# RGD-PIPELINE: ftp-file-extracts # MODULE: strains build Mar 13, 2024 # GENERATED-ON: 2025/07/05 # PURPOSE: information about active rat strains extracted from RGD database # CONTACT: rgd.data@mcw.edu # FORMAT: tab delimited text # NOTES: multiple values in a single column are separated by ';' # as of Oct 15, 2021, new columns were added: CITATION_ID, MRATBN_7.2_CHR, MRATBN_7.2_START_POS, MRATBN_7.2_STOP_POS, MRATBN_7.2_METHOD # as of Feb 08, 2024, column ORIGIN was renamed to ORIGINATION, and new column DESCRIPTION was added RGD_ID STRAIN_SYMBOL FULL_NAME ORIGINATION SOURCE STRAIN_TYPE LAST_KNOWN_STATUS RESEARCH_USE ALLELES ALLELE_RGD_IDS RGSC_3.4_CHR RGSC_3.4_START_POS RGSC_3.4_STOP_POS RGSC_3.4_METHOD RNOR_5.0_CHR RNOR_5.0_START_POS RNOR_5.0_STOP_POS RNOR_5.0_METHOD RNOR_6.0_CHR RNOR_6.0_START_POS RNOR_6.0_STOP_POS RNOR_6.0_METHOD MRATBN_7.2_CHR MRATBN_7.2_START_POS MRATBN_7.2_STOP_POS MRATBN_7.2_METHOD CITATION_ID DESCRIPTION 10000 ACI/N A X C 9935, Irish Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery spontaneous tumors; chronic renal disease; congenital malformations Tnfrsf1a 621237 RRID:RRRC_00142 Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR) 10001 AVN/Orl Ctr de Selection et d'Elev d'Anim de Lab, Orleans, France. inbred Unknown RRID:RGD_10001 10002 BBDP/Rhw inbred Unknown RRID:RGD_10002 S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. 10003 BBDR/Rhw R. H. William Laboratory, University of Washington, Seattle, Washington inbred Unknown RRID:RGD_10003 S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 +/- 53 days of age after the first and 67 +/- 10 days of age after the 9th cycle. 10004 BC/CpbU Central Laboratory Animal Institute of Utrecht University, The Netherlands. inbred Unknown RRID:RGD_10004 Obtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands. 10005 BDIX/Han inbred Unknown RRID:RGD_10005 unknown 10006 BDVII/Cub Charles University, Department of Biology, Prague, inbred Unknown RRID:RGD_10006 Druckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype. 10008 BN/SsNHsd Harlan inbred Unknown RRID:RGD_10008 Obtained by HSD from nucleus colony at NIH 10009 BP/Cub Charles University, Department of Biology, Prague, inbred Unknown RRID:RGD_10009 10010 BUF/Pit Buffalo inbred Unknown RRID:RGD_10010 10011 COP/OlaHsd Harlan inbred Unknown RRID:RGD_10011 These are derived from the original colony which was developed by Dr. W.F. Dunning. 10012 DA/PitN inbred Extinct RRID:RRRC_00154 Unknown 10013 DON/Melb inbred Unknown RRID:RGD_10013 10014 F344/Pit inbred Unknown RRID:RGD_10014 10015 FHH/Eur Erasmus University-Rotterdam inbred Unknown RRID:RGD_10015 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. 10016 GH/Omr Genetically Hypertensive University of Otago Wellcome Med. Res. Inst, New Zealand. inbred Unknown RRID:RGD_10016 This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. 10017 GK/KyoSwe Goto Kakizaki Department of Molecular Medicine, Karolinska Hospital, Stockholm, Sweden inbred Unknown RRID:RGD_10017 Developed from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975). 10018 IS/Kyo ishibashi rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis RRID:RGD_10018 Ishibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978. 10019 LE/Mol Long Evans M & B A/S, Denmark. inbred Unknown RRID:RGD_10019 10020 LEW/Pit Lewis inbred Unknown RRID:RGD_10020 10021 LH/Mav Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_10021 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 10022 LN/Mav Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_10022 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 10023 LOU/CHan Louvain inbred Unknown RRID:RGD_10023 unknown 10024 M520/N NIH Animal Genetic Resource Rat Resource and Research Center inbred Cryopreserved Embryo RRID:RRRC_00168 To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. 10025 MHS/Gib Milan Hypertensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_10025 Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure 10026 MNR/N Maudsely non-reactive NIH Animal Genetic Resource inbred Extinct RRID:RRRC_00174 To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci. 10027 MNRA/N NIH Animal Genetic Resource inbred Unknown RRID:RGD_10027 To Harrington in 1965 at F25 (Harrington 1981). 10028 MNS/Gib Milan Normotensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_10028 Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. 10029 MR/Pit inbred Unknown RRID:RGD_10029 As for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). 10030 NEDH/K Central Institute for Diabetes, Karlsburg, Germany. inbred Unknown RRID:RGD_10030 Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. 10031 NP9 inbred Unknown RRID:RGD_10031 From Wistar 10032 ODU/N Osaka Dental University NIH Animal Genetic Resource inbred Extinct RRID:RRRC_00176 From outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982). 10033 OKA/Wsl Professor Herve Bazin, Universite de Louvain, France inbred Unknown RRID:RGD_10033 10034 OM/Ztm Osborne-Mendel inbred Unknown RRID:RGD_10034 unknown 10035 P5C inbred Unknown RRID:RGD_10035 10036 PVG/Pit inbred Unknown RRID:RGD_10036 10037 SD/Rij Harlan Rijswijk inbred Unknown RRID:RGD_10037 From Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984). 10038 SHR/OlaHsd Spontaneously Hypertensive Rat Harlan Sprague Dawley, Inc. inbred Unknown RRID:RGD_10038 10039 SHRSP/Riv Spontaneously Hypertensive Rat, Stroke Prone inbred Unknown RRID:RGD_10039 10040 SR/Jr Salt Resistant Dr. John P. Rapp, Medical College of Ohio, USA Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00056 Originated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). 10041 SS/Jr Salt Sensitive Dr. John P. Rapp, Medical College of Ohio, USA Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Hmox1 2806 RRID:RRRC_00055 Strain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982) 10042 WAG/RijKyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_10042 Rij > Kyo (1979, F?, GF) 10043 WF/Pit Wistar Furth inbred Unknown RRID:RGD_10043 10044 WIST/Nhg Wistar Gesellschaft f. Strahlen & Umweltforschung, Munich, Germany. inbred Unknown Ugt1a1|Abcd2 3935|69244 RRID:RGD_10044 From outbred Wistar stock in 1967. 10045 WN/N Inbred Wistar; W/N NIH Animal Genetic Resource inbred Unknown RRID:RGD_10045 Heston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15. 10046 WKY/OlaHsd Harlan Sprague Dawley, Inc. inbred Unknown RRID:RGD_10046 10047 WTC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) RRID:RGD_10047 WTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. A missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene (Ohno et al. 2015). 60984 GH inbred Unknown RRID:RGD_60984 University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). 60985 BN BN Charles River Laboratories Charles River Laboratories inbred Unknown Cd36|Tnfrsf1a 2301|621237 RRID:RGD_60985 Billingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b). 60986 BUF/N NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_60986 Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. 60987 MHS/N Milan Hypertensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Extinct Add1|Add2 2041|2042 RRID:RRRC_00169 Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994). 60988 LOU/M inbred Unknown RRID:RGD_60988 Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible. Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978). 60989 BP inbred Unknown RRID:RGD_60989 Strain selected for resistance to Walker 256 tumour. 60990 LH/MavRrrc Lyon Hypertensive Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-02-13) RRID:RRRC_00057 Lyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed, unrestrained, conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 60991 LE Long Evans inbred Unknown RRID:RGD_60991 Dr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984). 60992 MNS Milan normotensive strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown RRID:RGD_60992 Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974). 60993 FHH Fawn Hooded Hypertensive University of Colorado Health Science Center, Denver, Colorado inbred Unknown RRID:RGD_60993 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. 60994 F344 Fischer NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_60994 Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. 60995 DRY Sankyo Co., Ltd., Tokyo, Japan inbred Unknown RRID:RGD_60995 Recombinant inbred strain used as normotensive control in studies of hypertension. 60996 DON Donryu rat inbred Unknown RRID:RGD_60996 R. Sato 1950 by inbreeding Japanese albino rats. 60997 DA DA inbred Unknown Ednrb|Tnfrsf1a 2536|621237 RRID:RGD_60997 Developed from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case. 60998 COP inbred Unknown RRID:RGD_60998 This Copenhagen (COP) rat was an inbred strain from Curtiss 1921 at Columbia University Institute for Cancer Research. 60999 LEW Lewis Harlan Sprague Dawley Inc. Indianapolis, United States inbred Unknown Fgf2|Tnfrsf1a 2609|621237 RRID:RGD_60999 Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992) 61000 SHR Spontaneously Hypertensive Rat inbred Unknown Agtr1b|Cd36|Ephx2 2071|2301|620732 RRID:RGD_61000 Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648). 61001 NEDH inbred Unknown RRID:RGD_61001 Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. 61002 BDIX inbred Unknown RRID:RGD_61002 Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 61003 BC inbred Unknown RRID:RGD_61003 Hagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973. 61004 WIST/Zihk inbred Unknown RRID:RGD_61004 From Wistar outbred stock in 1978. 61005 OM/N Osborne-Mendel NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_61005 Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). 61006 PVG PVG inbred Unknown RRID:RGD_61006 Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994). 61007 WF Wistar Furth inbred Unknown RRID:RGD_61007 J Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995). 61008 WAG Wistar Albino Glaxo inbred Unknown RRID:RGD_61008 AL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984). 61009 AVN inbred Unknown RRID:RGD_61009 Unknown. Keil University from O Stark, Charles University, Prague. 61010 SHRSP Spontaneously Hypertensive Rat, Stroke Prone Iffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-Buch inbred Unknown RRID:RGD_61010 The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994). 61011 BB/N BioBreeding rat inbred Extinct RRID:RRRC_00144 Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990). 61013 E3 inbred Unknown RRID:RGD_61013 Kroning, Gottingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968. 61014 OLETF Otsuka Long-Evans Tokushima fatty Otsuka Research Institute, Tokushima, Japan inbred Unknown RRID:RGD_61014 Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence' 61015 LN/MavRrrc lyon normotensive Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00058 (taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). 61096 SHR/NCruk Spontaneously Hypertensive Rat Charles River Laboratories UK Charles River Laboratories UK inbred Unknown RRID:RGD_61096 NIH derived strain maintained at the Charles River, United Kingdom. 61097 WKY/NCruk Charles River Laboratories UK Charles River Laboratories UK inbred Unknown RRID:RGD_61097 NIH derived strain maintained at the Charles River, United Kingdom. 61098 BXH/Ipcv Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_61098 These recombinant inbred strains are derived from the (BN-Lx/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic 61099 HXB/Ipcv Institute of Physiology, Czech Academy of Sciences, Charles University, Prague recombinant_inbred Unknown RRID:RGD_61099 Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published. 61100 SHR/Ola Czech Academy of Sciences, Prague, Czech Republic inbred Unknown RRID:RGD_61100 Strain originated from an inbred SHR strain from Harlan UK Ltd. 61103 WKY Medical College of Ohio, Toledo, Ohio inbred Unknown Cd36|Nos3 2301|3186 RRID:RGD_61103 This strain was maintained at Medical College of Ohio, Toledo, Ohio 61104 LEW/NCrl Charles River Laboratories USA Charles River Laboratories USA inbred Unknown RRID:RGD_61104 Substrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34. 61105 WKY/NHsd Envigo EnvigoD8Mit5-D8Mgh6)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 8 32203394 64762616 1 - by flanking markers 8 33603024 65467051 1 - by flanking markers 8 33558660 65717592 1 - by flanking markers 8 30848154 61290444 1 - by flanking markers RRID:RGD_61106 A segment of chr. 8 is transferred from the normotensive BN-Lx/Cub rat to the SHR/Ola. 61107 BB/OK BioBreeding rat Central Institute for Diabetes, Karlsburg, Germany National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Diabetes Obesity; Immunology Asns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk5 2162|2280|2332|2481|2794|3082|3726|3807|69430|70514 RRID:RGD_61107 This colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada. 61109 F344/NHsd F344/NHsd Envigo, Envigo aged Envigo, Envigo aged inbred Unknown RRID:RGD_61109 Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. 61110 SHR/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_61110 Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes. 61111 DA/Slc dark agouti National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_61111 These were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983. 61112 13M Laboratory of Human Behavior and Metabolism, Rockefeller University inbred Unknown RRID:RGD_61112 This is a Leprfa/Leprfa substrain derived from the Zucker rat. 61113 BN-Lx mutant Unknown RRID:RGD_61113 These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. 61114 DA/Bkl Bantin and Kingman, Fremont, California inbred Unknown RRID:RGD_61114 Commercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls. 61115 BN/SsN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_61115 To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony. 61116 SHRSP/A3 Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, Japan inbred Unknown RRID:RGD_61116 Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness. 61117 BN-Lx/Cub Brown Norway with polydactyly-luxate Charles University, Department of Biology, Prague inbred Unknown RRID:RGD_61117 These were derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. 61118 BUF/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer; Urology Bsis 2221 RRID:RGD_61118 Strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. 61119 WKY/NCrlCrlj Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo (as of 2023-05-30) RRID:RGD_61119 Originated from outbred Wistar of Kyoto University. To NIH from Kyoto University in 1971 and sib mating has started. To Charles River Laboratories, Inc from NIH in 1974 at F11, and to Charles River Japan, Inc. in 1981 at F25. (May 27, 2010). Used as control strain for the SHR strain. 61498 BN/NHsdMcwi PhysGen RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryorecovery RRID:RGD_61498 Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115). The genome of this BN strain is used as the rat reference assembly. 61499 SS/JrHsdMcwi PhysGen RGD HRDP, contact HRDP inbred Live Animals; Cryorecovery RRID:RGD_61499 Inbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115). 61517 FHL/Eur Fawn Hooded Low blood pressure Erasmus University-Rotterdam inbred Unknown RRID:RGD_61517 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damage 67934 WOKA inbred Unknown RRID:RGD_67934 Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. 67935 WOKW Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown RRID:RGD_67935 Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designated WOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. 67936 WR inbred Unknown RRID:RGD_67936 Sykora, Rosice (Stark et al 1968b). No further infromation. 67937 WST inbred Unknown RRID:RGD_67937 Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986). 67938 Y59 inbred Unknown RRID:RGD_67938 Strain developed in Zagreb, Jugoslavia. 67939 YA/N inbred Extinct RRID:RRRC_00191 No further information. 67940 YO inbred Unknown RRID:RGD_67940 Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992) 67941 Z61 inbred Unknown RRID:RGD_67941 Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours. 67942 ZI inbred Unknown RRID:RGD_67942 A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989). 67943 SHE/N-cp inbred Unknown RRID:RGD_67943 Reference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94. 67945 IS inbred Unknown RRID:RGD_67945 from a cross between a wild male and a Wistar female, with sib mating since 1968. 67948 JC inbred Unknown RRID:RGD_67948 LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984). 67957 APR inbred Unknown RRID:RGD_67957 Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). 67958 AS Albino Surgery National Institute for Medical Research, Mill Hill, UK inbred Unknown RRID:RGD_67958 University of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973). 67959 AS2 inbred Unknown RRID:RGD_67959 Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968). 67960 AUG inbred Unknown RRID:RGD_67960 Derived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England. 67962 AN inbred Unknown RRID:RGD_67962 Outbred Wistar Imamichi strain. 67965 AXC recombinant_inbred Unknown RRID:RGD_67965 A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976. 67966 B inbred Unknown RRID:RGD_67966 Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85. 67967 B/1N inbred Extinct RRID:RGD_67967 No further information. 67971 BBZ inbred Unknown RRID:RGD_67971 Strain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3 67974 BDE inbred Unknown RRID:RGD_67974 Zentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring. 67975 BDI inbred Unknown RRID:RGD_67975 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67976 BDII inbred Unknown RRID:RGD_67976 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67977 BDIII inbred Unknown RRID:RGD_67977 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67978 BDIV inbred Unknown RRID:RGD_67978 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67981 BDV inbred Unknown RRID:RGD_67981 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67983 BDVI inbred Unknown RRID:RGD_67983 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67984 BDVII inbred Unknown RRID:RGD_67984 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976) 67986 BDVIII inbred Unknown RRID:RGD_67986 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67987 BDX inbred Unknown Lypd3 69053 RRID:RGD_67987 Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. 67988 BEG inbred Unknown RRID:RGD_67988 from a cross between SC and TE. 67989 BH inbred Unknown RRID:RGD_67989 D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973. 67990 BI inbred Unknown RRID:RGD_67990 Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992) 67991 BIL/1 NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_67991 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. 67993 BIL/2 NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_67993 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. 68000 BIRMB inbred Unknown RRID:RGD_68000 same as BIRMA. 68001 BLK/N inbred Extinct Asip 2003 RRID:RGD_68001 This strain has an agouti mutation 68007 BROFO inbred Unknown RRID:RGD_68007 Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions. 68008 BS inbred Unknown RRID:RGD_68008 University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966). 68011 C inbred Unknown RRID:RGD_68011 No further information. 68012 CAP inbred Unknown RRID:RGD_68012 Polish Academy of Sciences, Krakow (Stark et al 1968a). 68013 CAR/N Hunt-Hoppert caries resistant; CA/R NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_68013 Hunt 1937, developed for resistance to dental caries (Hunt et al 1955). 68014 CAS inbred Unknown RRID:RGD_68014 Hunt 1937, developed for high incidence of dental caries. 68015 CBH inbred Unknown RRID:RGD_68015 Woodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded). 68018 CPB-WE inbred Unknown RRID:RGD_68018 Wistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands. 68019 CRDH Cohen Rosenthal Diabetic Hypertensive Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_68019 As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995). 68020 CWS inbred Unknown RRID:RGD_68020 R Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open. 68022 DB inbred Unknown RRID:RGD_68022 No further information. 68023 DEBR Dundee experimental bald rat inbred Unknown RRID:RGD_68023 The DEBR rats have been bred at the University of Dundee since March 1984. The original crosses involved the inbred stock BDIX rats showing lesion and Wistar rat. The descendants of this cross resulted from full sib-matings.Two strains of DEBR rats are geing developed: the black-hooded and brown-hooded strains. 68026 DSS/1N inbred Extinct RRID:RRRC_00155 Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N). 68027 DSS/2N inbred Extinct RRID:RRRC_00156 Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). 68028 DSS/3N inbred Extinct RRID:RRRC_00157 Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). 68029 DXE-1 recombinant_inbred Unknown RRID:RGD_68029 Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover) 68031 ET Taisho Pharmaceutical Co. Ltd inbred Unknown RRID:RGD_68031 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). 68032 EXBH inbred Unknown RRID:RGD_68032 Hannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990) 68034 F6R inbred Unknown RRID:RGD_68034 Mutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985). 68035 FCH inbred Unknown RRID:RGD_68035 Fice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol. 68036 FH inbred Unknown Rab38ru 1600311 RRID:RGD_68036 Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see strains FHH and FHL), which may have different characteristics. 68038 FHL inbred Unknown RRID:RGD_68038 see FHH. 68040 FNL inbred Unknown RRID:RGD_68040 Fice Normolipidemic strain. Developed as a control strain for FCH (see FCH). 68041 G inbred Unknown RRID:RGD_68041 Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977) 68042 GEPR inbred Unknown RRID:RGD_68042 Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a). 68044 GHA inbred Unknown RRID:RGD_68044 The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973). 68046 HCS inbred Unknown RRID:RGD_68046 Harvard to Liverpool, UK in 1960. 68047 HMT inbred Unknown RRID:RGD_68047 Outbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor". 68048 HS inbred Unknown RRID:RGD_68048 Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus. 68049 HXB-1-43/Ipcv Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlands recombinant_inbred Unknown RRID:RGD_68049 Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs. 68050 IIM inbred Unknown RRID:RGD_68050 Set of nine strains bred as parallel strains from a single outbred colony maintained by B. Houssay in 1948. All strains were selected for large body weight and high fertility. One strain designated Beta IIM (RGD:40924649) derived from line 'b' became obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). Alpha IIM (RGD:40924650) was used as a control strain in study. 68051 INR/N inbred Extinct RRID:RRRC_00160 Harrington 1962 from a stock selected by CS Hall for low open field defaecation. 68052 IR inbred Unknown RRID:RGD_68052 Harrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981). 68057 K inbred Unknown RRID:RGD_68057 Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973). 68058 KGH/PitN inbred Extinct RRID:RRRC_00162 Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974). 68059 KIRBY-B inbred Unknown RRID:RGD_68059 From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980). 68060 KX inbred Unknown RRID:RGD_68060 developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977) 68061 KYN/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68061 Makino, Hokkaido University 1960 from stock the carrying the 68062 LA/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68062 from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982). 68063 LA/N-cp NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_68063 The corpulent (LA/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. The obese homozygous (cp/cp) littermates developspontaneous insulin resistance, obesity, impaired glucose tolerance, hypertriglyceridemia and atherosclerosis. 68065 LEA inbred Unknown RRID:RGD_68065 Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993) 68066 LEC inbred Unknown RRID:RGD_68066 In 1975, at the Center for Experimental Plants and Animals, Hokkaido University, Long Evans Cinnamon was derived originally from a closed colony of Long-Evans rats obtained from Kobe University in 1975. 68067 LEJ/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68067 Hok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication). 68068 LEM inbred Unknown Ckb 2357 RRID:RGD_68068 Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980). 68069 LEO inbred Unknown RRID:RGD_68069 from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980). 68070 LEP inbred Unknown RRID:RGD_68070 Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984) 68071 LER/N inbred Extinct RRID:RRRC_00164 Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology. 68072 LET inbred Unknown RRID:RGD_68072 from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1 68073 LETL inbred Unknown RRID:RGD_68073 A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan 68074 LETO inbred Unknown RRID:RGD_68074 THe LETO was obtained by mating of Long-Evan rats in Otsuka Pharmaceutical Co.The LETO has not shown the diabetic syndrome. 68077 LL/MavRrrc Lyon hypotensive Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00059 Lyon Low-Tensive. See LH 68079 LOU Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France inbred Unknown RRID:RGD_68079 Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). 68082 LUDW inbred Unknown RRID:RGD_68082 Ludwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU. 68083 LXB recombinant_inbred Unknown RRID:RGD_68083 Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover) 68084 M14 inbred Unknown RRID:RGD_68084 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum. 68085 M17 inbred Unknown RRID:RGD_68085 AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum. 68086 M520 inbred Unknown RRID:RGD_68086 Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992). 68087 MAXX inbred Unknown RRID:RGD_68087 From a cross of BNxLEW with subsequent inbreeding. 68088 MF inbred Unknown RRID:RGD_68088 Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). 68091 MLCS Milan low-calpastatin strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy recombinant_inbred Unknown RRID:RGD_68091 From a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity. 68097 MSUBL inbred Unknown RRID:RGD_68097 Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977). 68098 MW Munich Wistar inbred Unknown RRID:RGD_68098 Munich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS. 68099 MWF inbred Unknown RRID:RGD_68099 From outbred Wistar rats selected for large numbers of superficial glomeruli. 68100 NBL inbred Unknown RRID:RGD_68100 Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990). 68103 NER noda epileptic rat inbred Unknown RRID:RGD_68103 From Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has. 68104 NIG-III/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68104 From a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987). 68106 NSD/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68106 NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock. 68107 NZR inbred Unknown RRID:RGD_68107 Subline of AS2 separated at F32. 68109 ODUS inbred Unknown RRID:RGD_68109 As for ODU, but maintained at Osaka Dental University. 68113 OXYR/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_68113 Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain. 68114 OXYS/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_68114 Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats. 68115 P77PMC inbred Unknown RRID:RGD_68115 Wistar rats from Beijing Medical College in 1977. 68116 PA inbred Unknown RRID:RGD_68116 King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction. 68117 PETH/N Royal College of Surgeons, RCS NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_68117 Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS. 68118 PKD PKD Central Institute for Laboratory Animal Breeding, Hanover, Germany inbred Unknown RRID:RGD_68118 Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991. 68119 PSDO/N inbred Extinct RRID:RRRC_00178 Reserved symbol for strain in development now at F6 (NIH 1989). 68121 R inbred Unknown RRID:RGD_68121 Muhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R. 68122 RCS/N inbred Extinct RRID:RRRC_00180 Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline. 68123 RHA/N Roman high avoidance NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_68123 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated. 68124 RII/1 inbred Unknown RRID:RGD_68124 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991). 68125 RII/2 inbred Unknown RRID:RGD_68125 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991). 68126 RLA/N inbred Unknown RRID:RGD_68126 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains. 68127 RP/AEurRij inbred Unknown RRID:RGD_68127 Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). 68128 S5B inbred Unknown RRID:RGD_68128 Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating. 68129 SBH Sabra hypertensive Barzilai Medical Center, Ashkelon, Israel inbred Unknown RRID:RGD_68129 Sabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics). 68130 SBN inbred Unknown RRID:RGD_68130 As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984). 68131 SC inbred Unknown RRID:RGD_68131 Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360) 68133 SDJ/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Slc2a2 3705 RRID:RGD_68133 Takeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966. 68134 SDNK inbred Unknown RRID:RGD_68134 Sprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan. 68136 SEL inbred Unknown RRID:RGD_68136 Dunning 1948. Probably extinct. 68137 SHHF inbred Unknown Grk2|Grk3 2062|2063 RRID:RGD_68137 JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile. 68140 SPRD/Hsd Harlan Harlan outbred Unknown RRID:RGD_68140 Originated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony. 68143 TA inbred Unknown RRID:RGD_68143 Outbred Wistar Imamichi. 68144 TE inbred Unknown RRID:RGD_68144 Outbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987). 68145 TF inbred Unknown RRID:RGD_68145 From outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988). 68146 THA inbred Unknown RRID:RGD_68146 Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990). 68147 THE/Utp Tsukuba high-emotional rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_68147 Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE). 68148 TLE/Utp Tsukuba low-emotional rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Behavior RRID:RGD_68148 Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE). 68149 TM Tester Moriyama rat Institute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, Japan inbred Unknown RRID:RGD_68149 Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication). 68150 TMB inbred Unknown RRID:RGD_68150 PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68151 TMD inbred Unknown RRID:RGD_68151 PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68152 TO/Hok Tokyo rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_68152 A breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994). 68154 TOM inbred Unknown RRID:RGD_68154 Toma Institute, Japan (Ikadai, personal communication, 1991) 68155 TS inbred Unknown RRID:RGD_68155 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). 68156 TS1 inbred Unknown RRID:RGD_68156 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68157 TS3/N inbred Extinct RRID:RRRC_00185 Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). 68158 TT inbred Unknown RRID:RGD_68158 outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991). 68160 TU inbred Unknown RRID:RGD_68160 From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991) 68161 TW inbred Unknown RRID:RGD_68161 Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985). 68162 TX inbred Unknown RRID:RGD_68162 From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991) 68163 U inbred Unknown RRID:RGD_68163 Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990). 68164 UChA University of Chile, Casilla, Chile inbred Unknown RRID:RGD_68164 Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. 68165 UChB University of Chile, Casilla, Chile inbred Unknown RRID:RGD_68165 Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. 68166 W/Hok inbred Unknown RRID:RGD_68166 Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977). 68167 W/Nhg inbred Unknown RRID:RGD_68167 Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany. 68168 WA inbred Unknown RRID:RGD_68168 St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983. 68169 WAB inbred Unknown RRID:RGD_68169 Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977). 68171 WBB/1N inbred Extinct RRID:RRRC_00186 No further information 68172 WBB/2N inbred Extinct RRID:RRRC_00187 No further information. 68173 WBN inbred Unknown RRID:RGD_68173 Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived. 68174 WCF inbred Unknown RRID:RGD_68174 R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot. 68175 WDF inbred Unknown RRID:RGD_68175 Ikeda et al (1981) by backcrossing the fatty gene to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus. 68176 WEC inbred Unknown RRID:RGD_68176 Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). 68177 WEK inbred Unknown RRID:RGD_68177 Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). 68178 WELS inbred Unknown RRID:RGD_68178 Outbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984) 68180 WIN inbred Unknown RRID:RGD_68180 WI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986). 68183 WKA inbred Unknown RRID:RGD_68183 King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992) 68184 WKAH/Hok Wistar-King Aptekman Hokkaido National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_68184 King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA. 68185 WKAM inbred Unknown RRID:RGD_68185 King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA. 68186 WKHA/N inbred Extinct RRID:RRRC_00188 From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure. 68187 WKHT/N inbred Extinct RRID:RRRC_00189 From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992). 68188 WKS inbred Unknown RRID:RGD_68188 National Institute of Genetics, Mishima, Japan. 68189 HTX/Hcj Department of Pharmacology, University of Florida, Gainesville. inbred Unknown RRID:RGD_68189 D. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30. 69369 SS Brookhaven National Laboratories, Upton, New York inbred Unknown RRID:RGD_69369 From a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension. 69638 BN/Ka Brown Norway Katholiek (kininogen or kinin deficient) Kitasato University, Kanagawa, Japan. inbred Unknown RRID:RGD_69638 Kitasato University, Kanagawa, Japan. 69643 F344/DuCrlCrlj Charles River Laboratories Japan, National BioResource Project for the Rat in Japan Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Cardio Hypertension RRID:RGD_69643 This strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976. 70410 AA Alko, Alcohol Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown RRID:RGD_70410 Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as drink for 10 days, after which they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. Fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight, so alcohol intake was used as a phenotypic measure. 70411 ANA Alko, Non-Alcohol Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown RRID:RGD_70411 Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure. 70413 WBB inbred Unknown RRID:RGD_70413 70416 ACH inbred Unknown RRID:RGD_70416 Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research. 70417 A28807/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RRRC_00141 Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982). 70418 A35322 inbred Unknown RRID:RGD_70418 Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990. 70419 A7322 inbred Unknown RRID:RGD_70419 Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus. 70420 A990 inbred Unknown RRID:RGD_70420 Curtiss 1921 at Columbia University Institute for Cancer Research. 70421 AAW inbred Unknown RRID:RGD_70421 Atomic Energy Commission, Melbourne (Adams et al 1984). 70422 ABH Nishimura, Hammatsu University School of Medicine, Japan. inbred Unknown RRID:RGD_70422 Yamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan. 70423 ACP inbred Unknown RRID:RGD_70423 Dunning to National Cancer Institute 1967 at F54. 70424 AGA inbred Unknown RRID:RGD_70424 Nakic, Zagreb (Stark et al 1968b). Used for immunological studies. 70425 AGUS inbred Unknown RRID:RGD_70425 Germ-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26. 70426 ALB/N Albany NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_70426 Wolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer. 70427 AM inbred Unknown RRID:RGD_70427 Torres, Rio de Janeiro, from outbred stock. 70428 AMDIL inbred Unknown RRID:RGD_70428 Torres, Rio de Janeiro, from outbred stock 70429 AO inbred Unknown RRID:RGD_70429 From ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995). 70440 BIRMA inbred Unknown RRID:RGD_70440 AM Mandl 1952 from Albino rats purchased from Birmingham market. 70446 LIH/Lac Liverpool Hooded inbred Unknown RRID:RGD_70446 "Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981). 70447 MNR Maudsely non-reactive inbred Unknown RRID:RGD_70447 PL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982). 70448 MNRA inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00692 Substrain of MNR. To Harrington in 1965 at F25 (Harrington 1981). 70449 MR/N Maudsely reactive NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_70449 Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). 70450 NBR inbred Unknown RRID:RGD_70450 Poiley 1966 from heterogeneous stock 70451 OKA inbred Unknown RRID:RGD_70451 From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days. 70452 OM Osborne-Mendel NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center outbred Unknown RRID:RGD_70452 Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). 70453 SR inbred Unknown RRID:RGD_70453 Rapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen. 70454 WKY/N NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-01) RRID:RRRC_00190 National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain. 70455 WKYO/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_70455 Inbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991). 70456 WM inbred Unknown RRID:RGD_70456 Wistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Mishima in 1951. 70457 WMS inbred Unknown RRID:RGD_70457 Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWF 70458 WN inbred Unknown RRID:RGD_70458 Heston in 1942 from Wistar stock of Nettleship, This WN is the parent to WN substrains maintained in other institutions. 70459 ZDF Vancouver diabetic fatty Zucker Animal Model Core Facility, University of California at Davis inbred Unknown RRID:RGD_70459 "Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b). 70508 SD Sprague-Dawley outbred Unknown Aqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f1 2141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|728892 RRID:RGD_70508 This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain, probably Wistar) and subsequently to his white female offspring for 7 generations. All the current colonies are from this original stock. 70509 F344/NRrrc NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Sperm Cdkn2a|Gfap|Tnfrsf1a 2323|2679|621237 RRID:RRRC_00158 Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. 625624 LETsc2Eker/Hin Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo Japan mutant Unknown Tsc2|Tsc2Eker 3908|12791989 10 13848210 13883189 7 10 13778990 13813725 7 10 13962006 13996684 7 10 13621135 13655773 7 RRID:RGD_625624 Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo. 625659 DRH/Seac National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_625659 Established by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3 628372 ACI.FHH-(D1Mit34-D1Rat156)/Eur Animal Research Center of the Erasmus University, Rotterdam, The Netherlands congenic Unknown 1 230963695 253410500 1 - by flanking markers 1 252776360 279213254 1 - by flanking markers 1 245529606 245529710 1 - by flanking markers 1 225126575 225126682 1 - by flanking markers RRID:RGD_628372 The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI. 628486 NER/Kyo Noda epileptic rat, GMS National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_628486 Originated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan. 628525 Ni/Hin Clea Japan Inc. Shiga inbred Unknown RRID:RGD_628525 Found in the Sprague-Dawley (Jci:SD) in Japan. In these the Tsc2 gene is not mutated. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream 628907 SHR.BN-RT1n congenic Unknown RRID:RGD_628907 This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR. 628908 SHR.BN-(D1Mit3-Igf2)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Igf2|Sa|Scnn1b|Scnn1g 2870|3616|3640|3641 1 146971846 202915231 1 - by flanking markers 1 162692213 222733868 1 - by flanking markers 1 156446196 215839081 1 - by flanking markers 1 144267353 197831802 1 - by flanking markers RRID:RGD_628908 Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. 628909 SHR.BN-(D13Arb5-Ren1)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 13 25430110 64281346 1 - by flanking markers 13 14281836 72173144 1 - by flanking markers 13 9016742 67207219 1 - by flanking markers 13 5994668 62022792 1 - by flanking markers RRID:RGD_628909 Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity. 629459 ZUC-LeprfaSteJrpz-/- Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USA mutant Unknown RRID:RGD_629459 Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology. 629462 ZUC-LeprfaSte-/- University of California Davis, Davis, CA mutant Unknown Leprfa 13432153 5 122320075 122503449 7 5 124380327 124556585 7 5 120597857 120597857 8 5 116389200 116389200 8 RRID:RRRC_00839 This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. 629463 ZUC-Lepr+Ste University of California Davis, Davis, CA mutant Unknown Lepr 3001 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_629463 This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype. 629464 ZUC-Leprfa mutant Unknown Leprfa 13432153 5 122320075 122503449 7 5 124380327 124556585 7 5 120597857 120597857 8 5 116389200 116389200 8 RRID:RGD_629464 This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions. 629465 SHR/NCrlCrlj Charles River Japan, National BioResource Project for the Rat in Japan Charles River Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cardio Hypertension RRID:RGD_629465 NIH derived strain maintained at the Charles River, Japan. 629481 SHR.WKY-(D1Wox33-D1Got194) Département de Physiologie et Pharmacologie Clinique, Faculté de Pharmacie, France congenic Unknown 1;2 160754901;198300754 208638156;198300855 1 - by flanking markers;1 - by flanking markers 1;2 174300636;224991853 228298222;224991955 1 - by flanking markers;1 - by flanking markers 1 221363524 221363653 1 - by flanking markers 1 203293397 203293528 1 - by flanking markers RRID:RGD_629481 This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background. 629482 WKY.SHR-(D1Wox19-D1Mit2)/Njs University of Leicester, Leicester, UK congenic Unknown 1 134980526 185691036 1 - by flanking markers 1 204942418 204942572 1 - by flanking markers 1 197963658 197963812 1 - by flanking markers 1 181133855 181134010 1 - by flanking markers RRID:RGD_629482 Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY 629484 LEW-tl Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1|Csf1tl 621063|12910954 RRID:RGD_629484 The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N. 629485 LE/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_629485 The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50. 629486 PVG/OlaHsd Envigo inbred Cryorecovery RRID:RGD_629486 black hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992 629487 SHR.WKY-(D1Wox19-D1Wox34)/Njs University of Leicester, Leicester, UK congenic Unknown 1 168382195 185691036 1 - by flanking markers 1 182435050 204942572 1 - by flanking markers 1 175447029 197963812 1 - by flanking markers 1 164747424 181134010 1 - by flanking markers RRID:RGD_629487 Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR 629488 SI-Tg(Ednrb)Ywa transgenic spotting lethal University of Texas Southwestern Medical Center, Dallas, Texas transgenic Unknown Ednrb|Ednrbsl 2536|10755424 RRID:RGD_629488 A 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals. 629489 Eker-Tg(Tsc2)5Hin Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 RRID:RGD_629489 Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. 