Gpr183em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gpr183em3Mcwi", "display_text" : "Gpr183em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143961", "page_area" : "allele", "display_name" : "RGD:5143961" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143961", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 2 (del 571-578)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Agtrap[em4Mcwi]", "display_text" : "Agtrapem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Agtrapem4Mcwi", "display_text" : "Agtrapem4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143963", "page_area" : "allele", "display_name" : "RGD:5143963" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143963", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157844-165157927)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myostatin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "myostatin; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mstn[em1Mcwi]", "display_text" : "Mstnem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mstnem1Mcwi", "display_text" : "Mstnem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143964", "page_area" : "allele", "display_name" : "RGD:5143964" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143964", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation deletes part of exon 2 and its splice acceptor (v3.4 del 45429512-45429528)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:25640143", "RGD:151347429", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ulk3[em1Mcwi]", "display_text" : "Ulk3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ulk3em1Mcwi", "display_text" : "Ulk3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143968", "page_area" : "allele", "display_name" : "RGD:5143968" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143968", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 5 (del 546-555)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 8, Medical College of Wisconsin", "display_text" : "angiotensin II receptor-associated protein; zinc finger nuclease induced mutant 8, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Agtrap[em8Mcwi]", "display_text" : "Agtrapem8Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Agtrapem8Mcwi", "display_text" : "Agtrapem8Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143970", "page_area" : "allele", "display_name" : "RGD:5143970" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143970", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor (del 165157761-165157860)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-03-29T15:41:10.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ulk3[em4Mcwi]", "display_text" : "Ulk3em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ulk3em4Mcwi", "display_text" : "Ulk3em4Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "unc-51-like kinase 3 (C. elegans); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143971", "page_area" : "allele", "display_name" : "RGD:5143971" } }, "date_created" : "2011-07-27T15:07:00.000-05:00", "date_updated" : "2011-07-27T15:07:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143971", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 88-bp frameshift deletion in exon 5 (del 476-563)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phospholipase C, delta 3; zinc finger nuclease induced mutant 7, Medical College of Wisconsin", "display_text" : "phospholipase C, delta 3; zinc finger nuclease induced mutant 7, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plcd3[em7Mcwi]", "display_text" : "Plcd3em7Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plcd3em7Mcwi", "display_text" : "Plcd3em7Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143976", "page_area" : "allele", "display_name" : "RGD:5143976" } }, "date_created" : "2011-07-27T15:07:01.000-05:00", "date_updated" : "2011-07-27T15:07:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143976", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 142-bp deletion, overlapping the start codon (del 68-209)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plekha7[em1Mcwi]", "display_text" : "Plekha7em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plekha7em1Mcwi", "display_text" : "Plekha7em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143978", "page_area" : "allele", "display_name" : "RGD:5143978" } }, "date_created" : "2011-07-27T15:07:01.000-05:00", "date_updated" : "2011-07-27T15:07:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143978", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 635-650)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "pleckstrin homology domain containing, family A member 7; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Plekha7[em4Mcwi]", "display_text" : "Plekha7em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Plekha7em4Mcwi", "display_text" : "Plekha7em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5143979", "page_area" : "allele", "display_name" : "RGD:5143979" } }, "date_created" : "2011-07-27T15:07:01.000-05:00", "date_updated" : "2011-07-27T15:07:01.000-05:00", "internal" : false, "primary_external_id" : "RGD:5143979", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 8 (del 638-656)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:25136115", "RGD:11079199", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ldlr[em4Mcwi]", "display_text" : "Ldlrem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ldlrem4Mcwi", "display_text" : "Ldlrem4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144075", "page_area" : "allele", "display_name" : "RGD:5144075" } }, "date_created" : "2011-07-29T14:45:28.000-05:00", "date_updated" : "2011-07-29T14:45:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144075", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 653-665)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "display_text" : "potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnq1[em9Mcwi]", "display_text" : "Kcnq1em9Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnq1em9Mcwi", "display_text" : "Kcnq1em9Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144076", "page_area" : "allele", "display_name" : "RGD:5144076" } }, "date_created" : "2011-07-29T14:45:28.000-05:00", "date_updated" : "2011-07-29T14:45:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144076", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 3 (del 631-637)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "integrin, alpha 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "integrin, alpha 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Itga9[em1Mcwi]", "display_text" : "Itga9em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Itga9em1Mcwi", "display_text" : "Itga9em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144077", "page_area" : "allele", "display_name" : "RGD:5144077" } }, "date_created" : "2011-07-29T14:45:28.000-05:00", "date_updated" : "2011-07-29T14:45:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144077", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor ( v3.4 del 123601499-123601585)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ldlr[em3Mcwi]", "display_text" : "Ldlrem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ldlrem3Mcwi", "display_text" : "Ldlrem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144082", "page_area" : "allele", "display_name" : "RGD:5144082" } }, "date_created" : "2011-07-29T14:45:28.000-05:00", "date_updated" : "2011-07-29T14:45:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144082", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp frameshift deletion in exon 4 (del 647-659)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 14, Medical College of Wisconsin", "display_text" : "potassium voltage-gated channel, KQT-like subfamily, member 1; zinc finger nuclease induced mutant 14, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnq1[em14Mcwi]", "display_text" : "Kcnq1em14Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnq1em14Mcwi", "display_text" : "Kcnq1em14Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144083", "page_area" : "allele", "display_name" : "RGD:5144083" } }, "date_created" : "2011-07-29T14:45:28.000-05:00", "date_updated" : "2011-07-29T14:45:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144083", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 17-bp frameshift deletion in exon 3 (del 621-637)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1,Mcwi", "display_text" : "neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1,Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2023-09-27T14:19:18.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Ncf2[em1Mcwi]", "display_text" : "Ncf2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ncf2em1Mcwi", "display_text" : "Ncf2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144089", "page_area" : "allele", "display_name" : "RGD:5144089" } }, "date_created" : "2011-07-29T14:45:29.000-05:00", "date_updated" : "2011-07-29T14:45:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144089", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 253-257)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:22326221", "PMID:27279484", "RGD:151347625", "RGD:4131263", "RGD:4139871", "RGD:9587793" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ldlr[em1Mcwi]", "display_text" : "Ldlrem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ldlrem1Mcwi", "display_text" : "Ldlrem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144090", "page_area" : "allele", "display_name" : "RGD:5144090" } }, "date_created" : "2011-07-29T14:45:29.000-05:00", "date_updated" : "2011-07-29T14:45:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144090", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 4 (del 647-659)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "low density lipoprotein receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ldlr[em2Mcwi]", "display_text" : "Ldlrem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ldlrem2Mcwi", "display_text" : "Ldlrem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144094", "page_area" : "allele", "display_name" : "RGD:5144094" } }, "date_created" : "2011-07-29T14:45:29.000-05:00", "date_updated" : "2011-07-29T14:45:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144094", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 123-bp frameshift deletion in exon 4 (del 536-658)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "HEXIM P-TEFb complex subunit 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "HEXIM P-TEFb complex subunit 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2022-05-03T17:17:19.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Hexim2[em4Mcwi]", "display_text" : "Hexim2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Hexim2em4Mcwi", "display_text" : "Hexim2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "hexamethylene bis-acetamide inducible 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "hexamethylene bis-acetamide inducible 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144095", "page_area" : "allele", "display_name" : "RGD:5144095" } }, "date_created" : "2011-07-29T14:45:29.000-05:00", "date_updated" : "2011-07-29T14:45:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144095", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 3 (del 798-807)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "agouti signaling protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "agouti signaling protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Asip[em1Mcwi]", "display_text" : "Asipem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Asipem1Mcwi", "display_text" : "Asipem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5144099", "page_area" : "allele", "display_name" : "RGD:5144099" } }, "date_created" : "2011-07-29T14:45:29.000-05:00", "date_updated" : "2011-07-29T14:45:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:5144099", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 2 (del 172-176)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Myadml2[em1Mcwi]", "display_text" : "Myadml2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Myadml2em1Mcwi", "display_text" : "Myadml2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508317", "page_area" : "allele", "display_name" : "RGD:5508317" } }, "date_created" : "2011-10-13T13:04:19.000-05:00", "date_updated" : "2011-10-13T13:04:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508317", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1(del 161-173)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Agtr1a[em5Mcwi]", "display_text" : "Agtr1aem5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Agtr1aem5Mcwi", "display_text" : "Agtr1aem5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508318", "page_area" : "allele", "display_name" : "RGD:5508318" } }, "date_created" : "2011-10-13T13:04:19.000-05:00", "date_updated" : "2011-10-13T13:04:19.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508318", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 3 (del 517-535)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:32324784", "RGD:127345089", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dguok[em4Mcwi]", "display_text" : "Dguokem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dguokem4Mcwi", "display_text" : "Dguokem4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508323", "page_area" : "allele", "display_name" : "RGD:5508323" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508323", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp frameshift deletion in exon 1 (del 78-86)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "natriuretic peptide B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nppb[em2Mcwi]", "display_text" : "Nppbem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nppbem2Mcwi", "display_text" : "Nppbem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508324", "page_area" : "allele", "display_name" : "RGD:5508324" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508324", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2 (del 165062746-165062845)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:26063669", "RGD:12910116", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dguok[em3Mcwi]", "display_text" : "Dguokem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dguokem3Mcwi", "display_text" : "Dguokem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508325", "page_area" : "allele", "display_name" : "RGD:5508325" } }, "date_created" : "2011-10-13T00:00:00.000-05:00", "date_updated" : "2013-10-07T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508325", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sorcs2[em4Mcwi]", "display_text" : "Sorcs2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sorcs2em4Mcwi", "display_text" : "Sorcs2em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508326", "page_area" : "allele", "display_name" : "RGD:5508326" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508326", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 15 (del 1991-1995)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "WD repeat domain 72; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "WD repeat domain 72; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Wdr72[em1Mcwi]", "display_text" : "Wdr72em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Wdr72em1Mcwi", "display_text" : "Wdr72em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508327", "page_area" : "allele", "display_name" : "RGD:5508327" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508327", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 (del 78900101 78900113)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "breast carcinoma amplified sequence 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "breast carcinoma amplified sequence 3; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bcas3[em4Mcwi]", "display_text" : "Bcas3em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bcas3em4Mcwi", "display_text" : "Bcas3em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508329", "page_area" : "allele", "display_name" : "RGD:5508329" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508329", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 9 (del 648-654)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "angiotensin II receptor, type 1a; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Agtr1a[em1Mcwi]", "display_text" : "Agtr1aem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Agtr1aem1Mcwi", "display_text" : "Agtr1aem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508331", "page_area" : "allele", "display_name" : "RGD:5508331" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508331", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp frameshift deletion in exon 3 (del 521-523)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tfdp2[em2Mcwi]", "display_text" : "Tfdp2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tfdp2em2Mcwi", "display_text" : "Tfdp2em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508332", "page_area" : "allele", "display_name" : "RGD:5508332" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508332", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 6 (del 620-632)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mylip[em2Mcwi]", "display_text" : "Mylipem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mylipem2Mcwi", "display_text" : "Mylipem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508333", "page_area" : "allele", "display_name" : "RGD:5508333" } }, "date_created" : "2011-10-13T00:00:00.000-05:00", "date_updated" : "2012-08-28T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508333", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 49-bp deletion in the genome and a G insertion at the deletion site.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tfdp2[em5Mcwi]", "display_text" : "Tfdp2em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tfdp2em5Mcwi", "display_text" : "Tfdp2em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508334", "page_area" : "allele", "display_name" : "RGD:5508334" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508334", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp frameshift deletion in exon 6 (del 618-633)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mylip[em3Mcwi]", "display_text" : "Mylipem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mylipem3Mcwi", "display_text" : "Mylipem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508336", "page_area" : "allele", "display_name" : "RGD:5508336" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508336", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 51-bp frameshift deletion in exon 1 (del 206-256)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "unc-51-like kinase 4 (C. elegans); zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "unc-51-like kinase 4 (C. elegans); zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ulk4[em3Mcwi]", "display_text" : "Ulk4em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ulk4em3Mcwi", "display_text" : "Ulk4em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508340", "page_area" : "allele", "display_name" : "RGD:5508340" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508340", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 (del 126242938 126242951)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prune homolog (Drosophila); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "prune homolog (Drosophila); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prune[em1Mcwi]", "display_text" : "Pruneem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pruneem1Mcwi", "display_text" : "Pruneem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508341", "page_area" : "allele", "display_name" : "RGD:5508341" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508341", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 198-bp deletion in the 5' URT and exon 1 (v3.4 del 190192348-190192545)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "neutrophil cytosolic factor 2; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ncf2[em4Mcwi]", "display_text" : "Ncf2em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ncf2em4Mcwi", "display_text" : "Ncf2em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508342", "page_area" : "allele", "display_name" : "RGD:5508342" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508342", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2 (v3.4 del 67808926-67809069, ins atctt)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "sortilin-related VPS10 domain containing receptor 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sorcs2[em1Mcwi]", "display_text" : "Sorcs2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sorcs2em1Mcwi", "display_text" : "Sorcs2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508343", "page_area" : "allele", "display_name" : "RGD:5508343" } }, "date_created" : "2011-10-13T00:00:00.000-05:00", "date_updated" : "2013-10-07T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508343", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 34-bp frameshift deletion in exon 15 (del 1989-2022)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dguok[em1Mcwi]", "display_text" : "Dguokem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dguokem1Mcwi", "display_text" : "Dguokem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508345", "page_area" : "allele", "display_name" : "RGD:5508345" } }, "date_created" : "2011-10-13T00:00:00.000-05:00", "date_updated" : "2013-10-07T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508345", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "myosin regulatory light chain interacting protein; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Mylip[em1Mcwi]", "display_text" : "Mylipem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Mylipem1Mcwi", "display_text" : "Mylipem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508347", "page_area" : "allele", "display_name" : "RGD:5508347" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508347", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 195-241)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "prune homolog (Drosophila); zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "prune homolog (Drosophila); zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prune[em3Mcwi]", "display_text" : "Pruneem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pruneem3Mcwi", "display_text" : "Pruneem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508348", "page_area" : "allele", "display_name" : "RGD:5508348" } }, "date_created" : "2011-10-13T13:04:20.000-05:00", "date_updated" : "2011-10-13T13:04:20.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508348", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 130-bp frameshift deletion in exon 1 (del 237-268)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "guanylate cyclase 1, soluble, alpha 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "guanylate cyclase 1, soluble, alpha 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gucy1a3[em1Mcwi]", "display_text" : "Gucy1a3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gucy1a3em1Mcwi", "display_text" : "Gucy1a3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508351", "page_area" : "allele", "display_name" : "RGD:5508351" } }, "date_created" : "2011-10-13T13:04:21.000-05:00", "date_updated" : "2011-10-13T13:04:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508351", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a14-bp frameshift deletion in exon 5 (del 784-797)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "TRAF type zinc finger domain containing 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "TRAF type zinc finger domain containing 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Trafd1[em1Mcwi]", "display_text" : "Trafd1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Trafd1em1Mcwi", "display_text" : "Trafd1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508352", "page_area" : "allele", "display_name" : "RGD:5508352" } }, "date_created" : "2011-10-13T13:04:21.000-05:00", "date_updated" : "2011-10-13T13:04:21.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508352", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 5 (del 440-452)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "deoxyguanosine kinase; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dguok[em2Mcwi]", "display_text" : "Dguokem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Dguokem2Mcwi", "display_text" : "Dguokem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5508354", "page_area" : "allele", "display_name" : "RGD:5508354" } }, "date_created" : "2011-10-13T00:00:00.000-05:00", "date_updated" : "2013-10-07T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5508354", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "NCK-associated protein 5; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nckap5[em4Mcwi]", "display_text" : "Nckap5em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nckap5em4Mcwi", "display_text" : "Nckap5em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509975", "page_area" : "allele", "display_name" : "RGD:5509975" } }, "date_created" : "2011-11-16T15:38:26.000-06:00", "date_updated" : "2011-11-16T15:38:26.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509975", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 6 (del 1558-1568)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "cytochrome P450, family 1, subfamily a, polypeptide 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp1a1[em2Mcwi]", "display_text" : "Cyp1a1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp1a1em2Mcwi", "display_text" : "Cyp1a1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509976", "page_area" : "allele", "display_name" : "RGD:5509976" } }, "date_created" : "2011-11-16T15:38:26.000-06:00", "date_updated" : "2011-11-16T15:38:26.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509976", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 188-bp deletion encompassing exon 4 (del 61466251-61466438)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "methionine sulfoxide reductase A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "methionine sulfoxide reductase A; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Msra[em4Mcwi]", "display_text" : "Msraem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Msraem4Mcwi", "display_text" : "Msraem4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509977", "page_area" : "allele", "display_name" : "RGD:5509977" } }, "date_created" : "2011-11-16T15:38:26.000-06:00", "date_updated" : "2011-11-16T15:38:26.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509977", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a net 1-bp frameshift deletion in exon 1 (del 95-99, ins cttc)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "serine threonine kinase 39; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "serine threonine kinase 39; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Stk39[em2Mcwi]", "display_text" : "Stk39em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Stk39em3Mcwi", "display_text" : "Stk39em3Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Stk39em2Mcwi", "display_text" : "Stk39em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509978", "page_area" : "allele", "display_name" : "RGD:5509978" } }, "date_created" : "2011-11-16T15:38:26.000-06:00", "date_updated" : "2011-11-16T15:38:26.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509978", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 24-bp frameshift deletion in exon 7 (del 1232-1255)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "natriuretic peptide B; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "natriuretic peptide B; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nppb[em4Mcwi]", "display_text" : "Nppbem4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nppbem4Mcwi", "display_text" : "Nppbem4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509979", "page_area" : "allele", "display_name" : "RGD:5509979" } }, "date_created" : "2011-11-16T15:38:26.000-06:00", "date_updated" : "2011-11-16T15:38:26.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509979", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2 (del 165062749 165062886)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transcription factor 7-like 2 (T-cell specific, HMG-box); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "transcription factor 7-like 2 (T-cell specific, HMG-box); zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tcf7l2[em1Mcwi]", "display_text" : "Tcf7l2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tcf7l2em1Mcwi", "display_text" : "Tcf7l2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509981", "page_area" : "allele", "display_name" : "RGD:5509981" } }, "date_created" : "2011-11-16T15:38:27.000-06:00", "date_updated" : "2011-11-16T15:38:27.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509981", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 169-bp deletion of exon5 and intron 5 (del 262106289 262106457)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "SH2B adaptor protein 3; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "SH2B adaptor protein 3; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sh2b3[em2Mcwi]", "display_text" : "Sh2b3em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sh2b3em2Mcwi", "display_text" : "Sh2b3em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509982", "page_area" : "allele", "display_name" : "RGD:5509982" } }, "date_created" : "2011-11-16T15:38:27.000-06:00", "date_updated" : "2011-11-16T15:38:27.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509982", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:4139871" ], "free_text" : "1-bp deletion (848) in exon 2 in the reference sequence differs from JX215366", "note_type_name" : "comment" }, { "internal" : false, "evidence_curies" : [ "RGD:4139871" ], "free_text" : "According to personal communication between RGD curators and Dr. H. Jacob's group the position of the 1-bp deletion is in exon 7 in SS/JrHsdMcwi (JX215366)", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 7 (del 1589) in SS/JrHsdMcwi", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:22948215", "PMID:25628389", "RGD:12904911", "RGD:12904914", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adrenergic, alpha-2A-, receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "adrenergic, alpha-2A-, receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adra2a[em1Mcwi]", "display_text" : "Adra2aem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adra2aem1Mcwi", "display_text" : "Adra2aem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509986", "page_area" : "allele", "display_name" : "RGD:5509986" } }, "date_created" : "2011-11-16T15:38:27.000-06:00", "date_updated" : "2011-11-16T15:38:27.