629490 DA.F344-Aia1/1 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 20 2790511 32560683 1 - by flanking markers 20 5249981 36993999 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_629490 genomic segments with region of interest from chr 20 were inserted to DA strain 629491 DA.F344-Aia1/2 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 36592628 85014222 1 - by flanking markers 4 37534124 151090861 1 - by flanking markers 4 37685175 86438507 1 - by flanking markers 4 39505275 85379614 1 - by flanking markers RRID:RGD_629491 genomic segments with region of interest from chr 4 were inserted to DA strain 629492 Sl Institute of Animal Reproduction, Omiya, Japan inbred Unknown Ednrb|Ednrbsl 2536|10755424 RRID:RGD_629492 Natural mutation in the progeny of a Wistar-Imamichi female and a wild rat. 629493 DA.F344-Aia1/3 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 54879077 54879214 1 - by flanking markers 4 55118586 55118722 1 - by flanking markers 4 55375865 55376001 1 - by flanking markers 4 56698790 56698927 1 - by flanking markers RRID:RGD_629493 genomic segments with region of interest from chr 4 were inserted to DA strain 629494 DA.F344-Aia1/4 National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 10 23444813 104060283 1 - by flanking markers RRID:RGD_629494 genomic segments with region of interest from chr 10 were inserted to DA strain 629495 WKY.SHRSP-(Mt1pa-D1Rat57)/Bbb Freie Universitdt Berlin, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 177313819 185690396 1 - by flanking markers 1 195736433 204941832 1 - by flanking markers 1 188794419 197963072 1 - by flanking markers 1 173421600 181133270 1 - by flanking markers RRID:RGD_629495 Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY 629499 BXS/Ipcv Czechoslovak Academy of Sciences, Prague recombinant_inbred Unknown RRID:RGD_629499 These recombinant inbred strains are obtained by crossing normotensive BN-Lx/Cub with hypertensive SHR/Ola progenitor strains. 629500 LEXF/Stm Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan recombinant_inbred Unknown RRID:RGD_629500 Recombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating. 629501 SD-Tg(Ren2)27 Center for Genome Research, University of Edinburgh, UK transgenic Unknown Agtr1b|Ace 2071|2493 RRID:RGD_629501 This is a hypertensive rat strain in which the mouse Ren2 renin gene along with its 5' and 3' flanking sequences were microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background. 629502 SHR.BN-(Il6-Npy) MRC Clinical Centre, London, UK congenic Unknown Il6|Npy 2901|3197 4 456799 78045187 1 - by flanking markers 4 3095536 144240956 1 - by flanking markers 4 3043231 79565059 1 - by flanking markers 4 5214602 78888495 1 - by flanking markers RRID:RGD_629502 This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes 629503 SHR.BN-(D19Rat57-D19Mit7)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Agt 2069 19 57234802 57235101 1 - by flanking markers 19 59599823 70892142 1 - by flanking markers 19 48798983 60220581 1 - by flanking markers 19 44306955 55283277 1 - by flanking markers RRID:RGD_629503 The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating. 629504 WKY.SHR-(D1Mit3-D1Rat57)/Iwai Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 146971846 177313977 1 - by flanking markers 1 162692213 195736590 1 - by flanking markers 1 156446196 188794576 1 - by flanking markers 1 144267353 173421758 1 - by flanking markers RRID:RGD_629504 Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY 629505 SS.MNS-(D10Mit11-D10M11Mit119)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers RRID:RGD_629505 fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr 629506 LEW-tl.BN-(D2Arb16-D2Wox8) Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1 621063 2 198312439 212776982 1 - by flanking markers 2 225003539 237636701 1 - by flanking markers 2 205572952 219581453 1 - by flanking markers 2 190602746 204499414 1 - by flanking markers RRID:RGD_629506 LEW.tl carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2. 629509 FHH/EurMcwi PhysGen Rat Resource and Research Center, RGD HRDP, contact HRDP inbred Live Animals; Cryorecovery RRID:RRRC_00293 An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. 629510 SS.BN-(D12Arb13-D12Rat79)/Mcwi PhysGen congenic Live Animals 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 18 59796478 59796643 1 - by flanking markers RRID:RGD_629510 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629511 SS-Chr 2BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629511 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629512 FHH-Chr 12BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629512 A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed 629513 SS-Chr 4BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629513 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629514 SS-Chr 6BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629514 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629515 SS-Chr 7BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629515 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629516 SS-Chr 8BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629516 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629517 SS-Chr YBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629517 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629518 SS-Chr 9BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629518 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629519 SS.BN-(D13Mgh13-D13Mit4)/Mcwi PhysGen congenic Unknown 13 90551150 90551272 1 - by flanking markers 13 41256240 97381801 1 - by flanking markers 13 36147533 92916783 1 - by flanking markers 13 31241331 86800898 1 - by flanking markers RRID:RGD_629519 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629520 FHH-Chr 1BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629520 A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed 629521 SS-Chr 11BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629521 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629522 SS-Chr 20BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629522 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629523 SS-Chr 13BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_629523 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629524 SS-Chr 16BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_629524 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629525 SS-Chr 18BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_629525 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 629548 SHR.BN-(D1Mit3-Igf2)/1lpcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_629548 SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv. 629578 SS.LEW-(D5Rat130-D5Mco10)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio. congenic Unknown 5 32701659 168174140 1 - by flanking markers 5 36590997 171686754 1 - by flanking markers 5 31926122 168109659 1 - by flanking markers 5 31663789 161481680 1 - by flanking markers RRID:RGD_629578 A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generations 631158 DXE1/Ztm Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631158 DXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. 631160 DXE2/Ztm Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631160 Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats 631161 DXE3/Ztm Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown RRID:RGD_631161 Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. 631163 LE/BluGill University of Illinois at Urbana-Champaign inbred Unknown RRID:RGD_631163 This inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock. 631182 DA/BklArbN NIH, Arthritis and Rheumatism Branch, Bethesda MD inbred Extinct RRID:RRRC_00091 This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding. 631219 SDT/Jcl CLEA Japan, Inc CLEA Japan, Inc inbred Live Animals (as of 2021-04-23) RRID:RGD_631219 Established from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating. 631220 SS.LEW-(D10Mco1-D10Mco31)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10 69986912 84284667 1 - by flanking markers 10 68786307 83220224 1 - by flanking markers 10 69123603 83411656 1 - by flanking markers 10 66743655 80537228 1 - by flanking markers RRID:RGD_631220 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 631275 WKY/Cfd WKY/Cfd Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown RRID:RGD_631275 Substrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA) 631276 WKHA/Cfd WKHA/Cfd Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown RRID:RGD_631276 Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM) 631278 SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Gstm1|Vcam1|S1pr1 2633|2755|3952|61958 2 46542246 210636169 1 - by flanking markers 2 65576721 235592880 1 - by flanking markers 2 46537589 217498710 1 - by flanking markers 2 46123260 202447032 1 - by flanking markers RRID:RGD_631278 Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background. 631279 SHRSP.WKY-(D2Rat13-D2Mit5)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst 2633 2 46542246 66680209 1 - by flanking markers 2 65576721 86560306 1 - by flanking markers 2 46537589 66828236 1 - by flanking markers 2 46123260 66118463 1 - by flanking markers RRID:RGD_631279 Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. 631280 WKY.SHRSP-(D2Mit5-D2Mgh12)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Pklr 3336 2 66680022 181223505 1 - by flanking markers 2 86560119 207874394 1 - by flanking markers 2 66828049 188458034 1 - by flanking markers 2 66118275 174551863 1 - by flanking markers RRID:RGD_631280 Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. 631281 WKY.SHRSP-(Fst-Pklr)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Pklr 2633|3336 2 46542246 181223505 1 - by flanking markers 2 65576721 207874394 1 - by flanking markers 2 46537589 188458034 1 - by flanking markers 2 46123260 174551863 1 - by flanking markers RRID:RGD_631281 Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. 631282 DA.F344-(D10Arb20-D10Arb22)/Arb Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 10 23444813 104060283 1 - by flanking markers RRID:RGD_631282 This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background. 631283 DA.F344-(D10Arb21-D10Arb22)/Arb Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 14721135 14721325 1 - by flanking markers 10 14644150 107484761 1 - by flanking markers 10 14827894 107857673 1 - by flanking markers 10 14487011 104060283 1 - by flanking markers RRID:RGD_631283 This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background. 631285 IER/Ihr Institute of Experimental Animals of Shiga University, Medical Science, Ohtsu, Japan National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Ophthalmology RRID:RGD_631285 A mutant rat strain which is a useful model for human cataract. 631286 WKY/Izm Wistar-Kyoto National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_631286 WKY strain from the Izumo colony 631294 F344.GK-(D1Arb42a-D1Rat90)/Swe Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden congenic Unknown Cyp2c12 2470 1 267110921 267111153 1 - by flanking markers 1 266156838 289137268 1 - by flanking markers 1 258709726 281795785 1 - by flanking markers 1 238699859 259647894 1 - by flanking markers RRID:RGD_631294 This congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 background 631571 SS.LEW-(D1Uia8-D1Mco38)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 110818690 110818887 1 - by flanking markers 1 117836211 117836407 1 - by flanking markers 1 116680361 116680557 1 - by flanking markers 1 110159449 110159650 1 - by flanking markers RRID:RGD_631571 Segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. 631572 SBH/Ygl Sabra hypertension prone Ben Gurion University Barzilai Medical Center, Ashkelon, Israel Available at the Barzilai University Medical Center in Ashkelon, Israel inbred Live Animals (as of 2024-07-15) RRID:RGD_631572 Bred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai University Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed - hence substrain designated with suffix/Ygl. 631573 SBN/Ygl Sabra hypertension resistant Ben Gurion University Barzilai Medical Center, Ashkelon, Israel Available at the Barzilai University Medical Center in Ashkelon, Israel inbred Live Animals (as of 2024-07-15) RRID:RGD_631573 Bred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed - hence substrain designated with suffix/Ygl 631574 Wild/K Department of Laboratory Animal Science, Greifswald, Karlsburg, Germany wild Unknown RRID:RGD_631574 Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany. 631576 LEW/CrlCrlj Charles River, Atsugi, Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Immunology; Osteosis RRID:RGD_631576 Developed by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34. 631577 SHR/Izm National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan inbred Live Animals Cardio Hypertension RRID:RGD_631577 Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). 631578 SHR.BN-(D2Rat171-D2Arb24)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic. congenic Unknown 2 116874922 221284686 1 - by flanking markers 2 135770850 248088631 1 - by flanking markers 2 116075644 228737869 1 - by flanking markers 9;2 67703258;112456140 67703293;212696837 1 - by flanking markers;1 - by flanking markers RRID:RGD_631578 This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background 631579 LEW/OlaHsd Harlan France Harlan France inbred Unknown RRID:RGD_631579 Obtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands. 631581 LEW.1F Zentralinstitut fur versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_631581 Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1f haplotype into the LEW stock 631582 SS.WKY-(Mme-D2Wox18)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 174727552 1 - by flanking markers 2 173193501 201402094 1 - by flanking markers 2 153799203 181987474 1 - by flanking markers 2 147686913 168355276 1 - by flanking markers RRID:RGD_631582 Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr 631583 SS.WKY-(D2Mgh8-D2Mgh9)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_631583 Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr 631585 SS.LEW-(D16Mit2-D16Rat12)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 16 380245 4227730 1 - by flanking markers RRID:RGD_631585 This congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr background 631586 SS.MNS-(D10Mco14-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 45105978 102587587 1 - by flanking markers 10 44914976 101157704 1 - by flanking markers 10 45157430 101482600 1 - by flanking markers 10 43593509 98003205 1 - by flanking markers RRID:RGD_631586 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 631587 SS.MNS-(D10M11Mit119-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown Ace 2493 10 69986912 102587587 1 - by flanking markers 10 68786307 101157704 1 - by flanking markers 10 69123603 101482600 1 - by flanking markers 10 66743655 98003205 1 - by flanking markers RRID:RGD_631587 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 631588 SS.MNS-(D10Mit11-Vamp2)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 101848683 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 10 53793581 53797815 1 - by flanking markers RRID:RGD_631588 Fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr 631589 SHR.WKY-(D1Wox34-D1Rat164)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 168382195 170218440 1 - by flanking markers 1 182435050 184213712 1 - by flanking markers 1 175447029 177235302 1 - by flanking markers 1 164747424 166533203 1 - by flanking markers RRID:RGD_631589 Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR 631590 SHR.WKY-(D1Wox34-Sah)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Acsm3 62086 1 168382195 178081751 1 - by flanking markers 1 182435050 196475596 1 - by flanking markers 1 175447029 189541233 1 - by flanking markers 1 164747424 174159966 1 - by flanking markers RRID:RGD_631590 Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR 631591 WKY.SHR-(D1Rat56-D1M7Mit206)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 172926151 172926455 1 - by flanking markers 1 191393321 191393468 1 - by flanking markers 1 184419946 184420093 1 - by flanking markers 1 169112897 169113045 1 - by flanking markers RRID:RGD_631591 Congenic substrain derived by backcrossing congenic strain WKY.SHR-(DWox19-D1Mit2) to WKY 631592 WKY.SHR-(D1Rat236-D1M7Mit206)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 155183458 155183662 1 - by flanking markers 1 169098399 169098603 1 - by flanking markers 1 162891429 162891633 1 - by flanking markers 1 152234464 152234669 1 - by flanking markers RRID:RGD_631592 Congenic substrain derived by backcrossing congenic strain WKY.SHR-(D1Wox19-D1Mit2) to WKY 631593 LEW/Rj Hopital Purpan, Toulouse Cedex, France inbred Unknown RRID:RGD_631593 Strain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). 631594 BN/Rj Hopital Purpan, Toulouse Cedex, France; Centre D'Elevage R. Janvier, Route des Chenes-Secs Le Genest-St-Isle, France inbred Unknown RRID:RGD_631594 Strain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). 631595 LEW.1AV1.DA-(D10Rat92-D10Rat135)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 108776963 1 - by flanking markers 10 77132487 108145987 1 - by flanking markers 10 77269759 108540162 1 - by flanking markers 10 74585846 104670812 1 - by flanking markers RRID:RGD_631595 LEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain. 631596 LEW.1AV1.DA-(D10Rat92-D10Wox17)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 91168491 1 - by flanking markers 10 77132487 89831596 1 - by flanking markers 10 77269759 90042115 1 - by flanking markers 10 74585846 87055282 1 - by flanking markers RRID:RGD_631596 Congenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2. 631597 LEW.1AV1.DA-(D10Wox17-D10Rat135)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 91168332 108776963 1 - by flanking markers 10 89831438 108145987 1 - by flanking markers 10 90041957 108540162 1 - by flanking markers 10 87055121 104670812 1 - by flanking markers RRID:RGD_631597 Congenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 631598 LEW.1AV1.DA-(D10Got154-D10Rat135)/Ubc Biomedical Center in Uppsala, Sweden congenic Unknown 10 101532360 108776963 1 - by flanking markers 10 100150192 108145987 1 - by flanking markers 10 100460820 108540162 1 - by flanking markers 10 97010147 104670812 1 - by flanking markers RRID:RGD_631598 Congenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 631599 SHRSP/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension; Neurobiology RRID:RGD_631599 Strain has been maintained at Kyoto University. 631600 WKY.SHRSP-(Mt1pa-D1Rat200)/Bbb Max-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany. congenic Unknown Mt1-ps1 3118 1 126938969 185690396 1 - by flanking markers 1 134116233 204941832 1 - by flanking markers 1 133076978 197963072 1 - by flanking markers 1 125611501 181133270 1 - by flanking markers RRID:RGD_631600 Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY 631601 WKY.SHRSP-(Asgr1-Vamp2)/Bbb Max-Delbruck Center for Molecular Medicine, Germany congenic Unknown Asgr1|Vamp2 2160|3949 10 55848264 56903173 1 - by flanking markers 10 55418231 56411205 1 - by flanking markers 10 55675171 56666086 1 - by flanking markers 10 53793581 54779642 1 - by flanking markers RRID:RGD_631601 Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki 631602 BN/Elh Department of Surgery and Biochemistry, University of Otago inbred Unknown RRID:RGD_631602 These rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony. 631603 WKY/Snk Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_631603 The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. 631604 SHR/Snk Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_631604 The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. 631605 SS.LEW-(D10Arb9-D10Got101)/Jr Medical College of Ohio, Toledo congenic Unknown 10 65068360 77547622 1 - by flanking markers 10 65339106 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_631605 Congenic strain originated from an inbred SS/Jr strain. 631606 SS.MNS-(D10Rat13-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 97152234 101848683 1 - by flanking markers 10 95701164 95701443 1 - by flanking markers 10 95967019 95967298 1 - by flanking markers 10 92698959 92699242 1 - by flanking markers RRID:RGD_631606 Congenic strain originated from an inbred SS/Jr strain. 631607 SS.WKY-(D2N35-Mme)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 153114515 1 - by flanking markers 2 173193501 173278946 1 - by flanking markers 2 153799203 153880910 1 - by flanking markers 2 147686913 147803808 1 - by flanking markers RRID:RGD_631607 Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr 631610 SS.LEW-(D1Rat39-D1Rat131)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 125983422 145648920 1 - by flanking markers 1 133172202 159182239 1 - by flanking markers 1 132134307 152871103 1 - by flanking markers 1 124668437 142990467 1 - by flanking markers RRID:RGD_631610 Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. 631691 SHRSP/A3Izm Research Institute, International Medical Center of Japan inbred Unknown RRID:RGD_631691 Substrain originates from the SHRSP/Izm strain. 631693 WKY.SHRSP-(Shbg-Atp1b2)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Atp1b2|Shbg 2171|3671 10 56418323 56435654 1 - by flanking markers 10 55951260 55983036 1 - by flanking markers 10 56205622 56237354 1 - by flanking markers 10 54318698 54350409 1 - by flanking markers RRID:RGD_631693 This strain has the blood pressure locus from chr 10 631694 WKY.SHRSP-(D1Rat200-D1Rat216)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 1 126938969 185923619 1 - by flanking markers 1 134116233 205161264 1 - by flanking markers 1 133076978 133164521 1 - by flanking markers 1 125611501 125611741 1 - by flanking markers RRID:RGD_631694 This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(D1Rat200-D1Rat216) 631695 SS/JrRkb Benjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany. inbred Unknown RRID:RGD_631695 This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin 631696 SHR/FubRkb Freie Universitat Berlin inbred Unknown RRID:RGD_631696 Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin. 631697 BBDP/Hri Hagedorn Research Institute, Gentofte, Denmark inbred Unknown RRID:RGD_631697 This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. 631698 BN/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_631698 This strain is maintained at the Mollegaard breeding center. 631699 BB.SHR-(D6Rat184-D6Rat101)/K University of Greifswald, Germany congenic Unknown 6 121381065 135964844 1 - by flanking markers 6 130448688 144756005 1 - by flanking markers 6 121224054 135658578 1 - by flanking markers 6 116506292 130245370 1 - by flanking markers RRID:RGD_631699 Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females. 631700 BB.SHR-(Gnal-D18Mit9)/K Department of Laboratory Animal Science, University Greifswald, Karlsburg, Germany congenic Unknown Gnal 2715 18 63595606 80370517 1 - by flanking markers 18 61991738 79748387 1 - by flanking markers 18 62805406 80696375 1 - by flanking markers 18 60622311 77209844 1 - by flanking markers RRID:RGD_631700 Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long. 631703 SS.LEW-(D10Rat207-D10Mgh1)/Ayd Research Centre-CHUM congenic Unknown 10 89896421 89896564 1 - by flanking markers 10 88662536 88662678 1 - by flanking markers 10 88865454 88865596 1 - by flanking markers 10 85887040 85887185 1 - by flanking markers RRID:RGD_631703 Congenic strain originated from an inbred SS strain 631844 Iusm:HAD1 high-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_631844 These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2). 631845 Iusm:LAD1 low-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_631845 These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2). 631846 F344.GK-(D1Mgh10-D1Rat90)/Swe Karolinska Institute congenic Unknown 1 204280278 267111153 1 - by flanking markers 1 223910550 289137268 1 - by flanking markers 1 217054291 281795785 1 - by flanking markers 1 199050459 259647894 1 - by flanking markers RRID:RGD_631846 Congenic strain originated from an inbred F344/Mcwi strain 631847 F344.GK-(D1Mit7-D1Mgh25)/Swe Karolinska Institute congenic Unknown 1 235677487 240980321 1 - by flanking markers 1 257430524 262617374 1 - by flanking markers 1 250195095 250195290 1 - by flanking markers 1 229550480 229550676 1 - by flanking markers RRID:RGD_631847 Congenic strain originated from an inbred F344 strain 631848 SHR/OlaIpcv Czech Academy of Sciences, Prague, Czech Republic inbred Unknown Sbf1m1Ipcv 10002755 RRID:RGD_631848 These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf1 was identified in this strain. 634359 WF.WKY-(D5Pas1-D5Uwm37)/Uwm University of Wisconsin-Madison congenic Unknown 5 26938679 130527490 1 - by flanking markers 5 30952629 132652105 1 - by flanking markers 5 26251767 128812854 1 - by flanking markers 5 26141669 123935338 1 - by flanking markers RRID:RGD_634359 WKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region. 634363 LEW/NIcoCrlf Charles River, France inbred Unknown RRID:RGD_634363 A substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. 634364 SHR/NIcoCrlf Charles River, France inbred Unknown RRID:RGD_634364 A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. 634365 SS/Hsd Harlan, Indianapolis, Indiana inbred Unknown RRID:RGD_634365 This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. 634366 SR/Hsd Harlan, Indianapolis, Indiana inbred Unknown RRID:RGD_634366 This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. 634367 BN/CrlCrlj Charles River Laboratories Japan, National BioResource Project for the Rat in Japan Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Ophthalmology; Immunology RRID:RGD_634367 1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced. 634369 WBN/KobSlc wistar bonn/kobori National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Diabetes Obesity; Ophthalmology RRID:RGD_634369 This strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1. 634370 F344.GK-(D1Mgh10-D1Rat119)/Swe Karolinska Institute congenic Unknown 1 204280278 242586311 1 - by flanking markers 1 223910550 264429516 1 - by flanking markers 1 217054291 256949019 1 - by flanking markers 1 199050459 236036450 1 - by flanking markers RRID:RGD_634370 GK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain. 634372 GHS Department of Medicine and Physiology, University of Rochester, Rochester, New York inbred Unknown RRID:RGD_634372 SD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain. 634373 DA/ZtmRhd Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_634373 DA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. 634374 E3/ZtmRhd Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_634374 E3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. 634376 LEA/Ncu Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown RRID:RGD_634376 These rats were established from a closed colony of Long-Evans. 634377 BN/Sea BN/Sea Sea Life Supply, Sand City, CA Sea Life Supply inbred Unknown RRID:RGD_634377 This inbred strain was obtained from Sea life Supply 634380 iP/Iusm inbred alcohol-preferring Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 RRID:RGD_634380 These were inbred alcohol-preferring rats developed from outbred alcohol-preferring rats (Iusm:P) at generation 30 at Indiana University for high-alcohol-preferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding. 634381 iNP/Iusm alcohol-nonpreferring Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 RRID:RGD_634381 These were inbred alcohol-nonpreferring rats developed from outbred alcohol-nonpreferring rats (Iusm:NP) at generation 30 at Indiana University for high-alcohol-nonpreferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding. 634382 SHR.BN-(D5Wox12-D5Wox20)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 5 147065698 147065912 1 - by flanking markers 5 149494416 149494629 1 - by flanking markers 5 145726049 145726262 1 - by flanking markers 5 139989554 139989768 1 - by flanking markers RRID:RGD_634382 This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background 634743 BIL NIH Autoimmune Rat Model Repository inbred Unknown RRID:RGD_634743 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. 724569 MWF/FubRkb Munich Wistar Fromter Freie Universitdt Berlin, Berlin, Germany inbred Unknown RRID:RGD_724569 The MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm). 724570 LEW/Rkb Freie Universitdt Berlin, Berlin, Germany inbred Unknown RRID:RGD_724570 The LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany. 724571 MITE/Mna Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japan inbred Unknown RRID:RGD_724571 This strain was established from captured Japanese wild rats. 724572 SS.LEW-(D10Wox51-D10Rat27)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 71294871 77092169 1 - by flanking markers 10 70062921 74127968 1 - by flanking markers 10 70428844 75983805 1 - by flanking markers 10 68011827 73453136 1 - by flanking markers RRID:RGD_724572 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 724573 SS/JrTol Dahl salt-sensitive (SS/Jr) rats Housed at the University of Toledo College of Medicine and Life Sciences. inbred Live Animals (as of 2021-06-08) RRID:RGD_724573 In the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet. 724574 SHR/NHsd Envigo Envigo inbred Unknown RRID:RGD_724574 SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) 724575 SS.LEW-(D10Rat17-D10Mgh1)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 95066219 95066632 1 - by flanking markers 10 93641751 93641934 1 - by flanking markers 10 93886117 93886300 1 - by flanking markers 10 90627439 90627625 1 - by flanking markers RRID:RGD_724575 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 724576 KDP/Tky Komeda diabetes-prone rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_724576 This is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross. 724577 SS.LEW-(D10Rat27-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 77091834 87834315 1 - by flanking markers 10 74127825 86759484 1 - by flanking markers 10 75983662 86962563 1 - by flanking markers 10 73452992 84007272 1 - by flanking markers RRID:RGD_724577 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728133 BN-RT1n/Rj The Center dElevage R. Janvier, France. coisogenic Unknown RRID:RGD_728133 This coisogenic strain was produced by selecting BN rats with the RT1n allele. 728134 SS.LEW-(D1Rat35-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 157498254 1 - by flanking markers 1 131958920 171330794 1 - by flanking markers 1 130917121 165129939 1 - by flanking markers 1 123479780 154464242 1 - by flanking markers RRID:RGD_728134 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728135 SS.LEW-(D5Uwm14-D5Uwm31)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 48908533 48908825 1 - by flanking markers 5 52440414 52440705 1 - by flanking markers 5 47842131 47842422 1 - by flanking markers 5 47002982 47003274 1 - by flanking markers RRID:RGD_728135 S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain 728137 SS.LEW-(D10Rat141-D10Mgh1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 19 38295381 38295550 1 - by flanking markers 19 51402312 51402480 1 - by flanking markers 10;19 91548145;40571888 91548388;40572056 1 - by flanking markers;1 - by flanking markers 19 36511450 36511619 1 - by flanking markers RRID:RGD_728137 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728138 SS.MNS-(Mme-Gca)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme|Npr1 2167|3098|3195 2 153031724 182740242 1 - by flanking markers 2 173193501 209287892 1 - by flanking markers 2 153799203 189857032 1 - by flanking markers 2 147686913 175950118 1 - by flanking markers RRID:RGD_728138 Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive 728139 WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown RRID:RGD_728139 This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(Shbg-Atp1b2) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(Shbg-Atp1b2) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs 728140 SS.LEW-(D10Rat11-D10Mgh1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10;19 100633512;38295381 100633982;38295550 1 - by flanking markers;1 - by flanking markers 10;19 99184058;51402312 99184250;51402480 1 - by flanking markers;1 - by flanking markers 10;19 99492217;40571888 99492409;40572056 1 - by flanking markers;1 - by flanking markers 19;10 36511450;96120911 36511619;96121100 1 - by flanking markers;1 - by flanking markers RRID:RGD_728140 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728142 BN.SHR-(Il6-Cd36)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Cd36|Il6 2301|2901 4 456799 13554416 1 - by flanking markers 4 3095536 14166434 1 - by flanking markers 4 3043231 14191498 1 - by flanking markers 4 5214602 17410084 1 - by flanking markers RRID:RGD_728142 This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR. 728143 SS.LEW-(D1Mco38-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 110818690 157498254 1 - by flanking markers 1 117836211 171330794 1 - by flanking markers 1 116680361 165129939 1 - by flanking markers 1 110159449 154464242 1 - by flanking markers RRID:RGD_728143 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728144 BN.PD-(D8Rat39-D8Rat35)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 8 49035642 64617259 1 - by flanking markers 8 48981076 65325374 1 - by flanking markers 8 50356432 50356607 1 - by flanking markers 8 46358478 46358654 1 - by flanking markers RRID:RGD_728144 This congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM. 728145 SS.LEW-(D5Rat130-D5Rat108)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 5 31663789 128034027 1 - by flanking markers RRID:RGD_728145 S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain 728146 F344.BN-(D3Mgh13-D3Mgh7)/Dlw Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 3 112319451 112319585 1 - by flanking markers 3 11139240 123812293 1 - by flanking markers 3 5775856 117288411 1 - by flanking markers 3 10549351 112272465 1 - by flanking markers RRID:RGD_728146 This congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USA 728147 BN.PD-(D8Rat39-D8Rat35),SHR-(D4Mgh2-Cd36),SHR-(D20Wox3-D20Mgh5)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown RRID:RGD_728147 This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM. 728148 SS.LEW-(D16Uia2-D16Rat12)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 16 380245 4227730 1 - by flanking markers RRID:RGD_728148 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728151 UPL/Ncc Hiroshima University, School of Medicine, Hiroshima, Japan inbred Unknown RRID:RGD_728151 The UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony. 728152 SS.LEW-(D1Rat196-D1Mgh7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 106445306 1 - by flanking markers 1 59282428 114601028 1 - by flanking markers 1 58354072 113593716 1 - by flanking markers 1 57336763 106047988 1 - by flanking markers RRID:RGD_728152 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728153 SS.LEW-(D1Rat196-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 157498254 1 - by flanking markers 1 59282428 171330794 1 - by flanking markers 1 58354072 165129939 1 - by flanking markers 1 57336763 154464242 1 - by flanking markers RRID:RGD_728153 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728155 BBDR.BBDP-(D4Mit6-D4Mit7)/1Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_728155 This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. 728156 SS.LEW-(D5Mco34-D5Mco10)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 168173895 168174140 1 - by flanking markers 5 171686510 171686754 1 - by flanking markers 5 168109415 168109659 1 - by flanking markers 5 161481433 161481680 1 - by flanking markers RRID:RGD_728156 SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain 728157 SS.LEW-(D5Rat130-D5Mit19)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 140744137 1 - by flanking markers 5 36590997 142892672 1 - by flanking markers 5 31926122 139102349 1 - by flanking markers 5 31663789 133752767 1 - by flanking markers RRID:RGD_728157 SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain 728158 SS.LEW-(D5Uia4-D5Mco10)/Jr Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 144865363 168174140 1 - by flanking markers 5 147288554 171686754 1 - by flanking markers 5 143523348 168109659 1 - by flanking markers 5 137790781 161481680 1 - by flanking markers RRID:RGD_728158 SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain 728159 SS.LEW-(D1Mco36-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 146189942 1 - by flanking markers 1 131958920 160138947 1 - by flanking markers 1 130917121 153834227 1 - by flanking markers 1 123479780 143506731 1 - by flanking markers RRID:RGD_728159 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. 728161 PD/Cub polydactylous Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic inbred Unknown RRID:RGD_728161 Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the polydactyly-luxate syndrome. 728162 SS.LEW-(D1Mco87-D1Rat71)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 145648742 206567907 1 - by flanking markers 1 159182062 226102807 1 - by flanking markers 1 152870926 219232156 1 - by flanking markers 1 142990289 201278233 1 - by flanking markers RRID:RGD_728162 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. 728163 SS.LEW-(D1Uia2-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_728163 Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. 728165 SS.LEW-(D1Rat196-D1Mco36)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 122992360 1 - by flanking markers 1 59282428 130268180 1 - by flanking markers 1 58354072 129209407 1 - by flanking markers 1 57336763 121834139 1 - by flanking markers RRID:RGD_728165 Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. 728166 WKY.SHRSP-(D1Rat112-D1Wox29)/Izm Shimane Medical University, Izumo, Japan congenic Unknown 1 124614679 206574346 1 - by flanking markers 1 131822204 226109267 1 - by flanking markers 1 130779148 219238616 1 - by flanking markers 1 123350408 201284693 1 - by flanking markers RRID:RGD_728166 A segment from SHRSP/Izm was transferred on a WKY/Izm background 728167 SS.LEW-(Nos2-D10M11Mit119)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Nos2 3185 10 65036884 65072453 1 - by flanking markers 10 65423626 65456957 1 - by flanking markers 10 66188290 66221621 1 - by flanking markers 10 63815308 63851208 1 - by flanking markers RRID:RGD_728167 Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment 728168 WOK Diabetes Research Center, Karlsberg, Germany inbred Unknown RRID:RGD_728168 The inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germany 728170 SS.MNS-(Mme-D2Mit14)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme 2167|3098 2 153031724 197256313 1 - by flanking markers 2 173193501 224018437 1 - by flanking markers 2 153799203 204585731 1 - by flanking markers 2 147686913 189599348 1 - by flanking markers RRID:RGD_728170 Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strain 728171 LEW-RT11/Rj The Center dElevage R. Janvier, France. coisogenic Unknown RRID:RGD_728171 This coisogenic strain was produced by selecting LEW rats with the RT11 allele. 728172 SS.MNS-(D2Mit6-Adh1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Adh1c|Agtr1b|Atp1a1 2044|2071|2167 2 77630629 235811584 1 - by flanking markers 2 98037122 262102977 1 - by flanking markers 2 78321410 243562243 1 - by flanking markers 2 76539322 226808892 1 - by flanking markers RRID:RGD_728172 Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNS 728183 WF/N NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_728183 To N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia. 728184 SHRSP/A3N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-04-21) RRID:RGD_728184 To NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517) 728185 N:NIH outbred Extinct RRID:RRRC_00237 Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony. 728186 LEW/SsN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728186 To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31. 728187 ACI/N-j NIH Autoimmune Rat Model Repository and Development Center congenic Extinct RRID:RGD_728187 Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. 728188 LOU/MN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-09-04) RRID:RGD_728188 To NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. 728189 SHR/N-di NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728189 Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. 728190 RCS-rdy-c Albino retinal dystrophy NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728190 This congenic strain is obtained from pink-eyed, tan-hooded RCS rats 728191 LOU/CN NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728191 To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045) 728192 RCS-rdy-p NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728192 This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks. 728193 N:SD Sprague-Dawley NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center outbred Extinct RRID:RRRC_00239 To N 1945 from Sprague Dawley, Inc. Colony closed since then. 728194 SHR/N NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728194 To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. 728195 SHR/N-cp Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo (as of 2021-01-20) RRID:RRRC_00231 The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolerance. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis. 728196 RHA/N-j NIH Autoimmune Rat Model Repository and Development Center congenic Extinct RRID:RGD_728196 Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. 728197 RCS-rdy-+ NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728197 This congenic strain is obtained from pink-eyed, tan-hooded RCS rats 728198 BHE/N Bureau of Home Economics NIH Autoimmune Rat Model Repository and Development Center inbred Extinct RRID:RGD_728198 To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University. 728199 RHA Roman high avoidance NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728199 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). 728200 ACI/N-di NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728200 Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41. 728358 SB R. Kalman, Authority for Animal Facilities outbred Unknown RRID:RGD_728358 This outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear. 728383 UPL/Cas Upjohn Pharmaceuticals Limited National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown Gja8m1Cas 13524999 RRID:RGD_728383 In 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating. 728384 SS.LEW-(D10Rat24-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79229067 87834315 1 - by flanking markers 10 78194957 86759484 1 - by flanking markers 10 78343027 86962563 1 - by flanking markers 10 75631887 84007272 1 - by flanking markers RRID:RGD_728384 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728385 WF.COP-(D2Rat2-D2M13Mit286)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 14747814 14747981 1 - by flanking markers 2 14095321 14095488 1 - by flanking markers 2 14237830 14237997 1 - by flanking markers 2 16491740 16491908 1 - by flanking markers RRID:RGD_728385 A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728386 SS.LEW-(D10Rat119-D10Rat133)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 65668639 1 - by flanking markers 10 53273326 64823355 1 - by flanking markers RRID:RGD_728386 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728387 WF.COP-(D2Mit29-D2Uwm13)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 11957973 1 - by flanking markers 2 5396621 11387756 1 - by flanking markers 2 5417336 11522696 1 - by flanking markers 2 7887772 13840758 1 - by flanking markers RRID:RGD_728387 A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728388 SS.LEW-(D10Rat119-D10Mgh1)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 53675478 1 - by flanking markers 10 53273326 53273444 1 - by flanking markers RRID:RGD_728388 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728389 WF.COP-(D2Mit29-D2Rat201)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 49691646 1 - by flanking markers 2 5396621 68633866 1 - by flanking markers 2 5417336 50260392 1 - by flanking markers 2 7887772 49657252 1 - by flanking markers RRID:RGD_728389 A segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728391 WF.COP-(D2Rat253-D2Uwm17)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 25663274 32051637 1 - by flanking markers 2 44171519 50382003 1 - by flanking markers 2 25012974 31224929 1 - by flanking markers 2 26559817 32374088 1 - by flanking markers RRID:RGD_728391 A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. 728392 RHA/N-di Roman high avoidance-di mutation NIH Autoimmune Rat Model Repository and Development Center NIH Autoimmune Rat Model Repository and Development Center congenic Unknown RRID:RGD_728392 Brattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. 728393 SS.LEW-(D10Got125-D10Rat120)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 86983905 92373412 1 - by flanking markers 10 85965754 91041690 1 - by flanking markers 10 86168841 91270722 1 - by flanking markers 10 83212828 88132643 1 - by flanking markers RRID:RGD_728393 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728394 SS.LEW-(D10Rat55-D10Rat13)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 97152587 1 - by flanking markers 10 87933406 95701443 1 - by flanking markers 10 88140923 95967298 1 - by flanking markers 10 85160679 92699242 1 - by flanking markers RRID:RGD_728394 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728395 SS.LEW-(D10Rat55-D10Rat120)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 92373412 1 - by flanking markers 10 87933406 91041690 1 - by flanking markers 10 88140923 91270722 1 - by flanking markers 10 85160679 88132643 1 - by flanking markers RRID:RGD_728395 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 728396 SS.LEW-(D10Mco15-D10Mgh1)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 98392296 98392508 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 10 93995749 93995963 1 - by flanking markers RRID:RGD_728396 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 731185 MWF/Fub Munich Wistar Fromter Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown RRID:RGD_731185 Munich Wistar Fromter rats were obtained from colonies at the Freie Universitat, Benjamin Franklin Campus Berlin, Germany 731186 SHR/Fub Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown RRID:RGD_731186 Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany 731187 Iusm:HAD2 high-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_731187 These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2). 731188 Iusm:LAD2 low-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_731188 These were developed by selective breeding for alcohol preference and consumption from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2). 731189 SHRSP.WKY-(Klk1-D1Rat116)/Izm Department of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, Japan congenic Unknown RRID:RGD_731189 A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method. 731190 SS.LEW-(D1Rat211-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17;1 1147796;43747374 1148037;43747532 1 - by flanking markers;1 - by flanking markers 1 35077728 50297622 1 - by flanking markers 1 33667777 49454378 1 - by flanking markers 1 31050840 49268520 1 - by flanking markers RRID:RGD_731190 A segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. 731191 SHRSP.WKY-(D2Rat14-D2Mgh12)/Gcrc University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 2 42804607 202447032 1 - by flanking markers RRID:RGD_731191 A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. 731192 SS.LEW-(D3Rat52-D3Rat130)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 44551542 1 - by flanking markers 3 19410399 55227748 1 - by flanking markers 3 14090411 48562146 1 - by flanking markers 3 18311454 47233430 1 - by flanking markers RRID:RGD_731192 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 731193 DA.PVG-(D4Rat141-D4Mgh11) Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 151158666 171204531 1 - by flanking markers 4 210231569 230565226 1 - by flanking markers 4 146942075 168047091 1 - by flanking markers 4 148090542 167139601 1 - by flanking markers RRID:RGD_731193 PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies. 731194 SS.LEW-(D3Chm64-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 52127226 121619110 1 - by flanking markers 3 62850379 133513825 1 - by flanking markers 3 56217734 127023997 1 - by flanking markers 3 54740735 121056321 1 - by flanking markers RRID:RGD_731194 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 731195 DA.E3-(D14Wox8-D14Rat64)/Rhd Medical Inflammation Research, BMC, University of Lund, Lund, Sweden congenic Unknown 14 68573958 68574165 1 - by flanking markers 14 67969510 67969716 1 - by flanking markers 14 67944692 67944898 1 - by flanking markers 14 63618971 63619178 1 - by flanking markers RRID:RGD_731195 The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain. 734471 SS.LEW-(D1Mgh7-D1Mco41)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 106445165 227693454 1 - by flanking markers 1 114600888 249451438 1 - by flanking markers 1 113593576 242177304 1 - by flanking markers 1 106047847 221920075 1 - by flanking markers RRID:RGD_734471 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background. 734472 SS.LEW-(D1Mco2-D1Wox6)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 131956599 131956825 1 - by flanking markers 1 58687835 138778112 1 - by flanking markers 1 57761120 137787460 1 - by flanking markers 1 56732484 56732668 1 - by flanking markers RRID:RGD_734472 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background. 734473 SS.LEW-(D17Mco3-D17Mco10)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 17 28967455 70289318 1 - by flanking markers 17 24748228 66699053 1 - by flanking markers 17 22774867 64946465 1 - by flanking markers 17 23080368 59555289 1 - by flanking markers RRID:RGD_734473 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. 734474 SS.LEW-(D5Mit9-D5Mco10)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 62555131 168174140 1 - by flanking markers 5 66128197 171686754 1 - by flanking markers 5 61612600 168109659 1 - by flanking markers 5 60293434 161481680 1 - by flanking markers RRID:RGD_734474 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. 734475 DA/OlaHsd inotiv inotiv inbred Unknown RRID:RGD_734475 Odell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965. 734476 Crl:CD(SD) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_734476 Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system. 734478 F344/DuCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_734478 This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960. 734479 SS.LEW-(D1Mco2-D1Rat49)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 58687835 171330794 1 - by flanking markers 1 57761120 165129939 1 - by flanking markers 1 56732484 154464242 1 - by flanking markers RRID:RGD_734479 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background. 734480 SS.LEW-(D10Mit10-D10Mgh1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 102587587 1 - by flanking markers 10 27082535 101157704 1 - by flanking markers 10 27237530 101482600 1 - by flanking markers 10 26521957 98003205 1 - by flanking markers RRID:RGD_734480 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. 734481 SS.LEW-(D1Mco2-D1Mco35)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 238358625 238358813 1 - by flanking markers 1 58687835 259930393 1 - by flanking markers 1 57761120 252708858 1 - by flanking markers 1 56732484 231916666 1 - by flanking markers RRID:RGD_734481 SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background. 734482 SS.LEW-(D1Rat45-D1Mco41)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 146189650 227693454 1 - by flanking markers 1 160138797 249451438 1 - by flanking markers 1 153834077 242177304 1 - by flanking markers 1 143506580 221920075 1 - by flanking markers RRID:RGD_734482 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. 734483 SS.LEW-(D1Rat42-D1Wox10)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 135418152 220639653 1 - by flanking markers 1 142342107 244066407 1 - by flanking markers 1 141381406 236763528 1 - by flanking markers 1 133587283 214537671 1 - by flanking markers RRID:RGD_734483 This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. 734526 OLETF/Got Otsuka Long Evans Tokushima Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan inbred Unknown RRID:RGD_734526 Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating. 734527 OLETF.F344-(D1Rat169-D1Rat459)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 229876870 267593558 1 - by flanking markers 1 251652807 289700417 1 - by flanking markers 1 244401175 282365384 1 - by flanking markers 1 224054293 260122809 1 - by flanking markers RRID:RGD_734527 Female OLETF/Got rats were crossed with F344/DuCrlCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. 734528 OLETF.BN-(D1Rat76-D1Rat459)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 230411091 267593558 1 - by flanking markers 1 252243728 289700417 1 - by flanking markers 1 244992467 282365384 1 - by flanking markers 1 224569538 260122809 1 - by flanking markers RRID:RGD_734528 Female OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. 734531 OLETF.F344-(D1Rat306-D1Rat461)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 248583506 266234812 1 - by flanking markers 1 268967725 288207792 1 - by flanking markers 1 280850604 280850810 1 - by flanking markers 1 258843780 258843987 1 - by flanking markers RRID:RGD_734531 Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation. 734758 DA/Ham Dark-agouti Shizuoka Laboratory Animal Center Hamamatsu, Japan inbred Unknown RRID:RGD_734758 Original DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). 734759 SHRSP/Gcrc Spontaneously hypertensive rat, stroke prone University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown RRID:RGD_734759 SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH 734760 WKY/Gcrc Wistar-Kyoto University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown RRID:RGD_734760 WKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH 734761 WF/Kga Wistar-Furth Kagoshima University Dental School, Kagoshima, Japan inbred Unknown RRID:RGD_734761 Obtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan). 737657 LEW.1AV1 National Veterinary Institute, Uppsala, Sweden congenic Extinct RRID:RRRC_00201 Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region. 737658 PVG.1AV1 Piebald-Virol-Glaxo Harlan UK, Blackthorn, Bicester, UK congenic Unknown RRID:RGD_737658 Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany 737690 F344/Crli Charles River, Calco, Italy inbred Unknown RRID:RGD_737690 These animals were from Charles River Italia, Calco, LC, Italy 737691 BN/Crli Charles River Laboratories Italy Charles River Laboratories Italy inbred Unknown RRID:RGD_737691 These animals were from Charles River Italia, Calco, LC, Italy 737703 LEW-Tg(HLA-B*0702,B2M)120-4TrgTg/Tg Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-07-08) RRID:RRRC_00042 Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity. 737857 DA.PVG.1AV1-(D4Rat155-D4Rat84) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 185398415 185398530 1 - by flanking markers 4 47848402 246313537 1 - by flanking markers 4 48053950 182171018 1 - by flanking markers 4 49524674 180699135 1 - by flanking markers RRID:RGD_737857 Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737858 DA.PVG.1AV1-(D4Rat155-Spr) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown Spr 3753 4 119365578 119369308 1 - by flanking markers 4 47848402 181496612 1 - by flanking markers 4 48053950 116916073 1 - by flanking markers 4 49524674 117676292 1 - by flanking markers RRID:RGD_737858 Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737859 DA.PVG.1AV1-(D4Mgh17-D4Rat56) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 116611031 143663540 1 - by flanking markers 4 177782842 204673386 1 - by flanking markers 4 113100978 113247809 1 - by flanking markers 4 114921280 114921417 1 - by flanking markers RRID:RGD_737859 Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737861 DA.PVG.1AV1-(D4Rat63-D4Rat203) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 161435775 1 - by flanking markers 4 219683260 224843794 1 - by flanking markers 4 152598827 157826751 1 - by flanking markers 4 153274175 158112799 1 - by flanking markers RRID:RGD_737861 Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 737862 SHRSP.WKY-(D2Rat14-D2Mit5)/Gcrc University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 2 42804607 66118463 1 - by flanking markers RRID:RGD_737862 A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. 737863 SHRSP.WKY-(D2Wox9-D2Mgh12)/Gcrc University of Glasgow, Glasgow, UK congenic Unknown Gstm1 2755 2 141259937 210636169 1 - by flanking markers 2 161271919 235592880 1 - by flanking markers 2 141583337 217498710 1 - by flanking markers 2 136445150 202447032 1 - by flanking markers RRID:RGD_737863 A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP 737864 SS.SR-(D13Mit9-D13Mit1)/Jr J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA congenic Unknown 13 25430110 55033994 1 - by flanking markers 13 14281836 63533335 1 - by flanking markers 13 9016742 58537177 1 - by flanking markers 13 5994668 53050594 1 - by flanking markers RRID:RGD_737864 Congenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain. 737865 WKY.SHRSP-(D2Rat14-D2Mgh12) University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 2 42804607 202447032 1 - by flanking markers RRID:RGD_737865 A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY. 737866 WKY.SHRSP-(D2Rat14-D2Mit5) University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 2 42804607 66118463 1 - by flanking markers RRID:RGD_737866 A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY 737867 SS.SR-(D13N1-D13Mit1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 13 25430110 38985930 1 - by flanking markers 13 14281836 48881269 1 - by flanking markers 13 9016742 43785939 1 - by flanking markers 13 5994668 37902821 1 - by flanking markers RRID:RGD_737867 Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain 737868 SS.SR-(Syt2-D13Mit1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Syt2 3804 13 25430110 47699094 1 - by flanking markers 13 14281836 56630530 1 - by flanking markers 13 9016742 51577824 1 - by flanking markers 13 5994668 46197976 1 - by flanking markers RRID:RGD_737868 Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain 737869 OLETF.BN-(D1Rat461-D1Rat459)/Got Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 266234605 267593558 1 - by flanking markers 1 288207586 289700417 1 - by flanking markers 1 280850604 282365384 1 - by flanking markers 1 258843780 260122809 1 - by flanking markers RRID:RGD_737869 Female OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study. 737870 DA.E3-(D20Wox3-D20Mgh4)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 3660646 6880472 1 - by flanking markers 20 6935875 7910747 1 - by flanking markers 20 4855475 5875448 1 - by flanking markers 20 3621656 6691706 1 - by flanking markers RRID:RGD_737870 A fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA. 737871 DA.E3-(D12Got46-D12Rat26)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23362298 23845733 1 - by flanking markers 12 27316608 30964880 1 - by flanking markers 12 25307118 29014362 1 - by flanking markers 12 22297209 22692658 1 - by flanking markers RRID:RGD_737871 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 737872 DA.E3-(D4Mit16-D4Mgh11)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 4 130228504 171204531 1 - by flanking markers 4 192286223 230565226 1 - by flanking markers 4 127777294 168047091 1 - by flanking markers 4 128289450 167139601 1 - by flanking markers RRID:RGD_737872 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 737873 DA.E3-(D6Wox5-D6Rat90)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6 117361909 117362003 1 - by flanking markers 6 126582753 126582846 1 - by flanking markers 6 117355600 117355693 1 - by flanking markers 6 112636280 112636374 1 - by flanking markers RRID:RGD_737873 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 737885 RHA/Kun Roman high avoidance Dept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlands inbred Unknown RRID:RGD_737885 Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands 737886 BDX/Cub Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737886 Recombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands 737887 AO/OlaHsd Envigo Envigo inbred Cryorecovery RRID:RGD_737887 These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands 737888 LEW/NHsdCpb Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737888 These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands 737889 LEW/Ipcv inbred Unknown RRID:RGD_737889 These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands 737891 Crl:SD Charles River Laboratories, Wilmington, MA outbred Unknown RRID:RGD_737891 Sprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory. 737892 ACI/SegHsd Envigo Envigo inbred Unknown Carcinogenesis; Estrogen-induced pituitary growth; Transplant immunology RRID:RGD_737892 This substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc. 737893 F344/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737893 Substrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannover 737894 LEW/Orl Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737894 Substrain of Lewis rats, maintained in Orleans, France 737895 WKY/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737895 Substrain of WKY rats maintained by Dr. H.J. Hedrich, Hannover 737896 BN/Maas Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown RRID:RGD_737896 Substrain of BN rats, maintained by Dr. Alex Maas, The Netherlands 737897 ACI/Kun Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown RRID:RGD_737897 Substrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands 737898 WOKA/K Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany inbred Unknown RRID:RGD_737898 Substrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germany 737899 BN/Cub Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737899 Recombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands 737900 WF/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737900 Recombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germany 737901 LH/Ztu inbred Unknown RRID:RGD_737901 A substrain of LH 737902 BDIX/Orl Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737902 Substrain of BDIX, now maintained in Orleans, France 737903 Hsd:SD Sprague Dawley Envigo outbred Unknown RRID:RGD_737903 Originated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratories' colonies are direct descendants of this original colony. 737904 U/A The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737904 Substrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Institute 737905 LEW/Maas University of Limburg, Netherlands inbred Unknown RRID:RGD_737905 Strain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. 737906 MWF/Hsd Munich Wistar Fromter Harlan inbred Unknown (as of 2020-04-03) RRID:RGD_737906 Substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley 737907 SS.SR-Inha/Jr J.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USA congenic Unknown RRID:RGD_737907 A chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strain 737908 WF/NHsd Envigo Envigo inbred Cryopreserved Embryo (as of 2022-03-24) RRID:RGD_737908 Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley. 737909 R/A The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737909 Substrain of R, from Wistar stock in 1947, to The Netherlands Cancer Institute 737910 ARISTORAT/Wsl Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown RRID:RGD_737910 Substrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgium 737911 BUF/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737911 Substrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germany 737912 SS/JrIpcv Czech Academy of Sciences inbred Unknown RRID:RGD_737912 strain originated from Dr. John P. Rapp, Medical College of Ohio, USA 737913 E3/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737913 Substrain of E3, from Dr. H.J. Hedrich, Hannover, Germany 737914 SDL/Ipcv inbred Unknown RRID:RGD_737914 Substrain of SDL 737915 R/AWa Dept of Genetics, Agricultural University, Wageningen, The Netherlands inbred Unknown RRID:RGD_737915 Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 737916 DZB/Gro Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown RRID:RGD_737916 Substrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningen 737917 WF/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737917 Substrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmark 737918 BN/Orl Institut de Transgenose, Orleans, France inbred Unknown RRID:RGD_737918 Substrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, France 737919 LEW/Han Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737919 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany 737920 BH/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737920 Substrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973 737921 BDIV/lfz inbred Unknown RRID:RGD_737921 Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971) 737922 LEW/SsNHsd ENVIGO ENVIGO inbred Unknown RRID:RGD_737922 Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNHsd rats were descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland USA. Harlan became Envigo in 2015. 737923 SHR/Maas Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown RRID:RGD_737923 Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands 737924 WAG/Rij Harlan Sprague Dawley, Indianapolis, IN inbred Unknown RRID:RGD_737924 Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979 737925 BN/Gro Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown RRID:RGD_737925 Substrain of BN, from Billingham and Silvers 1958, to U of Groningen 737926 F344/NCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_737926 Derived from NIH stock in 1992 by SASCO. To Charles River in 1996. 737927 ALC/Colle inbred Unknown RRID:RGD_737927 Substrain of ALC 737928 BN/NHsdCpb Harlan CPB, Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737928 Substrain of BN, from Billingham and Silvers 1958 737929 Crl:WI Wistar rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_737929 To Scientific Products Farm, Ltd. [predecessor of Charles River United Kingdom (CRUK)] in 1947 from Wistar Institute. To Charles River in 1975 from CRUK. This particular colony was selected because of a low incidence of hydronephrosis. 737930 LEW/Ztm LEW/Ztm Tierlaboratorium der Medizinischen Hochschule Hannover, Germany inbred Unknown Ncf1 61307 RRID:RGD_737930 This inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, Germany 737931 GC/Kun inbred Unknown RRID:RGD_737931 737932 LEW/Crl Lewis Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_737932 Developed by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34. 737933 SD/A The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown RRID:RGD_737933 Sprague-Dawley stock initiated by R. Dawley in 1925 737934 BN/RijKun Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown RRID:RGD_737934 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic University 737935 LEW/Nhg Gesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, Germany inbred Unknown RRID:RGD_737935 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germany 737936 SR/JrIpcv Baylor College of Medicine, Houston, TX inbred Unknown RRID:RGD_737936 Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962) 737937 SDH/Ztu inbred Unknown RRID:RGD_737937 unknown 737938 AUG/OlaHsd Envigo Envigo inbred Cryorecovery RRID:RGD_737938 Substrain of AUG, derived from US August substrains in 1951 737939 BBWB/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737939 unknown 737940 PAR/Wsl Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown RRID:RGD_737940 unknown 737941 LEP/Cub Dr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown RRID:RGD_737941 Substrain of LEP, from Charles University cross of outbred animals 737942 LE/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737942 Substrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973 737943 R/AEurRij Dr. Adam Goedde, Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Unknown RRID:RGD_737943 Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 737944 BN/RijN Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Extinct (as of 2023-12-14) RRID:RGD_737944 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk 737945 BN/Han Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737945 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973. 737946 WAG/OlaHsd Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_737946 Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawley 737947 BDII/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737947 Substrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971) 737948 BDE/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737948 Substrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color. 737949 A2/Colle Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown RRID:RGD_737949 unknown 737950 DA/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737950 Substrain of DA/OlaHsd, to Hannover after 1965 737951 CAP/Kuv Dr. HU Wottge, Universitat Kiel, Kiel, Germany inbred Unknown RRID:RGD_737951 unknown 737952 ACI/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737952 unknown 737953 LEW/Gut inbred Unknown RRID:RGD_737953 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germany 737954 AS/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737954 unknown 737955 Hooded/Colle Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown RRID:RGD_737955 unknown 737956 WF/Gut inbred Unknown RRID:RGD_737956 substrain of Wistar Furth stock, from J Furth in 1945 737957 WOKW/K Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany National BioResource Project for the Rat in Japan inbred Unknown Diabetes Obesity; Metabolism RRID:RGD_737957 Substrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991 737958 CHOC/Cub Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown RRID:RGD_737958 unknown 737959 RNU/Mol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737959 unknown 737960 Hsd:WI Wistar Envigo outbred Unknown RRID:RGD_737960 These are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan. 737961 SR/JrMol Mollegaard Breeding Centre Ltd., Denmark inbred Unknown RRID:RGD_737961 Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaard 737962 SPRD/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737962 Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976 737963 LEW/Cub Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown RRID:RGD_737963 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Prague 737964 BN/OlaHsd Harlan inbred Unknown RRID:RGD_737964 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis 737965 AGUS/OlaHsd Harlan inbred Unknown RRID:RGD_737965 Substrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968 737966 LEW/Kuv Universitat Kiel, Kiel, Germany inbred Unknown RRID:RGD_737966 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germany 737967 BS/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_737967 Substrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988 737968 BN/Gut inbred Unknown RRID:RGD_737968 Substrain of BN, from Billingham and Silvers 1958 737969 NAR/SaU non-albumin rat Dept of Laboratory Animal Science, University of Utrecht, The Netherlands inbred Unknown RRID:RGD_737969 Substrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrecht 737970 AMORAT/Wsl Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, Belgium inbred Unknown RRID:RGD_737970 unknown 737971 SHRSP/Rivm National Institute of Public Health and Environmental Protection, The Netherlands inbred Unknown RRID:RGD_737971 unknown 737972 BN/Crl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_737972 Silvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976. 738038 HEP high ethanol preferring Institut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, France inbred Unknown RRID:RGD_738038 High ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USA 738120 LEW-Tg(HLA-B*2705m1,B2M)133-1TrgTg/Tg Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-20) RRID:RRRC_00043 This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating. 738122 SD-Tg(UBC-EGFP)1BalRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) RRID:RRRC_00052 This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals. 1298093 LEW/NHsd Envigo inbred Unknown RRID:RGD_1298093 Descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. Maintained at Harlan-Sprague Dawley (Indianapolis, Indiana) . 1299868 SS.SR-(D7Uia1-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 113014423 1 - by flanking markers 7 112367543 116100169 1 - by flanking markers 7 112429186 112429483 1 - by flanking markers 7 103146217 103146515 1 - by flanking markers RRID:RGD_1299868 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 1299869 SS.SR-(Cyp11b1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_1299869 Congenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strain 1299870 SS.LEW-(D5Uia8-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 121964356 134872385 1 - by flanking markers 5 124025017 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 5 128033842 128034027 1 - by flanking markers RRID:RGD_1299870 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1299871 DA.F344-(D20Arb2-D20Arb8)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_1299871 Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299872 DA.F344-(D8Arb15-D8Arb22)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 8 71843628 124310337 1 - by flanking markers 8 77653284 127239929 1 - by flanking markers 8 73320439 128033168 1 - by flanking markers 8 68133439 119085047 1 - by flanking markers RRID:RGD_1299872 Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299873 SS.LEW-(D5Mco34-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 134871897 134872385 1 - by flanking markers 5 137107818 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 5 128033842 128034027 1 - by flanking markers RRID:RGD_1299873 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1299874 OLETF.F344-(D1Rat166-D1Rat90)/Tj Laboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_1299874 Female OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol. 1299875 DA.F344-(D7Rat22-D7Mit2)/Nsi The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 7 76615341 123191874 1 - by flanking markers 7 125794079 125794357 1 - by flanking markers 7 126080176 126080454 1 - by flanking markers 7 116294265 116294546 1 - by flanking markers RRID:RRRC_00679 Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous state 1299876 SS.LEW-(D5Rat54-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 126386030 134872385 1 - by flanking markers 5 128816449 137108002 1 - by flanking markers 5 124957483 133313852 1 - by flanking markers 5 120182440 128034027 1 - by flanking markers RRID:RGD_1299876 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1299877 DA.F344-(D10Rat204-D10Arb22)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 10 95695076 95695218 1 - by flanking markers 10 94240348 107484761 1 - by flanking markers 10 107857524 107857673 1 - by flanking markers 10 104060133 104060283 1 - by flanking markers RRID:RGD_1299877 Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299878 DA.F344-(D4Arb30-D4Arb4)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 73972453 154937227 1 - by flanking markers 4 216606296 216606455 1 - by flanking markers 4 150682435 150682594 1 - by flanking markers 4 151805502 151805662 1 - by flanking markers RRID:RGD_1299878 The DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley 1299879 SS.SR-(D7Mco7-D7Wox19)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 113044000 113044249 1 - by flanking markers 7 116151764 116152012 1 - by flanking markers 7 116249395 116249643 1 - by flanking markers 7 106839225 106839474 1 - by flanking markers RRID:RGD_1299879 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 1299880 F344.DA-(D20Arb2-D20Arb8)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 20 2646395 2666654 1 - by flanking markers RRID:RGD_1299880 Region of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses. 1299881 SS.LEW-(D5Wox3-D5Rat108)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 99080786 134872385 1 - by flanking markers 5 101964092 137108002 1 - by flanking markers 5 97921932 133313852 1 - by flanking markers 5 94858972 128034027 1 - by flanking markers RRID:RGD_1299881 SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain 1300432 HAA/FDSC Hatano High Avoidance Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_1300432 In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation. 1300433 LAA/FDSC Hatano Low Avoidance Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior RRID:RGD_1300433 In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation. 1300439 SD-Tg(UBC-EGFP)2BalRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) RRID:RRRC_00065 This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21. 1302359 HsdFcen:SD Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred Unknown RRID:RGD_1302359 These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. 1302360 W/HsdFcen Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina inbred Unknown RRID:RGD_1302360 These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. 1302372 SDDIO/Rrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00044 This strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet. 1302373 SDDR/Rrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00045 This strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet. 1302377 SPRD-Anks6PKD/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-07) Anks6PKD 11534996 5 63633540 63674953 7 5 67163440 67204853 7 5 62642974 62684387 7 5 61309183 61350596 7 RRID:RRRC_00046 From outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 (Anks6) mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002. 1302416 ACI.DA-(D10Rat2-D10Rat19)/Arb Center for Genomics and Human Genetics, Manhasset, New York congenic Unknown RRID:RGD_1302416 A fragment from DA/OlaHsd rats is transferred to ACI/SegHsd. 1302597 LEXF7C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302597 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302598 FXLE26/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302598 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302599 WKY/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302599 This strain originated from Takeda Chemical Industries, Ltd., Japan 1302600 HTX/Kyo hydrocephalus texas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology RRID:RGD_1302600 1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992. 1302601 FXLE23/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302601 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302602 FXLE12/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302602 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302603 FXLE25/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302603 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302604 LEXF4/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302604 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302605 LEXF2A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer RRID:RGD_1302605 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302606 SHRSP/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302606 This strain originated from Takeda Chemical Industries, Ltd., Japan 1302607 FXLE21/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302607 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302608 CXH6/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302608 Strain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan 1302610 KMI/Tky miniature rat ishikawa National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis Prkg2 3401 RRID:RGD_1302610 Miniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College. 1302611 FXLE24/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302611 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302612 LEXF10C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302612 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302613 BN/fMaiHok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_1302613 Kyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21 1302614 WKY/NMna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302614 Inbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain. 1302615 FXLE14/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302615 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302616 LEXF10B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302616 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302617 LEXF6B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302617 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302618 LEXF9/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302618 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302619 FXLE16/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-16) Diabetes Obesity; Cancer RRID:RGD_1302619 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302620 SHR/Kyo spontaneous hypertension rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-12) Cardio Hypertension RRID:RGD_1302620 Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). 1302621 LEXF10A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302621 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302622 WF/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_1302622 Inbred originated from Kagoshima University, Japan. 1302623 TM/Kyo tester moriyama rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Hematology Rab38ru 1600311 RRID:RGD_1302623 Tester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 . 1302624 RICO/Ngs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Ophthalmology RRID:RGD_1302624 Strain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan. 1302625 F344.OLETF-(D16Wox4-D16Rat13)/Tj National BioResource Project for the Rat in Japan congenic Unknown 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 16 48143982 73187298 1 - by flanking markers RRID:RGD_1302625 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302626 BN.UPL-(D2Rat134-D2Rat2)/Cas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology 2 14747814 190963154 1 - by flanking markers 2 14095321 217785884 1 - by flanking markers 2 14237830 198298901 1 - by flanking markers 2 16491740 183719262 1 - by flanking markers RRID:RGD_1302626 Strain originated from Hiroshima University, Japan 1302627 F344/NSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302627 Strain originated from Japan SLC, Inc, Shizuoka, Japan. 1302628 ACIS/Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302628 Spontaneous mutation from ACI/Hok in 1981. 1302629 WKY.SHRSP-(D1Rat49-D1Rat112)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302629 The desired fragment is transferred from SHRSP to WKY. 1302630 F344.OLETF-(D10Wox7-D10Wox6)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 10 98952626 98952741 1 - by flanking markers RRID:RGD_1302630 Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. 1302631 BN/SsNSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Immunology RRID:RGD_1302631 Strain originated from Japan SLC, Inc, Shizuoka, Japan. 1302632 WKY.SHRSP-(D1Smu11-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302632 The desired fragment is transferred from SHRSP to WKY. 1302633 FXLE20/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302633 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302634 BB/WorTky BioBreeding rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Diabetes Obesity; Immunology RRID:RGD_1302634 Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983. 1302635 F344.OLETF-(D12Rat8-D12Rat16)/Tj National BioResource Project for the Rat in Japan congenic Unknown 12 23934730 31489223 1 - by flanking markers 12 27805580 36160041 1 - by flanking markers 12 25799119 34265075 1 - by flanking markers 12 22779459 30427275 1 - by flanking markers RRID:RGD_1302635 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302636 WKY.SHRSP-(D1Wox29-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_1302636 This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background 1302637 LAA Hatano Low Avoidance Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown RRID:RGD_1302637 Strain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan 1302638 LEXF11/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302638 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302639 KHR/Kyo kaken hairless rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Dermatology Oca2 2318412 1 115683593 115991040 7 1 114661970 114987433 7 1 107116278 107446093 7 RRID:RGD_1302639 Kaken hairless rat were detected by Kimura from Gunn 1302640 ACI/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302640 Strain originated from The University of Tokushima, Tokushima, Japan. 1302641 LEXF1A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302641 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302642 LEA/Hkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_1302642 Strain originated at the University of Tokushima, Japan. 1302643 ACI/NKyo august copenhagen irish National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Reproduction RRID:RGD_1302643 NIH (1988, F143) > Kyo (F43) 1302644 CXA5/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302644 Strain originated at the University of Tokushima, Japan. 1302645 DMY/Kyo demyelination rat The Laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991 via Institute Pasteur, Paris National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29) Neurobiology Mrs2dmyKyo 12793071 RRID:RGD_1302645 From a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996). 1302646 LEXF2C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302646 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302647 F344.OLETF-(D5Rat166-D5Rat90)/Tj Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan congenic Unknown 5 137718909 139664499 1 - by flanking markers 5 140063670 141938308 1 - by flanking markers 5 136271682 138128882 1 - by flanking markers 5 130881210 132691399 1 - by flanking markers RRID:RGD_1302647 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302648 LEC/Hok Long Evans Cinnamon National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown (as of 2016-12-01) Cancer; Immunology Atp7bhts 11532742 RRID:RGD_1302648 At the Center for Experimental Plants and Animals, Hokkaido University, LEC, along with LEA, was established from a closed colony of Long-Evans rats obtained from Kobe University in 1975. In 1984, within the LEC rats of their F24 generation, a rat exhibiting spontaneous hepatitis with severe jaundice was found (Yoshida, 1987). The LEC was available from Charles River Japan, Inc., Kanagawa, as of spring, 1991. 1302649 LEXF7B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302649 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302650 F344.OLETF-(D9Mgh8-D9Rat15)/Tj National BioResource Project for the Rat in Japan congenic Unknown 9 33374546 62634991 1 - by flanking markers 9 40808491 71887966 1 - by flanking markers 9 41139089 70686886 1 - by flanking markers 9 36840385 65383934 1 - by flanking markers RRID:RGD_1302650 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302651 CXA1/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302651 Strain originated from the The University of Tokushima, Japan. 1302652 LEXF7A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302652 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302653 LEXF8A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302653 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302654 F344.OLETF-(D7Mgh16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 103612739 123191874 1 - by flanking markers 7 106942155 125794357 1 - by flanking markers 7 106995385 126080454 1 - by flanking markers 7 98011396 116294546 1 - by flanking markers RRID:RGD_1302654 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred. 1302655 TO/Hkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302655 Strain originated from the Graduate School of Medicine, Hokkaido University, Japan. 1302656 LEA/Hok Long Evans Agouti National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown (as of 2016-12-01) RRID:RGD_1302656 Long Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour . It is used as the control strain of the LEC rat, which is reported to exhibit several mutant phenotypes such as hepatic disorder (hts), blockage of the T cell differentiation (thid) and X-ray hypersensitivity (xhs1 and xhs2). 1302657 DOP/Nem dilute-opisthotonus (dop) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Myo5a 3143 RRID:RGD_1302657 Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established. 1302658 LEJ/Hkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302658 Strain originated at the Graduate School of Medicine, Hokkaido University, Japan. 1302659 CXH5/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302659 Strain originated at the University of Tokushima, Japan. 1302660 RCS/Kyo royal college of surgeons rat Department of Ophthalmology & Visual Sciences, Kyoto University National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29) Ophthalmology Mertkrdy 40902839 RRID:RGD_1302660 From Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998. 1302661 F344.OLETF-(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 14 1217606 39153750 1 - by flanking markers RRID:RGD_1302661 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred. 1302662 CXH2/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302662 Strain originated at the University of Tokushima, Japan. 