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509986", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 2 (del 514-520)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ubiquitin-conjugating enzyme E2Q family member 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "ubiquitin-conjugating enzyme E2Q family member 2; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ube2q2[em3Mcwi]", "display_text" : "Ube2q2em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ube2q2em3Mcwi", "display_text" : "Ube2q2em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5509987", "page_area" : "allele", "display_name" : "RGD:5509987" } }, "date_created" : "2011-11-16T15:38:27.000-06:00", "date_updated" : "2011-11-16T15:38:27.000-06:00", "internal" : false, "primary_external_id" : "RGD:5509987", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 7.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosducin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "phosducin; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pdc[em2Mcwi]", "display_text" : "Pdcem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pdcem2Mcwi", "display_text" : "Pdcem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687695", "page_area" : "allele", "display_name" : "RGD:5687695" } }, "date_created" : "2012-02-09T08:29:48.000-06:00", "date_updated" : "2012-02-09T08:29:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687695", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 5 (del 489-502)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "guanine nucleotide binding protein (G protein), beta polypeptide 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "guanine nucleotide binding protein (G protein), beta polypeptide 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gnb3[em1Mcwi]", "display_text" : "Gnb3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gnb3em1Mcwi", "display_text" : "Gnb3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687696", "page_area" : "allele", "display_name" : "RGD:5687696" } }, "date_created" : "2012-02-09T08:29:48.000-06:00", "date_updated" : "2012-02-09T08:29:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687696", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 111-bp deletion overlapping exon 7 (del 160960366 160960476)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "uromodulin zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "uromodulin zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Umod[em1Mcwi]", "display_text" : "Umodem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Umodem1Mcwi", "display_text" : "Umodem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687697", "page_area" : "allele", "display_name" : "RGD:5687697" } }, "date_created" : "2012-02-09T08:29:48.000-06:00", "date_updated" : "2012-02-09T08:29:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687697", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 104-bp frameshift deletion in exon 2 (del 294-397)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2B receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "adenosine A2B receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2b[em2Mcwi]", "display_text" : "Adora2bem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2bem2Mcwi", "display_text" : "Adora2bem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687698", "page_area" : "allele", "display_name" : "RGD:5687698" } }, "date_created" : "2012-02-09T08:29:48.000-06:00", "date_updated" : "2012-02-09T08:29:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687698", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 162-bp deletion in exon 1 (del 96-257)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:26385692", "RGD:11533328", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 34 (sodium phosphate), member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "solute carrier family 34 (sodium phosphate), member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc34a1[em1Mcwi]", "display_text" : "Slc34a1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc34a1em1Mcwi", "display_text" : "Slc34a1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687699", "page_area" : "allele", "display_name" : "RGD:5687699" } }, "date_created" : "2012-02-09T08:29:48.000-06:00", "date_updated" : "2012-02-09T08:29:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687699", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 12-bp deletion in exon 4 (del 425-436)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc7a9[em1Mcwi]", "display_text" : "Slc7a9em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc7a9em1Mcwi", "display_text" : "Slc7a9em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687700", "page_area" : "allele", "display_name" : "RGD:5687700" } }, "date_created" : "2012-02-09T00:00:00.000-06:00", "date_updated" : "2013-10-07T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5687700", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp frameshift deletion in exon 6 (del 745-751)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc7a9[em2Mcwi]", "display_text" : "Slc7a9em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc7a9em2Mcwi", "display_text" : "Slc7a9em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687701", "page_area" : "allele", "display_name" : "RGD:5687701" } }, "date_created" : "2012-02-09T08:29:48.000-06:00", "date_updated" : "2012-02-09T08:29:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687701", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 6 (del 746-755)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Cd247 molecule; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "Cd247 molecule; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd247[em1Mcwi]", "display_text" : "Cd247em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd247em1Mcwi", "display_text" : "Cd247em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687703", "page_area" : "allele", "display_name" : "RGD:5687703" } }, "date_created" : "2012-02-09T08:29:48.000-06:00", "date_updated" : "2012-02-09T08:29:48.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687703", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp frameshift deletion in exon 1 (del 154-164)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:24343121", "RGD:13442481", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Resp18[em2Mcwi]", "display_text" : "Resp18em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Resp18em2Mcwi", "display_text" : "Resp18em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687705", "page_area" : "allele", "display_name" : "RGD:5687705" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687705", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made using ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 3 (del 375-381)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:29570433", "RGD:14348960", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystatin C; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "cystatin C; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cst3[em1Mcwi]", "display_text" : "Cst3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cst3em1Mcwi", "display_text" : "Cst3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687708", "page_area" : "allele", "display_name" : "RGD:5687708" } }, "date_created" : "2012-02-09T00:00:00.000-06:00", "date_updated" : "2013-10-07T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5687708", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 18-bp deletion in exon 1 (del 228-245)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adipoq[em1Mcwi]", "display_text" : "Adipoqem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adipoqem1Mcwi", "display_text" : "Adipoqem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687709", "page_area" : "allele", "display_name" : "RGD:5687709" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687709", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 186-232)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosducin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "phosducin; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pdc[em3Mcwi]", "display_text" : "Pdcem3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pdcem3Mcwi", "display_text" : "Pdcem3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687712", "page_area" : "allele", "display_name" : "RGD:5687712" } }, "date_created" : "2012-02-09T00:00:00.000-06:00", "date_updated" : "2012-09-12T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5687712", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a net 47-bp deletion in exon 5 (del 450-501, ins. Catcg)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Cd247 molecule; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "Cd247 molecule; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd247[em5Mcwi]", "display_text" : "Cd247em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd247em5Mcwi", "display_text" : "Cd247em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687713", "page_area" : "allele", "display_name" : "RGD:5687713" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687713", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 1 (del 159-166)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "regulated endocrine-specific protein 18; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Resp18[em3Mcwi]", "display_text" : "Resp18em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Resp18em3Mcwi", "display_text" : "Resp18em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687714", "page_area" : "allele", "display_name" : "RGD:5687714" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687714", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made using ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 369-381)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "adiponectin, C1Q and collagen domain containing; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adipoq[em2Mcwi]", "display_text" : "Adipoqem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adipoqem2Mcwi", "display_text" : "Adipoqem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687716", "page_area" : "allele", "display_name" : "RGD:5687716" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687716", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp frameshift deletion in exon 1 (del 226-229)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Prex1[em2Mcwi]", "display_text" : "Prex1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Prex1em2Mcwi", "display_text" : "Prex1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687719", "page_area" : "allele", "display_name" : "RGD:5687719" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687719", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 16 (del 1872-1885)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fibroblast growth factor 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "fibroblast growth factor 5; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fgf5[em1Mcwi]", "display_text" : "Fgf5em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fgf5em1Mcwi", "display_text" : "Fgf5em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687720", "page_area" : "allele", "display_name" : "RGD:5687720" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687720", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp deletion in exon 1 (del 314-345)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear receptor subfamily 2, group F, member 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "nuclear receptor subfamily 2, group F, member 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nr2f2[em1Mcwi]", "display_text" : "Nr2f2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nr2f2em1Mcwi", "display_text" : "Nr2f2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687721", "page_area" : "allele", "display_name" : "RGD:5687721" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687721", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp in-frame deletion in exon 2 (del 600-647) resulting in a 5 amino acid deletion in the hinge region of the Nr2f2 protein, affecting protein-protein interaction with Zfpm2 (also known as Fog2).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:25687237", "RGD:10401852", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "stanniocalcin 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "stanniocalcin 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Stc1[em2Mcwi]", "display_text" : "Stc1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Stc1em2Mcwi", "display_text" : "Stc1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687722", "page_area" : "allele", "display_name" : "RGD:5687722" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687722", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp frameshift deletion in exon 3 (del 717-724)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 4, subfamily a, polypeptide 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "cytochrome P450, family 4, subfamily a, polypeptide 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp4a2[em1Mcwi]", "display_text" : "Cyp4a2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp4a2em1Mcwi", "display_text" : "Cyp4a2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687724", "page_area" : "allele", "display_name" : "RGD:5687724" } }, "date_created" : "2012-02-09T00:00:00.000-06:00", "date_updated" : "2012-08-28T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:5687724", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a net 2-bp frameshift deletion in exon 2 (del 319-320)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "catechol-O-methyltransferase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "catechol-O-methyltransferase; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Comt[em1Mcwi]", "display_text" : "Comtem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Comtem1Mcwi", "display_text" : "Comtem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687725", "page_area" : "allele", "display_name" : "RGD:5687725" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687725", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp frameshift deletion in exon 4 (del 639-652)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "myeloid-associated differentiation marker-like 2; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Myadml2[em5Mcwi]", "display_text" : "Myadml2em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Myadml2em5Mcwi", "display_text" : "Myadml2em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687726", "page_area" : "allele", "display_name" : "RGD:5687726" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687726", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 31-bp frameshift deletion in exon 1 (del 161-191)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fibroblast growth factor 5; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "fibroblast growth factor 5; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fgf5[em5Mcwi]", "display_text" : "Fgf5em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fgf5em5Mcwi", "display_text" : "Fgf5em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687727", "page_area" : "allele", "display_name" : "RGD:5687727" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687727", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 2-bp deletion in exon 1 (del 341-342)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenosine A2B receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "adenosine A2B receptor; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adora2b[em1Mcwi]", "display_text" : "Adora2bem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Adora2bem1Mcwi", "display_text" : "Adora2bem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687729", "page_area" : "allele", "display_name" : "RGD:5687729" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687729", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 114-bp deletion in exon 1 (del 141-254)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "Cd247 molecule; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "Cd247 molecule; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cd247[em3Mcwi]", "display_text" : "Cd247em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cd247em3Mcwi", "display_text" : "Cd247em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687730", "page_area" : "allele", "display_name" : "RGD:5687730" } }, "date_created" : "2012-02-09T08:29:49.000-06:00", "date_updated" : "2012-02-09T08:29:49.