1302663 F344.OLETF-(D11Rat4-D11Rat1)/Tj National BioResource Project for the Rat in Japan congenic Unknown 11 64573222 84443333 1 - by flanking markers 11 66731054 89693367 1 - by flanking markers 11 65352097 86593596 1 - by flanking markers 11 62790342 82450994 1 - by flanking markers RRID:RGD_1302663 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302664 WNA/Nshm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302664 Nagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research 1302665 FXLE13/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302665 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302666 LEXF1C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302666 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302667 F344.OLETF-(D5Mgh5-D5Mgh23)/Tj National BioResource Project for the Rat in Japan congenic Unknown 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 5 43726656 109897936 1 - by flanking markers RRID:RGD_1302667 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302668 IS-Tlk/Kyo tail anomaly lethal kyoto National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Osteosis RRID:RGD_1302668 Spontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto) 1302669 HAA Hatano High Avoidance Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown RRID:RGD_1302669 Strain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan. 1302670 ACI/NSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302670 Strain is from Japan SLC, Inc., Shizuoka, Japan. 1302671 WM/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302671 Strain is from the University of Tokushima, Japan. 1302672 W/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302672 Hok>Hkm>Kyo 1302673 FXLE15/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302673 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302674 VF/Kyo vacuole formation rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-10) Neurobiology RRID:RGD_1302674 The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS). A nonsense mutation in the dopey family member 1 (Dopey1)(Dop1a, RGD:1305534) was identified as the likely causative gene for the neurological disease phenotype of the VF rat. 1302675 WKY.SHRSP-(D1Smu13-D1Smu11)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302675 The desired fragment is transferred from SHRSP to WKY. 1302676 NER/Slc noda epileptic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Neurobiology RRID:RGD_1302676 Strain is from Japan SLC, Inc. Shizuoka, Japan. 1302677 NIG-III/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_1302677 Strain is from the University of Tokushima, Japan. 1302678 NAR/Slc non albumin rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals (as of 2024-09-24) Hematology RRID:RGD_1302678 Strain originated from Japan SLC, Inc, Shizuoka, Japan. 1302679 TRMR/Kyo tremor resistant National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Unknown Aspa 621693 RRID:RGD_1302679 Tremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. This strain is a substrain of TRM/Kyo and does not show tremor behavior. This strain carrying wild type Hcn1, is considered as segregating inbred strain of TRM. 1302680 SHR/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302680 Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan. 1302681 WKY.SHRSP-(D1Smu11-D1Rat112)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302681 The desired fragment is transferred from SHRSP to WKY. 1302682 FXLE18/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302682 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302683 FXLE22/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer RRID:RGD_1302683 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302684 F344/NHok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1302684 Dwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals 1302685 F344.OLETF-(D14Rat8-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 14 30320092 65026991 1 - by flanking markers RRID:RGD_1302685 Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment. 1302686 F344/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302686 Derived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating. 1302687 WKAH/HkmSlc Wistar King A, Hokkaido National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302687 Strain originated from Japan SLC, Inc., Shizuoka, Japan. 1302688 ACI/NMna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302688 This strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan. 1302689 WKY.SHRSP-(Ntrk3-D1Smu13)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302689 The desired fragment is transferred from SHRSP to WKY. 1302690 FXLE19/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302690 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302691 ALB/Hok Albany National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Dentistry RRID:RGD_1302691 Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1302692 WKY.SHRSP-(D1Wox18-D1Rat44)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302692 The desired fragment is transferred from SHRSP to WKY. 1302693 KZ-LeprfaTky National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Metabolism Lepr 3001 RRID:RGD_1302693 A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980. 1302694 WKA/Seac National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology RRID:RGD_1302694 Wistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979 1302695 SER/Kyo spontaneously epileptic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrn|Aspa 69063|621693 RRID:RGD_1302695 Spontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac 1302696 FH/HamSlc fawn hooded rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302696 Strain originated at Japan SLC, Inc., Shizuoka , Japan. 1302697 KND/Tky komeda non-diabetic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity RRID:RGD_1302697 Komeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls. 1302698 SDR/Slc Spontaneous dwarf rat Japan SLC, Inc National BioResource Project for the Rat in Japan, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-05-04) Metabolism Gh1sdr 12880380 RRID:RRRC_00066 The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype. This spontaneous mutation affected the 3' splice/acceptor site. Judging from this point mutation, one would predict an abnormal splicing and a 1-base deletion in the GH mRNA. Strain is from Japan SLC, Inc., Shizuoka, Japan. 1302699 LEXF8D/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302699 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302700 HOB/Snk hobble rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology Unc5c|Unc5chob 735109|12802353 RRID:RGD_1302700 HOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13. 1302701 LEW/SsNSlc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2020-08-26) Immunology RRID:RGD_1302701 Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNSlc rats were descended from a colony obtained from the National Institutes of Health, Bethesda, Maryland USA in 1994 to Japan SLC, Inc.,Shizuoka, Japan. 1302702 TRM/Kyo tremor rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) Neurobiology Aspa|Hcn1A354V 621693|13464319 RRID:RGD_1302702 In 1980, a spontaneous tremor mutant rat was found in the colony of Kyo:Wistar (Yamada, 1985). This disorder was found to be caused by an autosomal recessive gene and was designated tremor (tm). Deletion of Aspa gene was identified in the animal with no aspartoacylase activity in the brain and measurable level of activity in the kidney. TRM was established as a segregating inbred strain. In F18 progeny, a rat which did not have tm mutation was separated and established as a control strain of WTC (NBRP No.0020). (Dec 8, 2010) 1302703 WKY.SHRSP-(D1Wox29-D1Rat112)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302703 The desired fragment is transferred from SHRSP to WKY. 1302704 WKY.SHRSP-(D1Wox29-D1Rat199)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302704 The desired fragment is transferred from SHRSP to WKY. 1302705 WKY.SHRSP-(D1Wox29-D1Smu13)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302705 The desired fragment is transferred from SHRSP to WKY. 1302706 F344.OLETF-(D5Rat32-D5Rat26)/Tj National BioResource Project for the Rat in Japan congenic Unknown 5 119332868 139659574 1 - by flanking markers 5 121495621 141933383 1 - by flanking markers 5 117554114 138123957 1 - by flanking markers 5 113558156 132686472 1 - by flanking markers RRID:RGD_1302706 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302707 LEXF3/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302707 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302708 FXLE17/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer RRID:RGD_1302708 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 1302709 WKY/Hcm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_1302709 Strain is from the Hyogo College of Medicine, Japan. 1302710 LEXF2B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302710 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302711 ExHC/Seac National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1302711 Isolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993 1302712 ZIMY/Kyo Zitter Masao Yamada National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-17) Neurobiology Atrn 69063 RRID:RGD_1302712 ZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada). This strain is homozygous for zi and wild-type for tm. ZIMY (Zitter Masao Yamada) 1302713 F344.OLETF-(D8Rat58-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown 8 19796514 48675424 1 - by flanking markers 8 21850030 48631820 1 - by flanking markers 8 50007641 50007776 1 - by flanking markers 8 46008836 46008974 1 - by flanking markers RRID:RGD_1302713 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 1302714 KZC/Tky Komeda Zucker Creeping rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Reln 3553 RRID:RGD_1302714 Komeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983. 1302715 WKY.SHRSP-(D1Wox18-D1Wox29)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302715 The desired fragment is transferred from SHRSP to WKY. 1302716 OM/NSlc Osborne-Mendel rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals RRID:RGD_1302716 The Instutite of Medical Science, The University of Tokyo to Slc (1985) 1302717 ACI/NHok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension RRID:RGD_1302717 NIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135 1302718 HWY/Slc hairless wistar yagi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Dermatology RRID:RGD_1302718 Strain is from Japan SLC, Inc., Shizuoka, Japan. 1302719 DON/Kyo Donryu rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1302719 Japanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2 1302720 CXH10/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology RRID:RGD_1302720 Strain is from the University of Tokushima, Japan. 1302721 LEC/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) Cancer Atp7bhts 11532742 RRID:RGD_1302721 Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989 1302722 PVG/Seac Piebald Virol Glaxo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology RRID:RGD_1302722 Strain is from Seac Yoshitomi, LTD., Fukuoka, Japan. 1302723 LEXF5/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer RRID:RGD_1302723 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 1302724 SHR/Hcm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302724 Strain is from the Hyogo College of Medicine, Japan. 1302726 ZI/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology Atrnzi 40902832 RRID:RGD_1302726 Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. 1302727 SHRSR/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio Hypertension RRID:RGD_1302727 Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan. 1302728 MES/Slc Matsumoto Eosinophilia Shinshu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Hematology CybamesSdi 13209000 RRID:RGD_1302728 Derived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999) 1302729 LEA/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer RRID:RGD_1302729 Found in Long Evans strain at Kobe University; Inbreeding at Hokkaido University; Otsuka Pharmaceutical Co.; The University of Tokushima 1989 1302795 HTG Prague hypertriglyceridemic Institute of Physiology, Academy of Sciences Prague, Czech Republic inbred Unknown RRID:RGD_1302795 These were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding. 1302921 F344-Tg(NPHS2-HBEGF)Wig Division of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, Michigan transgenic Unknown RRID:RGD_1302921 hDTR (HBEGF) cDNA was inserted at the 3' of the 2.5 kb human podocin (NPHS2) promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs. 1303393 LEC/Ncu Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown RRID:RGD_1303393 These rats were established from a closed colony of Long-Evans. 1304487 BBDR/Wor inbred Unknown RRID:RGD_1304487 Diabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies. 1331811 LEW.BN-(D10Rat32-D10Rat133)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 10 51779662 51779830 1 - by flanking markers RRID:RGD_1331811 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331812 LEW.BN-(D10Rat83-D10Rat133)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46860047 65668639 1 - by flanking markers 10 46728252 64823355 1 - by flanking markers 10 46955258 46955430 1 - by flanking markers 10 45393829 45394002 1 - by flanking markers RRID:RGD_1331812 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331813 BN.GK-(D8Rat29-D8Got130)/Ox Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 74769551 87069779 1 - by flanking markers 8 76345502 89012772 1 - by flanking markers 8 89482236 89482480 1 - by flanking markers 8 82872062 82872307 1 - by flanking markers RRID:RGD_1331813 This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 1331814 BN.GK-(D8Got302-D8Got130)/Ox Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 48185711 87069779 1 - by flanking markers 8 48160321 89012772 1 - by flanking markers 8 49533872 89482480 1 - by flanking markers 8 45539309 82872307 1 - by flanking markers RRID:RGD_1331814 This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 1331815 LEW/Mol LEW/Mol Mollegaard Breeding Center Ltd., Denmark inbred Unknown Ncf1 61307 RRID:RGD_1331815 This substrain can be traced originally to Scripps Clinic, La Jolla, to University of Pennsylvania to Simonsen Laboratories in 1966, to Institute of Pathological Anatomy, University of Copenhagen, Denmark 1973. From University of Copenhagen to M&B A/S (Mollegaard Breeding Center Ltd., Denmark ) from 1977 to 2002. (now Taconic Europe) 1331816 DA.ACI-(D10Rat2-D10Rat29)/Kini Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology; Immunology 10 68842878 68843272 1 - by flanking markers 10 67642121 110568670 1 - by flanking markers 10 67988035 110992275 1 - by flanking markers 10 107057622 107057807 1 - by flanking markers RRID:RGD_1331816 (DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA. 1331817 BN.LEW-(D10Rat32-D10Mgh4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 96799937 1 - by flanking markers 10 53381898 95372987 1 - by flanking markers 10 53630865 95638337 1 - by flanking markers 10 51779662 92369470 1 - by flanking markers RRID:RGD_1331817 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331818 LEW.BN-(D10Rat43-D10Mco4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 42042465 1 - by flanking markers 10 22266756 41793199 1 - by flanking markers 10 22402817 41976505 1 - by flanking markers 10 22918268 40741723 1 - by flanking markers RRID:RGD_1331818 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331819 F344/Eer F344/Eer Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown RRID:RGD_1331819 Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana 1331820 LEW.BN-(D10Got9-D10Rat2)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 5641331 5641541 1 - by flanking markers 10 4578252 110568670 1 - by flanking markers 10 5760565 110992275 1 - by flanking markers 10 5684047 107057807 1 - by flanking markers RRID:RGD_1331820 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331821 LEW.BN-(D10Wox26-D10Arb4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 30343658 46737218 1 - by flanking markers 10 30131785 46592053 1 - by flanking markers 10 30303447 46835685 1 - by flanking markers 10 29659462 45274336 1 - by flanking markers RRID:RGD_1331821 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331822 DA.ACI-(D10Rat2-D10Rat6) Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 106310811 106310957 1 - by flanking markers 10 104746165 110568670 1 - by flanking markers 10 105077900 110992275 1 - by flanking markers 10 101435864 107057807 1 - by flanking markers RRID:RGD_1331822 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331823 LEW.BN-(D10Rat43-D10Rat27)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 77092169 1 - by flanking markers 10 22266756 74127968 1 - by flanking markers 10 22402817 75983805 1 - by flanking markers 10 22918268 73453136 1 - by flanking markers RRID:RGD_1331823 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331824 DA.ACI-(D10Rat219-D10Rat29) Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 68842878 81986757 1 - by flanking markers 10 67642121 80884595 1 - by flanking markers 10 67988035 81042642 1 - by flanking markers 10 78306880 78307017 1 - by flanking markers RRID:RGD_1331824 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331826 LEW.BN-(D10Mgh7-D10Rat27)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 77092169 1 - by flanking markers 10 55720558 74127968 1 - by flanking markers 10 55978483 75983805 1 - by flanking markers 10 54098674 73453136 1 - by flanking markers RRID:RGD_1331826 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331827 DA.ACI-(D10Rat10-D10Rat142) Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 92448353 100301488 1 - by flanking markers 10 91113514 98868127 1 - by flanking markers 10 91345679 99171690 1 - by flanking markers 10 88207600 95803900 1 - by flanking markers RRID:RGD_1331827 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331828 DA.ACI-(D10Rat12-D10Rat144) Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 86290650 99198997 1 - by flanking markers 10 85276455 97759008 1 - by flanking markers 10 85487741 98044833 1 - by flanking markers 10 82538790 94725019 1 - by flanking markers RRID:RGD_1331828 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331829 BN.LEW-(D9Got8-D9Got200)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 9 3811425 3811711 1 - by flanking markers 9 2597055 9698468 1 - by flanking markers 9 2657610 10706733 1 - by flanking markers 9 1185844 4302019 1 - by flanking markers RRID:RGD_1331829 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331830 F344.BN-(D5Rat1-D5Mit5)/Dlw Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 5 35911094 109163425 1 - by flanking markers 5 39876314 112058005 1 - by flanking markers 5 35225432 108092802 1 - by flanking markers 5 34730116 104251008 1 - by flanking markers RRID:RGD_1331830 This congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USA 1331831 LEW.BN-(D10Rat173-D10Rat133)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 37505289 65668639 1 - by flanking markers 10 37209026 64823355 1 - by flanking markers 10 37435916 37436126 1 - by flanking markers 10 36244402 36244613 1 - by flanking markers RRID:RGD_1331831 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. 1331832 BN.LEW-(D10Rat72-D10Arb4)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 46737218 1 - by flanking markers 10 46591952 46592053 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 10 45274234 45274336 1 - by flanking markers RRID:RGD_1331832 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331833 DA.ACI-(D10Rat15-D10Rat29) Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 68842878 96667338 1 - by flanking markers 10 67642121 95243104 1 - by flanking markers 10 67988035 95508221 1 - by flanking markers 10 92238327 92238497 1 - by flanking markers RRID:RGD_1331833 DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. 1331834 BN.LEW-(D10Rat100-D10Rat126)/Rj Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 26434477 26434620 1 - by flanking markers 10 26363403 42526523 1 - by flanking markers 10 26517020 42716241 1 - by flanking markers 10 25790546 41482228 1 - by flanking markers RRID:RGD_1331834 This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. 1331836 WKY/Eer WKY/Eer Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown RRID:RGD_1331836 Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana 1354669 BN/OrlIcoCrlf Charles River France Charles River France inbred Unknown RRID:RGD_1354669 Strain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991. 1354670 F344/IcoCrlf Charles River France Charles River France inbred Unknown RRID:RGD_1354670 These are inbred rats that were bought from Charles River, Les Oncins near Lyon, France. 1357172 WF.BBDR-(D4Arb29-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 121645621 1 - by flanking markers 4 63250011 183837621 1 - by flanking markers 4 63537179 63537431 1 - by flanking markers 4 64528739 64528994 1 - by flanking markers RRID:RGD_1357172 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357173 SS.MNS-(Vamp2-D10M11Mit84)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 55852132 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 10 53793581 53797815 1 - by flanking markers RRID:RGD_1357173 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 1357174 BBDR.BBDP-(D4Mit6-D4Mit24)/Rhw Department of Medicine University of Washington, Seattle, Washington congenic Unknown 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 4 76647384 78882945 1 - by flanking markers RRID:RGD_1357174 S. Bieg and coworkers (1998) generated this congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ñ 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. Lacks one C nucleotide at 478 position which causes a frameshift mutation in the ORF of exon 3 forming a significantly truncated protein. 1357175 F344.DR-(D4Mit6-D4Mit24)-Tg(Gimap5)Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin transgenic Unknown RRID:RGD_1357175 Wild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(D4Mit6-D4Mit24) 1357176 WF.BBDR-(D4Arb29-D4Rat96)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 65434807 1 - by flanking markers 4 63250011 65397196 1 - by flanking markers 4 63537179 65577249 1 - by flanking markers 4 64528739 66609456 1 - by flanking markers RRID:RGD_1357176 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357177 F344.DR(DP)-(D4Mit6-D4Mit24)/Rhw Department of Medicine University of Washington, Seattle, Washington Rat Resource & Research Center congenic Cryopreserved Embryo 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 4 76647384 78882945 1 - by flanking markers RRID:RRRC_00082 The lymphopenia locus from BBDR.BBDP-(D4Mit6-D4Mit24) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding. 1357178 CD Cohen diabetic rat Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_1357178 Originally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism. 1357179 SS.WKY-(D2N35-Mme),MNS-(D10Mit11-D10M11Mit119)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_1357179 SS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F1 were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister mating 1357180 SS.LEW-(D8Chm14-D8Rat16)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Grik4 2734 8 45510258 98878889 1 - by flanking markers 8 45279673 100781055 1 - by flanking markers 8 46804134 101305168 1 - by flanking markers 8 42903043 94388843 1 - by flanking markers RRID:RGD_1357180 Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada 1357181 CDR/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, Israel inbred Unknown RRID:RGD_1357181 Cohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. 1357182 Eker-Tg(Tsc2)28Hin Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 RRID:RGD_1357182 Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. 1357183 SS.MNS-(D10Mco10-Aldoc)/Jr Medical College of Ohio, Toledo congenic Unknown Nos2 3185 10 6849272 65072453 1 - by flanking markers 10 5706467 65456957 1 - by flanking markers 10 6908932 66221621 1 - by flanking markers 10 6813971 63851208 1 - by flanking markers RRID:RGD_1357183 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 1357184 Crl:ZUC-Leprfa Zucker rats Charles River Laboratories Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_1357184 The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company. 1357185 RHA.Gunn-Ugt1a1j/N Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USA congenic Unknown RRID:RGD_1357185 RHA/N rats were crossed with Gunn rats. F1 hybrids were intercrossed for 12 cycles while selecting for jaundice loci. 1357186 Gunn-Ugt1a1j/BluHsd Gunn rat Harlan mutant Unknown Ugt1a1j 13432064 9 87091241 87098362 7 9 94982916 94990037 7 9 95300017 95300017 8 9 88805660 88805660 8 RRID:RGD_1357186 This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. 1357187 WF.BBDR-(D4Rat16-D4Got39)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 56704967 1 - by flanking markers 4 56868238 56868336 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 4 58432133 58432232 1 - by flanking markers RRID:RGD_1357187 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357189 SS.LEW-(D8Rat56-D8Rat51)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 8 8294860 29559867 1 - by flanking markers 8 9505886 30947391 1 - by flanking markers 8 9531047 30918267 1 - by flanking markers 8 8462195 28243068 1 - by flanking markers RRID:RGD_1357189 Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada 1357190 SS.MNS-(Adh1-D2Mit5)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Adh1c 2044 2 235799396 235811584 1 - by flanking markers 2 262090818 262102977 1 - by flanking markers 2 243550655 243562243 1 - by flanking markers 2 226797303 226808892 1 - by flanking markers RRID:RGD_1357190 This congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr background 1357191 CDS/Ygl Cohen diabetic-sensitive rat Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown RRID:RGD_1357191 Cohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. 1357192 WF.BBDR-(D4Got39-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 121645621 1 - by flanking markers 4 56868238 183837621 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 4 58432133 58432232 1 - by flanking markers RRID:RGD_1357192 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357193 WF.BBDR-(D4Got51-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 70123187 121645621 1 - by flanking markers 4 136548956 183837621 1 - by flanking markers 4 71744558 71744763 1 - by flanking markers 4 71241724 71241930 1 - by flanking markers RRID:RGD_1357193 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357194 WF.BBDR-(D4Rat96-D4Rat44)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65434709 121645621 1 - by flanking markers 4 65397099 183837621 1 - by flanking markers 4 65577152 65577249 1 - by flanking markers 4 66609358 66609456 1 - by flanking markers RRID:RGD_1357194 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357195 SS.MNS-(Aldoc-D10Mco1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Nos2 3185 10 67677924 67678060 1 - by flanking markers 10 63366082 63366218 1 - by flanking markers 10 64648175 64648311 1 - by flanking markers 10 61345276 61345413 1 - by flanking markers RRID:RGD_1357195 This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. 1357196 WF.BBDR-(D4Arb29-D4Rat265)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 82266081 1 - by flanking markers 4 63250011 148715224 1 - by flanking markers 4 63537179 84053053 1 - by flanking markers 4 64528739 83007655 1 - by flanking markers RRID:RGD_1357196 This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. 1357345 DA/K Dark Agouti/Karlsburg Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown RRID:RGD_1357345 Dark agouti rats which were bred and housed in Dept. of Laboratory Animal Science, Karlsburg, Germany 1357346 BB.SHR-(D4Mit6-Spr)/K Department of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, Germany congenic Unknown Npy|Spr 3197|3753 4 75732943 119369308 1 - by flanking markers 4 141978848 181496612 1 - by flanking markers 4 77307388 116916073 1 - by flanking markers 4 76647384 117676292 1 - by flanking markers RRID:RGD_1357346 BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected. 1357417 SD-Tg(Npy)400Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1357417 14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene. 1357953 WAG/RijHfr Envigo (Harlan France) inbred Unknown RRID:RGD_1357953 Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Envigo (Harlan France) 1357954 F344/NHfr Harlan France inbred Unknown RRID:RGD_1357954 Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France. 1357955 WF/NHfr Wistar-Furth Harlan France inbred Unknown RRID:RGD_1357955 Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France. 1357957 LEW/HanHfr ENVIGO France ENVIGO France inbred Unknown The LEW/HanHsd is very susceptible to the induction of EAE, while the LEW/SsNHsd is not susceptible to the induction of EAE RRID:RGD_1357957 Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. To Central Institute for Laboratory Animal Breeding, Hannover, in 1973 at F58. In 1994, to Harlan Netherlands through acquisition of Central Institute for Laboratory Animal Breeding. Harlan became Envigo in 2015 1357958 BN/RijHfr Harlan France inbred Unknown RRID:RGD_1357958 Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France. 1357959 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin congenic Live Animals Ctsc|Grm5|Nox4|Rab38|Tyr 2445|2746|620600|628752|1589755 1 157084760 158516775 1 - by flanking markers 1 150775310 152202960 1 - by flanking markers 1 140879679 142314355 1 - by flanking markers RRID:RGD_1357959 The Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH. 1357960 LE/CpbHfr Envigo (Harlan France) inbred Unknown RRID:RGD_1357960 Substrain of LE which was bred at Harlan CPB now at Harlan France. 1357974 BB.SHR-(D4Got41-Gimap5)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown Gimap5 628871 4 60262965 76843214 1 - by flanking markers 4 60179409 143073003 1 - by flanking markers 4 60439127 78386683 1 - by flanking markers 4 61697658 77701025 1 - by flanking markers RRID:RGD_1357974 Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. 1357975 SS.LEW-(D1Mco4-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 29841428 43747532 1 - by flanking markers 1 33073397 50297622 1 - by flanking markers 1 31647701 49454378 1 - by flanking markers 1 29038037 49268520 1 - by flanking markers RRID:RGD_1357975 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357976 BB.SHR-(D4Got41-D4Rat171)/K Department of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 4 60262965 87996003 1 - by flanking markers 4 60179409 154162556 1 - by flanking markers 4 60439127 89342035 1 - by flanking markers 4 61697658 88217207 1 - by flanking markers RRID:RGD_1357976 Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. 1357977 SS.LEW-(D1Mco8-D1Rat213)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 32329137 81548909 1 - by flanking markers 1;9 84537073;7947583 84537228;7947744 1 - by flanking markers;1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 1 81777564 81777720 1 - by flanking markers RRID:RGD_1357977 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357978 SS.MNS-(D2Mit6-D2Rat303)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 131522430 1 - by flanking markers 2 98037122 155130826 1 - by flanking markers 2 78321410 135646395 1 - by flanking markers 2 76539322 127460910 1 - by flanking markers RRID:RGD_1357978 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain 1357979 SS.MNS-(Mme-D2Rat131)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Mme 3098 2 153031724 179302663 1 - by flanking markers 2 173193501 206015340 1 - by flanking markers 2 153799203 186612024 1 - by flanking markers 2 147686913 172711135 1 - by flanking markers RRID:RGD_1357979 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain 1357980 BB.SHR-(D4Got41-Tacr1)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Metabolism Tacr1 3811 4 60262965 116780394 1 - by flanking markers 4 60179409 178095041 1 - by flanking markers 4 60439127 113416139 1 - by flanking markers 4 61697658 115089733 1 - by flanking markers RRID:RGD_1357980 Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997. 1357981 SS.LEW-(D3Mco21-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 68499987 121619110 1 - by flanking markers 3 79183926 133513825 1 - by flanking markers 3 72672290 127023997 1 - by flanking markers 3 70348525 121056321 1 - by flanking markers RRID:RGD_1357981 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 1357982 SS.LEW-(D3Rat52-D3Chm63)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 51161895 1 - by flanking markers 3 19410399 61857467 1 - by flanking markers 3 14090411 55245509 1 - by flanking markers 3 18311454 53781346 1 - by flanking markers RRID:RGD_1357982 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 1357983 SS.LEW-(D1Mco75-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 43747374;2897342 43747532;2897591 1 - by flanking markers;1 - by flanking markers 1 36805624 50297622 1 - by flanking markers 1 35406399 49454378 1 - by flanking markers 1 32765502 49268520 1 - by flanking markers RRID:RGD_1357983 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357984 SS.MNS-(D2Mit6-D2Rat166)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 145701148 1 - by flanking markers 2 98037122 165313939 1 - by flanking markers 2 78321410 145903673 1 - by flanking markers 2 76539322 140636154 1 - by flanking markers RRID:RGD_1357984 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain 1357985 LOU/Ins INSERM, C.H.U. Bichat-Claude Bernard, Paris, France inbred Unknown RRID:RGD_1357985 originated from Universite Catholique de Louvain. 1357986 SS.LEW-(D1Uia8-D1Rat211)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 1147796 1148037 1 - by flanking markers 1 35077728 35077968 1 - by flanking markers 1 33667777 33668017 1 - by flanking markers 1 31050840 31051081 1 - by flanking markers RRID:RGD_1357986 This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F1 followed by F1 X F1 intercross to get F2 which was screened for the desired recombinants. 1357987 SS.LEW-(D1Uia8-D1Rat18)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 43747374 43747532 1 - by flanking markers 1 50297465 50297622 1 - by flanking markers 1 49454221 49454378 1 - by flanking markers 1 49268362 49268520 1 - by flanking markers RRID:RGD_1357987 A 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. 1357988 SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 121619110 1 - by flanking markers 3 19410399 133513825 1 - by flanking markers 3 14090411 127023997 1 - by flanking markers 3 18311454 121056321 1 - by flanking markers RRID:RGD_1357988 A segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 1357994 SHR/NCrl Charles River Laboratories Charles River Laboratories inbred Live Animals (as of 2020-01-23) RRID:RGD_1357994 To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneous hypertension. 1358112 WKY/NCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_1358112 Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11 1358114 SS-Chr 5BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_1358114 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 1358150 SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 350232 1 - by flanking markers 16 751266 1084414 1 - by flanking markers 16 756352 1090164 1 - by flanking markers 16 88524 380356 1 - by flanking markers RRID:RGD_1358150 This congenic strain originated from a SS/Jr parental strain. 1358151 FHH-Chr 8BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358151 A FHH genomic background with a BN chromosome 8 introgressed. 1358152 SS-Chr 14BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358152 A SS genomic background with a BN chromosome 14 introgressed. 1358153 COP/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_1358153 Inbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998. 1358154 SS-Chr 3BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Sperm RRID:RGD_1358154 A SS genomic background with a BN chromosome 3 introgressed. 1358155 SS.LEW-(D10Rat119-D10Mgh1)(D16Rat21-D16Rat112)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown RRID:RGD_1358155 This double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (D10Rat119-D10Mgh1)and (D16Rat21-D16Rat112) from the LEW strain 1358156 SS.MNS-(D2Rat183-D2Chm113)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 144136724 145774334 1 - by flanking markers 2 163731761 165386311 1 - by flanking markers 2 144313532 145975996 1 - by flanking markers 2 139096736 140708949 1 - by flanking markers RRID:RGD_1358156 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358157 FHH-Chr 7BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358157 A FHH genomic background with a BN chromosome 7 introgressed. 1358158 FHH-Chr 16BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358158 A FHH genomic background with a BN chromosome 16 introgressed. 1358159 FHH-Chr 6BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358159 A FHH genomic background with a BN chromosome 6 introgressed. 1358160 SS.BN-(D8Rat163-D8Rat81)/Mcwi PhysGen congenic Unknown 8 31508524 124926877 1 - by flanking markers 8 32911182 127854519 1 - by flanking markers 8 32888352 128653291 1 - by flanking markers 8 30188867 119698120 1 - by flanking markers RRID:RGD_1358160 A SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81. 1358161 SS.LEW-(D16Rat38-D16Chm66)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 3080748 8612621 1 - by flanking markers 16 3405986 11276947 1 - by flanking markers 16 3439525 9316554 1 - by flanking markers 16 2995225 8336378 1 - by flanking markers RRID:RGD_1358161 This congenic strain originated from a SS/Jr parental strain. 1358162 SS-Chr 12BN/Mcwi PhysGen consomic Live Animals RRID:RGD_1358162 A SS genomic background with a BN chromosome 12 introgressed. 1358163 SS-Chr 15BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1358163 A SS genomic background with a BN chromosome 15 introgressed. 1358164 FHH-Chr 17BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358164 A FHH genomic background with a BN chromosome 17 introgressed. 1358165 SS.MNS-(D2Chm51-D2Rat341)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 151616735 155664303 1 - by flanking markers 2 171854997 177018102 1 - by flanking markers 2 152460836 157650873 1 - by flanking markers 2 146368688 150090572 1 - by flanking markers RRID:RGD_1358165 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain. 1358166 SS.LEW-(D16Mit3-D16Rat112)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 47434384 1 - by flanking markers 16 773329 47069744 1 - by flanking markers 16 778415 47346612 1 - by flanking markers 16 110590 44236047 1 - by flanking markers RRID:RGD_1358166 This congenic strain originated from a SS/Jr parental strain. 1358167 SS.MNS-(D2Wox27-Adh1)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Adh1c 2044 2 202186267 235811584 1 - by flanking markers 2 228956554 262102977 1 - by flanking markers 2 209489455 243562243 1 - by flanking markers 2 194352314 226808892 1 - by flanking markers RRID:RGD_1358167 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358168 SS.LEW-(D16Mit2-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 4304517 1 - by flanking markers 16 751266 5038806 1 - by flanking markers 16 756352 5098704 1 - by flanking markers 16 88524 4227730 1 - by flanking markers RRID:RGD_1358168 This congenic strain originated from a SS/Jr parental strain. 1358169 SS.MNS-(D2Chm25-D2Rat131)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 179302663 1 - by flanking markers 2 199188066 206015340 1 - by flanking markers 2 179779225 186612024 1 - by flanking markers 2 166144095 172711135 1 - by flanking markers RRID:RGD_1358169 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Chm90-D2Wox37)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358170 FHH-Chr 5BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358170 A FHH genomic background with a BN chromosome 5 introgressed. 1358171 SS-Chr 17BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358171 A SS genomic background with a BN chromosome 17 introgressed. 1358172 SS.MNS-(D2Chm25-Fgg)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Fgg 2613 2 172459883 174734594 1 - by flanking markers 2 199188066 201409143 1 - by flanking markers 2 179779225 181994523 1 - by flanking markers 2 166144095 168362325 1 - by flanking markers RRID:RGD_1358172 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358173 FHH-Chr 11BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358173 A FHH genomic background with a BN chromosome 11 introgressed. 1358174 SS-Chr 19BN/Mcwi PhysGen Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) RRID:RRRC_00601 A SS genomic background with a BN chromosome 19 introgressed. 1358175 FHH-Chr 20BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358175 A FHH genomic background with a BN chromosome 20 introgressed. 1358176 FHH-Chr 18BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358176 A FHH genomic background with a BN chromosome 18 introgressed. 1358177 SS.MNS-(D2Chm25-D2Mit14)/Ayd Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 197256313 1 - by flanking markers 2 199188066 224018437 1 - by flanking markers 2 179779225 204585731 1 - by flanking markers 2 166144095 189599348 1 - by flanking markers RRID:RGD_1358177 Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. 1358178 SS-Chr 10BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358178 A SS genomic background with a BN chromosome 10 introgressed. 1358179 FHH-Chr 13BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1358179 A FHH genomic background with a BN chromosome 13 introgressed. 1358180 FHH-Chr 19BN/Mcwi PhysGen Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) RRID:RRRC_00581 A FHH genomic background with a BN chromosome 19 introgressed. 1358258 RCS/LavRrrc royal college of surgeons rat Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) RRID:RRRC_00314 Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Then to University of California- San Francisco, School of Medicine, deposited to Rat Resource & Research Center. 1358259 RCS-p+/LavRrrc Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) RRID:RRRC_00315 This strain has homozygous wild type at the pink eye (p+) locus and homozygous for a deletion in the Mertk gene. Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain. 1358277 RCS-rdy+/LavRrrc Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-07-16) RRID:RRRC_00317 Developed by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated. 1358278 RCS-rdy+p+/LavRrrc Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12) RRID:RRRC_00316 Developed by crossing a pink-eyed control(RCS-rdy+/Lav x black-eyed dystrophic(RCS-p+/Lav) The F12 progeny was backcrossed to RCS-rdy+/Lav. The strain is pigmented (p+) congenic control strain (rdy+, wild-type at the retinal dystrophy locus) for the pigmented RCS-p+ dystrophic (rdy-) strain 1358298 SD-Tg(Rho*P23H)1LavRrrc Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Live Animals (as of 2021-05-07) Rho 11239 RRID:RRRC_00639 This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). 1358299 SD-Tg(Rho*P23H)2Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358299 This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). 1358300 SD-Tg(Rho*P23H)3Lav Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown RRID:RRRC_00641 This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). 1358302 SD-Tg(Rho*S334X)3Lav Retinal Degeneration Rat Model Resource , Rat Resource and Research Center Retinal Degeneration Rat Model Resource , Rat Resource and Research Center transgenic Unknown RRID:RRRC_00643 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358303 SD-Tg(Rho*S334X)4Lav Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown RRID:RRRC_00645 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358304 SD-Tg(Rho*S334X)5Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358304 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358305 SD-Tg(Rho*S334X)7Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358305 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358306 SD-Tg(Rho*S334X)9Lav Retinal Degeneration Rat Model Resource Retinal Degeneration Rat Model Resource transgenic Unknown RRID:RGD_1358306 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. 1358632 MR/Har Maudsely reactive Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania. Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-20) RRID:RRRC_00691 This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. 1358633 MNRA/Har Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania inbred Unknown RRID:RGD_1358633 Originally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. 