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687730", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp frameshift deletion in exon 1 (del 155-167)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Sorcs3[em1Mcwi]", "display_text" : "Sorcs3em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Sorcs3em1Mcwi", "display_text" : "Sorcs3em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687731", "page_area" : "allele", "display_name" : "RGD:5687731" } }, "date_created" : "2012-02-09T08:29:50.000-06:00", "date_updated" : "2012-02-09T08:29:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687731", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp insertion in exon 7 (del 1392-1419, ins. Gacgtggtagagcggtgcatcatgagttgtctctggatgcataggtacctgccacatcttgtaataacagcatggtactccgtcatgtgcatatatcttagctgcttcaaatgctccttaattccttgac)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc6a12[em1Mcwi]", "display_text" : "Slc6a12em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Slc6a12em1Mcwi", "display_text" : "Slc6a12em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687736", "page_area" : "allele", "display_name" : "RGD:5687736" } }, "date_created" : "2012-02-09T08:29:50.000-06:00", "date_updated" : "2012-02-09T08:29:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687736", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 53-bp deletion overlapping exon 2 (v3.4 del 157781847- 157781899)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 4, subfamily a, polypeptide 3; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "cytochrome P450, family 4, subfamily a, polypeptide 3; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp4a3[em3Mcwi]", "display_text" : "Cyp4a3em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp4a3em3Mcwi", "display_text" : "Cyp4a3em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687737", "page_area" : "allele", "display_name" : "RGD:5687737" } }, "date_created" : "2012-02-09T08:29:50.000-06:00", "date_updated" : "2012-02-09T08:29:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687737", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 11-bp deletion in exon 2 (del 311-321)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystatin C; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "cystatin C; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cst3[em3Mcwi]", "display_text" : "Cst3em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cst3em3Mcwi", "display_text" : "Cst3em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687738", "page_area" : "allele", "display_name" : "RGD:5687738" } }, "date_created" : "2012-02-09T08:29:50.000-06:00", "date_updated" : "2012-02-09T08:29:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687738", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 1 (ins t at position 234)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "chloride channel 6; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "chloride channel 6; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Clcn6[em2Mcwi]", "display_text" : "Clcn6em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Clcn6em2Mcwi", "display_text" : "Clcn6em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:5687740", "page_area" : "allele", "display_name" : "RGD:5687740" } }, "date_created" : "2012-02-09T08:29:50.000-06:00", "date_updated" : "2012-02-09T08:29:50.000-06:00", "internal" : false, "primary_external_id" : "RGD:5687740", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp frameshift deletion in exon 13 (del 1180-1194)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "EMAP like 1, tish mutant", "display_text" : "EMAP like 1, tish mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Eml1[tish]", "display_text" : "Eml1tish", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:597538481", "page_area" : "allele", "display_name" : "RGD:597538481" } }, "date_created" : "2025-01-23T11:29:26.000-06:00", "date_updated" : "2025-01-23T11:29:26.000-06:00", "internal" : false, "primary_external_id" : "RGD:597538481", "note_dtos" : [ { "internal" : false, "free_text" : "The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the Eml1 genome (Rnor_6.0; ENSRNOG00000043143). It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:32179177", "PMID:9236234", "RGD:407985868", "RGD:597538480" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cystic fibrosis transmembrane conductance regulator;CRISPR/Cas9 induced mutant 1,Wpick", "display_text" : "cystic fibrosis transmembrane conductance regulator;CRISPR/Cas9 induced mutant 1,Wpick", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cftr[em1Wpick]", "display_text" : "Cftrem1Wpick", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:598092489", "page_area" : "allele", "display_name" : "RGD:598092489" } }, "date_created" : "2025-03-18T16:00:31.000-05:00", "date_updated" : "2025-03-18T16:00:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:598092489", "note_dtos" : [ { "internal" : false, "free_text" : "A targeted 16 bp deletion was made in Exon 3 of the rat Cftr gene using CRISPR-Cas9 technology.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lysosomal trafficking regulator; beige mutant", "display_text" : "lysosomal trafficking regulator; beige mutant", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lyst[bg]", "display_text" : "Lystbg", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:598099555", "page_area" : "allele", "display_name" : "RGD:598099555" } }, "date_created" : "2025-04-01T15:18:18.000-05:00", "date_updated" : "2025-04-01T15:18:18.000-05:00", "internal" : false, "primary_external_id" : "RGD:598099555", "note_dtos" : [ { "internal" : false, "free_text" : "This Lyst gene mutation was identified in 1985 in DA rats maintained at Hamamatsu University School of Medicine since 1980. The mutant beige protein was frameshift and prematured truncated at the 2594th amino acids due to 578 bp deletion (positions 7742-8319) caused by recombination between LINE1s (Long Interspersed Nuclear Element 1)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:10384041", "RGD:633300" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adenylate cyclase 3; CRISPR/Cas9 induced mutant 3, Mcwi", "display_text" : "adenylate cyclase 3; CRISPR/Cas9 induced mutant 3, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adcy3[em3Mcwi]", "display_text" : "Adcy3em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:616390062", "page_area" : "allele", "display_name" : "RGD:616390062" } }, "date_created" : "2025-06-09T11:12:34.000-05:00", "date_updated" : "2025-06-09T11:12:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:616390062", "note_dtos" : [ { "internal" : false, "free_text" : "Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062).", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP binding cassette subfamily A member 4; CRISPR/Cas9 induced mutant 1, Tuckr", "display_text" : "ATP binding cassette subfamily A member 4; CRISPR/Cas9 induced mutant 1, Tuckr", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abca4[em1Tuckr]", "display_text" : "Abca4em1Tuckr", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:617212699", "page_area" : "allele", "display_name" : "RGD:617212699" } }, "date_created" : "2025-07-16T17:02:25.000-05:00", "date_updated" : "2025-07-16T17:02:25.000-05:00", "internal" : false, "primary_external_id" : "RGD:617212699", "note_dtos" : [ { "internal" : false, "free_text" : "This is an Abca4 knockout mutant allele induced by CRISPR/Cas9 targeted at exon 2 to exon 8 of rat Abca4 gene.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 5 member 9;CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "solute carrier family 5 member 9;CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-07-28T11:24:21.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc5a9[em1Mcwi]", "display_text" : "Slc5a9em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:617301244", "page_area" : "allele", "display_name" : "RGD:617301244" } }, "date_created" : "2025-07-28T11:18:58.000-05:00", "date_updated" : "2025-07-28T11:18:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:617301244", "note_dtos" : [ { "internal" : false, "free_text" : "This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence AGGTCATGGATCTTCCAGCC. A 4-bp deletion in exon 2 (rn7: chr5:126,730,986-126,730,989) resulted.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:38545789", "RGD:617301242" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "solute carrier family 5 member 10; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "solute carrier family 5 member 10; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Slc5a10[em1Mcwi]", "display_text" : "Slc5a10em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:617301245", "page_area" : "allele", "display_name" : "RGD:617301245" } }, "date_created" : "2025-07-28T11:29:39.000-05:00", "date_updated" : "2025-07-28T11:29:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:617301245", "note_dtos" : [ { "internal" : false, "free_text" : "This CRISPR/Cas9 induced Slc5a9 mutant allele was created by injecting Crl:SD embryos with CRISPR-Cas9 using guide RNA targeting the sequence GAATACATTCAGAAGCGCTT. A 29-bp deletion in exon 5 (rn7: chr10:46,393,272-46,393,300) resulted.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:38545789", "RGD:617301242" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "FMRP translational regulator 1; ZFN induced mutant1,Sidb", "display_text" : "FMRP translational regulator 1; ZFN induced mutant1,Sidb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fmr1[em1Sidb]", "display_text" : "Fmr1em1Sidb", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fmr1em1Pwc", "display_text" : "Fmr1em1Pwc", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:625813034", "page_area" : "allele", "display_name" : "RGD:625813034" } }, "date_created" : "2025-08-14T14:38:16.000-05:00", "date_updated" : "2025-08-14T14:43:03.000-05:00", "internal" : false, "primary_external_id" : "RGD:625813034", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting knock out of Fmr1 mRNA and protein", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:31142675", "PMID:33031903", "PMID:36536454", "RGD:401976434", "RGD:405100224", "RGD:405100225" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb", "display_text" : "synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Syngap1[em1Sidb]", "display_text" : "Syngap1em1Sidb", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419667", "page_area" : "allele", "display_name" : "RGD:626419667" } }, "date_created" : "2025-09-04T12:44:31.000-05:00", "date_updated" : "2025-09-04T12:44:31.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419667", "note_dtos" : [ { "internal" : false, "free_text" : "This allele carrying a 2bp deletion and 1bp insertion, leading to a frameshift mutation in exon 8 of Syngap1, which prevents expression of the protein.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "synaptic Ras GTPase activating protein 1; endonucease induced mutant 2,Sidb", "display_text" : "synaptic Ras GTPase activating protein 1; endonucease induced mutant 2,Sidb", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-08T12:53:20.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Syngap1[em2Sidb]", "display_text" : "Syngap1em2Sidb", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb", "display_text" : "synaptic Ras GTPase activating protein 1; endonucease induced mutant 1,Sidb", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419668", "page_area" : "allele", "display_name" : "RGD:626419668" } }, "date_created" : "2025-09-04T12:50:57.000-05:00", "date_updated" : "2025-09-04T12:50:57.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419668", "note_dtos" : [ { "internal" : false, "free_text" : "This allele created in LE embryos contains a 3,584-bp selective deletion and 3-bp insertion were confirmed by sequencing, which resulted in a mutant protein that was 377 amino acids smaller than endogenous SYNGAP1.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutamate ionotropic receptor NMDA type subunit 2A; endonuclease induced mutant 1, Sidb", "display_text" : "glutamate ionotropic receptor NMDA type subunit 2A; endonuclease induced mutant 1, Sidb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Grin2a[em1Sidb]", "display_text" : "Grin2aem1Sidb", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419669", "page_area" : "allele", "display_name" : "RGD:626419669" } }, "date_created" : "2025-09-04T12:56:40.000-05:00", "date_updated" : "2025-09-04T12:56:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419669", "note_dtos" : [ { "internal" : false, "free_text" : "This allele has a deletion of a 1065bp region spanning Grin2a exon 8 (which encodes key pore forming domains of GluN2A) in Long Evans (LE) embryos, generating a KO allele.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cyclin-dependent kinase-like 5; endonuclease induced mutant 1, Sidb", "display_text" : "cyclin-dependent kinase-like 5; endonuclease induced mutant 1, Sidb", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cdkl5[em1Sidb]", "display_text" : "Cdkl5em1Sidb", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419670", "page_area" : "allele", "display_name" : "RGD:626419670" } }, "date_created" : "2025-09-04T13:11:03.000-05:00", "date_updated" : "2025-09-04T13:11:03.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419670", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 technology was used in Long Evans (LE) embryos to introduce a 10bp deletion in exon 8 of the Cdkl5 gene (Ensembl coordinates X:35,674,763–35,674,772, in the Rnor_6.0 genome assembly) which results in the introduction of an early stop codon in constitutive exon 9, leading to lack of CDKL5 protein expression.