1358918 W-Plp1md/Nya W-Plp1md Division of Laboratories and Research, New York State Department of Health, Albany, New York mutant Unknown Plp1|Plp1md 3354|12802346 X 124488627 124503639 7 X 107379831 107394881 7 X 107505372 107505372 8 X 100195051 100195051 8 RRID:RGD_1358918 Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders. 1358919 F344/Seac SEAC Yoshitomi Co., Fukuoka, Japan inbred Unknown RRID:RGD_1358919 Inbred strain originated from F344 rats 1358921 WF.DA-(D19Mit1-D19Mit6)/Kop kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nqo1 2503 19 26536747 41612881 1 - by flanking markers 19 35433730 54715514 1 - by flanking markers 19 24455726 43907843 1 - by flanking markers 19 24817978 39654489 1 - by flanking markers RRID:RGD_1358921 Congenic strain originated from a parental DA/Slc strain. 1358922 BB.WOKW-(D4Got41-Fabp1)/K Dept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, Germany congenic Unknown Fabp1 2590 4 60262965 104415981 1 - by flanking markers 4 60179409 163844105 1 - by flanking markers 4 60439127 99066957 1 - by flanking markers 4 61697658 103194791 1 - by flanking markers RRID:RGD_1358922 Congenic strain originated from a BB/OK parental strain. 1358923 LE-Mbpmd Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada mutant Unknown Mbp|Mbpmd 3054|12802351 18 78943608 79057329 7 18 78385304 78504226 7 18 79326738 79437310 7 18 75855878 75966404 7 RRID:RGD_1358923 A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks. 1358989 WKY.SHR-(D2Rat174-D2Rat28)(D2Rat161-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown RRID:RGD_1358989 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl 1358990 DA.F344-(D10Mit9-D10Rat24)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 79229233 1 - by flanking markers 10 31740635 78195122 1 - by flanking markers 10 31919397 78343192 1 - by flanking markers 10 31224026 75632053 1 - by flanking markers RRID:RGD_1358990 Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd 1358991 F344.HTX-(D11Rat4-D11Arb4)/Hcj Department of Pharmacology, University of Florida, Gainesville congenic Unknown 11 64573222 68235010 1 - by flanking markers 11 66731054 72739915 1 - by flanking markers 11 65352097 69649936 1 - by flanking markers 11 62790342 66422377 1 - by flanking markers RRID:RGD_1358991 Congenic strain originated from F344/NHsd parental strain bred to HTX/Hcj 1358992 SHR.WKY-(D2Rat40-D2Rat50) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 163154227 200390471 1 - by flanking markers 2 189197858 227035367 1 - by flanking markers 2 169852670 207612467 1 - by flanking markers 2 157142078 192625452 1 - by flanking markers RRID:RGD_1358992 Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers 1358993 WKY.SHR-(D2Rat161-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 238140155 1 - by flanking markers 2 138120195 264423808 1 - by flanking markers 2 118446646 245893748 1 - by flanking markers 2 114837527 229059787 1 - by flanking markers RRID:RGD_1358993 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl 1358994 SHR.WKY-(D2Rat161-D2Rat241) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 217985582 1 - by flanking markers 2 138120195 242993417 1 - by flanking markers 2 118446646 118446793 1 - by flanking markers 2 114837527 114837675 1 - by flanking markers RRID:RGD_1358994 This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) congenic strain to the parental strain SHR/NCrl 1358995 F344.OLETF-(D1Rat166-D1Rat90)/Tj Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_1358995 Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. 1358996 SHR.WKY-(D2Rat10-D2Mgh13) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 35874553 244809764 1 - by flanking markers 2 54092967 270992875 1 - by flanking markers 2 34967269 252466565 1 - by flanking markers 2 36023184 235501121 1 - by flanking markers RRID:RGD_1358996 This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background 1358997 WKY.SHR-(D2Rat241-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 217985399 238140155 1 - by flanking markers 2 242993235 264423808 1 - by flanking markers 2 245893572 245893748 1 - by flanking markers 2 229059610 229059787 1 - by flanking markers RRID:RGD_1358997 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl 1358998 BUF/NHsd Harlan Harlan inbred Unknown RRID:RGD_1358998 Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan. 1358999 WKY.SHR-(D2Rat174-D2Rat28) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 107574826 1 - by flanking markers 2 83930202 126824737 1 - by flanking markers 2 60746052 107083569 1 - by flanking markers 2 59744817 104815148 1 - by flanking markers RRID:RGD_1358999 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl 1359000 DA.F344-(D10Arb27-D10Rat6)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 69160380 106310957 1 - by flanking markers 10 67971352 104746310 1 - by flanking markers 10 68305037 105078045 1 - by flanking markers 10 65927233 101436010 1 - by flanking markers RRID:RGD_1359000 Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd 1359001 WKY.SHR-(D2Rat42-D2Rat139) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 180768203 232533087 1 - by flanking markers 2 207416346 258769070 1 - by flanking markers 2 188013923 240243929 1 - by flanking markers 2 174110900 223490532 1 - by flanking markers RRID:RGD_1359001 Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers 1359002 NTac:WKY Taconic outbred Unknown RRID:RGD_1359002 The Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony. 1359003 LEW/Jr Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_1359003 This strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA. 1359004 DA.F344-(D10Mit9-D10Rat11)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 100633982 1 - by flanking markers 10 31740635 99184250 1 - by flanking markers 10 31919397 99492409 1 - by flanking markers 10 31224026 96121100 1 - by flanking markers RRID:RGD_1359004 Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd 1359005 SHR.WKY-(D2Rat15-D2Rat50) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 46251938 200390471 1 - by flanking markers 2 66171293 227035367 1 - by flanking markers 2 47783949 207612467 1 - by flanking markers 2 47137898 192625452 1 - by flanking markers RRID:RGD_1359005 This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) to parental strain SHR/NCrl 1359006 WKY.SHR-(D2Rat27-D2Rat243) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 96481750 221307793 1 - by flanking markers 2 116297660 248110514 1 - by flanking markers 2 96556622 228759752 1 - by flanking markers 2 94359407 212719943 1 - by flanking markers RRID:RGD_1359006 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl 1359007 WKY.SHR-(D2Rat174-D2Rat62) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 228664122 1 - by flanking markers 2 83930202 254867363 1 - by flanking markers 2 60746052 236318668 1 - by flanking markers 2 59744817 219753474 1 - by flanking markers RRID:RGD_1359007 This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl 1359008 F344.HTX-(D11Rat4-D11Arb4)(D17Rat23-D17Rat154)/Hcj Department of Pharmacology, University of Florida, Gainesville congenic Unknown RRID:RGD_1359008 Double congenic strain originated from a cross between single congenic strains F344.HTX-(D11Rat4-D11Arb4)/Hcj and F344.HTX-(D17Rat23-D17Rat154)/Hcj. 1359009 WKY.SHR-(D2Rat174-D2Rat185) Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 238140155 1 - by flanking markers 2 83930202 264423808 1 - by flanking markers 2 60746052 245893748 1 - by flanking markers 2 59744817 229059787 1 - by flanking markers RRID:RGD_1359009 Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers 1359010 WF.BBDR-ART2a/Wor Wistar Furth University of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605 congenic Unknown RRID:RGD_1359010 Congenic strain created by backcrossing WF strain to BBDR strain which are RT1 u/u , ART2a. 1547865 FHH-Chr 3BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1547865 A FHH genomic background with a BN chromosome 3 introgressed. 1547866 F344/Jcl CLEA Japan, Inc CLEA Japan, Inc inbred Live Animals (as of 2021-04-22) RRID:RGD_1547866 Inbred strain originated from F344 1547867 FHH-Chr 4BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547867 A FHH genomic background with a BN chromosome 4 introgressed. 1547868 FHH-Chr 2BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547868 A FHH genomic background with a BN chromosome 2 introgressed. 1547869 ACI/Eur August x Copenhagen Irish Department of Pediatric Surery, Erasmus Medical Center, Rotterdam, Netherlands inbred Unknown RRID:RGD_1547869 Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH 1547870 FHH-Chr 14BN/Mcwi PhysGen consomic Live Animals RRID:RGD_1547870 A FHH genomic background with a BN chromosome 14 introgressed. 1547871 ACI.FHH-(D1Rat324-D1Rat156)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229301063 253410500 1 - by flanking markers 1 251109240 279213254 1 - by flanking markers 1 243853559 243853760 1 - by flanking markers 1 223506828 223507030 1 - by flanking markers RRID:RGD_1547871 Congenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains. 1547872 FHH-Chr XBN/Mcwi FHH-Chr XBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547872 A FHH genomic background with a BN chromosome X introgressed. 1547873 FHH-Chr 15BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547873 A FHH genomic background with a BN chromosome 15 introgressed. 1547874 FHH-Chr YBN/Mcwi FHH-Chr YBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547874 A FHH genomic background with a BN chromosome Y introgressed. 1547875 ACI.FHH-(D17Rat117-D17Arb5)(D17Rat180-D17Rat51)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 17 31007408 69257442 1 - by flanking markers 17 27537443 67580933 1 - by flanking markers 17 25609692 65831023 1 - by flanking markers 17 24982652 58691962 1 - by flanking markers RRID:RGD_1547875 Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. 1547876 FHH-Chr 10BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1547876 A FHH genomic background with a BN chromosome 10 introgressed. 1549794 SS.LEW-(D2Rat199-D2Mco17)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 4;2 157987925;41032071 157987994;76020140 1 - by flanking markers;1 - by flanking markers 2;4 60242455;221211532 95618891;221211601 1 - by flanking markers;1 - by flanking markers 2;4 41179255;154125111 75896315;154125180 1 - by flanking markers;1 - by flanking markers 4;X;2 154786975;46603085;41243963 154787045;46603120;74997963 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_1549794 Congenic strain was created from a SS/Jr parental strain 1549795 SS.LEW-(D2Rat199-D2Rat143)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 41032071 106236206 1 - by flanking markers 2 60242455 125885146 1 - by flanking markers 2 41179255 106156987 1 - by flanking markers 2 41243963 103519040 1 - by flanking markers RRID:RGD_1549795 Congenic strain was created from a SS/Jr parental strain 1549796 BN/2Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo RRID:RGD_1549796 Transferred from Hokkaido University, Chromosome Research Unit, 1987 F16 1549797 BUF.ACI-(D16Rat31-D16Arb1)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown 16 8340080 8340453 1 - by flanking markers 16 11019972 11020174 1 - by flanking markers 16 9055590 9055792 1 - by flanking markers 16 8082906 8083107 1 - by flanking markers RRID:RGD_1549797 This congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method. 1549798 BB.PVG-RT1u/a/Tky National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology RRID:RGD_1549798 A congenic strain with the genetic background of the BB/WorTky strain (RT1.Bu,Du ) onto which the MHC locus of PVG.R23 strain (RT1.B,D) has been transferred. 1549799 BB.SHR-(D6Rat184-D6Rat3)/K National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Metabolism 6 121381065 145279536 1 - by flanking markers 6 130448688 154782041 1 - by flanking markers 6 121224054 145868598 1 - by flanking markers 6 116506292 138922889 1 - by flanking markers RRID:RGD_1549799 Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000. 1549800 BN/KunKtsSlc This strain is no longer available from NBRP-Rat (June 2022). inbred Unknown (as of 2022-06-09) Metabolism RRID:RGD_1549800 Kitasato University School of Medicine to Slc (2001) 1549801 BN/Seac Seac Yoshitomi, LTD, Fukuoka, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Behavior; Ophthalmology RRID:RGD_1549801 Seac Yoshitomi, LTD, Fukuoka, Japan 1549802 BN/1Hok National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1549802 Transferred from Hokkaido University, Chromosome Research Unit, 1987 F15 1549803 ACI-Lystbg-Kyo/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Hematology RRID:RGD_1549803 Spontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999. 1549804 BUF/NacJcl Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan inbred Unknown RRID:RGD_1549804 CLEA Japan, Inc., Tokyo Japan 1549805 BUF.Cg-Foxn1rnu/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Urology RRID:RGD_1549805 BUF/Mna, NN1H-Rnu/Rnu 1549806 BUF.ACI-(D3Rat56-D3Rat83)/Ncc Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 3 3577905 42635088 1 - by flanking markers 3 2612834 52104192 1 - by flanking markers 3 2631421 46996487 1 - by flanking markers 3 8227194 45391731 1 - by flanking markers RRID:RGD_1549806 This strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strain 1549808 SS.LEW-(Prlr-D2Rat143)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown Prlr 3407 2 59507966 106236206 1 - by flanking markers 2 84360850 125885146 1 - by flanking markers 2 60131410 106156987 1 - by flanking markers 2 59134147 103519040 1 - by flanking markers RRID:RGD_1549808 Congenic strain was created from a SS/Jr parental strain 1549809 BN/KtsSlc This strain is no longer available from NBRP-Rat (June 2022). inbred Unknown (as of 2022-06-09) Immunology RRID:RGD_1549809 Kitasato University School of Medicine to Slc (2002) 1549810 AI/Msik amelogenesis imperfecta rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Dentistry RRID:RGD_1549810 This strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc. 1549811 ACI/NJcl Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan National BioResource Project for the Rat in Japan inbred Unknown RRID:RGD_1549811 ACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan. 1549813 F344.ACI-Lmx1aqc/Kyo Institute of Laboratory Animals at Kyoto University, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-12) Apoa2|Selp|Lmx1a 2131|3656|1304784 13 79886614 87116372 1 - by flanking markers 13 87308435 94225670 1 - by flanking markers 13 82428914 89598805 1 - by flanking markers 13 76476229 83646358 1 - by flanking markers RRID:RGD_1549813 Congenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. The short-tail mutation, “queue courte” in French (with qc as a symbol), occurred spontaneously in 1994, in the ACI/Pas inbred strain of rat maintained at the Institute Pasteur (Paris, France), and was kept segregating in this stock. Since importation into the Institute of Laboratory Animals at Kyoto University, it has been maintained as a congenic strain F344.ACI-qc using F344/NSlc as an inbred partner. 1554301 WKHA/Bord Universite Victor Segalen Bordeaux 2, Bordeaux cedex, France inbred Unknown RRID:RGD_1554301 Strain was originated from WHHA/Edh at the University of Vermont College of Medicine 1554302 HOB-Unc5chob/Snk hobble rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Unc5c|Unc5chob 735109|12802353 2 239365109 239721231 7 2 265573406 265926229 7 2 247045813 247397483 7 2 230180353 230535219 7 RRID:RGD_1554302 Homozygous hobble rats that were taken from the inbred hobble rat colony. 1554303 CVD/Opu Cerebellar vermis defect rat Department of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, Japan inbred Unknown Unc5c 735109 RRID:RGD_1554303 Originated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates. 1554304 GAERS/Mave Genetic Absence Epilepsy Rats from Strasbourg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_1554304 30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding. 1554305 DA-Tg(CAG-lacZ)30Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RRRC_00295 lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. 1554306 GK/Slc Goto Kakizaki Rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Diabetes Obesity RRID:RGD_1554306 Spontaneous mutant GK rat which were obtained from Japan SLC, Inc. 1554307 W-Tg(LAC3)Ys YS New Technology Institute, Tochigi, Japan transgenic Unknown RRID:RGD_1554307 These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase. 1554308 Gunn-Ugt1a1j/Slc Gunn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Live Animals Neurobiology; Metabolism Ugt1a1j 13432064 RRID:RGD_1554308 Segregated inbred Gunn rat which were obtained from Japan SLC, Inc. 1554309 W-Tg(CAG-GFP)184Ys National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00259 These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. 1554310 DA-Tg(CAG-lacZ)19Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00294 lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. 1556748 F344/Snk Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown RRID:RGD_1556748 Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan 1558660 SHRSP/Tkyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558660 Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo 1558661 WKY/Tkyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558661 Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo 1558662 SHR/Tkyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown RRID:RGD_1558662 Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo 1559030 LEC-Tg(ATP7B)Tohm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_1559030 A 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA. 1559031 NE/Mave National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_1559031 The control strain of GAERS, free of any spontaneous spike and wave discharges. 1559032 SS.LEW-(D17Rat65-D17Chm2)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 82247891 93930006 1 - by flanking markers 17 76483116 88435496 1 - by flanking markers 17 74823053 86731080 1 - by flanking markers 17 70973784 82479847 1 - by flanking markers RRID:RGD_1559032 This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment 1559033 SS.LEW-(D17Rat65-Prl)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown Prl 3403 17 44699101 93930006 1 - by flanking markers 17 41720751 88435496 1 - by flanking markers 17 39814236 86731080 1 - by flanking markers 17 37859999 82479847 1 - by flanking markers RRID:RGD_1559033 This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain 1559034 SS.LEW-(D17Chm14-D17Rat97)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 80182186 1 - by flanking markers 17 60264084 74265481 1 - by flanking markers 17 58467778 72580782 1 - by flanking markers 17 62109333 68784138 1 - by flanking markers RRID:RGD_1559034 This congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment 1559035 SS.LEW-(D17Chm14-D17Rat181)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 38257211 80182186 1 - by flanking markers 17 35100574 74265481 1 - by flanking markers 17 33208959 72580782 1 - by flanking markers 17 31896010 68784138 1 - by flanking markers RRID:RGD_1559035 This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain 1559036 LEW/Jms National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01) RRID:RRRC_00054 Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. 1559037 SS.LEW-(D17Chm9-D17Rat97)/Ayd Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 83074398 1 - by flanking markers 17 60264084 77361330 1 - by flanking markers 17 58467778 75705622 1 - by flanking markers 17 62109333 71774817 1 - by flanking markers RRID:RGD_1559037 This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment 1559039 ODS/Shi Osteogenic disorder Shionogi Shionogi & Co., Ltd. Japan inbred Unknown RRID:RGD_1559039 Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. 1559040 MD/Tama myelin deficient rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2024-09-24) Neurobiology; Development RRID:RGD_1559040 X-linked mutant of the Wistar rat. 1559041 SHRSP/Ngsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension; Osteosis RRID:RGD_1559041 Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980. 1559042 SHR/Nig National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Pharmacology RRID:RGD_1559042 Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976. 1559043 MV/Opu myelin vacuolation rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Neurobiology Atrnmv 40902835 RRID:RGD_1559043 The myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999. 1559044 SS.SR-(D3Mco19-D3Mco5)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Edn3 2534 7;3 23312460;147799021 23312636;167653069 1 - by flanking markers;1 - by flanking markers 7;3 27325365;158391833 27325541;183008351 1 - by flanking markers;1 - by flanking markers 3;7 153327515;27206010 153327695;27206186 1 - by flanking markers;1 - by flanking markers 7;3 21089863;145871677 21090040;145871858 1 - by flanking markers;1 - by flanking markers RRID:RGD_1559044 A region of chr 3 which contains the Edn3 gene was introgressed into the SS rats 1559045 LEW/Crlc Charles River Laboratories, La Salle, Quebec, Canada inbred Unknown RRID:RGD_1559045 LEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canada 1559046 SHR-Chr YW/K National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Unknown RRID:RGD_1559046 Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996. 1559047 SHRSP/Ezo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension RRID:RGD_1559047 Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan 1559048 SHR.ODS-Gulood/Shi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Osteosis Gulo 620701 RRID:RGD_1559048 A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995. 1566430 SimTac:LE Taconic outbred Unknown RRID:RGD_1566430 Taconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock. 1566431 BN/MolTac Taconic inbred Unknown RRID:RGD_1566431 The BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003. 1566432 WKY/NMolTac Wistar Kyoto Taconic inbred Unknown RRID:RGD_1566432 The inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit. 1566433 HanTac:WH Taconic outbred Unknown RRID:RGD_1566433 In 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000. 1566434 NTac:SHR Taconic outbred Unknown RRID:RGD_1566434 Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony. 1566437 SS-Chr XBN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1566437 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 1566438 DA/MolTac Taconic inbred Unknown RRID:RGD_1566438 Developed at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004. 1566439 F344/NTac Taconic inbred Unknown RRID:RGD_1566439 Axenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH. 1566440 NTac:SD Taconic outbred Unknown RRID:RGD_1566440 Taconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies. 1566443 LEW/MolTac Lewis Taconic inbred Unknown RRID:RGD_1566443 Scripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived. 1566444 MolTac:SD Taconic outbred Unknown RRID:RGD_1566444 The SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993. 1566445 ACI.BN-(D5Mgh17-D5Rat205)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Extinct 5 14730738 14730949 1 - by flanking markers 5 19190627 19190837 1 - by flanking markers 5 14408903 14409113 1 - by flanking markers 5 14529225 14529436 1 - by flanking markers RRID:RGD_1566445 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 1566447 GK/MolTac Goto-Kakizaki Taconic inbred Unknown RRID:RGD_1566447 The Goto-Kakizaki inbred model was developed by Tohoku University in 1975. Aarhus University Hospital in Denmark received stock in 1994. M&B A/S (now Taconic Europe) received stock from Aarhus in 1997. The rats were derived by embryo transfer in 2005 at Taconic US. 1566448 FHH-Chr 9BN/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_1566448 A FHH genomic background with a BN chromosome 9 introgressed. 1566453 SD-Tg(HIV-LacZ)AngRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00049 Fertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid. 1566454 BDIV/Zte BDIV/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_1566454 derived from Berlin-Druckrey strain BDIV 1566455 HTX/HcjRrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery RRID:RRRC_00050 Available at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30. 1566456 BDIX/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_1566456 derived from Berlin-Druckrey strain BDIX 1566457 SPRD Sprague-Dawley inbred Unknown RRID:RGD_1566457 From outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990). 1566458 F344-Tg(ROSA26-ALPP)EpsRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-07-01) ALPP 1314395 RRID:RRRC_00048 F344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP, ALPP). 1566459 F344-Tg(ROSA26-EGFP)Eps Department of Pathobiological Sciences, University of Wisconsin-Madison, Madison, Wisconsin transgenic Unknown RRID:RGD_1566459 F344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP). 1566460 SD-Tg(ICAM2-DAF)AngRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00051 Embryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter. 1578692 BN.LEW-(D10Rat32-D10Rat116)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 54220239 1 - by flanking markers 10 53381898 53807373 1 - by flanking markers 10 53630865 54057745 1 - by flanking markers 10 51779662 52200160 1 - by flanking markers RRID:RGD_1578692 Congenic strain was bred from BN.LEW-(D10Mco17-D10Mco14)/Ciml backcrossed to BN/Rj. 1578693 LEW.BN-(D10Mco17-D10Rat221)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578693 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578694 AT Alcohol-Tolerant Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00076 The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. 1578695 SHA/BruRrrc Syracuse High Avoidance Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00068 Selective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats. 1578696 LAS1 Low Alcohol Sensitive strain 1 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00080 Selectively bred for 24 generations for low sensitivity to ethanol then inbred. 1578697 BN.LEW-(D10Rat32-D10Rat31)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53616237 53786515 1 - by flanking markers 10 53216481 53382065 1 - by flanking markers 10 53465198 53631032 1 - by flanking markers 10 51611529 51779830 1 - by flanking markers RRID:RGD_1578697 Congenic strain was bred from BN.LEW-(D10Rat32-D10Rat221)/Ciml backcrossed to BN/Rj. 1578698 LAS2 Low Alcohol Sensitive strain 2 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00081 Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred 1578699 BG anemic Belgrade Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery RRID:RRRC_00072 These are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY. 1578700 HAS1 High Alcohol Sensitive strain 1 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00077 Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred 1578701 HAS2 High Alcohol Sensitive strain 2 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00079 Selectively bred for high ethanol sensitivity for 24 generations, then inbred. 1578702 LEW.BN-(D10Rat32-D10Rat133)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 10 51779662 51779830 1 - by flanking markers RRID:RGD_1578702 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578703 SLA/BruRrrc Syracuse Low Avoidance Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00069 Selective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats. 1578704 WLP Warsaw Low Prefering Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown RRID:RGD_1578704 These were bred from albino stock of Wistar rats as lines that had low ethanol preference. 1578705 LEW.BN-(D10Arb4-D10Rat133)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 65668639 1 - by flanking markers 10 46591952 64823355 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 10 45274234 45274336 1 - by flanking markers RRID:RGD_1578705 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578706 LEW.BN-(D10Mco17-D10Mco14)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578706 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578708 LEW.BN-(D10Mgh7-D10Rat221)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 56171177 1 - by flanking markers 10 55720558 55720772 1 - by flanking markers 10 55978483 55978697 1 - by flanking markers 10 54098674 54098889 1 - by flanking markers RRID:RGD_1578708 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578709 IA incisor absent Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00064 These rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption. 1578710 LEW.1AR1-iddm/Ztm Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany coisogenic Unknown Dock8m1Ztm 13830868 RRID:RGD_1578710 arose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.AaB/DuCu) in the intra-MHC recombinant inbred strain LEW.1AR1; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain since 1578711 LEW.BN-(D10Mco17-D10Rat133)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 65668639 1 - by flanking markers 10 44914976 64823355 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578711 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578712 BN.LEW-(D10Mco17-D10Mco14)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 10 43593509 43593911 1 - by flanking markers RRID:RGD_1578712 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578713 BN/Ztm Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany inbred Unknown RRID:RGD_1578713 substrain of BN 1578714 BN.LEW-(D10Mco17-D10Rat80)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 61798393 1 - by flanking markers 10 44914976 61030524 1 - by flanking markers 10 45157430 61300905 1 - by flanking markers 10 43593509 59378278 1 - by flanking markers RRID:RGD_1578714 Congenic strain created from parental LEW/Rj and BN/Rj strains. 1578715 ANT Alcohol-Nontolerant Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Gabra6 61861 RRID:RRRC_00078 The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. 1578716 LEW.1AR1/Ztm Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany congenic Unknown RRID:RGD_1578716 Lewis strain containing MHC haplotype RT1.AaB/DuCu 1578717 WHP Warsaw High Prefering Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown RRID:RGD_1578717 These were bred from albino stock of Wistar rats as lines that had ethanol preference. 1579677 FHH-Maddm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Maddm1Mcwi 1578796 3 75498321 75541073 7 3 86669054 86711776 7 3 79960301 80003023 7 3 77114330 77157865 7 RRID:RGD_1579677 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated. 1579678 ACI.FHH-(D3Wox2-D3Rat59)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Live Animals; Cryopreserved Sperm 3 46419462 163443738 1 - by flanking markers 3 57173123 176609927 1 - by flanking markers 3 50533100 170534769 1 - by flanking markers 3 49162911 161299569 1 - by flanking markers RRID:RGD_1579678 Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. 1579680 Wild/Tku Wild Caught in Tokyo wild Unknown RRID:RGD_1579680 These rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed. 1579681 BN-Birc3m1Mcwi PhysGen mutant Extinct (as of 2016-10-24) Birc3m1Mcwi 1578788 8 4682202 4696856 7 8 6047454 6075236 7 8 6048590 6076828 7 8 5000844 5028470 7 RRID:RGD_1579681 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated. 1579682 FHH-Tlr4m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tlr4m1Mcwi 1578785 5 83564100 83577735 7 5 86690670 86704302 7 5 82587424 82601056 7 5 80145867 80159501 7 RRID:RRRC_00411 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V489A mutation is generated. 1579683 FHH-Ghsrm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsrm1Mcwi 1578794 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RRRC_00405 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. codon CAG/TAG mutation is generated which changes the AA Q343Stop. 1579684 FHH-Slc8a2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc8a2m1Mcwi 1578786 1 76473938 76498624 7 1 79296259 79320746 7 1 78029555 78054042 7 1 76816583 76852928 7 RRID:RRRC_00404 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y213Stop mutation is generated from the codon change TAT/TAA. 1579685 FHH-Tgfbr2m2Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tgfbr2m2Mcwi 1578782 8 120593595 120680453 7 8 123585765 123671209 7 8 124310288 124399345 7 8 115794537 115883615 7 RRID:RRRC_00400 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG. 1579686 GH/OmrMcwi PhysGen inbred Live Animals; Cryopreserved Embryo RRID:RGD_1579686 This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then. 1579687 FHH-Procm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Procm1Mcwi 1578790 18 24563368 24573715 7 18 24633206 24643623 7 18 24918402 24928822 7 18 23764367 23774816 7 RRID:RRRC_00410 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L312P mutation is generated. 1579688 BN-Tgfbr2m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Tgfbr2m1Mcwi 1578800 8 120593595 120680453 7 8 123585765 123671209 7 8 124310288 124399345 7 8 115794537 115883615 7 RRID:RGD_1579688 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG. 1579689 FHH-F10m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10m1Mcwi 1578783 16 81327237 81346544 7 16 81288536 81307842 7 16 81803169 81822476 7 16 76468834 76488141 7 RRID:RRRC_00401 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V453G mutation is generated from the codon change GTC/GGC. 1579690 FHH-Slc27a5m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Slc27a5m1Mcwi 1578799 1 72924630 72935223 7 1 66387832 66398425 7 1 65576599 65587192 7 1 73616556 73627149 7 RRID:RGD_1579690 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated. 1579691 SS.SHR-(D11Mgh3-D11Rat31)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 11 8176272 68234949 1 - by flanking markers 11 10373455 72739854 1 - by flanking markers 11 6673351 69649875 1 - by flanking markers 11 8200022 66422316 1 - by flanking markers RRID:RGD_1579691 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579692 FHH-Lcatm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcatm1Mcwi 1578793 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00402 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H353L mutation is generated from the codon change CAC/CTC. 1579693 T2DN/Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin inbred Unknown RRID:RGD_1579693 Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained. 1579694 FHH-Egln3m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Egln3m1Mcwi 1578781 6 74451038 74476506 7 6 84592894 84618360 7 6 75050329 75075795 7 6 71650297 71675766 7 RRID:RRRC_00409 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E60G mutation is generated. 1579695 ACI.FHH-(D1Rat298-D1Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 225625031 267111153 1 - by flanking markers 1 247303036 289137268 1 - by flanking markers 1 240017117 281795785 1 - by flanking markers 1 219932573 259647894 1 - by flanking markers RRID:RGD_1579695 Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. 1579696 SS.SHR-(D6Wox13-D6Rat84)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 6 136451997 136452267 1 - by flanking markers 6 144273721 144273990 1 - by flanking markers 6 136142742 136143011 1 - by flanking markers 6 130729205 130729475 1 - by flanking markers RRID:RGD_1579696 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579697 SS.SHR-(D13Rat63-D13Mit1)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 13 25430110 80482429 1 - by flanking markers 13 14281836 87877411 1 - by flanking markers 13 9016742 82995671 1 - by flanking markers 13 5994668 77046890 1 - by flanking markers RRID:RGD_1579697 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579698 FHH-Adra1am1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Adra1am1Mcwi 1578792 15 46173429 46263198 7 15 48197628 48297316 7 15 43296997 43398314 7 15 40830125 40935902 7 RRID:RRRC_00408 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a. 1579699 WKY.WKHA-(D5Rat45-D5Rat245)/Cfd WKY.WKHA-(D5Rat45-D5Rat245)/Cfd Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA congenic Unknown 5 159265355 159265706 1 - by flanking markers 5 162571275 162571427 1 - by flanking markers 5 158854038 158854190 1 - by flanking markers 5 152630083 152630236 1 - by flanking markers RRID:RGD_1579699 This congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain background 1579700 ACI.FHH-(D1Rat475-D1Rat90)(D3Rat84-D3Rat59)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1579700 Double congenic strain from backcross of ACI.FHH-(D1Rat298-D1Rat90)/Eur and ACI.FHH-(D3Wox2-D3Rat59)/Eur. 1579701 BN-Nos1m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Nos1m1Mcwi 1578795 12 39812500 39869484 7 12 46049288 46209569 7 12 44214949 44405530 7 12 38615111 38795492 7 RRID:RGD_1579701 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L72Stop mutation is generated. 1579702 SS.SHR-(D9Wox16-D9Rat64)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 21667066 21667256 1 - by flanking markers 9 27914255 97338238 1 - by flanking markers 9 29075079 97647719 1 - by flanking markers 9 25268044 91090963 1 - by flanking markers RRID:RGD_1579702 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579703 SS.SHR-(D2Rat61-D2Mco18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 2 79796833 227150249 1 - by flanking markers 2 88594475 100298539 1 - by flanking markers 2 68865414 80632096 1 - by flanking markers 2;18 78665619;79924734 78665763;79925127 1 - by flanking markers;1 - by flanking markers RRID:RGD_1579703 Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. 1579704 FHH-Agtr1bm1Mcwi PhysGen, Rat Resource & Research Center mutant Extinct (as of 2016-11-29) Agtr1bm1Mcwi 1578784 2 105503269 105602591 7 2 124879262 124954378 7 2 105149020 105224335 7 2 102844969 102920232 7 RRID:RGD_1579704 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A 3bp deletion generates a mutation at TTC (del251F)of rat Agtr1b. 1579705 FHH-Nr0b2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nr0b2m1Mcwi 1578798 5 151524685 151528000 7 5 155465275 155468590 7 5 151776004 151779319 7 5 145779294 145782609 7 RRID:RRRC_00403 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC. 1579706 FHH-Nr4a1m1Mcwi PhysGen mutant Cryopreserved Sperm (as of 2017-01-26) Nr4a1m1Mcwi 1578791 7 140012807 140020590 7 7 140700242 140721073 7 7 142899358 142920216 7 7 132368399 132389300 7 RRID:RGD_1579706 Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA. 1579707 FHH-Adipoqm2Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm2Mcwi 1578797 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00407 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq. 1579708 FHH-Desm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Desm1Mcwi 1578801 9 74637783 74645499 7 9 82325835 82333549 7 9 82556574 82564288 7 9 76850979 76858695 7 RRID:RGD_1579708 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated. 1579709 Wild/Mcwi Wild Caught in Milwaukee Wisconsin wild Unknown RRID:RGD_1579709 These rats were caught wild in Milwaukee, used for experiments and then sacrificed. 1579710 GK/Far Goto-Kakizaki James A. Haley Veterans Hospital, Tampa Florida inbred Unknown RRID:RGD_1579710 Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. 1579711 FHH-Adipoqm1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm1Mcwi 1578787 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00406 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.Y162C mutation is generated on rat Adipoq. 1579712 FHH-Klf6m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Klf6m1Mcwi 1578789 17 75578498 75585072 7 17 69616967 69674031 7 17 67887939 67945052 7 17 64539456 64548451 7 RRID:RGD_1579712 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated. 1579894 SS.LEW-(D10Rat204-D10Rat9)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 94837236 99588446 1 - by flanking markers 10 93421499 93421719 1 - by flanking markers 10 93662786 93663006 1 - by flanking markers 10 90404397 90404618 1 - by flanking markers RRID:RGD_1579894 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. 1579895 FHH-Bdkrb2m1Mcwi PhysGen mutant Extinct (as of 2016-10-24) Bdkrb2m1Mcwi 1579889 6 129744781 129748851 7 6 138615812 138622272 7 6 129399468 129429676 7 6 124472317 124502497 7 RRID:RGD_1579895 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated. 1579896 SS.LEW-(D2Rat18-D2Chm277)/Ayd Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 40912197 56722286 1 - by flanking markers 2 60126669 76472773 1 - by flanking markers 2 41063439 56736627 1 - by flanking markers 2 41125789 56532139 1 - by flanking markers RRID:RGD_1579896 Congenic strain was created from a SS/Jr parental strain 1579897 SS.SR-(D9Rat69-D9Mco14)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 9 66679876 74437140 1 - by flanking markers 9 74640722 82125547 1 - by flanking markers 9 74858383 82356286 1 - by flanking markers 9 69371595 76650886 1 - by flanking markers RRID:RGD_1579897 A congenic strain derived from the progenitor strains SS and SR. 1579898 SS.LEW-(D10Chm128-D10Chm121)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 71365656 1 - by flanking markers 10 69272915 71014829 1 - by flanking markers 10 69638898 70499629 1 - by flanking markers 10 67232398 68082614 1 - by flanking markers RRID:RGD_1579898 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579899 SS.LEW-(D5Rat130-D5Rat31)/JrMcwi SS.LEW-(D5Rat130-D5Rat31)/JrMcwi Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 139996194 1 - by flanking markers 5 36590997 142265366 1 - by flanking markers 5 31926122 138454239 1 - by flanking markers 5 31663789 133011550 1 - by flanking markers RRID:RGD_1579899 This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. 1579900 SS.SR-(D9Rat89-Resp18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 72257996 74558151 1 - by flanking markers 9 80172493 82246695 1 - by flanking markers 9 80400409 82477136 1 - by flanking markers 9 74701668 76771824 1 - by flanking markers RRID:RGD_1579900 Congenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strain 1579901 SS.LEW-(D10Chm224-D10Chm6)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76000447 1 - by flanking markers 10 75100237 76438561 1 - by flanking markers 10 75001953 76556637 1 - by flanking markers 10 72508825 72509024 1 - by flanking markers RRID:RGD_1579901 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579902 SS.LEW-(D5Rat130-D5Rat108)/JrMcwi SS.LEW-(D5Rat130-D5Rat108)/JrMcwi Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 5 31663789 128034027 1 - by flanking markers RRID:RGD_1579902 This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. 1579903 SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 97152234 100633982 1 - by flanking markers 10 95701164 99184250 1 - by flanking markers 10 95967019 99492409 1 - by flanking markers 10 92698959 96121100 1 - by flanking markers RRID:RGD_1579903 A congenic substrain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. 1579904 SS.SR-(D9Mgh11-D9Mco33)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 10 86983905 86984155 1 - by flanking markers 10 85965754 85966003 1 - by flanking markers 10 86168841 86169090 1 - by flanking markers 10 83212828 83213078 1 - by flanking markers RRID:RGD_1579904 A congenic strain derived from the progenitor strains SS and SR. 1579905 SS.SR-(D9Rat89-D9Mco27)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 10;9 76477677;72257996 76477875;72258219 1 - by flanking markers;1 - by flanking markers 9;10 80172493;74600366 80172715;74600564 1 - by flanking markers;1 - by flanking markers 9;10 80400409;75505821 80400631;75506019 1 - by flanking markers;1 - by flanking markers 10;9 72976092;74701668 72976291;74701891 1 - by flanking markers;1 - by flanking markers RRID:RGD_1579905 Congenic strain derived from parental strains SS and SR. 1579906 FHH-Adipoqm3Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqm3Mcwi 1579887 11 79908291 79911065 7 11 84363940 84382663 7 11 81330845 81344488 7 11 77721912 77735644 7 RRID:RRRC_00414 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L119P mutation is generated from the codon change CTG/CCG of rat Adipoq. 1579907 SS.LEW-(D10Chm128-D10Chm169)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 70654393 1 - by flanking markers 10 69272915 69442411 1 - by flanking markers 10 69638898 69809020 1 - by flanking markers 10 67232398 67400546 1 - by flanking markers RRID:RGD_1579907 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579908 SS.SR-(D9Mco95-Resp18)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80867159 82246695 1 - by flanking markers 9 81100315 82477136 1 - by flanking markers 9 75403227 76771824 1 - by flanking markers RRID:RGD_1579908 A congenic strain derived from the progenitor strains SS and SR. 1579909 FHH-Fgl2m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Fgl2m1Mcwi 1579885 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1579909 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA. 1579910 FHH-Ccr2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccr2m1Mcwi 1579888 8 128892784 128893905 7 8 123734465 123742483 7 RRID:RRRC_00399 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N117S mutation is generated from the codon change AAT/AGT. 1579911 SS.LEW-(D5Rat130-D5Rat72)/Mcwi SS.LEW-(D5Rat130-D5Rat72)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 120983466 1 - by flanking markers 5 36590997 123028200 1 - by flanking markers 5 31926122 119125145 1 - by flanking markers 5 31663789 114973531 1 - by flanking markers RRID:RGD_1579911 This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. 