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein subunit alpha L; CRISPR/Cas9 induced mutant 2, Hpng", "display_text" : "G protein subunit alpha L; CRISPR/Cas9 induced mutant 2, Hpng", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gnal[em2Hpng]", "display_text" : "Gnalem2Hpng", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gnalsplicing variant 2-del44", "display_text" : "Gnalsplicing variant 2-del44", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419678", "page_area" : "allele", "display_name" : "RGD:626419678" } }, "date_created" : "2025-09-05T09:43:44.000-05:00", "date_updated" : "2025-09-05T09:43:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419678", "note_dtos" : [ { "internal" : false, "free_text" : "Gnal knockout allele was generated by CRISPR/Cas9 technology. Exon1 of rat Gnal splicing variant 2 was targeted, resulting in a deletion of 1 base pair that corresponds to position 44 downstream of the translation start point ATG of the Gnal splicing variant 2.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein subunit alpha L; CRISPR/Cas9 induced mutant 3, Hpng", "display_text" : "G protein subunit alpha L; CRISPR/Cas9 induced mutant 3, Hpng", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gnal[em3Hpng]", "display_text" : "Gnalem3Hpng", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Gnaldel44-178", "display_text" : "Gnaldel44-178", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419680", "page_area" : "allele", "display_name" : "RGD:626419680" } }, "date_created" : "2025-09-05T09:56:04.000-05:00", "date_updated" : "2025-09-05T09:56:04.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419680", "note_dtos" : [ { "internal" : false, "free_text" : "The allele was generated by CRISPR/Cas9 technology. A deletion of 135 base pairs, corresponding to position 44-178, downstream of the translation initiation start ATG of the Gnal splicing variant 2, results in a deletion mutation.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "G protein-coupled receptor 143; endonuclease induced mutant 1, Gosh", "display_text" : "G protein-coupled receptor 143; endonuclease induced mutant 1, Gosh", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Gpr143[em19Gosh]", "display_text" : "Gpr143em19Gosh", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419681", "page_area" : "allele", "display_name" : "RGD:626419681" } }, "date_created" : "2025-09-05T12:09:34.000-05:00", "date_updated" : "2025-09-05T12:09:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419681", "note_dtos" : [ { "internal" : false, "free_text" : "This allele carries deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:35063136", "RGD:598092594" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paternally expressed 3; endonuclease induced mutant 1, Soar", "display_text" : "paternally expressed 3; endonuclease induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Peg3[em1Soar]", "display_text" : "Peg3em1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419682", "page_area" : "allele", "display_name" : "RGD:626419682" } }, "date_created" : "2025-09-05T13:24:26.000-05:00", "date_updated" : "2025-09-05T13:24:26.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419682", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 genome editing of the Peg3 gene", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "collagen type VII alpha 1 chain; endonuclease induced mutant 1, Jtol", "display_text" : "collagen type VII alpha 1 chain; endonuclease induced mutant 1, Jtol", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Col7a1[em1Jtol]", "display_text" : "Col7a1em1Jtol", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419684", "page_area" : "allele", "display_name" : "RGD:626419684" } }, "date_created" : "2025-09-05T13:53:50.000-05:00", "date_updated" : "2025-09-05T13:53:50.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419684", "note_dtos" : [ { "internal" : false, "free_text" : "The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:38722855", "RGD:598130078" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "DOP1 leucine zipper like protein A;vacuole formation", "display_text" : "DOP1 leucine zipper like protein A;vacuole formation", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Dop1a[vf]", "display_text" : "Dop1avf", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419686", "page_area" : "allele", "display_name" : "RGD:626419686" } }, "date_created" : "2025-09-05T14:18:26.000-05:00", "date_updated" : "2025-09-05T14:18:26.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419686", "note_dtos" : [ { "internal" : false, "free_text" : "This vacuole formation causing mutation (Dop1avf) in Dopey1(Dop1a) in VF/Kyo strain.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transmembrane protein 130; endonuclease induced mutant 1, Taoki", "display_text" : "transmembrane protein 130; endonuclease induced mutant 1, Taoki", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tmem130[em1Taoki]", "display_text" : "Tmem130em1Taoki", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419687", "page_area" : "allele", "display_name" : "RGD:626419687" } }, "date_created" : "2025-09-05T14:28:39.000-05:00", "date_updated" : "2025-09-05T14:28:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419687", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NADPH oxidase 1; endonuclease induced mutant 1, Shmo", "display_text" : "NADPH oxidase 1; endonuclease induced mutant 1, Shmo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nox1[em1Shmo]", "display_text" : "Nox1em1Shmo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419688", "page_area" : "allele", "display_name" : "RGD:626419688" } }, "date_created" : "2025-09-05T14:41:53.000-05:00", "date_updated" : "2025-09-05T14:41:53.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419688", "note_dtos" : [ { "internal" : false, "free_text" : "A 29-base deletion was introduced into the first exon of the NADPH oxidase 1 (Nox1) gene of F344/DuCrj rats by CRISPR/Cas9.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Shmo", "display_text" : "cytochrome b-245 beta chain; CRISPR/Cas9 system induced mutant 1, Shmo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cybb[em1Shmo]", "display_text" : "Cybbem1Shmo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419689", "page_area" : "allele", "display_name" : "RGD:626419689" } }, "date_created" : "2025-09-05T14:47:27.000-05:00", "date_updated" : "2025-09-05T14:47:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419689", "note_dtos" : [ { "internal" : false, "free_text" : "A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NADPH oxidase 4; endonuclease induced mutant 1, Shmo", "display_text" : "NADPH oxidase 4; endonuclease induced mutant 1, Shmo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nox4[em1Shmo]", "display_text" : "Nox4em1Shmo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419690", "page_area" : "allele", "display_name" : "RGD:626419690" } }, "date_created" : "2025-09-05T14:53:24.000-05:00", "date_updated" : "2025-09-05T14:53:24.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419690", "note_dtos" : [ { "internal" : false, "free_text" : "A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "galectin 3; endonuclease induced mutant 1, Dfult", "display_text" : "galectin 3; endonuclease induced mutant 1, Dfult", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-05T15:20:15.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Lgals3[em1Dfult]", "display_text" : "Lgals3em1Dfult", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419691", "page_area" : "allele", "display_name" : "RGD:626419691" } }, "date_created" : "2025-09-05T15:16:13.000-05:00", "date_updated" : "2025-09-05T15:16:13.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419691", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR technology was used on the Sprague-Dawley background (Sage) to edit Lgals3 genome. CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue", "note_type_name" : "comment" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "PDZ binding kinase; endonuclease induced mutant 1, Dfult", "display_text" : "PDZ binding kinase; endonuclease induced mutant 1, Dfult", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pbk[em1Dfult]", "display_text" : "Pbkem1Dfult", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626419692", "page_area" : "allele", "display_name" : "RGD:626419692" } }, "date_created" : "2025-09-05T15:29:29.000-05:00", "date_updated" : "2025-09-05T15:29:29.000-05:00", "internal" : false, "primary_external_id" : "RGD:626419692", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR-Cas9 technology was used to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "heat shock protein family A (Hsp70) member 8; ENU induced mutant1, Kyo", "display_text" : "heat shock protein family A (Hsp70) member 8; ENU induced mutant1, Kyo", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hspa8[m1Kyo]", "display_text" : "Hspa8m1Kyo", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626467888", "page_area" : "allele", "display_name" : "RGD:626467888" } }, "date_created" : "2025-09-08T16:24:02.000-05:00", "date_updated" : "2025-09-08T16:24:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:626467888", "note_dtos" : [ { "internal" : false, "free_text" : "This is an ENU induced mutation causing gait abnormality in KK rats (F344/NSlc background). The mutation is identified as a missense mutation (c.284T>A, p. V95E).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:38384479", "RGD:598092576" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu", "display_text" : "heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hspa8[em1Opu]", "display_text" : "Hspa8em1Opu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626467889", "page_area" : "allele", "display_name" : "RGD:626467889" } }, "date_created" : "2025-09-08T16:39:30.000-05:00", "date_updated" : "2025-09-08T16:39:30.000-05:00", "internal" : false, "primary_external_id" : "RGD:626467889", "note_dtos" : [ { "internal" : false, "free_text" : "The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:38384479", "RGD:598092576" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu", "display_text" : "heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hspa8[em2Opu]", "display_text" : "Hspa8em2Opu", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626467891", "page_area" : "allele", "display_name" : "RGD:626467891" } }, "date_created" : "2025-09-08T16:50:41.000-05:00", "date_updated" : "2025-09-08T16:50:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:626467891", "note_dtos" : [ { "internal" : false, "free_text" : "The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:38384479", "RGD:598092576" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "thrombomodulin; CRISPR/Cas 9 induced mutant 1, Soar", "display_text" : "thrombomodulin; CRISPR/Cas 9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Thbd[em1Soar]", "display_text" : "Thbdem1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626469576", "page_area" : "allele", "display_name" : "RGD:626469576" } }, "date_created" : "2025-09-16T17:45:02.000-05:00", "date_updated" : "2025-09-16T17:45:02.000-05:00", "internal" : false, "primary_external_id" : "RGD:626469576", "note_dtos" : [ { "internal" : false, "free_text" : "1316 bp deletion of the coding region of the Thbd gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "pleckstrin homology-like domain, family A, member 2; em1, Soar", "display_text" : "pleckstrin homology-like domain, family A, member 2; em1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Phlda2[em1Soar]", "display_text" : "Phlda2em1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626469578", "page_area" : "allele", "display_name" : "RGD:626469578" } }, "date_created" : "2025-09-16T17:52:37.000-05:00", "date_updated" : "2025-09-16T17:52:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:626469578", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated 103 bp deletion within Exon 1 of the Phlda2 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "adrenomedullin; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "adrenomedullin; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Adm[em1Soar]", "display_text" : "Admem1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626469800", "page_area" : "allele", "display_name" : "RGD:626469800" } }, "date_created" : "2025-09-17T11:48:58.000-05:00", "date_updated" : "2025-09-17T11:48:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:626469800", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated 206 bp deletion associated with Exon 2 and the second intron of the Adm gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "TATA-box binding protein associated factor 7-like; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "TATA-box binding protein associated factor 7-like; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Taf7l[em1Soar]", "display_text" : "Taf7lem1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626469801", "page_area" : "allele", "display_name" : "RGD:626469801" } }, "date_created" : "2025-09-17T12:01:28.000-05:00", "date_updated" : "2025-09-17T12:01:28.000-05:00", "internal" : false, "primary_external_id" : "RGD:626469801", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated 110 bp deletion targeting Exon 3 of the Taf7l gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-17T12:27:19.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tfap2c[em1Soar]", "display_text" : "Tfap2cem1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626469802", "page_area" : "allele", "display_name" : "RGD:626469802" } }, "date_created" : "2025-09-17T12:13:09.000-05:00", "date_updated" : "2025-09-17T12:13:09.000-05:00", "internal" : false, "primary_external_id" : "RGD:626469802", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated 308 bpy deletion within Exon 4 of the Tfap2c gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 2, Soar", "display_text" : "transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 2, Soar", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-22T11:23:49.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-22T11:23:19.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-22T09:29:18.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Tfap2c[em2Soar]", "display_text" : "Tfap2cem2Soar", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "transcription factor AP-2 gamma; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Tfap2c[em3Soar]", "display_text" : "Tfap2cem3Soar", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626469803", "page_area" : "allele", "display_name" : "RGD:626469803" } }, "date_created" : "2025-09-17T12:28:44.000-05:00", "date_updated" : "2025-09-17T12:28:44.000-05:00", "internal" : false, "primary_external_id" : "RGD:626469803", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated insertion of loxp sites flanking Exon 4 of the Tfap2c gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "T-box transcription factor 21; ZFN induced mutant 1, Sage", "display_text" : "T-box transcription factor 21; ZFN induced mutant 1, Sage", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tbx21[em1Sage]", "display_text" : "Tbx21em1Sage", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:626471108", "page_area" : "allele", "display_name" : "RGD:626471108" } }, "date_created" : "2025-09-18T09:52:54.000-05:00", "date_updated" : "2025-09-18T09:52:54.000-05:00", "internal" : false, "primary_external_id" : "RGD:626471108", "note_dtos" : [ { "internal" : false, "free_text" : "This allele is created using ZFN technology targeting Tbx21 exon 1 coding sequences 378-412. The resulting mutation is a 22-bp deletion (392-413).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:29564567", "RGD:626469805" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "endothelial PAS domain protein 1; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "endothelial PAS domain protein 1; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2025-09-19T16:16:15.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Epas1[em1Soar]", "display_text" : "Epas1em1Soar", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Epas1[em1Soar", "display_text" : "Epas1em1Soar", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:628359038", "page_area" : "allele", "display_name" : "RGD:628359038" } }, "date_created" : "2025-09-19T16:08:32.000-05:00", "date_updated" : "2025-09-19T16:08:32.000-05:00", "internal" : false, "primary_external_id" : "RGD:628359038", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated 34 bp deletion within Exon 2 of the Epas1 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "LIF receptor subunit alpha; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "LIF receptor subunit alpha; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lifr[em1Soar]", "display_text" : "Lifrem1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:628359039", "page_area" : "allele", "display_name" : "RGD:628359039" } }, "date_created" : "2025-09-19T16:15:16.000-05:00", "date_updated" : "2025-09-19T16:15:16.000-05:00", "internal" : false, "primary_external_id" : "RGD:628359039", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated 88bp deletion of Exon 2 of the Lifr gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "follistatin like 3; CRISPR/Cas9 induced mutant 1, Soar", "display_text" : "follistatin like 3; CRISPR/Cas9 induced mutant 1, Soar", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fstl3[em1Soar]", "display_text" : "Fstl3em1Soar", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:628359040", "page_area" : "allele", "display_name" : "RGD:628359040" } }, "date_created" : "2025-09-19T16:24:58.000-05:00", "date_updated" : "2025-09-19T16:24:58.000-05:00", "internal" : false, "primary_external_id" : "RGD:628359040", "note_dtos" : [ { "internal" : false, "free_text" : "Crispr/Cas9 mediated 3243 bp deletion affecting Exons 1-3 of the Fstl3 gene", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "period circadian regulator 1; CRISPR/Cas9 induced mutant 1,Smoc", "display_text" : "period circadian regulator 1; CRISPR/Cas9 induced mutant 1,Smoc", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Per1[em1Smoc]", "display_text" : "Per1em1Smoc", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Per1 (c.‐3353_‐3345delTGACGTCA) Smoc", "display_text" : "Per1 (c.‐3353_‐3345delTGACGTCA) Smoc", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:629006643", "page_area" : "allele", "display_name" : "RGD:629006643" } }, "date_created" : "2025-11-11T13:29:59.000-06:00", "date_updated" : "2025-11-11T13:29:59.000-06:00", "internal" : false, "primary_external_id" : "RGD:629006643", "note_dtos" : [ { "internal" : false, "free_text" : "CRISPR/Cas9 system was used to generate a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter in Sprague Dawley (Charles River) rat embryos.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating 1; CRISPR/Cas9 induced mutant 1, Mcwi", "display_text" : "recombination activating 1; CRISPR/Cas9 induced mutant 1, Mcwi", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag1[em6Mcwi]", "display_text" : "Rag1em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:629096379", "page_area" : "allele", "display_name" : "RGD:629096379" } }, "date_created" : "2025-12-02T15:07:41.000-06:00", "date_updated" : "2025-12-02T15:07:41.000-06:00", "internal" : false, "primary_external_id" : "RGD:629096379", "note_dtos" : [ { "internal" : false, "free_text" : "The allele was produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion.", "note_type_name" : "mutation_description" } ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ROSA 26 ZFN-stimulated knockin mutant 1; Medical College of Wisconsin", "display_text" : "ROSA 26 ZFN-stimulated knockin mutant 1; Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2023-08-01T10:47:59.000-05:00", "nomenclature_event_name" : "symbol_and_name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "ROSA26[em1(SB11)Mcwi]", "display_text" : "ROSA26em1(SB11)Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rosa26em1(SB11)Mcwi", "display_text" : "Rosa26em1(SB11)Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "zinc finger nuclease-stimulated knockin", "display_text" : "zinc finger nuclease-stimulated knockin", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484518", "page_area" : "allele", "display_name" : "RGD:6484518" } }, "date_created" : "2012-06-20T10:24:27.000-05:00", "date_updated" : "2012-06-20T10:24:27.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484518", "note_dtos" : [ { "internal" : false, "free_text" : "this locus incorporates the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA and SV40 polyadenylation signal to integrate the transgene by homologous recombination", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:12842434", "PMID:21151125", "PMID:22564063", "RGD:6484515", "RGD:6484516", "RGD:6484517" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "leptin; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lep[em5Mcwi]", "display_text" : "Lepem5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lepem5Mcwi", "display_text" : "Lepem5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484700", "page_area" : "allele", "display_name" : "RGD:6484700" } }, "date_created" : "2012-07-02T15:29:59.000-05:00", "date_updated" : "2012-07-02T15:29:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484700", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 118-130)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "leptin receptor; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[em2Mcwi]", "display_text" : "Leprem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Leprem2Mcwi", "display_text" : "Leprem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484701", "page_area" : "allele", "display_name" : "RGD:6484701" } }, "date_created" : "2012-07-02T15:29:59.000-05:00", "date_updated" : "2012-07-02T15:29:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484701", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 16-bp deletion in exon 11 (del 2130-2145)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:27465994", "PMID:32390513", "RGD:12911217", "RGD:34888223", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ace[em1Mcwi]", "display_text" : "Aceem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Aceem1Mcwi", "display_text" : "Aceem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484702", "page_area" : "allele", "display_name" : "RGD:6484702" } }, "date_created" : "2012-07-02T15:29:59.000-05:00", "date_updated" : "2012-07-02T15:29:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484702", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 6.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "calcium channel, voltage-dependent, T type, alpha 1H subunit; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "calcium channel, voltage-dependent, T type, alpha 1H subunit; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cacna1h[em2Mcwi]", "display_text" : "Cacna1hem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cacna1hem2Mcwi", "display_text" : "Cacna1hem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484703", "page_area" : "allele", "display_name" : "RGD:6484703" } }, "date_created" : "2012-07-02T15:29:59.000-05:00", "date_updated" : "2012-07-02T15:29:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484703", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 11.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "angiotensin I converting enzyme (peptidyl-dipeptidase A) 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ace[em2Mcwi]", "display_text" : "Aceem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Aceem2Mcwi", "display_text" : "Aceem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484704", "page_area" : "allele", "display_name" : "RGD:6484704" } }, "date_created" : "2012-07-02T15:29:59.000-05:00", "date_updated" : "2012-07-02T15:29:59.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484704", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 6.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cubilin (intrinsic factor-cobalamin receptor) ; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "cubilin (intrinsic factor-cobalamin receptor) ; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Cubn[em1Mcwi]", "display_text" : "Cubnem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cubnem1Mcwi", "display_text" : "Cubnem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484705", "page_area" : "allele", "display_name" : "RGD:6484705" } }, "date_created" : "2012-07-02T15:30:00.000-05:00", "date_updated" : "2012-07-02T15:30:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484705", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 14.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lss[em2Mcwi]", "display_text" : "Lssem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lssem2Mcwi", "display_text" : "Lssem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484706", "page_area" : "allele", "display_name" : "RGD:6484706" } }, "date_created" : "2012-07-02T15:30:00.000-05:00", "date_updated" : "2012-07-02T15:30:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484706", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a net 10-bp deletion in exon 2 (del 117-130, ins. Gtgg)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATPase, Ca++ transporting, plasma membrane 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "ATPase, Ca++ transporting, plasma membrane 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Atp2b1[em2Mcwi]", "display_text" : "Atp2b1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Atp2b1em2Mcwi", "display_text" : "Atp2b1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484707", "page_area" : "allele", "display_name" : "RGD:6484707" } }, "date_created" : "2012-07-02T15:30:00.000-05:00", "date_updated" : "2012-07-02T15:30:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484707", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 117-bp deletion in intron 8 and exon 9.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "branched chain amino acid transaminase 1, cytosolic; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "branched chain amino acid transaminase 1, cytosolic; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Bcat1[em2Mcwi]", "display_text" : "Bcat1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Bcat1em2Mcwi", "display_text" : "Bcat1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484708", "page_area" : "allele", "display_name" : "RGD:6484708" } }, "date_created" : "2012-07-02T15:30:00.000-05:00", "date_updated" : "2012-07-02T15:30:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484708", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 15-bp deletion in exon 5", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "lipin 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "lipin 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lpin1[em1Mcwi]", "display_text" : "Lpin1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lpin1em1Mcwi", "display_text" : "Lpin1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6484709", "page_area" : "allele", "display_name" : "RGD:6484709" } }, "date_created" : "2012-07-02T15:30:00.000-05:00", "date_updated" : "2012-07-02T15:30:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:6484709", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 4-bp deletion in exon 3 (del 719-722)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 1 receptor, type I; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "interleukin 1 receptor, type I; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il1r1[em3Mcwi]", "display_text" : "Il1r1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il1r1em3Mcwi", "display_text" : "Il1r1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893378", "page_area" : "allele", "display_name" : "RGD:6893378" } }, "date_created" : "2012-08-24T10:31:14.000-05:00", "date_updated" : "2012-08-24T10:31:14.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893378", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp insertion in exon 5.(ins a)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "display_text" : "potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 5, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj11[em5Mcwi]", "display_text" : "Kcnj11em5Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnj11em5Mcwi", "display_text" : "Kcnj11em5Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893379", "page_area" : "allele", "display_name" : "RGD:6893379" } }, "date_created" : "2012-08-24T10:31:15.000-05:00", "date_updated" : "2012-08-24T10:31:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893379", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting allele is a 8-bp deletion in exon 1 (del 311-318)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 6, Medical College of Wisconsin", "display_text" : "FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fyn[em6Mcwi]", "display_text" : "Fynem6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fynem6Mcwi", "display_text" : "Fynem6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893380", "page_area" : "allele", "display_name" : "RGD:6893380" } }, "date_created" : "2012-08-24T10:31:15.000-05:00", "date_updated" : "2012-08-24T10:31:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893380", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is an 8-bp deletion in exon 4 (del 385-392)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "display_text" : "potassium inwardly rectifying channel, subfamily J, member 11; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj11[em9Mcwi]", "display_text" : "Kcnj11em9Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnj11em9Mcwi", "display_text" : "Kcnj11em9Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893381", "page_area" : "allele", "display_name" : "RGD:6893381" } }, "date_created" : "2012-08-24T10:31:15.000-05:00", "date_updated" : "2012-08-24T10:31:15.