1579912 FHH-F10m2Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10m2Mcwi 1579886 16 81327237 81346544 7 16 81288536 81307842 7 16 81803169 81822476 7 16 76468834 76488141 7 RRID:RRRC_00412 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C388 Stop mutation is generated from the codon change TGC/TGA 1579913 SS.LEW-(D10Chm224-D10Chm222)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76477875 1 - by flanking markers 10 74600366 76309841 1 - by flanking markers 10 75505821 75506019 1 - by flanking markers 10 72976092 72976291 1 - by flanking markers RRID:RGD_1579913 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. 1579914 SS.LEW-(D10Mco30-D10Got92)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 77956387 1 - by flanking markers 10 73693979 76919627 1 - by flanking markers 10 76420583 77055888 1 - by flanking markers 10 73887148 74372232 1 - by flanking markers RRID:RGD_1579914 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. 1580542 PCK-Pkhd1pck/CrljCrl Charles River Laboratories Charles River Laboratories coisogenic Unknown Pkhd1pck 11535943 RRID:RGD_1580542 This model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Harris and associates in 2002. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD). 1581616 DA.ACI-(D15Rat23-D15Rat71)/Kini DA.ACI-(D15Rat23-D15Rat71)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 83040937 85456512 1 - by flanking markers 15 87155990 89768452 1 - by flanking markers 15 83647062 86002030 1 - by flanking markers 15 76003569 78330139 1 - by flanking markers RRID:RGD_1581616 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581617 SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13Gar University of Texas Southwestern Medical Center, Dallas Texas transgenic Unknown RRID:RGD_1581617 This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) 1581618 SHRSP/Bbb Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown RRID:RGD_1581618 This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany. 1581619 BN.PD-(D8Rat39-D8Rat35),SHR-(D2Mit4-D2Rat28),SHR-(D2Rat103-D2Rat107)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown RRID:RGD_1581619 This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-Lx. 1581620 SS.SR-(D9Mco61-D9Mco27)/Mco Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown RRID:RGD_1581620 A congenic strain derived from the progenitor strains SS and SR. 1581621 DA.ACI-(D15Rat6-D15Rat48)/Kini DA.ACI-(D15Rat6-D15Rat48)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 61161186 1 - by flanking markers 15 37103190 65959514 1 - by flanking markers 15 33219101 62301382 1 - by flanking markers 15 28030665 55302115 1 - by flanking markers RRID:RGD_1581621 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581622 SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrc University of Texas Southwestern Medical Center, Dallas, Texas Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-17) RRID:RRRC_00318 This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) 1581623 LA/Humd low autotomy Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581623 Low Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581624 FHH-Lipem1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Lipem1Mcwi 1581495 1 80663791 80682480 7 1 83511504 83530200 7 1 82248031 82266727 7 1 80965612 80984313 7 RRID:RGD_1581624 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L347P mutation is generated from the codon change CTA/CCA. 1581625 BN-Hand1m1Mcwi PGA mutant Unknown Hand1m1Mcwi 1581493 10 43423366 43425933 7 10 43050068 43052635 7 10 43250729 43253296 7 10 42006646 42009213 7 RRID:RGD_1581625 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC. 1581626 FHL/EurMcwi Fawn Hooded Low blood pressure PGA inbred Unknown RRID:RGD_1581626 The low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage. 1581627 WF.WKY-(D5Uwm66-D5Uwm67)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 73080117 79919776 1 - by flanking markers 5 76105513 82897734 1 - by flanking markers 5 71940894 78777811 1 - by flanking markers 5 69927283 76370048 1 - by flanking markers RRID:RGD_1581627 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581628 DA.ACI-(D15Rat6-D15Rat13)/Kini DA.ACI-(D15Rat 6-D15Rat13)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 43772355 1 - by flanking markers 15 37103190 51565184 1 - by flanking markers 15 33219101 47814460 1 - by flanking markers 15 28030665 38692741 1 - by flanking markers RRID:RGD_1581628 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581629 WF.WKY-(D5Wox8-D5Uwm62)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 4291144 61238981 1 - by flanking markers 5 4498411 64739489 1 - by flanking markers 5 4525738 60225339 1 - by flanking markers 5 5112159 58973694 1 - by flanking markers RRID:RGD_1581629 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581630 WF.WKY-(D5Uwm63-D5Uwm64)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 57848236 62299211 1 - by flanking markers 5 61271852 65886550 1 - by flanking markers 5 56733010 61370302 1 - by flanking markers 5 55564549 60051321 1 - by flanking markers RRID:RGD_1581630 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581631 WF.WKY-(D5Uwm61-D5Uwm37)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 84434303 130527490 1 - by flanking markers 5 87362775 132652105 1 - by flanking markers 5 83268986 128812854 1 - by flanking markers 5 80813116 123935338 1 - by flanking markers RRID:RGD_1581631 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581632 WF.WKY-(D5Uwm65-D5Uwm60)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 65553185 76159022 1 - by flanking markers 5 72838045 79426001 1 - by flanking markers 5 68395096 75274687 1 - by flanking markers 5 63190890 72943679 1 - by flanking markers RRID:RGD_1581632 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581633 DA.ACI-(D15Rat6-D15Rat71)/Kini DA.ACI-(D15Rat6-D15Rat71)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 85456512 1 - by flanking markers 15 37103190 89768452 1 - by flanking markers 15 33219101 86002030 1 - by flanking markers 15 28030665 78330139 1 - by flanking markers RRID:RGD_1581633 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581634 BN-Adora2am1Mcwi PhysGen mutant Extinct (as of 2016-10-24) Adora2am1Mcwi 1581476 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1581634 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a. 1581635 WKY/Bbb Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown RRID:RGD_1581635 This WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany. 1581636 BN-Cebpem1Mcwi PGA mutant Unknown Cebpem1Mcwi 1581494 15 32787946 32789344 7 15 37241081 37242479 7 15 33356119 33357517 7 15 28169711 28171471 7 RRID:RGD_1581636 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG. 1581637 FHH-Has1m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Has1m1Mcwi 1581477 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1581637 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG. 1581638 DA.ACI-(D15Rat126-D15Rat71)/Kini DA.ACI-(D15Rat126-D15Rat71)/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 85456315 85456512 1 - by flanking markers 15 86610850 89768452 1 - by flanking markers 15 83094829 86002030 1 - by flanking markers 15 75448637 78330139 1 - by flanking markers RRID:RGD_1581638 This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain 1581639 HAn/Humd high autotomy new Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581639 Males and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581640 HA/Humd high autotomy Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581640 High Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581641 WF.WKY-(D5Uwm68-D5Mit4)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 77277626 94516069 1 - by flanking markers 5 80544432 97315322 1 - by flanking markers 5 76401130 93273395 1 - by flanking markers 5 74047272 90450412 1 - by flanking markers RRID:RGD_1581641 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 1581642 FHH-Ccr4m1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ccr4m1Mcwi 1581492 8 118883148 118884230 7 8 121843005 121848545 7 8 122530152 122535959 7 8 114176291 114182033 7 RRID:RGD_1581642 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA. 1581643 LAn/Humd low autotomy new Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown RRID:RGD_1581643 Males and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. 1581644 FHH-Htr1am1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Htr1am1Mcwi 1581496 2 36434518 36435786 7 2 55362662 55363930 7 2 36246628 36247896 7 2 36693462 36698026 7 RRID:RRRC_00413 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C266Y mutation is generated from the codon change TGT/TAT. 1581645 LL/Mav Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown RRID:RGD_1581645 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. 1582184 SR/JrHsd Dahl Salt-Resistant inotiv inbred Unknown RRID:RGD_1582184 Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. 1582185 SS.SR-(D3Mco36-D3Got166)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 166484910 171009778 1 - by flanking markers 3 178896560 181074971 1 - by flanking markers 3 172850273 177366660 1 - by flanking markers 3 163556062 168974694 1 - by flanking markers RRID:RGD_1582185 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582186 FHH.FHH.1BN-(D1Rat183-D1Rat76)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 131123181 230411453 1 - by flanking markers 1 138077032 252243871 1 - by flanking markers 1 137083889 244992610 1 - by flanking markers 1 129384185 224569684 1 - by flanking markers RRID:RGD_1582186 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582187 SS.SR-(D3Mco24-D3Got130)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 166525892 1 - by flanking markers 3 160026579 178936339 1 - by flanking markers 3 155586270 172890235 1 - by flanking markers 3 147739514 163596045 1 - by flanking markers RRID:RGD_1582187 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582188 SS.SR-(D3Mco36-D3Mco46)/Jr Medical College of Ohio, Toledo, Ohio, USA Rat Resource and Research Center, congenic Cryopreserved Sperm (as of 2019-02-18) 3 168983202 171009778 1 - by flanking markers 3 181074759 181830490 1 - by flanking markers 3 175283587 177366660 1 - by flanking markers 3 167003822 168974694 1 - by flanking markers RRID:RRRC_00660 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582189 SS.SR-(D3Mco39-D3Got130)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 149823173 1 - by flanking markers 3 160026579 180014700 1 - by flanking markers 3 155586270 176305870 1 - by flanking markers 3 147739514 167914627 1 - by flanking markers RRID:RGD_1582189 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582190 SS/JrHsd Dahl Salt-Sensitive Envigo Envigo inbred Unknown RRID:RGD_1582190 Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. 1582191 FHH.FHH.1BN-(D1Rat287-D1Rat84)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 190114247 259322833 1 - by flanking markers 1 208389496 281400240 1 - by flanking markers 1 201358068 273987019 1 - by flanking markers 1 185356336 252280168 1 - by flanking markers RRID:RGD_1582191 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582192 SS.SR-(D3Mco36-D3Got159)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 162807724 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 3 168974481 168974694 1 - by flanking markers RRID:RGD_1582192 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582193 FHH.FHH.1BN-(D1Mgh13-D1Rat89)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 252340389 265343617 1 - by flanking markers 1 274224224 287349830 1 - by flanking markers 1 266793821 279986079 1 - by flanking markers 1 245907761 257976495 1 - by flanking markers RRID:RGD_1582193 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582194 SS.SR-(D3Mco78-D3Got130)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 164079729 1 - by flanking markers 3 160026579 177341735 1 - by flanking markers 3 155586270 171277347 1 - by flanking markers 3 147739514 161994638 1 - by flanking markers RRID:RGD_1582194 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 1582195 FHH.FHH.1BN-(D1Rat173F6B-D1Rat84)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 259322503 259322833 1 - by flanking markers 1 281400069 281400240 1 - by flanking markers 1 273986848 273987019 1 - by flanking markers 1 252279996 252280168 1 - by flanking markers RRID:RGD_1582195 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1582196 FHH.FHH.1BN-(D1Rat234-D1Rat265)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 41225047 90449243 1 - by flanking markers 1 95453405 95453561 1 - by flanking markers 1 94364073 94364229 1 - by flanking markers 1 90664883 90665040 1 - by flanking markers RRID:RGD_1582196 FHH-1BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. 1598797 WF.WKY-(D10Got124-D10Rat187)/Uwm Department of Oncology, University of Wisconsin, Madison Wisconsin congenic Unknown 10 89575059 110385665 1 - by flanking markers 10 88338460 109941891 1 - by flanking markers 10 88544136 110355174 1 - by flanking markers 10 85565469 106428971 1 - by flanking markers RRID:RGD_1598797 WKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL. 1598798 BBDP/WorN NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) RRID:RRRC_00092 Diabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. 1598799 ACI.FHH-(D1Rat384-D1Rat452)(D17Rat61-D1Arb5)(D17Rat51)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1598799 Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain. 1598800 ACI.FHH-(D1Rat384-D1Rat156)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229184432 253410500 1 - by flanking markers 1 250993318 279213254 1 - by flanking markers 1 243737319 243737466 1 - by flanking markers 1 223390805 223390953 1 - by flanking markers RRID:RGD_1598800 Congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain. 1598801 ACI.FHH-(D1Mit18-D1Mit8)(D14Mit11-D14Hmgc14b)(D14Rat65-D14Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_1598801 Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. 1598802 BBDR/WorN NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) RRID:RRRC_00094 Diabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation 1598803 BBNB/WorN NIH Autoimmune Rat Model Repository and Dev Ctr. Rat Resource and Research Center inbred Unknown (as of 2020-02-24) RRID:RRRC_00093 Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. 1598804 WKY.GHS-(D1Rat32-D1Mit32) Department of Medicine and Physiology, University of Rochester, Rochester New York congenic Unknown 1 112148733 250430505 1 - by flanking markers 1 202649657 272443364 1 - by flanking markers 1 195598053 265002735 1 - by flanking markers 1 244113147 244113296 1 - by flanking markers RRID:RGD_1598804 GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTL 1599674 BBDP.WF-(D8Rat59-D8Sunn1467)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 112242639 128970675 1 - by flanking markers 8 115112735 132425312 1 - by flanking markers 8 133272922 133273132 1 - by flanking markers 8 123815688 123815899 1 - by flanking markers RRID:RGD_1599674 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1599675 BBDP.WF-(D13Rat124-D13Mgh5)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown Ptprc 3451 13 46721037 63301552 1 - by flanking markers 13 55662705 71178960 1 - by flanking markers 13 50609228 66204630 1 - by flanking markers 13 45228358 61058078 1 - by flanking markers RRID:RGD_1599675 The BBDP/WorSunn rats were crossed with inbred WF rats (that share the same MHC haplotype as BBDP/WorSunn rats but differ at the CD45 allele) obtained from Charles River. Introgression of the WF CD45 (RT7.2) allele into BBDP/WorSunn was performed by phenotypic selection of backcross breeders for >10 generations, followed by intercrossing. This led to WF RT7.2 allele introgressed onto the genetic background of BBDP rats and also called BBDP/WorSunn.WF-CD45 inbred line. 1599755 F344.BN-(D16Mit5-D16Rat75) Department of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, Italy congenic Unknown 16 24131965 24132402 1 - by flanking markers 16 24112631 24112769 1 - by flanking markers 16 24228228 24228366 1 - by flanking markers 16 22477482 22477621 1 - by flanking markers RRID:RGD_1599755 BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segment 1599756 BN-Has2m1Mcwi PGA mutant Unknown Has2m1Mcwi 1599566 7 93230135 93256139 7 7 97055458 97081461 7 7 96438046 96464049 7 7 88113326 88139337 7 RRID:RGD_1599756 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA. 1599757 BN-Adora2am2Mcwi PhysGen mutant Extinct (as of 2016-10-24) Adora2am2Mcwi 1599561 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1599757 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a. 1599758 SS-Sod3m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2021-11-03) Sod3m1Mcwi 1599567 14 63381447 63387180 7 14 61071304 61083776 7 14 60958583 60971143 7 14 58610104 58615845 7 RRID:RRRC_00415 Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT. 1599759 GRY/Idr groggy rat National BioResource Project for the Rat in Japan, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan National BioResource Project for the Rat in Japan, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan inbred Cryopreserved Embryo (as of 2024-09-24) Neurobiology Cacna1agry 12880382 RRID:RGD_1599759 Groggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003. 1599760 SPRD.WKY-(D18Wox8-D18Rat44)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 18 19892650 86863412 1 - by flanking markers 18 20030289 86114102 1 - by flanking markers 18 20285758 87080053 1 - by flanking markers 18 19278901 83218561 1 - by flanking markers RRID:RGD_1599760 SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. 1599761 BN-Lcatm2Mcwi PGA mutant Unknown Lcatm2Mcwi 1599570 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RGD_1599761 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG. 1599762 SS-Bdkrb2m2Mcwi PGA mutant Unknown Bdkrb2m2Mcwi 1599568 6 129744781 129748851 7 6 138615812 138622272 7 6 129399468 129429676 7 6 124472317 124502497 7 RRID:RGD_1599762 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA. 1599763 SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 5 24978084 24978263 1 - by flanking markers 5 29109097 29109277 1 - by flanking markers RRID:RGD_1599763 SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. 1599764 COP.DA-(D16Rat12-D16Rat90)/Mco University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 16 350121 85734479 1 - by flanking markers 16 1084304 85597057 1 - by flanking markers 16 1090054 86162972 1 - by flanking markers 16 380245 80345693 1 - by flanking markers RRID:RGD_1599764 Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. 1599765 SS-Klf4m2Mcwi PGA mutant Unknown Klf4m2Mcwi 1599559 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RGD_1599765 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC. 1599766 SS-Hps6m1Mcwi PGA mutant Unknown Hps6m1Mcwi 1599564 1 251226344 251228953 7 1 273191755 273194364 7 1 265761818 265764427 7 1 244853256 244855865 7 RRID:RGD_1599766 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG. 1599767 SS-Htr1am2Mcwi PGA mutant Unknown Htr1am2Mcwi 1599562 2 36434518 36435786 7 2 55362662 55363930 7 2 36246628 36247896 7 2 36693462 36698026 7 RRID:RGD_1599767 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC. 1599768 SS-Klf4m1Mcwi PGA mutant Unknown Klf4m1Mcwi 1599569 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RGD_1599768 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC. 1599769 COP.DA-(D3Rat233-D3Mgh14)/Mco University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 3 118863100 118863223 1 - by flanking markers 3 130198712 130198834 1 - by flanking markers 3 123700322 123700444 1 - by flanking markers 3 118376416 118376539 1 - by flanking markers RRID:RGD_1599769 Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. 1600337 F344.GK-(D1Mgh14-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 263698966 267111153 1 - by flanking markers 1 285604773 289137268 1 - by flanking markers 1 278228767 281795785 1 - by flanking markers 1 256448513 259647894 1 - by flanking markers RRID:RGD_1600337 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600338 SHR.F344-(D12Mgh5-D12Mgh6)/Snk Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan congenic Unknown 12 29130180 42387195 1 - by flanking markers 12 33647399 33647522 1 - by flanking markers 12 31723565 31723688 1 - by flanking markers 12 28064433 28064557 1 - by flanking markers RRID:RGD_1600338 Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique 1600339 BN.GK-(D1Wox18-D1Got254)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 1 94626541 264367394 1 - by flanking markers 1 101198387 286341689 1 - by flanking markers 1 100133276 278978026 1 - by flanking markers 1 94644435 257091168 1 - by flanking markers RRID:RGD_1600339 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 1600340 DA/BklArbNsi Feinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NY Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00693 Originally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI. 1600341 LEW-Tg(Ren2)27/Jmul Wake Forest University School of Medicine, Winston-Salem, North Carolina transgenic Unknown RRID:RGD_1600341 This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl rats 1600342 F344.GK-(D1Got250-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 259168938 267111153 1 - by flanking markers 1 281200731 289137268 1 - by flanking markers 1 273787505 281795785 1 - by flanking markers 1 252080660 259647894 1 - by flanking markers RRID:RGD_1600342 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600343 SHRSP.WKY-(D1Wox29-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_1600343 This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy 1600344 F344.GK-(D1Rat175-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 267110921 267111153 1 - by flanking markers 1 289137107 289137268 1 - by flanking markers 1 281795624 281795785 1 - by flanking markers 1 259647732 259647894 1 - by flanking markers RRID:RGD_1600344 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600345 F344.GK-(D1Rat83-D1Rat376)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 252133623 252133935 1 - by flanking markers 1 274017004 274017147 1 - by flanking markers 1 266587077 266587220 1 - by flanking markers 1 245700955 245701099 1 - by flanking markers RRID:RGD_1600345 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600346 F344.GK-(D1Swe4-D1Rat85)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 255386328 258599658 1 - by flanking markers 1 277075545 280845045 1 - by flanking markers 1 269633949 273433763 1 - by flanking markers 1 248746112 251790570 1 - by flanking markers RRID:RGD_1600346 This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. 1600490 SS-Chr 1BN/Mcwi PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_1600490 A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed 1625284 Wild1/Hubr Hubrecht Laboratory, Utrecht, The Netherlands wild Unknown RRID:RGD_1625284 This rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolation 1626207 BN-Adora2am3Mcwi PhysGen mutant Extinct (as of 2016-10-24) Adora2am3Mcwi 1642070 20 13815719 13834131 7 20 16449385 16466147 7 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_1626207 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E207K mutation is generated from the codon change GAG/AAG of rat Adora2a. 1626210 BN-Lipem2Mcwi PGA mutant Unknown Lipem2Mcwi 1642169 1 80663791 80682480 7 1 83511504 83530200 7 1 82248031 82266727 7 1 80965612 80984313 7 RRID:RGD_1626210 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q52L mutation is generated from the codon change CTG/CAG. 1626211 SS-Cpf2m1Mcwi PGA mutant Unknown RRID:RGD_1626211 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. 1626213 BN-Oxtrm1Mcwi PGA mutant Unknown Oxtrm1Mcwi 1642173 4 148314089 148326797 7 4 207701360 207717840 7 4 144399326 144417598 7 4 145598549 145614674 7 RRID:RGD_1626213 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F225Y mutation is generated from the codon change TTC/TAC. 1626214 BN-Slc27a5m2Mcwi PGA mutant Unknown Slc27a5m2Mcwi 1642170 1 72924630 72935223 7 1 66387832 66398425 7 1 65576599 65587192 7 1 73616556 73627149 7 RRID:RGD_1626214 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K160E mutation is generated from the codon change AAA/GAA. 1641831 MWF-Chr 6SHR/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_1641831 MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 1641849 SS.LEW-(D10Mit1-D10Mgh1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 95368898 95369088 1 - by flanking markers 10 93929621 93929812 1 - by flanking markers RRID:RGD_1641849 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641850 SHR.WKY-(D1Got158-D1Got161)/Njs Department of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UK congenic Unknown Spon1 619918 1 169571535 169571693 1 - by flanking markers 1 183593063 183593220 1 - by flanking markers 1 176611942 176612099 1 - by flanking markers 1 165908744 165908902 1 - by flanking markers RRID:RGD_1641850 This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region 1641851 SHR.PD-(D8Rat42-D8Arb23)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16Lx 727921|12910834 8 51376771 52822796 1 - by flanking markers 8 51046971 52459221 1 - by flanking markers 8 52446316 53840120 1 - by flanking markers 8 48432652 49868959 1 - by flanking markers RRID:RGD_1641851 A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-Lx strain 1641852 WF.BBDR-(D4Got48-D4Got43)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65628995 68036772 1 - by flanking markers 4 65594194 133430955 1 - by flanking markers 4 65776688 68645203 1 - by flanking markers 4 66800270 69276226 1 - by flanking markers RRID:RGD_1641852 This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. 1641853 SS.LEW-(D10Mco38-D10Mgh1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 65122086 1 - by flanking markers 10 65339106 66856515 1 - by flanking markers RRID:RGD_1641853 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641854 HAS.LAS-(D5Rat70-D5Rat37)/Rar Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado congenic Unknown 5 36386126 148460381 1 - by flanking markers 5 40446731 151220567 1 - by flanking markers 5 35788756 147487820 1 - by flanking markers 5 35189153 141643988 1 - by flanking markers RRID:RGD_1641854 HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, 1641855 BBDP.WF-(D8Rat73-D8Rat20)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 94870319 1 - by flanking markers 8 94761016 96840283 1 - by flanking markers 8 95257972 97339444 1 - by flanking markers 8 88552647 90508589 1 - by flanking markers RRID:RGD_1641855 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641856 P.NP-(D4Rat119-D4Rat55)/Iusm Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 4 126192368 126192555 1 - by flanking markers RRID:RGD_1641856 iP and iNP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection 1641857 BBDP.WF-(D8Rat16-D8Sunn1467)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 98878516 128970675 1 - by flanking markers 8 100780886 132425312 1 - by flanking markers 8 101304999 133273132 1 - by flanking markers 8 94388671 123815899 1 - by flanking markers RRID:RGD_1641857 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641858 SHR.WKY-(D1Rat420-D1Rat278)/Njs Department of Cardiovascular Sciences, University of Leicester, Glenfield Hospital, UK congenic Unknown 1 167931247 168930831 1 - by flanking markers 1 181904343 182965674 1 - by flanking markers 1 174905726 175980872 1 - by flanking markers 1 164310419 165279420 1 - by flanking markers RRID:RGD_1641858 This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region 1641859 SS.MNS-(D10Bra1-D10Mit11)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers RRID:RGD_1641859 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641860 SS.MNS-(D10Mco62-D10Mit1)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 95369088 1 - by flanking markers 10 70763267 93929812 1 - by flanking markers RRID:RGD_1641860 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641861 HAS.LAS-(D2Rat53-D2Rat138)/Rar Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 2 204077549 230157845 1 - by flanking markers 2 230770662 256283467 1 - by flanking markers 2 211301116 237742948 1 - by flanking markers 2 196146703 221167075 1 - by flanking markers RRID:RRRC_00729 HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, 1641862 F344-ApcPirc/Uwm University of Wisconsin-Madison, Madison, Wisconsin A substrain with F344/NHsd background is deposit at Rat Resource and Research Center mutant Live Animals; Cryopreserved Sperm (as of 2018-07-16) ApcPirc 1554322 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RRRC_00782 Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam) 1641863 SHR.PD-(D8Mgh9-D8Rat149)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16Lx 727921|12910834 8 58692901 58693265 1 - by flanking markers 8 58297648 58297798 1 - by flanking markers 8 59716199 59716349 1 - by flanking markers 8 55523877 55524028 1 - by flanking markers RRID:RGD_1641863 A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv. 1641864 WF/CrCrli Charles River Laboratories Italy Charles River Laboratories Italy inbred Unknown RRID:RGD_1641864 J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute. 1641865 SD-Brca2m1Uwm University of Wisconsin-Madison, Madison, Wisconsin Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca2m1Uwm 728326 12 4282952 4323693 7 12 490733 535090 7 12 518257 518257 8 12 74070 74070 8 RRID:RRRC_00286 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. Nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon). 1641866 SS.LEW-(D10Mit10-D10Rat24)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 79229233 1 - by flanking markers 10 27082535 78195122 1 - by flanking markers 10 27237530 78343192 1 - by flanking markers 10 26521957 75632053 1 - by flanking markers RRID:RGD_1641866 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641867 Iusm:P alcohol-preferring Indiana Alcohol Research Center at the Indiana University School of Medicine outbred Unknown Snca 3729 RRID:RGD_1641867 These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop this preference line (P) and non-preference line (Iusm:NP, RGD:1641873). 1641868 WF.BBDR-(D4Rat93-D4Rat228)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown Tcrb 3834 4 67390393 67390598 1 - by flanking markers 4 67470286 67470490 1 - by flanking markers 4 67663300 67663504 1 - by flanking markers 4 68653456 68653663 1 - by flanking markers RRID:RGD_1641868 This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. 1641869 SS.MNS-(D10Mco31-D10Mit11)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 84284413 101848683 1 - by flanking markers 10 83219971 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 10 80536974 80537228 1 - by flanking markers RRID:RGD_1641869 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641870 BBDP.WF-(D8Rat73-D8Rat121)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 118705380 1 - by flanking markers 8 94761016 121648073 1 - by flanking markers 8 95257972 95258175 1 - by flanking markers 8 88552647 88552853 1 - by flanking markers RRID:RGD_1641870 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641871 SS.MNS-(D10Mco62-D10Mco31)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 84284667 1 - by flanking markers 10 70763267 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 10 80536974 80537228 1 - by flanking markers RRID:RGD_1641871 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641872 SS.LEW-(D10Mco38-D10Mco41)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 85793448 1 - by flanking markers 10 65339106 84798381 1 - by flanking markers 10 85007626 85007896 1 - by flanking markers 10 82057244 82057515 1 - by flanking markers RRID:RGD_1641872 This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1641873 Iusm:NP alcohol-nonpreferring Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown Snca 3729 RRID:RGD_1641873 These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop a preference line (Iusm:P, RGD:1641867) and this non-preference line (Iusm:NP). 1641874 BBDP.WF-(D8Rat73-D8Rat90)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 114974688 1 - by flanking markers 8 94761016 118204000 1 - by flanking markers 8 95257972 118862813 1 - by flanking markers 8 88552647 110572221 1 - by flanking markers RRID:RGD_1641874 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641875 SHR-Chr YBN/Cub Czech Academy of Sciences, Prague, Czech Republic consomic Unknown RRID:RGD_1641875 BN-Lx/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations 1641876 BBDP.WF-(D8Rat73-D8Sunn1467)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 128970675 1 - by flanking markers 8 94761016 132425312 1 - by flanking markers 8 95257972 133273132 1 - by flanking markers 8 88552647 123815899 1 - by flanking markers RRID:RGD_1641876 WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP 1641877 NP.P-(D4Rat119-D4Rat55)/Iusm Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown Akr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap1 2092|3197|3729|68368|735049|1307836|1308501|1310949|1311418 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 4 126192368 126192555 1 - by flanking markers RRID:RGD_1641877 Male iP and female iNP rats were crossed to get F1 animals which were further backcrossed to iNP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection 1641878 WF.BBDR-(Clcn1-D4Rat228)/Wor University of Massachusetts Medical School, Worcerster, MA congenic Unknown Clcn1 2360 4 70052319 70081449 1 - by flanking markers 4 136479719 136509472 1 - by flanking markers 4 71674218 71704318 1 - by flanking markers 4 71171949 71201483 1 - by flanking markers RRID:RGD_1641878 This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. 1641879 SS-Chr 19SHR/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_1641879 SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 1641880 SD-Brca1m1Uwm University of Wisconsin-Madison, Madison, Wisconsin Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca1|Brca1m1Uwm 2218|728298 10 90513630 90572676 7 10 89192653 89252760 7 10 89394821 89455093 7 10 86417441 86477762 7 RRID:RRRC_00285 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon. 1642017 BBDR/WorBrm Biomedical Research Models, Inc. Biomedical Research Models, Inc. inbred Unknown RRID:RGD_1642017 Diabetes resistant BB rats maintained in BRM. This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at Biomedical Research Models, Inc. 1642018 BBDP/WorBrm Biomedical Research Models, Inc. Biomedical Research Models, Inc. inbred Unknown RRID:RGD_1642018 This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester. 1642036 SHR/OlaIpcv-mtBN/Crl Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic conplastic Unknown RRID:RGD_1642036 Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic background 1642269 SS-Birc3m2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Birc3m2Mcwi 1642178 8 4682202 4696856 7 8 6047454 6075236 7 8 6048590 6076828 7 8 5000844 5028470 7 RRID:RGD_1642269 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K170E mutation is generated from the codon change AAG/GAG. 1642270 BN-Lcatm3Mcwi PGA Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery Lcatm3Mcwi 1642175 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00397 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC. 1642271 SS-Klf4m3Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klf4m3Mcwi 1642179 5 73446928 73451286 7 5 76447643 76452001 7 5 72283311 72287669 7 5 70278843 70283751 7 RRID:RRRC_00417 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H344L mutation is generated from the codon change CAT/CTT. 1642272 SS.LEW-(D10Mco84-D10Got93)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 72827158 1 - by flanking markers 10 69542746 71779712 1 - by flanking markers 10 69910832 71870652 1 - by flanking markers 10 67502108 69424978 1 - by flanking markers RRID:RGD_1642272 This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642273 SS-Thbdm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Thbdm1Mcwi 1642182 3 137158955 137162607 7 3 149159895 149163547 7 3 142748673 142752325 7 3 135863366 135867018 7 RRID:RGD_1642273 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N256K mutation is generated from the codon change AAC/AAA. 1642274 SS-Has1m2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Has1m2Mcwi 1642171 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1642274 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V155L mutation is generated from the codon change GTC/CTC. 1642275 SS.LEW-(D10Rat29-D10Mco88)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 71513333 1 - by flanking markers 10 67642121 71109330 1 - by flanking markers 10 67988035 70647306 1 - by flanking markers 10 68230134 68230352 1 - by flanking markers RRID:RGD_1642275 This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642276 SS-Kcna5m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcna5m1Mcwi 1642177 4 162896283 162898091 7 4 226075051 226076859 7 4 159077195 159079003 7 4 159354689 159358173 7 RRID:RRRC_00418 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N152K mutation is generated from the codon change AAT/AAA. 1642277 SS-Cpt2m1Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cpt2m1Mcwi 1642174 5 129007685 129025501 7 5 131353542 131370821 7 5 127505646 127523016 7 5 122664677 122682126 7 RRID:RRRC_00416 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F475L mutation is generated from the codon change TTC/CTC. 1642278 SS-Ghsrm2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ghsrm2Mcwi 1642180 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RGD_1642278 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S342P mutation is generated from the codon change TCC/CCC. 1642279 SS.LEW-(D10Arb9-D10Rat161)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 97589703 1 - by flanking markers 10 66048908 96133217 1 - by flanking markers 10 65590122 65590250 1 - by flanking markers 10 63221094 63221223 1 - by flanking markers RRID:RGD_1642279 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642281 SS-Podxlm1Mcwi PhysGen mutant Extinct (as of 2017-01-26) Podxlm1Mcwi 1642176 4 58611904 58658598 7 4 58581513 58645671 7 4 58829049 58893353 7 4 60135124 60181829 7 RRID:RGD_1642281 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA. 1642282 SS-Cacna1gm1Mcwi PGA mutant Unknown Cacna1gm1Mcwi 1642168 10 83043636 83112886 7 10 81950594 82017885 7 10 82129071 82197828 7 10 79354998 79422960 7 RRID:RGD_1642282 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S490T mutation is generated from the codon change TCT/ACT. 1642283 SS.LEW-(D10Rat29-D10Got93)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 72827158 1 - by flanking markers 10 67642121 71779712 1 - by flanking markers 10 67988035 71870652 1 - by flanking markers 10 69424852 69424978 1 - by flanking markers RRID:RGD_1642283 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642284 SS-Fgl2m2Mcwi PGA mutant Unknown Fgl2m2Mcwi 1642181 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1642284 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K129N mutation is generated from the codon change AAG/AAT. 1642285 SS.LEW-(D10Arb9-D10Rat57)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 74388696 1 - by flanking markers 10 66048908 73484175 1 - by flanking markers 10 65590122 73582866 1 - by flanking markers 10 63221094 70982751 1 - by flanking markers RRID:RGD_1642285 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642287 SS.LEW-(D10Arb9-D10Mco84)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 70757419 1 - by flanking markers 10 66048908 69542910 1 - by flanking markers 10 65590122 69910996 1 - by flanking markers 10 63221094 67502273 1 - by flanking markers RRID:RGD_1642287 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642288 SS.LEW-(D10Mco89-D10Got101)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72684998 78262332 1 - by flanking markers 10 71638135 77223025 1 - by flanking markers 10 71727774 77360263 1 - by flanking markers 10 69282350 74676620 1 - by flanking markers RRID:RGD_1642288 This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642289 SS-Serpina5m1Mcwi PGA mutant Unknown Serpina5m1Mcwi 1642167 6 128156901 128161334 7 6 136972583 136990812 7 6 127753152 127772403 7 6 123009224 123028412 7 RRID:RGD_1642289 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H24R mutation is generated from the codon change CAT/CGT. 1642362 SS-Has1m3Mcwi PGA mutant Unknown Has1m3Mcwi 1642359 1 56503365 56516133 7 1 60640270 60652067 7 1 59720612 59732409 7 1 58693411 58705653 7 RRID:RGD_1642362 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D167D mutation is generated from the codon change GAT/GAC. 1642363 BN-Fgl2m3Mcwi PGA mutant Unknown Fgl2m3Mcwi 1642355 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RGD_1642363 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N353H mutation is generated from the codon change AAT/CAT. 1642364 SS-Ghsrm3Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsrm3Mcwi 1642357 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RRRC_00421 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N26K mutation is generated from the codon change AAC/AAA. 1642365 SS-Fgl2m4Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fgl2m4Mcwi 1642354 4 9176333 9181976 7 4 10315666 10321309 7 4 10323598 10329241 7 4 13710566 13716207 7 RRID:RRRC_00420 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H338P mutation is generated from the codon change CAT/CCT. 1642366 SS-Lcatm4Mcwi PhysGen, Rat Resource & Research Center mutant Extinct (as of 2017-01-26) Lcatm4Mcwi 1642358 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RGD_1642366 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT. 1642367 BN-Ccr2m2Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ccr2m2Mcwi 1642356 8 128892784 128893905 7 8 123734465 123742483 7 RRID:RGD_1642367 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I99T mutation is generated from the codon change ATC/ACC. 1642439 SS-Lcatm5Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcatm5Mcwi 1642438 19 35781507 35784966 7 19 48780364 48783830 7 19 37913333 37916799 7 19 33834748 33838214 7 RRID:RRRC_00419 Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y297Stop mutation is generated from the codon change TAC/TAA. 1642689 BN.OLETF-(D1Rat169-D1Rat90)/Got Otsuka Pharmacuetical Company, Tokushima, Japan congenic Unknown Prlhr 71037 1 229876870 267111153 1 - by flanking markers 1 251652807 289137268 1 - by flanking markers 1 244401175 281795785 1 - by flanking markers 1 224054293 259647894 1 - by flanking markers RRID:RGD_1642689 OLETF/Got females were crossed with BN/Crlj to produce F1 which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotyped 1642690 LA-cp/NJcr Department of Surgery, University of Alberta, Edmonton, Canada congenic Unknown RRID:RGD_1642690 Originated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta. 1642968 SS.LEW-(D10Mco84-D10Rat58)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 71067824 1 - by flanking markers 10 69542746 70966782 1 - by flanking markers 10 69910832 70202084 1 - by flanking markers 10 67502108 67785171 1 - by flanking markers RRID:RGD_1642968 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642969 SS.LEW-(D10Mco84-D10Mco134)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642969 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642970 SS.LEW-(D10Mco113-D10Got93)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72827032 72827158 1 - by flanking markers 10 71779587 71779712 1 - by flanking markers 10 71870527 71870652 1 - by flanking markers 10 69424852 69424978 1 - by flanking markers RRID:RGD_1642970 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642971 SS.LEW-(D10Mco84-D10Mco129)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642971 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642972 SS.LEW-(D10Mco84-D10Mco143)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 10 67502108 67502273 1 - by flanking markers RRID:RGD_1642972 This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 1642989 SS-Tg(CAG-EGFP)1Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Cryopreserved Sperm (as of 2019-04-04) RRID:RGD_1642989 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642990 SD-Tg(CAG-EGFP)63Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642990 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. 