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893381", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting allele is a 5-bp deletion in exon 1 (del 310-314)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hvcn1[em1Mcwi]", "display_text" : "Hvcn1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Hvcn1em1Mcwi", "display_text" : "Hvcn1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893410", "page_area" : "allele", "display_name" : "RGD:6893410" } }, "date_created" : "2012-08-28T10:52:34.000-05:00", "date_updated" : "2012-08-28T10:52:34.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893410", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 314-321)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "FYN oncogene related to SRC, FGR, YES; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fyn[em1Mcwi]", "display_text" : "Fynem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fynem1Mcwi", "display_text" : "Fynem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893411", "page_area" : "allele", "display_name" : "RGD:6893411" } }, "date_created" : "2012-08-28T10:52:35.000-05:00", "date_updated" : "2012-08-28T10:52:35.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893411", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 4 (del 383-389)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "fibroblast growth factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "fibroblast growth factor 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Fgf1[em2Mcwi]", "display_text" : "Fgf1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Fgf1em2Mcwi", "display_text" : "Fgf1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893412", "page_area" : "allele", "display_name" : "RGD:6893412" } }, "date_created" : "2012-08-28T10:52:36.000-05:00", "date_updated" : "2012-08-28T10:52:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893412", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp deletion in exon 3 (del 442-451)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "N-acetyltransferase 8; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "display_text" : "N-acetyltransferase 8; zinc finger nuclease induced mutant 4, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nat8[em4Mcwi]", "display_text" : "Nat8em4Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nat8em4Mcwi", "display_text" : "Nat8em4Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893413", "page_area" : "allele", "display_name" : "RGD:6893413" } }, "date_created" : "2012-08-28T10:52:37.000-05:00", "date_updated" : "2012-08-28T10:52:37.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893413", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 1 (del 46-52)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 1 receptor, type I; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "interleukin 1 receptor, type I; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il1r1[em2Mcwi]", "display_text" : "Il1r1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il1r1em2Mcwi", "display_text" : "Il1r1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893414", "page_area" : "allele", "display_name" : "RGD:6893414" } }, "date_created" : "2012-08-28T10:52:38.000-05:00", "date_updated" : "2012-08-28T10:52:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893414", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 7-bp deletion in exon 5 (del 444-450)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnmb1[em1Mcwi]", "display_text" : "Kcnmb1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnmb1em1Mcwi", "display_text" : "Kcnmb1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893415", "page_area" : "allele", "display_name" : "RGD:6893415" } }, "date_created" : "2012-08-28T10:52:38.000-05:00", "date_updated" : "2012-08-28T10:52:38.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893415", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting allele is a net 4-bp deletion in exon 2 (del 441-447, ins. Tct)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "glutamate receptor, metabotropic 7; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "glutamate receptor, metabotropic 7; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Grm7[em2Mcwi]", "display_text" : "Grm7em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Grm7em2Mcwi", "display_text" : "Grm7em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893416", "page_area" : "allele", "display_name" : "RGD:6893416" } }, "date_created" : "2012-08-28T10:52:39.000-05:00", "date_updated" : "2012-08-28T10:52:39.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893416", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 1-bp deletion in exon 3 (a)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 6, Medical College of Wisconsin", "display_text" : "transcription factor Dp-2 (E2F dimerization partner 2); zinc finger nuclease induced mutant 6, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tfdp2[em6Mcwi]", "display_text" : "Tfdp2em6Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tfdp2em6Mcwi", "display_text" : "Tfdp2em6Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893417", "page_area" : "allele", "display_name" : "RGD:6893417" } }, "date_created" : "2012-08-28T10:52:40.000-05:00", "date_updated" : "2012-08-28T10:52:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893417", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 14-bp deletion in exon 6 (del 614-627)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nos3[em2Mcwi]", "display_text" : "Nos3em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nos3em2Mcwi", "display_text" : "Nos3em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893418", "page_area" : "allele", "display_name" : "RGD:6893418" } }, "date_created" : "2012-08-28T10:52:40.000-05:00", "date_updated" : "2012-08-28T10:52:40.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893418", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 3 (del 399-411)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "hydrogen voltage-gated channel 1; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Hvcn1[em2Mcwi]", "display_text" : "Hvcn1em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Hvcn1em2Mcwi", "display_text" : "Hvcn1em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893419", "page_area" : "allele", "display_name" : "RGD:6893419" } }, "date_created" : "2012-08-28T10:52:41.000-05:00", "date_updated" : "2012-08-28T10:52:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893419", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 8-bp deletion in exon 5 (del 313-320)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:31250553", "RGD:14985213", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "display_text" : "potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnmb1[em3Mcwi]", "display_text" : "Kcnmb1em3Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnmb1em3Mcwi", "display_text" : "Kcnmb1em3Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893420", "page_area" : "allele", "display_name" : "RGD:6893420" } }, "date_created" : "2012-08-28T10:52:41.000-05:00", "date_updated" : "2012-08-28T10:52:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893420", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting allele is a 21-bp deletion in exon 2 and intron 2 (del 18906672-18906692)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 8, Medical College of Wisconsin", "display_text" : "nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 8, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nos3[em8Mcwi]", "display_text" : "Nos3em8Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nos3em8Mcwi", "display_text" : "Nos3em8Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893421", "page_area" : "allele", "display_name" : "RGD:6893421" } }, "date_created" : "2012-08-28T10:52:41.000-05:00", "date_updated" : "2012-08-28T10:52:41.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893421", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 109-bp deletion in exon 3 (del 309-417)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 13, Medical College of Wisconsin", "display_text" : "nitric oxide synthase 3, endothelial cell; zinc finger nuclease induced mutant 13, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Nos3[em13Mcwi]", "display_text" : "Nos3em13Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Nos3em13Mcwi", "display_text" : "Nos3em13Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893422", "page_area" : "allele", "display_name" : "RGD:6893422" } }, "date_created" : "2012-08-28T10:52:42.000-05:00", "date_updated" : "2012-08-28T10:52:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893422", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "potassium inwardly-rectifying channel, subfamily J, member 16; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "potassium inwardly-rectifying channel, subfamily J, member 16; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Kcnj16[em1Mcwi]", "display_text" : "Kcnj16em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Kcnj16em1Mcwi", "display_text" : "Kcnj16em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893423", "page_area" : "allele", "display_name" : "RGD:6893423" } }, "date_created" : "2012-08-28T10:52:42.000-05:00", "date_updated" : "2012-08-28T10:52:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893423", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting allele is a 18-bp deletion in exon 1 (del 529-546)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:28931751", "PMID:30605394", "RGD:38500203", "RGD:38500204", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "peroxisome proliferator-activated receptor gamma; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "peroxisome proliferator-activated receptor gamma; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pparg[em1Mcwi]", "display_text" : "Ppargem1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ppargem1Mcwi", "display_text" : "Ppargem1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893424", "page_area" : "allele", "display_name" : "RGD:6893424" } }, "date_created" : "2012-08-28T10:52:42.000-05:00", "date_updated" : "2012-08-28T10:52:42.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893424", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "interleukin 1 receptor, type I; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "interleukin 1 receptor, type I; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Il1r1[em1Mcwi]", "display_text" : "Il1r1em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Il1r1em1Mcwi", "display_text" : "Il1r1em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893425", "page_area" : "allele", "display_name" : "RGD:6893425" } }, "date_created" : "2012-08-28T10:52:43.000-05:00", "date_updated" : "2012-08-28T10:52:43.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893425", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 13-bp deletion in exon 5 (del 441-453)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "ATP-binding cassette, subfamily B (MDR/TAP), member 1B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "ATP-binding cassette, subfamily B (MDR/TAP), member 1B; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Abcb1b[em2Mcwi]", "display_text" : "Abcb1bem2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Abcb1bem2Mcwi", "display_text" : "Abcb1bem2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:6893598", "page_area" : "allele", "display_name" : "RGD:6893598" } }, "date_created" : "2012-09-12T10:29:50.000-05:00", "date_updated" : "2012-09-12T10:29:50.000-05:00", "internal" : false, "primary_external_id" : "RGD:6893598", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 98-bp frameshift deletion in exon 4 that includes the splice acceptor.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 1, Zentrales Tierlaboratorium, Medizinische Hochschule Hannover", "display_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 1, Zentrales Tierlaboratorium, Medizinische Hochschule Hannover", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag1[em1Ztm]", "display_text" : "Rag1em1Ztm", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag1em1Ztm", "display_text" : "Rag1em1Ztm", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7204132", "page_area" : "allele", "display_name" : "RGD:7204132" } }, "date_created" : "2012-12-17T12:07:24.000-06:00", "date_updated" : "2012-12-17T12:07:24.000-06:00", "internal" : false, "primary_external_id" : "RGD:7204132", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is a 4-bp deletion in exon 2 (del 5246-5249).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23136839", "RGD:7204131" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 1, Ignacio Anegon", "display_text" : "recombination activating gene 1; zinc finger nuclease induced mutant 1, Ignacio Anegon", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Rag1[em1Ang]", "display_text" : "Rag1em1Ang", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rag1em1Ang", "display_text" : "Rag1em1Ang", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7204135", "page_area" : "allele", "display_name" : "RGD:7204135" } }, "date_created" : "2012-12-17T13:19:44.000-06:00", "date_updated" : "2018-06-20T16:22:33.000-05:00", "internal" : false, "primary_external_id" : "RGD:7204135", "note_dtos" : [ { "internal" : false, "free_text" : "This mutant allele was made by zinc finger nuclease mutagenesis using meganucleases recognizing the 22-bp DNA sequence (nt731â¿¿752) in exon 2 of the Rag1 gene. This allele showed a 5-bp deletion due to the deletion of 8-bp and insertion of 3-bp that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23150522", "PMID:29688994", "RGD:13628403", "RGD:7204134" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "parkinson protein 2, E3 ubiquitin protein ligase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "parkinson protein 2, E3 ubiquitin protein ligase; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2018-03-14T13:28:31.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-09-05T09:54:58.000-05:00", "nomenclature_event_name" : "symbol_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Prkn[em1Sage]", "display_text" : "Prknem1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Park2em1Sage", "display_text" : "Park2em1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Park2[em1Sage]", "display_text" : "Park2em1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Prkn em1Sage", "display_text" : "Prkn em1Sage", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Prkn [em1Sage]", "display_text" : "Prkn em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7241041", "page_area" : "allele", "display_name" : "RGD:7241041" } }, "date_created" : "2013-02-25T15:09:01.000-06:00", "date_updated" : "2013-02-25T15:09:01.000-06:00", "internal" : false, "primary_external_id" : "RGD:7241041", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:7241035" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "parkinson protein 7; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "parkinson protein 7; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Park7[em1Sage]", "display_text" : "Park7em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Park7em1Sage", "display_text" : "Park7em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7241042", "page_area" : "allele", "display_name" : "RGD:7241042" } }, "date_created" : "2013-02-25T15:09:02.000-06:00", "date_updated" : "2013-02-25T15:09:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:7241042", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24157858", "PMID:24969022", "RGD:12880446", "RGD:13210569", "RGD:7241035" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leucine-rich repeat kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "leucine-rich repeat kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrrk1[em1Sage]", "display_text" : "Lrrk1em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lrrk1em1Sage", "display_text" : "Lrrk1em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7241044", "page_area" : "allele", "display_name" : "RGD:7241044" } }, "date_created" : "2013-02-25T15:09:02.000-06:00", "date_updated" : "2013-02-25T15:09:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:7241044", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 19-bp frameshift deletion in exon 4 (TGCCTCGCAGCGGCTGCTG)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "RGD:7241035" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leucine-rich repeat kinase 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "leucine-rich repeat kinase 2; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lrrk2[em1Sage]", "display_text" : "Lrrk2em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Lrrk2em1Sage", "display_text" : "Lrrk2em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7241045", "page_area" : "allele", "display_name" : "RGD:7241045" } }, "date_created" : "2013-02-25T15:09:02.000-06:00", "date_updated" : "2013-02-25T15:09:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:7241045", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 10-bp frameshift deletion in exon 30 (CCCAGAGAGC)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:23799078", "PMID:24244710", "PMID:24465451", "PMID:24927544", "RGD:12880447", "RGD:13462048", "RGD:13462051", "RGD:13462057", "RGD:7241035" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "display_text" : "PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Pink1[em1Sage]", "display_text" : "Pink1em1Sage", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pink1em1Sage", "display_text" : "Pink1em1Sage", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7241046", "page_area" : "allele", "display_name" : "RGD:7241046" } }, "date_created" : "2013-02-25T15:09:02.000-06:00", "date_updated" : "2013-02-25T15:09:02.000-06:00", "internal" : false, "primary_external_id" : "RGD:7241046", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24157858", "PMID:24969022", "PMID:25421206", "RGD:11560775", "RGD:12880446", "RGD:13210569", "RGD:7241035" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "RNA binding motif protein 20; mutation 1, Marion Greaser", "display_text" : "RNA binding motif protein 20; mutation 1, Marion Greaser", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2013-03-12T00:00:00.000-05:00", "nomenclature_event_name" : "data_merged" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Rbm20[m1Mlgw]", "display_text" : "Rbm20m1Mlgw", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Rbm20m1Mlgw", "display_text" : "Rbm20m1Mlgw", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7241593", "page_area" : "allele", "display_name" : "RGD:7241593" } }, "date_created" : "2013-03-12T12:34:36.000-05:00", "date_updated" : "2013-03-12T12:34:36.000-05:00", "internal" : false, "primary_external_id" : "RGD:7241593", "note_dtos" : [ { "internal" : false, "free_text" : "a deletion in chromosome 1 between bp 260,070,892 and 260,166,363 originally found in Hsd:SD which is responsible for an altered titin isoform expression", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:16491431", "PMID:22466703", "PMID:24367651", "RGD:126925234", "RGD:7241564", "RGD:7241566", "RGD:7241567" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "toll-like receptor 4; mutation 1, Gregg E. Homanics", "display_text" : "toll-like receptor 4; mutation 1, Gregg E. Homanics", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Tlr4[em1Geh]", "display_text" : "Tlr4em1Geh", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Tlr4em1Geh", "display_text" : "Tlr4em1Geh", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7257661", "page_area" : "allele", "display_name" : "RGD:7257661" } }, "date_created" : "2013-08-28T00:00:00.000-05:00", "date_updated" : "2013-08-28T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:7257661", "note_dtos" : [ { "internal" : false, "free_text" : "TALEN (Transcription activator-like effector nuclease) mediated 13 bp deletion in Exon 1", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:24199847", "RGD:12910488", "RGD:2292495" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "cytochrome P450, family 11, subfamily b, polypeptide 2; mutation 1", "display_text" : "cytochrome P450, family 11, subfamily b, polypeptide 2; mutation 1", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:70820" ], "date_created" : "2005-10-12T00:00:00.000-05:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_provisional" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Cyp11b2[m1]", "display_text" : "Cyp11b2m1", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Cyp11b2m1", "display_text" : "Cyp11b2m1", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:728295", "page_area" : "allele", "display_name" : "RGD:728295" } }, "date_created" : "2003-11-13T13:32:17.000-06:00", "date_updated" : "2003-11-13T13:32:17.000-06:00", "internal" : false, "primary_external_id" : "RGD:728295", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:727991", "PMID:11832364" ], "free_text" : "exhibits lower 11- and 18-hydroxylase activities, but higher 18-oxidase activity", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "nucleotide 752 (G) in exon 4 of Milan hypertensive (MHS) differs from that of normotensive (MNS) rats (A)", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:11832364", "RGD:727991" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BRCA1, DNA repair associated; mutation 1, University of Wisconsin-Madison", "display_text" : "BRCA1, DNA repair associated; mutation 1, University of Wisconsin-Madison", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:737654" ], "date_created" : "2007-04-12T10:57:09.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2004-12-14T12:15:44.000-06:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_approved" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Brca1[m1Uwm]", "display_text" : "Brca1m1Uwm", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Brca1[m1Uwm]", "display_text" : "Brca1m1Uwm", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Brca1m1Uwm", "display_text" : "Brca1m1Uwm", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:728298", "page_area" : "allele", "display_name" : "RGD:728298" } }, "date_created" : "2003-11-13T13:32:18.000-06:00", "date_updated" : "2004-12-14T12:07:58.000-06:00", "internal" : false, "primary_external_id" : "RGD:728298", "note_dtos" : [ { "internal" : false, "free_text" : "produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:12754522", "RGD:727990" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "BRCA2, DNA repair associated; mutation 1, University of Wisconsin-Madison", "display_text" : "BRCA2, DNA repair associated; mutation 1, University of Wisconsin-Madison", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:737654" ], "date_created" : "2007-04-12T10:54:14.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2004-12-14T12:15:44.000-06:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_approved" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Brca2[m1Uwm]", "display_text" : "Brca2m1Uwm", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Brca2[m1Uwm]", "display_text" : "Brca2m1Uwm", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "Brca2m1Uwm", "display_text" : "Brca2m1Uwm", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:728326", "page_area" : "allele", "display_name" : "RGD:728326" } }, "date_created" : "2003-11-13T13:32:29.000-06:00", "date_updated" : "2004-12-14T12:09:21.000-06:00", "internal" : false, "primary_external_id" : "RGD:728326", "note_dtos" : [ { "internal" : false, "evidence_curies" : [ "RGD:727990", "PMID:12754522" ], "free_text" : "homozygous rats exhibit severe atrophy; the testis displays severe atrophy with seminiferous tubules that do not contain spermatids; the ovaries are extremely atrophic and do not contain any developing germ cells", "note_type_name" : "comment" }, { "internal" : false, "free_text" : "produced by N-ethyl-N-nitrosourea (ENU)-induced germline mutations in Sprague Dawley (SD) rats; nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon)", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:12754522", "PMID:16964288", "RGD:1599505", "RGD:727990" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "apolipoprotein E; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "display_text" : "apolipoprotein E; zinc finger nuclease induced mutant 9, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Apoe[em9Mcwi]", "display_text" : "Apoeem9Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Apoeem9Mcwi", "display_text" : "Apoeem9Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:7364878", "page_area" : "allele", "display_name" : "RGD:7364878" } }, "date_created" : "2013-10-07T00:00:00.000-05:00", "date_updated" : "2013-10-07T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:7364878", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 (del 81879590-81879690).", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "paired box gene 6, small eye mutation", "display_text" : "paired box gene 6, small eye mutation", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2017-08-11T13:24:30.000-05:00", "nomenclature_event_name" : "symbol_updated" }, { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:1299863" ], "date_created" : "2004-12-14T12:15:44.000-06:00", "nomenclature_event_name" : "symbol_and_name_status_set_to_approved" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Pax6[Sey]", "display_text" : "Pax6Sey", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Pax6Sey", "display_text" : "Pax6Sey", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:737688", "page_area" : "allele", "display_name" : "RGD:737688" } }, "date_created" : "2004-02-23T12:33:27.000-06:00", "date_updated" : "2004-12-14T12:10:21.000-06:00", "internal" : false, "primary_external_id" : "RGD:737688", "note_dtos" : [ { "internal" : false, "free_text" : "Genomic DNA analysis from mutants revealed a single base (G) insertion generating a novel 5' donor splice site. Abnormal splicing between this donor site and a non-conforming downstream acceptor site led to an internal 602-bp deletion in the Pax6 mRNA, removing approximately 1/3 of the 3' end of the coding region and part of the 3'-UTR. The mutation results in nose and eye defects in Sprague Dawley (SD) rats.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:7981749", "PMID:9247338", "RGD:1601213", "RGD:731242" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ndufc2[em1Mcwi]", "display_text" : "Ndufc2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ndufc2em1Mcwi", "display_text" : "Ndufc2em1Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:9588537", "page_area" : "allele", "display_name" : "RGD:9588537" } }, "date_created" : "2014-10-30T00:00:00.000-05:00", "date_updated" : "2014-10-30T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:9588537", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is a 9-bp deletion in exon 1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:26888427", "RGD:11040458", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "display_text" : "NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Ndufc2[em2Mcwi]", "display_text" : "Ndufc2em2Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Ndufc2em2Mcwi", "display_text" : "Ndufc2em2Mcwi", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:9588541", "page_area" : "allele", "display_name" : "RGD:9588541" } }, "date_created" : "2014-10-30T00:00:00.000-05:00", "date_updated" : "2014-10-30T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:9588541", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by ZFN mutagenesis. The resulting mutation is 111-bp deletion in the genome and 4-bp insertion (TTGT) in the deletion site, net 107-bp deletion in exon 1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:26888427", "RGD:11040458", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "nuclear factor, erythroid 2-like 2; TALEN induced mutant 1, Medical College of Wisconsin", "display_text" : "nuclear factor, erythroid 2-like 2; TALEN induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" }, "allele_nomenclature_event_dtos" : [ { "internal" : false, "created_by_curie" : "RGD", "evidence_curies" : [ "RGD:629549" ], "date_created" : "2015-04-28T00:00:00.000-05:00", "nomenclature_event_name" : "name_updated" } ], "allele_symbol_dto" : { "internal" : false, "format_text" : "Nfe2l2[em1Mcwi]", "display_text" : "Nfe2l2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "nuclear factor, erythroid 2-like 2", "display_text" : "nuclear factor, erythroid 2-like 2", "name_type_name" : "full_name" }, { "internal" : false, "format_text" : "Nfe2l2em1Mcwi", "display_text" : "Nfe2l2em1Mcwi", "name_type_name" : "nomenclature_symbol" }, { "internal" : false, "format_text" : "zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "display_text" : "zinc finger nuclease induced mutant 1, Medical College of Wisconsin", "name_type_name" : "full_name" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:9588549", "page_area" : "allele", "display_name" : "RGD:9588549" } }, "date_created" : "2014-10-30T00:00:00.000-05:00", "date_updated" : "2014-10-30T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:9588549", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was made by TALEN mutagenesis. The resulting mutation is a 41-bp deletion in exon 1.", "note_type_name" : "mutation_description" } ], "reference_curies" : [ "PMID:19628861", "PMID:26637559", "RGD:11344212", "RGD:4131263", "RGD:4139871" ], "taxon_curie" : "NCBITaxon:10116" }, { "allele_full_name_dto" : { "internal" : false, "format_text" : "leptin receptor; mutant 1, Rudolph L. Leibel", "display_text" : "leptin receptor; mutant 1, Rudolph L. Leibel", "name_type_name" : "full_name" }, "allele_symbol_dto" : { "internal" : false, "format_text" : "Lepr[m1Rll]", "display_text" : "Leprm1Rll", "name_type_name" : "nomenclature_symbol" }, "allele_synonym_dtos" : [ { "internal" : false, "format_text" : "Leprm1Rll", "display_text" : "Leprm1Rll", "name_type_name" : "nomenclature_symbol" } ], "created_by_curie" : "RGD", "data_provider_dto" : { "internal" : false, "source_organization_abbreviation" : "RGD", "cross_reference_dto" : { "internal" : false, "prefix" : "RGD", "referenced_curie" : "RGD:9835400", "page_area" : "allele", "display_name" : "RGD:9835400" } }, "date_created" : "2015-03-24T00:00:00.000-05:00", "date_updated" : "2015-03-24T00:00:00.000-05:00", "internal" : false, "primary_external_id" : "RGD:9835400", "note_dtos" : [ { "internal" : false, "free_text" : "This allele was found in F2 progeny of BNx13M and WKYx13M; substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269", "note_type_name" : "comment" } ], "reference_curies" : [ "PMID:8690163", "RGD:9835399" ], "taxon_curie" : "NCBITaxon:10116" } ] }