1642991 SS-Tg(CAG-eGFP)18Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642991 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642992 SS-Tg(CAG-EGFP)28Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642992 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642993 SD-Tg(CAG-EGFP)97Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642993 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. 1642994 SS-Tg(CAG-EGFP)43Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642994 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642995 SS-Tg(CAG-eGFP)10Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642995 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642996 SS-Tg(CAG-EGFP)2Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642996 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1642997 SS-Tg(CAG-EGFP)23Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_1642997 This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. 1643001 FH/Unc Fawn-hooded Department of Psychiatry, University of North Carolina, Chapel Hill, North Carolina inbred Unknown RRID:RGD_1643001 A substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hill 1643002 SHR.WKY-(D1Rat420-D1Got161)/Njs Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Spon1 619918 1 167931247 167931390 1 - by flanking markers 1 181904343 181904486 1 - by flanking markers 1 174905726 174905869 1 - by flanking markers 1 164310419 164310563 1 - by flanking markers RRID:RGD_1643002 Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR 1643007 DA.ACI-(D12Wox12-D12Rat53)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 12 20932555 43863270 1 - by flanking markers 12 24663002 50380790 1 - by flanking markers 12 22650721 48598906 1 - by flanking markers 12 19610889 42828880 1 - by flanking markers RRID:RGD_1643007 ACI/SegHsd and DA/OlaHsd were crossed to get F2 animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsd 1643010 F344.OLETF-(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj University of Tokushima Graduate School, Kuramato-cho, Tokushima, Japan congenic Unknown RRID:RGD_1643010 double congenic strain generated by intercrossing F344.OLETF-(D7Rat18-D7Mit2)/Tj and F344.OLETF-(D14Rat23-D14Rat12)/Tj and F2 rats screened for homozygosity 2289819 SS.MNS-(D10Mco62-D10Got99)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 76465800 1 - by flanking markers 10 70763267 74612561 1 - by flanking markers 10 75493824 75493944 1 - by flanking markers 10 72964095 72964216 1 - by flanking markers RRID:RGD_2289819 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289820 SS.MNS-(D10Mco30-D10Got91)/1Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289820 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289821 SS.MNS-(D10Mco30-D10Got91)/3Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289821 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289822 SS.MNS-(D10Mco30-D10Got112)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 79857935 1 - by flanking markers 10 73693979 78816367 1 - by flanking markers 10 76420583 78970405 1 - by flanking markers 10 73887148 76246212 1 - by flanking markers RRID:RGD_2289822 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289823 SS.MNS-(D10Mco62-D10Mco30)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 77547622 1 - by flanking markers 10 70763267 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289823 This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289824 SS.MNS-(D10Mco30-D10Got101)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78262332 1 - by flanking markers 10 73693979 77223025 1 - by flanking markers 10 76420583 77360263 1 - by flanking markers 10 73887148 74676620 1 - by flanking markers RRID:RGD_2289824 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289825 SS.MNS-(D10Rat24-D10Mco31)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 79229067 84284667 1 - by flanking markers 10 78194957 83220224 1 - by flanking markers 10 78343027 83411656 1 - by flanking markers 10 75631887 80537228 1 - by flanking markers RRID:RGD_2289825 This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289826 SS.MNS-(D10Mco30-D10Got91)/2Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 10 73887148 73887455 1 - by flanking markers RRID:RGD_2289826 This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289827 SS.MNS-(D10Mco30-D10Mco31)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 84284667 1 - by flanking markers 10 73693979 83220224 1 - by flanking markers 10 76420583 83411656 1 - by flanking markers 10 73887148 80537228 1 - by flanking markers RRID:RGD_2289827 This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289913 SS.MNS-(D10Rat13-D10Rat12)/Jr Medical College of Ohio, Toledo congenic Unknown 10 97152234 99198997 1 - by flanking markers 10 95701164 97759008 1 - by flanking markers 10 95967019 98044833 1 - by flanking markers 10 92698959 94725019 1 - by flanking markers RRID:RGD_2289913 This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289916 SS.MNS-(D10Mco15-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 98392296 101848683 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 10 93995749 93995963 1 - by flanking markers RRID:RGD_2289916 This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2289917 SS.MNS-(D10Mco70-D10Mit11)/Jr Medical College of Ohio, Toledo congenic Unknown 10 101355656 101848683 1 - by flanking markers 10 99976910 99977168 1 - by flanking markers 10 100287441 100287699 1 - by flanking markers 10 96836006 96836268 1 - by flanking markers RRID:RGD_2289917 This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2290056 F344-Elmod3Tn(sb-T2/Bart3)2.42Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Elmod3Tn(sb-T2/Bart3)2.42Mcwi 2290055 4 105866419 106099850 7 4 165192607 165237016 7 4 100422256 100465152 7 4 104614665 104653122 7 RRID:RRRC_00423 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Rbed1 gene. 2290057 F344-TgTn(T2/Bart3)1Ceb PGA transgenic Cryopreserved Sperm RRID:RGD_2290057 The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. 2290064 F344-Trpc4Tn(sb-T2/Bart3)2.192Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Trpc4Tn(sb-T2/Bart3)2.192Mcwi 2290060 2 143350286 143485716 7 2 163115873 163282223 7 2 143433102 143605757 7 2 138307676 138476856 7 RRID:RRRC_00344 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. 2290065 F344-CA338503Tn(sb-T2/Bart3)2.196Mcwi PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.196Mcwi 2290059 RRID:RGD_2290065 this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD: 2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). 2290066 F344-Nell1Tn(sb-T2/Bart3)2.195Mcwi PGA mutant Unknown Nell1Tn(sb-T2/Bart3)2.195Mcwi 2290061 1 99805922 100758002 7 1 106397933 107260905 7 1 105348577 106218970 7 1 99709305 100573872 7 RRID:RGD_2290066 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the second intron of the Nell1. 2290067 F344-BI285226Tn(sb-T2/Bart3)2.193Mcwi PGA mutant Unknown BI285226Tn(sb-T2/Bart3)2.193Mcwi 2290062 RRID:RGD_2290067 this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). 2290078 F344-Myo9aTn(sb-T2/Bart3)2.186Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Myo9aTn(sb-T2/Bart3)2.186Mcwi 2290068 8 63578001 63783813 7 8 64335907 64534890 7 8 64573248 64777607 7 8 60149234 60352330 7 RRID:RRRC_00385 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene. 2290079 F344-BI285226Tn(sb-T2/Bart3)2.194Mcwi PGA mutant Unknown BI285226Tn(sb-T2/Bart3)2.194Mcwi 2290069 RRID:RGD_2290079 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290080 F344-BI284938Tn(sb-T2/Bart3)2.187Mcwi PGA mutant Unknown BI284938Tn(sb-T2/Bart3)2.187Mcwi 2290074 RRID:RGD_2290080 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290081 F344-BI284934Tn(sb-T2/Bart3)2.185Mcwi PGA Rat Resource & Research Center mutant Cryopreserved Sperm BI284934Tn(sb-T2/Bart3)2.185Mcwi 2290072 RRID:RRRC_00367 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290082 F344-Brinp3Tn(sb-T2/Bart3)2.189Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Brinp3Tn(sb-T2/Bart3)2.189Mcwi 2290071 13 60584348 61024196 7 13 68507826 68938032 7 13 63526486 63959390 7 13 58413883 58846828 7 RRID:RRRC_00425 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. 2290083 F344-Slc24a3Tn(sb-T2/Bart3)2.188Mcwi PGA mutant Unknown Slc24a3Tn(sb-T2/Bart3)2.188Mcwi 2290073 3 133734890 134249326 7 3 145760074 146259491 7 3 139333942 139835728 7 3 132552119 133051192 7 RRID:RGD_2290083 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene. 2290100 F344-Entpd6Tn(sb-T2/Bart3)2.174Mcwi PGA mutant Unknown Entpd6Tn(sb-T2/Bart3)2.174Mcwi 2290086 3 141385480 141407860 7 3 152905464 152927857 7 3 146546424 146568828 7 3 139575659 139598163 7 RRID:RGD_2290100 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Entpd6 gene. 2290101 F344-CB706876Tn(sb-T2/Bart3)2.181Mcwi PGA mutant Unknown CB706876Tn(sb-T2/Bart3)2.181Mcwi 2290092 RRID:RGD_2290101 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290102 F344-Klhl13Tn(sb-T2/Bart3)2.176Mcwi PGA mutant Unknown Klhl13Tn(sb-T2/Bart3)2.176Mcwi 2290085 X 10344050 10424665 7 X 121716856 121876640 7 X 121578965 121735014 7 X 113942309 114107299 7 RRID:RGD_2290102 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene. 2290103 F344-Nrg1Tn(sb-T2/Bart3)2.183Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrg1Tn(sb-T2/Bart3)2.183Mcwi 2290090 16 63937796 64126183 7 16 62632432 63718738 7 16 62969573 64065063 7 16 59250658 60304519 7 RRID:RRRC_00343 this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb and F344-Tg(PGK2-sb11)Ceb. This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene. 2290104 F344-Cadm2Tn(sb-T2/Bart3)2.180Mcwi PGA mutant Unknown Cadm2Tn(sb-T2/Bart3)2.180Mcwi 2290088 11 4273771 5330393 7 11 7871257 8090100 7 11 4175078 4397335 7 11 4548367 5525420 7 RRID:RGD_2290104 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. 2290105 F344-Sptbn4Tn(sb-T2/Bart3)2.179Mcwi PGA mutant Unknown Sptbn4Tn(sb-T2/Bart3)2.179Mcwi 2290097 1 82436626 82523827 7 1 85379609 85467354 7 1 84168494 84254679 7 1 82650750 82738345 7 RRID:RGD_2290105 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. 2290106 F344-BQ195794Tn(sb-T2/Bart3)2.182Mcwi PGA mutant Unknown BQ195794Tn(sb-T2/Bart3)2.182Mcwi 2290070 RRID:RGD_2290106 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290107 F344-CyssTn(sb-T2/Bart3)2.173Mcwi PGA mutant Unknown CyssTn(sb-T2/Bart3)2.173Mcwi 2290095 3 138826625 138830963 7 3 150801395 150805733 7 3 144427430 144431768 7 3 137432049 137436654 7 RRID:RGD_2290107 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyss gene. 2290108 F344-LOC290071Tn(sb-T2/Bart3)2.170Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LOC290071Tn(sb-T2/Bart3)2.170Mcwi 2290089 15 30634899 32273880 7 RRID:RRRC_00338 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene. 2290109 F344-CA338503Tn(sb-T2/Bart3)2.168Mcwi PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.168Mcwi 2290087 RRID:RGD_2290109 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290110 F344-Lims1Tn(sb-T2/Bart3)2.169Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lims1Tn(sb-T2/Bart3)2.169Mcwi 2290096 20 37349188 37397427 7 20 29715580 29824252 7 20 27895981 28004767 7 20 26309833 26418511 7 RRID:RRRC_00362 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. 2290111 F344-Cst3Tn(sb-T2/Bart3)2.172Mcwi PGA mutant Unknown Cst3Tn(sb-T2/Bart3)2.172Mcwi 2290093 3 137650903 137654776 7 3 149628692 149632565 7 3 143219671 143223544 7 3 136336923 136340796 7 RRID:RGD_2290111 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cst3 gene. 2290112 F344-CA338503Tn(sb-T2/Bart3)2.175Mcwi PGA mutant Unknown CA338503Tn(sb-T2/Bart3)2.175Mcwi 2290094 RRID:RGD_2290112 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290113 F344-Fam19a2Tn(sb-T2/Bart3)2.184Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam19a2Tn(sb-T2/Bart3)2.184Mcwi 2290098 7 63388665 63566226 7 7 66221368 66695803 7 7 66017066 66496690 7 7 58942598 59418640 7 RRID:RRRC_00387 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. 2290114 F344-Slc24a3Tn(sb-T2/Bart3)2.178Mcwi PGA mutant Unknown Slc24a3Tn(sb-T2/Bart3)2.178Mcwi 2290091 3 133734890 134249326 7 3 145760074 146259491 7 3 139333942 139835728 7 3 132552119 133051192 7 RRID:RGD_2290114 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene. 2290135 F344-Chsy1Tn(sb-T2/Bart3)2.165Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Chsy1Tn(sb-T2/Bart3)2.165Mcwi 2290123 1 120539002 120600102 7 1 128095353 128156041 7 1 127010587 127071570 7 1 119689626 119750711 7 RRID:RRRC_00337 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Chsy1. 2290136 F344-Slc24a4Tn(sb-T2/Bart3)2.145Mcwi PGA mutant Unknown Slc24a4Tn(sb-T2/Bart3)2.145Mcwi 2290127 6 126403837 126538501 7 6 135226112 135364945 7 6 126015799 126158727 7 6 121279590 121419811 7 RRID:RGD_2290136 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a4 gene. 2290137 F344-BF522453Tn(sb-T2/Bart3)2.166Mcwi PGA Rat Resource & Research Center mutant Cryopreserved Sperm BF522453Tn(sb-T2/Bart3)2.166Mcwi 2290126 RRID:RRRC_00361 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290138 F344-Glis1Tn(sb-T2/Bart3)2.149Mcwi PGA mutant Extinct (as of 2016-12-12) Glis1Tn(sb-T2/Bart3)2.149Mcwi 2290128 5 128736183 128739369 7 5 130891667 131081696 7 5 127043344 127233395 7 5 122222155 122412141 7 RRID:RRRC_00332 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. 2290139 F344-AW527406Tn(sb-T2/Bart3)2.156Mcwi PGA mutant Unknown AW527406Tn(sb-T2/Bart3)2.156Mcwi 2290122 RRID:RGD_2290139 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290140 F344-BI285110Tn(sb-T2/Bart3)2.167Mcwi PGA mutant Unknown BI285110Tn(sb-T2/Bart3)2.167Mcwi 2290115 RRID:RGD_2290140 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290141 F344-AbatTn(sb-T2/Bart3)2.163Mcwi PGA, Transposagen. Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2016-11-11) AbatTn(sb-T2/Bart3)2.163Mcwi 2290121 10 7040725 7137154 7 10 5894187 6002068 7 10 7093406 7200439 7 10 6996688 7092835 7 RRID:RRRC_00381 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene. 2290142 F344-LOC681893Tn(sb-T2/Bart3)2.161Mcwi PGA mutant Unknown LOC681893Tn(sb-T2/Bart3)2.161Mcwi 2290118 RRID:RGD_2290142 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. 2290143 F344-NapbTn(sb-T2/Bart3)2.162Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) NapbTn(sb-T2/Bart3)2.162Mcwi 2290116 3 137447072 137490500 7 3 149431212 149473190 7 3 143017571 143063904 7 3 136132248 136179280 7 RRID:RRRC_00335 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. 2290144 F344-Adgrl3Tn(sb-T2/Bart3)2.151Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adgrl3Tn(sb-T2/Bart3)2.151Mcwi 2290129 14 28385112 28854677 7 14 28183727 29040121 7 14 28362176 29226085 7 14 26336320 27104060 7 RRID:RRRC_00334 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 gene. 2290145 F344-BI284938Tn(sb-T2/Bart3)2.155Mcwi PGA mutant Unknown BI284938Tn(sb-T2/Bart3)2.155Mcwi 2290120 RRID:RGD_2290145 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2290146 F344-Plce1Tn(sb-T2/Bart3)2.146Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plce1Tn(sb-T2/Bart3)2.146Mcwi 2290125 1 242794858 243103437 7 1 264652842 264956664 7 1 257156023 257465440 7 1 236243445 236552571 7 RRID:RRRC_00380 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene. 2290147 F344-Sptlc3Tn(sb-T2/Bart3)2.147Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Sptlc3Tn(sb-T2/Bart3)2.147Mcwi 2290124 3 127691668 127825206 7 3 139023075 139151792 7 3 132560437 132689313 7 3 126847878 126978010 7 RRID:RRRC_00331 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Sptlc3 gene. 2290148 F344-Map2k5Tn(sb-T2/Bart3)2.150Mcwi PGA mutant Extinct (as of 2016-12-21) Map2k5Tn(sb-T2/Bart3)2.150Mcwi 2290117 8 67313472 67542723 7 8 67784868 68010809 7 8 68055976 68282656 7 8 63625220 63852090 7 RRID:RRRC_00333 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. 2290159 F344-Spetex-2HTn(sb-T2/Bart3)2.136Mcwi PGA mutant Unknown Spetex-2HTn(sb-T2/Bart3)2.136Mcwi 2290150 15 5180002 5186910 7 RRID:RGD_2290159 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Spetex-2H gene. 2290160 F344-Rph3aTn(sb-T2/Bart3)2.104Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rph3aTn(sb-T2/Bart3)2.104Mcwi 2290154 12 36678613 36753316 7 12 42938832 43014142 7 12 41073296 41149799 7 12 35542389 35618901 7 RRID:RRRC_00326 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene. 2290161 F344-Tmco1Tn(sb-T2/Bart3)2.135Mcwi PGA mutant Extinct (as of 2017-01-30) Tmco1Tn(sb-T2/Bart3)2.135Mcwi 2290156 13 82971926 82995262 7 13 90108152 90202246 7 13 85465015 85559113 7 13 79460229 79483557 7 RRID:RRRC_00328 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene. 2290162 F344-Inpp4bTn(sb-T2/Bart3)2.143Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Inpp4bTn(sb-T2/Bart3)2.143Mcwi 2290149 19 27722430 28363639 7 19 40508684 41132035 7 19 29592889 30341528 7 19 25920189 26670085 7 RRID:RRRC_00379 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. 2290163 F344-TgTn(T2/Bart3)2Ceb transposon sleeping beauty PGA transgenic Extinct (as of 2016-11-14) RRID:RGD_2290163 The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. 2290164 F344-Syne1Tn(sb-T2/Bart3)2.68Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Syne1Tn(sb-T2/Bart3)2.68Mcwi 2290153 1 35803552 36269628 7 1 42947742 43158478 7 1 41608287 42086662 7 1 41512146 41983382 7 RRID:RRRC_00325 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109th intron of the Syne1 gene. 2290165 F344-NtmTn(sb-T2/Bart3)2.130Mcwi PGA mutant Extinct (as of 2017-01-24) NtmTn(sb-T2/Bart3)2.130Mcwi 2290157 8 28587019 29019888 7 8 30073163 31070882 7 8 30039332 31041755 7 8 27376582 28366604 7 RRID:RRRC_00327 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene. 2290166 F344-Plcb3Tn(sb-T2/Bart3)2.69Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plcb3Tn(sb-T2/Bart3)2.69Mcwi 2290155 1 209628425 209643694 7 1 229198739 229215831 7 1 222207887 222224993 7 1 204143257 204160384 7 RRID:RRRC_00424 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene. 2290167 F344-Dlg1Tn(sb-T2/Bart3)2.133Mcwi PGA mutant Unknown Dlg1Tn(sb-T2/Bart3)2.133Mcwi 2290152 11 70735283 70930374 7 11 75239783 75454358 7 11 72164566 72378895 7 11 68911883 69103230 7 RRID:RGD_2290167 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Dlg1 gene. 2290168 F344-Pde5aTn(sb-T2/Bart3)2.144Mcwi PGA mutant Extinct (as of 2017-01-24) Pde5aTn(sb-T2/Bart3)2.144Mcwi 2290151 2 219410394 219550910 7 2 246260843 246406296 7 2 226899604 227044916 7 2 210858515 211003480 7 RRID:RRRC_00330 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). The trap construct targeted to the 4th intron of the Pde5a gene. 2290169 F344-Tg(PGK2-sb11)Ceb Sleeping beauty transposase transgenic PGA transgenic Extinct (as of 2016-11-14) RRID:RGD_2290169 sb11 cDNA linked to human PGK2 promoter was used. 2290170 F344-Cd226Tn(sb-T2/Bart3)2.141Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cd226Tn(sb-T2/Bart3)2.141Mcwi 2290158 18 86064574 86157909 7 18 85337942 85433295 7 18 86299392 86394772 7 18 82449924 82545107 7 RRID:RRRC_00329 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Cd226 gene. 2290171 F344-LOC681893Tn(sb-T2/Bart3)2.159Mcwi PGA mutant Unknown LOC681893Tn(sb-T2/Bart3)2.159Mcwi 2290119 RRID:RGD_2290171 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. 2290186 SD-Tg(SOD1*G93A)39 Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 RRID:RGD_2290186 SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation 2290187 SD-Tg(SOD1*H46R)4 Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 RRID:RGD_2290187 SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutation 2290272 SS/JrNgs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2290272 strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan 2290273 SHRSP.WKY-(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension RRID:RGD_2290273 The desired fragment is transferred from WKY to SHRSP 2290274 SHRSP.WKY-(D15Rat2-D15Rat94)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 11832728 76115762 1 - by flanking markers 15 15643978 80627247 1 - by flanking markers 15 11605245 77072316 1 - by flanking markers 15 10355054 69625966 1 - by flanking markers RRID:RGD_2290274 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290275 SHRSP.WKY-(D3Tkyo7-D3Rat1)/Tkyo National Bio Resource Project Japan National Bio Resource Project Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 170016252 170016653 1 - by flanking markers 3 180127863 180128021 1 - by flanking markers 3 176417943 176418101 1 - by flanking markers 3 168026691 168026850 1 - by flanking markers RRID:RGD_2290275 The desired fragment is transferred from WKY to SHRSP 2290276 SHRSP.WKY-(D3Mgh16-D3Mgh15)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 118757096 1 - by flanking markers 3 11361699 130099054 1 - by flanking markers 3 6000748 123599709 1 - by flanking markers 3 10778704 118275626 1 - by flanking markers RRID:RGD_2290276 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290277 SHRSP.WKY-(D3Rat227-D3Rat166)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 101359980 1 - by flanking markers 3 50522686 113470358 1 - by flanking markers 3 45406058 106900596 1 - by flanking markers 3 43827364 102200699 1 - by flanking markers RRID:RGD_2290277 The desired fragment is transferred from WKY to SHRSP 2290278 SR/JrNgs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2290278 strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan 2290279 SHRSP.WKY-(D15Rat68-D15Rat106)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 106177917 1 - by flanking markers 15 67139660 109944957 1 - by flanking markers 15 63498932 106550657 1 - by flanking markers 15 56484420 98288169 1 - by flanking markers RRID:RGD_2290279 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290280 SHRSP.WKY-(D3Mgh16-D3Rat110)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 3 10778704 10778823 1 - by flanking markers RRID:RGD_2290280 The desired fragment is transferred from WKY to SHRSP 2290281 SHRSP.WKY-(D3Rat227-D3Rat1)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 170016653 1 - by flanking markers 3 50522686 180128021 1 - by flanking markers 3 45406058 176418101 1 - by flanking markers 3 43827364 168026850 1 - by flanking markers RRID:RGD_2290281 This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2290282 SHRSP.WKY-(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension RRID:RGD_2290282 The desired fragment is transferred from WKY to SHRSP 2290298 SHR-Tg(Thy1-MAPT)318 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 RRID:RGD_2290298 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 2290299 SHR-Tg(Thy1-MAPT)72 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 RRID:RGD_2290299 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 2290311 SD-Tg(SOD1*G93A)26Dwc Ludwig Institute of Cancer Research, University of California at San Diego, La Jolla, California transgenic Unknown SOD1 730855 RRID:RGD_2290311 SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation 2290386 SD-Tg(Wlds)23Cole University of Cologne, Cologne, Germany transgenic Unknown RRID:RGD_2290386 SD rats were microinjected with a mouse Wlds with a Ube4b-derived domain with A46R and M60T amino acid changes 2290387 SD-Tg(UbC-APPswe)6590 Karolinska Institutet, Stockholm, Sweden transgenic Unknown APP 736021 RRID:RGD_2290387 SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutation 2290391 SD-Tg(Wlds)79Cole University of Cologne, Cologne, Germany transgenic Unknown RRID:RGD_2290391 SD rats were microinjected with a mouse Wlds with a Ube4b-derived domain with A46R and M60T amino acid changes 2290429 SS-Tg(ApoC3-CETP)53Opaz Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00310 SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter 2291840 F344-Dzank1Tn(sb-T2/Bart3)2.164Mcwi PGA mutant Extinct (as of 2016-10-17) Dzank1Tn(sb-T2/Bart3)2.164Mcwi 2291839 3 133021912 133073987 7 3 145054445 145114445 7 3 138624517 138684530 7 3 131855890 131908217 7 RRID:RGD_2291840 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene. 2292168 ISIAH Inherited stress-induced arterial hypertension Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_2292168 Selected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stress 2292384 SS.LEW-(D10Chm167-D10Chm257)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70589279 71366998 1 - by flanking markers 10 69375493 71016171 1 - by flanking markers 10 69742043 70500971 1 - by flanking markers 10 67335465 68083956 1 - by flanking markers RRID:RGD_2292384 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. 2292385 SS.LEW-(D10Mco30-D10Got107)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 78712717 1 - by flanking markers 10 73693979 77664589 1 - by flanking markers 10 76420583 77803328 1 - by flanking markers 10 73887148 75121215 1 - by flanking markers RRID:RGD_2292385 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. 2292386 SS.LEW-(D10Chm155-D10Rat127)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 87272312 100040883 1 - by flanking markers 10 86214887 98591695 1 - by flanking markers 10 86418952 98888676 1 - by flanking markers 10 83463114 95552352 1 - by flanking markers RRID:RGD_2292386 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. 2292387 SS.LEW-(D10Chm224-D10Chm259)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 75291923 1 - by flanking markers 10 75776633 76309841 1 - by flanking markers 10 74325927 74326153 1 - by flanking markers 10 71831756 71831983 1 - by flanking markers RRID:RGD_2292387 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. 2292388 SS.LEW-(D10Chm246-D10Chm257)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 71262405 71366998 1 - by flanking markers 10 70027256 71016171 1 - by flanking markers 10 70396378 70500971 1 - by flanking markers 10 67979320 68083956 1 - by flanking markers RRID:RGD_2292388 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. 2292389 SS.LEW-(D10Chm10-D10Chm14)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 96778676 99233951 1 - by flanking markers 10 95351725 97793613 1 - by flanking markers 10 95617075 98079438 1 - by flanking markers 10 92348201 94759977 1 - by flanking markers RRID:RGD_2292389 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat13-D10Rat11)/Ayd. 2292390 SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 75706467 76081753 1 - by flanking markers 10 75018615 75388855 1 - by flanking markers 10 74712046 75083773 1 - by flanking markers 10 72219294 72590339 1 - by flanking markers RRID:RGD_2292390 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. 2292451 F344-Stxbp5lTn(sb-T2/Bart3)2.202Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Stxbp5lTn(sb-T2/Bart3)2.202Mcwi 2292450 11 65129572 65455115 7 11 69337663 69661463 7 11 66246624 66566331 7 11 63334667 63654270 7 RRID:RRRC_00386 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene. 2292452 F344-Syndig1Tn(sb-T2/Bart3)2.171Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Syndig1Tn(sb-T2/Bart3)2.171Mcwi 2292449 3 139434170 139834916 7 3 151405855 151571801 7 3 145031427 145199273 7 3 138030995 138234646 7 RRID:RRRC_00342 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. 2292453 F344-BE329202Tn(sb-T2/Bart3)2.198Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm BE329202Tn(sb-T2/Bart3)2.198Mcwi 2292448 RRID:RRRC_00345 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2292454 F344-RGD1564304Tn(sb-T2/Bart3)2.201Mcwi PhysGen mutant Extinct (as of 2017-01-26) RGD1564304Tn(sb-T2/Bart3)2.201Mcwi 2292447 RRID:RGD_2292454 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene. 2292459 WF.LEW-RVFV Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-11-15) RRID:RRRC_00208 This rat strain was developed by classical breeding technique inserting the gene for resistance to lethal RVFV infection from the LEW rat strain into the genetic background of the WF rat strain. 2292526 SS-Tg(Atp1a1)48Opaz Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24) RRID:RRRC_00281 SS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase 2292527 SS-Tg(RA1V9)64Opaz Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00308 Dahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal. 2292528 F344-Tg(APPswe)Opaz Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00283 F344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter 2292529 LEW-Tg((ROSA)26Sor-luc)11Jmsk Rat Resource and Research Center, National BioResource Project for the Rat in Japan Rat Resource and Research Center, National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-08) Development RRID:RRRC_00299 LEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site 2292530 SD-Tg(Pou5f1-Dsred) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00320 This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells. 2292531 SD-Tg(Pou5f1-EGFP) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-04-23) RRID:RRRC_00319 This transgenic strain carries a random insertion of a construct containing mouse promoter Pou5f1 to drive the expression of EGFP. 2292532 F344-Tg(betaCTF-l45F) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00277 F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein 2292564 ACI.COP-(D6Rat80-D6Rat146)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 6 16302145 16302283 1 - by flanking markers 6 26052697 26052834 1 - by flanking markers 6 16100120 16100257 1 - by flanking markers 6 2299357 2299495 1 - by flanking markers RRID:RGD_2292564 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292565 ACI.COP-(D3Mgh16-D3Rat119)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 6373335 52643538 1 - by flanking markers 3 11361699 63334520 1 - by flanking markers 3 6000748 56715367 1 - by flanking markers 3 10778704 55223816 1 - by flanking markers RRID:RGD_2292565 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292566 ACI.COP-(D3Rat130-D3Rat114)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 44551252 149496698 1 - by flanking markers 3 55227530 160347840 1 - by flanking markers 3 48561928 155263151 1 - by flanking markers 3 47233211 147415807 1 - by flanking markers RRID:RGD_2292566 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292567 ACI.COP-(D10Mgh20-D10Rat4)/Shul Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 10 53781126 107033716 1 - by flanking markers 10 53376677 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 10 102134116 102134272 1 - by flanking markers RRID:RGD_2292567 Female COP/CrCrl and male ACI/SegHsd were crossed to get F1 progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped 2292647 SS.LEW-(D1Mco36-D1Rat106)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 139471673 1 - by flanking markers 1 130267716 146282094 1 - by flanking markers 1 129208943 145354344 1 - by flanking markers 1 121833674 137184926 1 - by flanking markers RRID:RGD_2292647 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292648 SS.LEW-(D1Mco36-D1Mco77)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 122992360 1 - by flanking markers 1 130267716 130268180 1 - by flanking markers 1 129208943 129209407 1 - by flanking markers 1 121833674 121834139 1 - by flanking markers RRID:RGD_2292648 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292649 SS.LEW-(D1Mco36-D1Rat131)/1Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 1 121833674 142990467 1 - by flanking markers RRID:RGD_2292649 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292650 SS.LEW-(D1Mco36-D1Rat131)/2Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 1 121833674 142990467 1 - by flanking markers RRID:RGD_2292650 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292651 SS.LEW-(D1Mco99-D1Rat49)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_2292651 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292652 SS.LEW-(D1Mco85-D1Rat49)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 1 154464069 154464242 1 - by flanking markers RRID:RGD_2292652 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2292653 SS.LEW-(D1Mco36-D1Mco101)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 97174943 122992360 1 - by flanking markers 1 103735751 130268180 1 - by flanking markers 1 102658741 129209407 1 - by flanking markers 1 97146283 121834139 1 - by flanking markers RRID:RGD_2292653 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2293012 ACI.BBDP-(RT1u)(Gimap5)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada. Rat Resource and Research Center congenic Unknown RRID:RRRC_00788 2 BBDP regions [Iddm1(RT1u) and Iddm2(Gimap5)] were introgressed into the ACI/SegHsd background 2293120 LOU.BN-(D10Mgh1-D10Mgh14)/Ins Cardiovascular Physiopathology, INSERM, Montpellier, France congenic Unknown Ace 2493 10 65379850 65379965 1 - by flanking markers 10 65109232 65109346 1 - by flanking markers 10 66539729 66539843 1 - by flanking markers 10 64155469 64155584 1 - by flanking markers RRID:RGD_2293120 segment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOU 2293143 SS.BN-(D13Rat20-D13Rat127)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13 38329089 55373537 1 - by flanking markers 13 23200281 47267192 1 - by flanking markers 13 17996178 42155682 1 - by flanking markers 13 37262092 53383120 1 - by flanking markers RRID:RGD_2293143 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293144 SS.BN-(D13Rat91-D13Rat179)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46911975 60669696 1 - by flanking markers 13 55853015 68592209 1 - by flanking markers 13 50799478 63611529 1 - by flanking markers 13 45417753 58498119 1 - by flanking markers RRID:RGD_2293144 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293145 SS.BN-(D13Hmgc64-RN34_13048990782)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13;13;13 49428397;48990782;45215472 49428577;48990782;45215667 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13 54170894;58314588 54171089;58314767 1 - by flanking markers;1 - by flanking markers 13;13 49102205;53264698 49102400;53264877 1 - by flanking markers;1 - by flanking markers 13;13 47841075;43763752 47841255;43763948 1 - by flanking markers;1 - by flanking markers RRID:RGD_2293145 SS/JrHsdMcwi were crossed with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293146 SS.BN-(D13Rat20-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 38329089;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 47267053;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 42155543;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 5;13 93541170;37262092 93542503;37262232 1 - by flanking markers;1 - by flanking markers RRID:RGD_2293146 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2293354 LEW.WKY-(D16Rat88-D16Rat40)/Tja Imperial College, London, UK Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 16 832236 56733837 1 - by flanking markers RRID:RRRC_00708 segment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsd 2293355 WKY.LEW-(D16Rat88-D16Rat40)/Tja Imperial College, London, UK congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 16 832236 56733837 1 - by flanking markers RRID:RRRC_00706 22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrl 2293729 SHR-Gja8m1-/-Cub Department of Biology, Charles University in Prague, Prague, Czech Republic mutant Unknown Gja8m1Cub 12791992 2 218536831 218538447 7 2 199052374 199052374 8 2 184492360 184492360 8 RRID:RGD_2293729 This strain is a coisogenic mutant derived from SHR/OlaIpcv where a mutation is observed in the NH2-terminal cytosolic domain of Cx50, L7Q 2293761 LH-Chr 17BN/Mav Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2293761 Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped 2293770 SHHF/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown RRID:RGD_2293770 Initial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breeding 2293832 LOU.BN-(D6Rat128-D6Rat115)/Ins INSERM, Paris, France congenic Unknown 6 76613351 116550459 1 - by flanking markers 6 86645162 125802733 1 - by flanking markers 6 77111071 116576287 1 - by flanking markers 6 73691999 111838254 1 - by flanking markers RRID:RGD_2293832 segment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercross 2298494 Kini:DA,PVG-G10 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown RRID:RGD_2298494 Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F1 generation, 7 couples of F1 with DA/Han and PVG.1AV1 females founders generated F2. F3 generation originated from breeding 50 random couples 2298498 W/Gaox Department of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China inbred Unknown RRID:RGD_2298498 Generated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine University 2298772 WFfzHsd Fuzzy rat Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-14) RRID:RRRC_00340 Sparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987) 2299122 F344-Tasp1Tn(sb-T2/Bart3)2.219Mcwi PhysGen mutant Extinct (as of 2017-01-26) Tasp1Tn(sb-T2/Bart3)2.219Mcwi 2299101 3 128002479 128228127 7 3 139347611 139588372 7 3 132888785 133131213 7 3 127176416 127408039 7 RRID:RGD_2299122 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene. 2299123 F344-AW921689Tn(sb-T2/Bart3)2.209Mcwi PhysGen mutant Unknown AW921689Tn(sb-T2/Bart3)2.209Mcwi 2299108 RRID:RGD_2299123 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2299124 F344-Ubqln4Tn(sb-T2/Bart3)2.230Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ubqln4Tn(sb-T2/Bart3)2.230Mcwi 2299109 2 180669525 180684724 7 2 207318101 207333435 7 2 187915701 187931035 7 2 174012726 174028062 7 RRID:RRRC_00350 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene. 2299125 F344-Ccdc85aTn(sb-T2/Bart3)2.248Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccdc85aTn(sb-T2/Bart3)2.248Mcwi 2299113 14 109197317 109434306 7 14 112609601 112636341 7 14 112719482 112900724 7 14 102126574 102359207 7 RRID:RRRC_00356 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. 2299126 F344-Kcnip4Tn(sb-T2/Bart3)2.225Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnip4Tn(sb-T2/Bart3)2.225Mcwi 2299100 14 66284290 67452628 7 14 65635533 66780362 7 14 65549362 66749181 7 14 61380699 62531399 7 RRID:RRRC_00348 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene. 2299127 F344-Eva1aTn(sb-T2/Bart3)2.233Mcwi PhysGen mutant Extinct (as of 2017-01-26) Eva1aTn(sb-T2/Bart3)2.233Mcwi 2299094 4 116280880 116330122 7 4 177461600 177511382 7 4 112714023 112823659 7 4 114593773 114643011 7 RRID:RGD_2299127 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. 2299128 F344-Lama2Tn(sb-T2/Bart3)2.2013Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Lama2Tn(sb-T2/Bart3)2.2013Mcwi 2299103 1 18203466 18885462 7 1 20002787 20647256 7 1 18491264 19143486 7 1 17672675 18320641 7 RRID:RRRC_00432 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene. 2299129 F344-Lrrc4cTn(sb-T2/Bart3)2.224Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Lrrc4cTn(sb-T2/Bart3)2.224Mcwi 2299107 3 80921606 82413671 7 3 92119546 93502229 7 3 85421169 86821783 7 3 82305495 83684039 7 RRID:RGD_2299129 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene. 2299130 F344-AdaTn(sb-T2/Bart3)2.237Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-13) AdaTn(sb-T2/Bart3)2.237Mcwi 2299093 3 154636530 154660637 7 3 166306001 166330108 7 3 160115840 160139947 7 3 152398745 152422854 7 RRID:RRRC_00426 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene. 2299131 F344-Grk1Tn(sb-T2/Bart3)2.234Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Grk1Tn(sb-T2/Bart3)2.234Mcwi 2299115 16 80979323 80991796 7 16 80641991 80657693 7 16 81153489 81165442 7 16 76122501 76135792 7 RRID:RRRC_00388 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene. 2299132 F344-Cadm1Tn(sb-T2/Bart3)2.229Mcwi PhysGen mutant Extinct (as of 2017-01-26) Cadm1Tn(sb-T2/Bart3)2.229Mcwi 2299116 8 50765645 51108962 7 8 50460752 50796128 7 8 51858906 52200591 7 8 47847836 48178703 7 RRID:RGD_2299132 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. 2299133 F344-Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rap1gds1Tn(sb-T2/Bart3)2.251Mcwi 2299098 2 236522381 236638692 7 2 262787595 262899803 7 2 244258550 244370983 7 2 227500366 227645213 7 RRID:RRRC_00357 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene. 2299134 F344-Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppapdc1aTn(sb-T2/Bart3)2.207Mcwi 2299105 1 188518590 188643804 7 1 209449940 209577459 7 1 202432366 202560628 7 1 183829794 183959319 7 RRID:RRRC_00347 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene. 2299135 F344-Mgat4cTn(sb-T2/Bart3)2.244Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mgat4cTn(sb-T2/Bart3)2.244Mcwi 2299106 7 40171454 40383441 7 7 43829446 44052611 7 7 43249369 44024278 7 7 36709564 37485810 7 RRID:RRRC_00354 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. 2299136 F344-SnphTn(sb-T2/Bart3)2.214Mcwi PhysGen mutant Extinct (as of 2017-01-26) SnphTn(sb-T2/Bart3)2.214Mcwi 2299117 3 141921547 141961697 7 3 153455882 153496985 7 3 147102394 147143576 7 3 140098540 140139342 7 RRID:RGD_2299136 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene. 2299137 F344-Erbb4Tn(sb-T2/Bart3)2.208Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Erbb4Tn(sb-T2/Bart3)2.208Mcwi 2299110 9 66843898 67967970 7 9 74804287 75310350 7 9 75021790 76178936 7 9 69523733 70596743 7 RRID:RRRC_00383 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. 2299138 F344-Nrxn2Tn(sb-T2/Bart3)2.250Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrxn2Tn(sb-T2/Bart3)2.250Mcwi 2299118 1 209211740 209318064 7 1 228789462 228899340 7 1 221792191 221908047 7 1 203726420 203842301 7 RRID:RRRC_00449 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene. 2299139 F344-Dnhd1Tn(sb-T2/Bart3)2.243Mcwi PhysGen mutant Extinct (as of 2017-01-26) Dnhd1Tn(sb-T2/Bart3)2.243Mcwi 2299114 1 163380065 163467261 7 1 177487073 177576072 7 1 170473792 170570220 7 1 159990785 160077990 7 RRID:RGD_2299139 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. 2299140 F344-DccTn(sb-T2/Bart3)2.205Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) DccTn(sb-T2/Bart3)2.205Mcwi 2298938 18 68026795 69140741 7 18 65688901 66793126 7 18 66518213 67629801 7 18 64868987 65972783 7 RRID:RRRC_00384 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. 2299141 F344-Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi PhysGen mutant Extinct (as of 2017-01-26) Ppp2r2bTn(sb-T2/Bart3)2.239Mcwi 2299104 18 35865837 36318308 7 18 36647298 37076455 7 18 36985709 37421383 7 18 34653716 35080889 7 RRID:RGD_2299141 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene. 2299142 F344-Inpp4bTn(sb-T2/Bart3)2.232Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Inpp4bTn(sb-T2/Bart3)2.232Mcwi 2299095 19 27722430 28363639 7 19 40508684 41132035 7 19 29592889 30341528 7 19 25920189 26670085 7 RRID:RGD_2299142 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. 2299143 F344-Kif16bTn(sb-T2/Bart3)2.200Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kif16bTn(sb-T2/Bart3)2.200Mcwi 2299111 3 130967515 131250402 7 3 143103727 143381598 7 3 136596621 136936809 7 3 129974692 130254194 7 RRID:RRRC_00346 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene. 2299144 F344-TrdnTn(sb-T2/Bart3)2.238Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) TrdnTn(sb-T2/Bart3)2.238Mcwi 2299099 1 24514752 24925948 7 1 26865461 27248423 7 1 25403390 25787664 7 1 23955651 24410494 7 RRID:RRRC_00368 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene. 2299145 F344-Rprd1aTn(sb-T2/Bart3)2.247Mcwi PhysGen mutant Extinct (as of 2017-01-26) Rprd1aTn(sb-T2/Bart3)2.247Mcwi 2299096 18 16283291 16328357 7 18 16209135 16256883 7 18 16450160 16497913 7 18 15791418 15839338 7 RRID:RGD_2299145 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. 2299146 F344-PtpreTn(sb-T2/Bart3)236Mcwi PhysGen mutant Extinct (as of 2017-01-26) PtpreTn(sb-T2/Bart3)236Mcwi 2299097 1 195263489 195303249 7 1 214818446 214920034 7 1 207820719 207987123 7 1 190344331 190494815 7 RRID:RGD_2299146 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene. 2299147 F344-Prr5lTn(sb-T2/Bart3)2.228Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Prr5lTn(sb-T2/Bart3)2.228Mcwi 2299112 3 86868129 86948468 7 3 97950297 98119477 7 3 91290207 91461208 7 3 88001951 88173532 7 RRID:RRRC_00349 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. 2299148 F344-Immp1lTn(sb-T2/Bart3)2.246Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Immp1lTn(sb-T2/Bart3)2.246Mcwi 2299102 3 91408864 91436603 7 3 102575250 102646194 7 3 95955126 96024316 7 3 92385329 92449559 7 RRID:RRRC_00355 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene. 2300018 SHRSP.ZUC-(D5Rat4-D5Rat36)/IzmDmcr Mukogawa Women's University, Nishinomiya, Hyogo Japan National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension RRID:RGD_2300018 Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm 2300195 EHC.BN-(D14Rat43-D14Rat132)/Kyu Kyushu University, Fukuoka, Japan congenic Unknown 14 79256324 107101727 1 - by flanking markers 14 78419915 110102984 1 - by flanking markers 14 78446303 110402569 1 - by flanking markers 14 100147356 100147478 1 - by flanking markers RRID:RGD_2300195 EHC/Seac and BN/Seac were crossed to get F1 progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenics 2300215 SHR.BN-(D10Mgh3-D10Rat85)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 10 48994688 100090454 1 - by flanking markers 10 49018990 98640289 1 - by flanking markers 10 49239646 98939361 1 - by flanking markers 10 47494000 95600487 1 - by flanking markers RRID:RGD_2300215 Congenic substrain derived from SHR.BN-(D10Mgh3-Srebf1)/Ipcv 2300216 SHR-Tg(PEPCK-SREBF1)1Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 RRID:RGD_2300216 SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal 2300217 SHR.BN-(D10Mgh3-Srebf1)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Srebf1 69423 10 46461684 100090454 1 - by flanking markers 10 46326015 98640289 1 - by flanking markers 10 46570996 98939361 1 - by flanking markers 10 45007637 95600487 1 - by flanking markers RRID:RGD_2300217 53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background 2301079 F344-Lrrc7Tn(sb-T2/Bart3)2.253Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc7Tn(sb-T2/Bart3)2.253Mcwi 2301078 2 256228792 256644029 7 2 283549882 283934360 7 2 264910594 265300860 7 2 247146616 247634945 7 RRID:RRRC_00360 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7. 2301080 F344-Lrrc4cTn(sb-T2/Bart3)2.254Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc4cTn(sb-T2/Bart3)2.254Mcwi 2301076 3 80921606 82413671 7 3 92119546 93502229 7 3 85421169 86821783 7 3 82305495 83684039 7 RRID:RRRC_00359 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene. 2301081 F344-Mmel1Tn(sb-T2/Bart3)2.255Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mmel1Tn(sb-T2/Bart3)2.255Mcwi 2301077 5 171675007 171703353 7 5 175729143 175759868 7 5 172273450 172303905 7 5 165431278 165461716 7 RRID:RRRC_00358 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1. 2301246 SS.LEW-(D3Rat61-D3Wox1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 147852788 168149595 1 - by flanking markers 3 158115782 182470017 1 - by flanking markers 3 153381237 174632112 1 - by flanking markers 3 145925360 166177555 1 - by flanking markers RRID:RGD_2301246 A segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 2301247 SS.LEW-(D16Got3-D16Rat112)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 64718 3531727 1 - by flanking markers 16 773329 4149422 1 - by flanking markers 16 778415 4203372 1 - by flanking markers 16 110590 3447332 1 - by flanking markers RRID:RGD_2301247 A sub congenic strain derived from the progenitor strain SS.LEW-(D16Mit2-D16Chm23)/Ayd 2301248 SS.LEW-(D3Got33-D3Chm68)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 45100293 60708929 1 - by flanking markers 3 55769295 71451283 1 - by flanking markers 3 49115270 64892832 1 - by flanking markers 3 47769862 62962984 1 - by flanking markers RRID:RGD_2301248 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd 2301249 SS.LEW-(D18Rat30-D18Chm29)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 5682011 12249935 1 - by flanking markers 18 5795276 15461904 1 - by flanking markers 18 5825946 15691464 1 - by flanking markers 18 5584537 11796356 1 - by flanking markers RRID:RGD_2301249 A segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 2301315 LE/Orl Long-Evans/Cryptorchid Centre Nationale de la Researche Scientifique, Orleans, France inbred Unknown RRID:RGD_2301315 Obtained from Centre Nationale de la Researche Scientifique, Orleans, France 2301330 KH International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, Oklahoma inbred Unknown RRID:RGD_2301330 Develped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahoma 2301367 SHRSP.WKY-(D2Mit5-D2Rat133)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 66680022 170817807 1 - by flanking markers 2 86560119 197513270 1 - by flanking markers 2 66828049 178177553 1 - by flanking markers 2 66118275 164552628 1 - by flanking markers RRID:RGD_2301367 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301368 SHRSP.WKY-(D2Wox15-D2Rat133)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 170817613 170817807 1 - by flanking markers 2 197513076 197513270 1 - by flanking markers 2 178177359 178177553 1 - by flanking markers 2 164552433 164552628 1 - by flanking markers RRID:RGD_2301368 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301369 SHRSP.WKY-(D2Rat132-D2Rat53)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 196277776 204077687 1 - by flanking markers 2 223058573 230770799 1 - by flanking markers 2 203613889 211301253 1 - by flanking markers 2 188657176 196146841 1 - by flanking markers RRID:RGD_2301369 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301370 SHRSP.WKY-(D2Wox9-D2Rat231)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 141259937 190384899 1 - by flanking markers 2 161271919 216143762 1 - by flanking markers 2 141583337 196645063 1 - by flanking markers 2 136445150 183048631 1 - by flanking markers RRID:RGD_2301370 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301371 SHRSP.WKY-(D2Mit21-D2Rat157)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Gstm1|Vcam1|S1pr1 2755|3952|61958 2 182724363 216711836 1 - by flanking markers 2 209270725 241761983 1 - by flanking markers RRID:RGD_2301371 Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment 2301381 SS.LEW-(D18Chm41-D18Rat92)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 53898282 1 - by flanking markers 18 30797572 52299753 1 - by flanking markers 18 31109532 53083766 1 - by flanking markers 18 29804982 51515008 1 - by flanking markers RRID:RGD_2301381 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301382 SS.LEW-(D18Chm91-D18Rat67)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 12677191 23780206 1 - by flanking markers 18 15053338 23867696 1 - by flanking markers 18 15274408 24147513 1 - by flanking markers 18 12205066 23012468 1 - by flanking markers RRID:RGD_2301382 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301383 SS.LEW-(D18Chm31-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 54856651 1 - by flanking markers 18 2761846 53346447 1 - by flanking markers 18 2745212 54108474 1 - by flanking markers 18 52539763 52539863 1 - by flanking markers RRID:RGD_2301383 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301384 SS.LEW-(D18Chm41-D18Rat45)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 77511190 1 - by flanking markers 18 30797572 76318715 1 - by flanking markers 18 31109532 77212332 1 - by flanking markers 18 29804982 74055742 1 - by flanking markers RRID:RGD_2301384 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301385 SS.LEW-(D18Rat29-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 13904295 54856651 1 - by flanking markers 18 13042236 53346447 1 - by flanking markers 18 13257458 54108474 1 - by flanking markers 18 13529795 52539863 1 - by flanking markers RRID:RGD_2301385 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301386 SS.LEW-(D18Rat61-D18Rat45)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 61571526 77511190 1 - by flanking markers 18 60167906 76318715 1 - by flanking markers 18 60971508 77212332 1 - by flanking markers 18 58805687 74055742 1 - by flanking markers RRID:RGD_2301386 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301387 SS.LEW-(D18Rat67-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 23779885 54856651 1 - by flanking markers 18 23867550 53346447 1 - by flanking markers 18 24147367 54108474 1 - by flanking markers 18 23012321 52539863 1 - by flanking markers RRID:RGD_2301387 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301388 SS.LEW-(D18Chm56-D18Rat55)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 49014933 54856651 1 - by flanking markers 18 47711090 53346447 1 - by flanking markers 18 48499359 54108474 1 - by flanking markers 18 46969392 52539863 1 - by flanking markers RRID:RGD_2301388 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 2301700 F344-Spata13Tn(sb-T2/Bart3)2.267Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spata13Tn(sb-T2/Bart3)2.267Mcwi 2301697 15 39722469 39849214 7 15 44749770 44878760 7 15 40937652 41066645 7 15 34778479 34907645 7 RRID:RRRC_00373 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene. 2301701 F344-PtpraTn(sb-T2/Bart3)2.261Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) PtpraTn(sb-T2/Bart3)2.261Mcwi 2301698 3 118061713 118171300 7 3 129475237 129582992 7 3 122976066 123084585 7 3 117650146 117759744 7 RRID:RRRC_00370 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene. 2301702 F344-Sf4Tn(sb-T2/Bart3)2.264Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Sf4Tn(sb-T2/Bart3)2.264Mcwi 2301696 16 19835921 19866795 7 16 20950430 21047301 7 16 21100923 21131795 7 16 19352659 19383533 7 RRID:RRRC_00371 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene. 2301937 BN.GH-(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 18 59279066 79585133 1 - by flanking markers 18 57699045 79012652 1 - by flanking markers 18 58476128 79948741 1 - by flanking markers 18;6 56594589;118921813 76477940;118921891 1 - by flanking markers;1 - by flanking markers RRID:RGD_2301937 Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations 2301938 BN.GH-(D6Mit12-D6Rat15)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 3158401 105011726 1 - by flanking markers 6 2916444 113050815 1 - by flanking markers 6 104890044 104890216 1 - by flanking markers 6 100873387 100873560 1 - by flanking markers RRID:RGD_2301938 Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations 2301939 BN.GH-(D2Rat22-D2Mgh11)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2 69302718 69303085 1 - by flanking markers 2 88968735 223460027 1 - by flanking markers 2 69243686 204022555 1 - by flanking markers 2 68462860 189039377 1 - by flanking markers RRID:RGD_2301939 Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations 2301986 BN.GH-(D2Rat22-D2Mgh11)(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301986 desired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh background 2301987 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301987 desired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh background 2301988 BN.GH-(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301988 desired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh background 2301989 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_2301989 desired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh background 2302067 F344/DuCrlSwe Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown RRID:RGD_2302067 Substrain of Fischer rats maintained at Malmo, Sweden 2302080 Rhd:F344,GK-G21 Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden advanced_intercross_line Unknown RRID:RGD_2302080 GK/Swe and F344/Swe were bred to create F1 generation, couples of F1 with GK/Swe and F344/Swe females founders generated F2. F3 generation originated from breeding random couples which were intercrossed to get further generations 2302081 DA.E3-(D11Got79-D11Wox5)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 11 82238710 85432136 1 - by flanking markers 11 86800287 90495881 1 - by flanking markers 11 83727048 87444587 1 - by flanking markers 11 80039141 83440803 1 - by flanking markers RRID:RGD_2302081 This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers. The region corresponding with he production of RF-Igl ambda antibodies was mapped to a narrower region 'D11Got79-D11Rat50.' 2302106 SHRSP.WKY-(D1Rat44-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 1 150872626 182418476 1 - by flanking markers RRID:RGD_2302106 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302108 SHRSP.WKY-(D1Mgh5-D1Wox29)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 124614852 1 - by flanking markers 1 80946174 131822376 1 - by flanking markers 1 79689548 130779320 1 - by flanking markers 1 78430536 123350581 1 - by flanking markers RRID:RGD_2302108 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302109 SHRSP.WKY-(D1Mgh5-D1Rat44)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 153754250 1 - by flanking markers 1 80946174 167707569 1 - by flanking markers 1 79689548 161493868 1 - by flanking markers 1 78430536 150872737 1 - by flanking markers RRID:RGD_2302109 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302110 SHRSP.WKY-(Apbb1-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension Apbb1 2122 1 163282918 187092492 1 - by flanking markers 1 177393531 206277202 1 - by flanking markers 1 170387625 199254774 1 - by flanking markers 1 159896889 182418476 1 - by flanking markers RRID:RGD_2302110 SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F1 were intercrossed to obtain F2 recombinant individuals were selected by marker assisted selection 2302132 SHRSP-Tg(Tagln-ACE2)6918Bdr Max-Delbruck-Center for Molecular Medicine, Berlin-Buch, Germany transgenic Unknown Tagln|ACE2 3723|1347174 RRID:RGD_2302132 Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos 2302141 F344-Tg(Cyp1a1-Ren2)10Jmul University of Edinburgh Medical School, Edinburgh, UK transgenic Unknown Cyp1a1|Ren2 2458|1622375 RRID:RGD_2302141 Generated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression. The integration site was on Y chromosome as suggested by Southern blot analysis. 2302148 SHR-Tg(EEF1A1-Cd36)10Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302148 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) 2302149 SHR-Tg(EEF1A1-Cd36)19Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302149 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) 2302150 SHR-Tg(EEF1A1-Cd36)93Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302150 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter). 2302151 SHR-Tg(EEF1A1-Cd36)106Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 RRID:RGD_2302151 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter) 2302279 F344.SDT-(D3Wox9-D3Arb20)/Kbe Kobe University School of Medicine, Chuo-ku, Kobe, Japan congenic Unknown 3 47722501 47722628 1 - by flanking markers 3 58456360 58456486 1 - by flanking markers 3 51821710 51821836 1 - by flanking markers 3 50436913 50437042 1 - by flanking markers RRID:RGD_2302279 Female F344/NSlc were crossed with male SDT/CrljJcl, then female F1 were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markers 2302387 DA.ACI-(D2Mit12-D2Mgh29)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 174730375 227310008 1 - by flanking markers 2 74640967 201405160 1 - by flanking markers 2 181990297 235290110 1 - by flanking markers 2 168358098 218414891 1 - by flanking markers RRID:RRRC_00667 Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsi 2302649 F344-Nsun4Tn(sb-T2/Bart3)2.286Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nsun4Tn(sb-T2/Bart3)2.286Mcwi 2302645 5 136277224 136297339 7 5 138152068 138689234 7 5 134885377 134905492 7 5 129511224 129532498 7 RRID:RRRC_00435 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene. 2302650 F344-Enox1Tn(sb-T2/Bart3)2.282Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Enox1Tn(sb-T2/Bart3)2.282Mcwi 2302641 15 58555747 58762870 7 15 63013519 63564418 7 15 59331134 59884512 7 15 52517833 53079752 7 RRID:RRRC_00470 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. 2302651 F344-Klra1Tn(sb-T2/Bart3)2.279Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klra1Tn(sb-T2/Bart3)2.279Mcwi 2302638 4 168892865 168928286 7 4 227986994 228022556 7 4 165426365 165460140 7 4 164873735 164985429 7 RRID:RRRC_00431 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene. 2302652 F344-Pde4dTn(sb-T2/Bart3)2.285Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pde4dTn(sb-T2/Bart3)2.285Mcwi 2302644 2 40196097 41311012 7 2 59292847 60521358 7 2 40219999 41468551 7 2 40014933 41529190 7 RRID:RRRC_00436 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene. 2302653 F344-Mov10Tn(sb-T2/Bart3)2.281Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mov10Tn(sb-T2/Bart3)2.281Mcwi 2302647 2 200053185 200075536 7 2 226696252 226717551 7 2 207277088 207301245 7 2 192292041 192315142 7 RRID:RRRC_00377 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene. 2302654 F344-Csmd3Tn(sb-T2/Bart3)2.288Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Csmd3Tn(sb-T2/Bart3)2.288Mcwi 2302637 7 83586771 84932392 7 7 86689912 87802035 7 7 86695703 88072106 7 7 78747322 80066466 7 RRID:RRRC_00390 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene. 2302655 F344-Tmtc2Tn(sb-T2/Bart3)2.276Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tmtc2Tn(sb-T2/Bart3)2.276Mcwi 2302646 7 43667983 44133854 7 7 47197110 47603261 7 7 47179596 47586777 7 7 40392377 40806685 7 RRID:RRRC_00376 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene. 2302656 F344-Casp7Tn(sb-T2/Bart3)2.280Mcwi PhysGen mutant Extinct (as of 2017-01-26) Casp7Tn(sb-T2/Bart3)2.280Mcwi 2302642 1 262689300 262721591 7 1 284572208 284623736 7 1 277190557 277242779 7 1 255437438 255476737 7 RRID:RGD_2302656 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. 2302657 F344-Orc3Tn(sb-T2/Bart3)2.275Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Orc3Tn(sb-T2/Bart3)2.275Mcwi 2302648 5 51172243 51226644 7 5 54588113 54644440 7 5 50019159 50075533 7 5 49123758 49181552 7 RRID:RRRC_00375 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene. 2302658 F344-BbxTn(sb-T2/Bart3)2.291Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) BbxTn(sb-T2/Bart3)2.291Mcwi 2302640 11 51655446 51799132 7 11 56153038 56397255 7 11 52983286 53228557 7 11 50381249 50628934 7 RRID:RRRC_00428 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. 2302659 F344-Snx25Tn(sb-T2/Bart3)2.270Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Snx25Tn(sb-T2/Bart3)2.270Mcwi 2302636 16 49415658 49518663 7 16 49051539 49159381 7 16 49328958 49432415 7 16 46134552 46238471 7 RRID:RRRC_00374 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene. 2302660 F344-Nectin1Tn(sb-T2/Bart3)2.284Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nectin1Tn(sb-T2/Bart3)2.284Mcwi 2302639 8 46739657 46799051 7 8 46714981 46777484 7 8 48094233 48198499 7 8 44101776 44164863 7 RRID:RRRC_00378 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1. 2302661 F344-Gramd1bTn(sb-T2/Bart3)2.287Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gramd1bTn(sb-T2/Bart3)2.287Mcwi 2302635 8 43260379 43429258 7 8 61200537 61378124 7 8 44160634 44399110 7 8 40654492 40893869 7 RRID:RRRC_00389 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene. 2302662 F344-Slc7a11Tn(sb-T2/Bart3)2.266Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a11Tn(sb-T2/Bart3)2.266Mcwi 2302643 2 139241142 139317101 7 2 158930294 159004937 7 2 139453774 139528479 7 2 134382002 134517622 7 RRID:RRRC_00372 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene. 2302666 Scr:sP Sardinian alcohol-preferring rats The Scripps Research Institute, LaJolla, California outbred Unknown RRID:RGD_2302666 sP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding. 2302984 SS.BN-(D13Rat151-D13Rat197)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 64083138 80109632 1 - by flanking markers 13 71941043 87516988 1 - by flanking markers 13 66971778 66971975 1 - by flanking markers 13 61825626 61825824 1 - by flanking markers RRID:RGD_2302984 SS/JrHsdMcwi were crossed with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302985 SS.BN-(D13Rat111-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;13;13;5 32030139;42627610;45828608;97701780 32030259;42627837;45828716;97703112 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;13;5 54791498;51509286;40421740;100631702 54791605;51509512;40421859;100633034 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;13;5 49720575;46444570;35301263;96601805 49720682;46444796;35301382;96603137 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;5 30395351;41184022;93541170 30395471;41184251;93542503 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_2302985 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302986 SS.BN-(D13Rat88-D13Rat91)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 46912163 1 - by flanking markers 13 51509286 55853202 1 - by flanking markers 13 46444570 50799665 1 - by flanking markers 13 41184022 45417941 1 - by flanking markers RRID:RGD_2302986 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302987 SS.BN-(D13Rat7-D13Rat60)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 13053933 1 - by flanking markers 13 19518130 32069874 1 - by flanking markers 13 14279081 26919398 1 - by flanking markers 13 11766535 23001904 1 - by flanking markers RRID:RGD_2302987 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302989 SS.BN-(D13Rat57-D13Rat192)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 80109432 100133413 1 - by flanking markers 13 87516787 109040616 1 - by flanking markers 13 104392076 104392271 1 - by flanking markers 13 95722244 95722440 1 - by flanking markers RRID:RGD_2302989 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302994 SS.BN-(D13Rat127-D13Rat61)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 63301678 1 - by flanking markers 13 23200281 71179041 1 - by flanking markers 13 17996178 66204711 1 - by flanking markers 13 53382878 61058159 1 - by flanking markers RRID:RGD_2302994 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302995 SS.BN-(D13Rat115-D13Rat101)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 35719010 49428577 1 - by flanking markers 13 44763184 58314767 1 - by flanking markers 13 39639775 53264877 1 - by flanking markers 13 34778619 47841255 1 - by flanking markers RRID:RGD_2302995 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302996 SS.BN-(D13Rat7-D13Rat88)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 38329229 1 - by flanking markers 13 19518130 47267192 1 - by flanking markers 13 14279081 42155682 1 - by flanking markers 13 11766535 37262232 1 - by flanking markers RRID:RGD_2302996 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302997 SS.BN-(D13Rat91-D13Got45)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 63301678 1 - by flanking markers 13 53846466 71179041 1 - by flanking markers 13 48776655 66204711 1 - by flanking markers 13 43437904 61058159 1 - by flanking markers RRID:RGD_2302997 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2302999 SS.BN-(D13Rat178-D13Got45)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 57566232 64083335 1 - by flanking markers 13 65516837 71941240 1 - by flanking markers 13 60528276 66971975 1 - by flanking markers 13 55481090 61825824 1 - by flanking markers RRID:RGD_2302999 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303000 SS.BN-(D13Rat123-D13Rat150)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 57566359 1 - by flanking markers 13 53846466 65516963 1 - by flanking markers 13 48776655 60528402 1 - by flanking markers 13 43437904 55481217 1 - by flanking markers RRID:RGD_2303000 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303001 SS.BN-(D13Rat111-D13Rat127)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 49428577 1 - by flanking markers 13 40421740 58314767 1 - by flanking markers 13 35301263 53264877 1 - by flanking markers 13 30395351 47841255 1 - by flanking markers RRID:RGD_2303001 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303002 SS.BN-(D13Rat123-D13Rat197)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 76779489 1 - by flanking markers 13 51509286 83929327 1 - by flanking markers 13 46444570 79034003 1 - by flanking markers 13 41184022 73485113 1 - by flanking markers RRID:RGD_2303002 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303003 SS.BN-(D13Rat7-D13Rat127)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 49428577 1 - by flanking markers 13 19518130 58314767 1 - by flanking markers 13 14279081 53264877 1 - by flanking markers 13 11766535 47841255 1 - by flanking markers RRID:RGD_2303003 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303004 SS.BN-(D13Rat115-D13Rat61)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 67752598 1 - by flanking markers 13 71178814 75143303 1 - by flanking markers 13 66204484 70172216 1 - by flanking markers 13 61057931 64901750 1 - by flanking markers RRID:RGD_2303004 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303005 SS.BN-(D13Rat127-D13Rat77)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 57922038 1 - by flanking markers 13 23200281 65861506 1 - by flanking markers 13 17996178 60876578 1 - by flanking markers 13 53382878 55829942 1 - by flanking markers RRID:RGD_2303005 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303006 SS.BN-(D13Rat101-D13Rat46)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46269934 72638941 1 - by flanking markers 13 55560677 79943775 1 - by flanking markers 13 75026588 75026713 1 - by flanking markers 13 69535761 69535887 1 - by flanking markers RRID:RGD_2303006 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303007 SS.BN-(D13Rat127-D13Rat46)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 72638941 1 - by flanking markers 13 23200281 79943775 1 - by flanking markers 13 17996178 75026713 1 - by flanking markers 13 53382878 69535887 1 - by flanking markers RRID:RGD_2303007 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303008 SS.BN-(D13Rat61-D13GRat197)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 76779489 1 - by flanking markers 13 71178814 83929327 1 - by flanking markers 13 66204484 79034003 1 - by flanking markers 13 61057931 73485113 1 - by flanking markers RRID:RGD_2303008 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303009 SS.BN-(D13Rat183-D13Rat192)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 77336098 100133413 1 - by flanking markers 13 84460970 109040616 1 - by flanking markers 13 79567081 104392271 1 - by flanking markers 13 74023918 95722440 1 - by flanking markers RRID:RGD_2303009 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303010 SS.BN-(D13Got51-D13Rat192)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 100133413 1 - by flanking markers 13 76974692 109040616 1 - by flanking markers 13 72031440 104392271 1 - by flanking markers 13 66706825 95722440 1 - by flanking markers RRID:RGD_2303010 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303011 SS.BN-(D13Got51-D13Rat57)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 80109632 1 - by flanking markers 13 76974692 87516988 1 - by flanking markers 13 72031440 72031708 1 - by flanking markers 13 66706825 66707096 1 - by flanking markers RRID:RGD_2303011 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 2303099 F344-Kcnh7Tn(sb-T2/Bart3)2.295Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnh7Tn(sb-T2/Bart3)2.295Mcwi 2303095 3 44657361 45153509 7 3 55325680 55822973 7 3 48662450 49168716 7 3 47329338 47822122 7 RRID:RRRC_00430 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene. 2303100 F344-Slc16a12Tn(sb-T2/Bart3)2.298Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc16a12Tn(sb-T2/Bart3)2.298Mcwi 2303097 1 238643040 238665699 7 1 260197556 260275962 7 1 252976071 253054500 7 1 232184004 232262170 7 RRID:RRRC_00438 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene. 2303101 F344-Kcnab1Tn(sb-T2/Bart3)2.300Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnab1Tn(sb-T2/Bart3)2.300Mcwi 2303094 2 154837841 155145882 7 2 174966379 175400010 7 2 155555798 156011438 7 2 149137025 149603540 7 RRID:RRRC_00471 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene. 2303102 F344-Dnah11Tn(sb-T2/Bart3)2.293Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Dnah11Tn(sb-T2/Bart3)2.293Mcwi 2303098 6 145190931 145516859 7 6 154698519 155011384 7 6 145784893 146099212 7 6 138839175 139155554 7 RRID:RRRC_00429 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. 2303103 F344-Pebp4Tn(sb-T2/Bart3)2.299Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pebp4Tn(sb-T2/Bart3)2.299Mcwi 2303096 15 50225405 50460627 7 15 55252902 55466149 7 15 51528587 51740626 7 15 44920946 45134188 7 RRID:RRRC_00455 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene. 2303116 SPRD.WKY-(D10Rat91-D10Rat135)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 10 9762188 108776963 1 - by flanking markers 10 8619955 108145987 1 - by flanking markers 10 9841807 108540162 1 - by flanking markers 10 9658275 104670812 1 - by flanking markers RRID:RGD_2303116 SPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. 2303117 SPRD.WKY-(D5Rat190-D5Rat114)(D18Rat102-D18Rat44)/Ibmm Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown RRID:RGD_2303117 Double congenic strain generated by intercrossing SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm and SPRD.WKY-(D18Rat102-D18Rat44)/Ibmm; F1 animals were intercrossed and F2 screened for heterozygousity by markers 2303148 SS.SHR-(D9Wox16-D9Rat76)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 33497026 1 - by flanking markers 9 24681016 40929956 1 - by flanking markers 9 25819185 41261265 1 - by flanking markers 9 22198773 36962591 1 - by flanking markers RRID:RGD_2303148 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303149 SS.SHR-(D9Wox16-D9Mco73)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 47764357 1 - by flanking markers 9 24681016 55323208 1 - by flanking markers 9 25819185 55627498 1 - by flanking markers 9 22198773 50687400 1 - by flanking markers RRID:RGD_2303149 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region. 2303150 SS.SHR-(D9Mco74-D9Rat64)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 25174989 91131755 1 - by flanking markers 9 31484855 98715585 1 - by flanking markers 9 32677807 99041268 1 - by flanking markers 9 28806563 92491790 1 - by flanking markers RRID:RGD_2303150 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303151 SS.SHR-(D9Wox16-D9Mco77)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 54083264 1 - by flanking markers 9 24681016 64294638 1 - by flanking markers 9 25819185 64491201 1 - by flanking markers 9 22198773 56777289 1 - by flanking markers RRID:RGD_2303151 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303152 SS.SHR-(D9Mco72-D9Mco93)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 90249887 1 - by flanking markers 9 52352690 97845437 1 - by flanking markers 9 52686874 98164303 1 - by flanking markers 9 47902208 91616855 1 - by flanking markers RRID:RGD_2303152 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303153 SS.SHR-(D9Rat7-D9Mco93)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77170797 90249887 1 - by flanking markers 9 83451810 97845437 1 - by flanking markers 9 83686153 98164303 1 - by flanking markers 9 79271511 91616855 1 - by flanking markers RRID:RGD_2303153 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303154 SS.SHR-(D9Wox16-D9Mco85)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 76456066 1 - by flanking markers 9 24681016 82659881 1 - by flanking markers 9 25819185 82890620 1 - by flanking markers 9 22198773 78595166 1 - by flanking markers RRID:RGD_2303154 This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2303504 LEW/JmsNgs congenital hydrocephalus rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Dentistry RRID:RGD_2303759 In 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating. 2303761 SD-Tg(CAG-EGFP)4Osb Green rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals RRID:RGD_2303761 This transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc. 2303779 OLETF-Chr 14F344/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303779 Chromosome 14 from F344 is introgressed in OLETF background 2303784 SHR-Chr 4WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2303784 Chromosome 3 from WKY is introgressed into the genomic background of SHR 2303785 SHRSP-Chr 3WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2303785 Chromosome 3 from WKY is introgressed into the genomic background of SHRSP 2303792 WTC.ZI-Atrnzi/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrnzi 40902832 RRID:RGD_2303792 Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University 2303793 WTC.DMY-dmy/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_2303793 Congenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University 2303971 OLETF.F344-(D7Mgh16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 96492203 1 - by flanking markers 7 100584458 100584693 1 - by flanking markers 7 100004559 100004794 1 - by flanking markers 7 91256311 91256547 1 - by flanking markers RRID:RGD_2303971 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. 2303972 BN-Chr 13SS/Mcwi PhysGen consomic Unknown RRID:RGD_2303972 A cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed 2303973 OLETF.F344-(D10Wox7-D10Wox6)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 10 98952626 98952741 1 - by flanking markers RRID:RGD_2303973 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating. 2303976 F344-Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi 2303974 2 103102679 103271273 7 2 122442002 122610354 7 2 102701903 102871257 7 2 100502791 100669713 7 RRID:RRRC_00472 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. 2303977 F344-Ano3Tn(sb-T2/Bart3)2.307Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ano3Tn(sb-T2/Bart3)2.307Mcwi 2303975 3 96123925 96237157 7 3 108441370 108751911 7 3 101843516 102203368 7 3 97235671 97550090 7 RRID:RRRC_00477 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene. 2303978 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303978 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303979 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303979 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303986 WKAH.LEC-Atp7bhts/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-11) Cancer Atp7bhts 11532742 16 74607988 74680080 7 16 74495179 74575822 7 16 74865516 74944935 7 16 69952286 70024404 7 RRID:RGD_2303986 A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. 2303987 F344.OLETF-(D17Mgh4-Edn1)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity Edn1 2532 17 28303886 28309775 1 - by flanking markers 17 24117499 24124188 1 - by flanking markers 17 22136814 22143745 1 - by flanking markers 17 22454924 22460812 1 - by flanking markers RRID:RGD_2303987 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303988 F344.OLETF-(D14Rat23-D14Rat12)(D8Rat54-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303988 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303989 F344.OLETF-(D9Mgh8-D9Mit2)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2303989 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303990 F344.OLETF-(D1Mit20-D1Mgh26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 1 172711200 172711337 1 - by flanking markers RRID:RGD_2303990 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303991 F344.OLETF-(D7Rat31-D7Rat35)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 20307479 28488710 1 - by flanking markers 7 24326613 32338830 1 - by flanking markers 7 24175337 32258115 1 - by flanking markers 7 18169505 26029351 1 - by flanking markers RRID:RGD_2303991 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303992 F344.OLETF-(D5Mgh29-D5Mgh22)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 157584332 157584492 1 - by flanking markers 5 160953624 160953783 1 - by flanking markers 5 157212263 157212422 1 - by flanking markers 5 151005994 151006154 1 - by flanking markers RRID:RGD_2303992 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303993 OLETF.F344-(D9Mgh8-D9Mit2)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2303993 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. 2303994 F344.OLETF-(D5Mgh4-D5Rat21)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 99344678 99344842 1 - by flanking markers 5 102264251 102264414 1 - by flanking markers 5 98224053 98224216 1 - by flanking markers 5 95112065 95112231 1 - by flanking markers RRID:RGD_2303994 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303995 F344.OLETF-(D8Rat54-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2303995 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303996 F344.Cg-Foxn1rnu/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology; Cancer Foxn1 3970 10 64243323 64256847 1 - by flanking markers 10 66004940 66030134 1 - by flanking markers 10 65621142 65634666 1 - by flanking markers 10 63251400 63273710 1 - by flanking markers RRID:RGD_2303996 This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. 2303997 F344.OLETF-(D7Mgh8-D7Mgh16)(D14Rat23-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303997 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2303998 WKAH.LEC-Ptprkthid/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Ptprk 619706 1 17328563 17752200 1 - by flanking markers 1 18602550 19574958 1 - by flanking markers 1 17445052 18058266 1 - by flanking markers 1 16738896 17236687 1 - by flanking markers RRID:RGD_2303998 A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. 2303999 F344.OLETF-(D14Rat8-D14Rat26)(D14Rat18-D14Rat22)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2303999 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304000 F344.OLETF-(D12Wox5-D12Rat21)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 12 13635523 42767729 1 - by flanking markers RRID:RGD_2304000 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304001 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2304001 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304002 F344.OLETF-(D11Mgh4-D11Mgh1)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 11 59802622 82566702 1 - by flanking markers RRID:RGD_2304002 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304003 F344.OLETF-(D16Rat19-D16Rat13)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 35339929 77968799 1 - by flanking markers 16 35126908 77759249 1 - by flanking markers 16 35307110 78172206 1 - by flanking markers 16 31951520 73187298 1 - by flanking markers RRID:RGD_2304003 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304004 F344.OLETF-(D7Mit2-D7Mgh16)(D14Rat23-D14Rat26)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2304004 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304016 BUF.ACI-(D4Rat192-D4Rat66)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 161023350 161023765 1 - by flanking markers 4 224435359 224435481 1 - by flanking markers 4 157417581 157417703 1 - by flanking markers 4 157704599 157704722 1 - by flanking markers RRID:RGD_2304016 This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. 2304017 F344.CVD-Unc5ccvd/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-05) Neurobiology Unc5c|Unc5ccvd 735109|12802355 2 239365109 239721231 7 2 265573406 265926229 7 2 247352390 247352390 8 2 230489880 230489880 8 RRID:RGD_2304017 CVD ( Cerebellar vermis defect) rat originated from spontanious mutation of LEW inbred at Osaka Prefecture University in 1992. A mutation in Unc5c has been identified in CVD rats. A congenic strain was produced by backcrossing CVD to F344/NSlc strain at Kyoto University. 2304018 BUF.ACI-(D4Rat226-D4Rat109)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 61542056 117094107 1 - by flanking markers 4 61331785 178404466 1 - by flanking markers 4 61612433 113728420 1 - by flanking markers 4 62837725 115401611 1 - by flanking markers RRID:RGD_2304018 This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. 2304019 BUF.ACI-(D15Rat68-D15Rat29)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 62521452 108387411 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 15 56484420 56484560 1 - by flanking markers RRID:RGD_2304019 This congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method. 2304020 ACI.BUF-(D15Rat97-D15Rat29)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 78048029 108387411 1 - by flanking markers 15 82573157 82573380 1 - by flanking markers 15 79033484 79033707 1 - by flanking markers 15 71477067 71477291 1 - by flanking markers RRID:RGD_2304020 This congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method. 2304037 DDI/Ddia dokkyo diabetes insipidus rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Metabolism; Urology RRID:RGD_2304037 Strain developed at Dokkyo University, School of Medicine, Tochigi, Japan 2304038 OP/Jtt Opacitas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Ophthalmology RRID:RGD_2304038 Maintained in sib mating between opacitas rats (heterozygoutes) and normal rats. 2304039 WIC-Tgrdw/Kts School of Medicine, Kitasato University National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism Tgrdw 12879860 7 104035776 104220754 7 7 107399165 107602400 7 7 107567063 107567063 8 7 98517376 98517376 8 RRID:RGD_2304039 Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. This strain has a spontaneous missense mutation, G2320R, in the thyroglobul gene. 2304040 F344.OP-Op/Jtt National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology RRID:RGD_2304040 Opacitas rats (heterozygtes) are backcorssed with F344/DuCrj. 2304041 SD-Tg(CAG-Rgn)Slc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals Osteosis Rgn 3560 RRID:RGD_2304041 Transgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and the rat Rgn gene 2304045 F344.ZUC-Leprfa(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 14 1217606 39153750 1 - by flanking markers RRID:RGD_2304045 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. 2304046 F344.ZUC-(Leprfa)(D7Rat16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 108647236 108647376 1 - by flanking markers 7 112143411 112143550 1 - by flanking markers 7 112204378 112204517 1 - by flanking markers 7 102920123 102920263 1 - by flanking markers RRID:RGD_2304046 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. 2304047 F344.ZUC-Leprfa/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity Lepr|Leprfa 3001|13432153 RRID:RGD_2304047 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating. 2304050 F344.OLETF-(D14Rat23-D14Rat55)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 27571792 1 - by flanking markers 14 2222207 27510976 1 - by flanking markers 14 2227825 27686562 1 - by flanking markers 14 1217606 25656577 1 - by flanking markers RRID:RGD_2304050 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304051 F344.OLETF-(D14Rat8-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 41707592 1 - by flanking markers 14 32389647 61886417 1 - by flanking markers 14 32593926 61783215 1 - by flanking markers 14 30320092 39153750 1 - by flanking markers RRID:RGD_2304051 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304052 F344.OLETF-(D14Rat55-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 27571487 41707592 1 - by flanking markers 14 27510756 61886417 1 - by flanking markers 14 27686342 61783215 1 - by flanking markers 14 25656356 39153750 1 - by flanking markers RRID:RGD_2304052 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304053 F344.OLETF-(D14Rat23-D14Rat5)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 11589751 1 - by flanking markers 14 2222207 11868597 1 - by flanking markers 14 2227825 11926177 1 - by flanking markers 14 1217606 10277166 1 - by flanking markers RRID:RGD_2304053 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304054 F344.OLETF-(D14Rat23-D14Rat10)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 33157602 1 - by flanking markers 14 2222207 32957654 1 - by flanking markers 14 2227825 33163485 1 - by flanking markers 14 1217606 30883947 1 - by flanking markers RRID:RGD_2304054 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304055 F344.OLETF-(D14Wox1-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 41707423 41707592 1 - by flanking markers 14 61886249 61886417 1 - by flanking markers 14 61783047 61783215 1 - by flanking markers 14 39153581 39153750 1 - by flanking markers RRID:RGD_2304055 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304056 F344.OLETF-(D14Rat23-D14Wox14)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 21885861 1 - by flanking markers 14 2222207 21925011 1 - by flanking markers 14 2227825 22009966 1 - by flanking markers 14 1217606 1217776 1 - by flanking markers RRID:RGD_2304056 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304057 F344.OLETF-(D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in JapanD14Rat143-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 19738306 41707592 1 - by flanking markers 14 19754557 61886417 1 - by flanking markers 14 19847829 61783215 1 - by flanking markers 14 18212584 39153750 1 - by flanking markers RRID:RGD_2304058 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304059 F344.OLETF-(D14Rat5-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 11589293 41707592 1 - by flanking markers 14 11868448 61886417 1 - by flanking markers 14 11926028 61783215 1 - by flanking markers 14 10277016 39153750 1 - by flanking markers RRID:RGD_2304059 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304060 F344.OLETF-(D14Wox14-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 21885743 41707592 1 - by flanking markers 14 21924894 61886417 1 - by flanking markers 14 22009849 61783215 1 - by flanking markers 14 39153581 39153750 1 - by flanking markers RRID:RGD_2304060 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. 2304061 F344.OLETF-(D14Rat23)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 1764554 1 - by flanking markers 14 2222207 2222374 1 - by flanking markers 14 2227825 2227992 1 - by flanking markers 14 1217606 1217776 1 - by flanking markers RRID:RGD_2304061 Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. 2304063 KDP-Tg(H2Kd-Cblb)2Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304063 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304064 KDP-Tg(H2Kd-Cblb)1Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304064 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304065 KDP-Tg(INS-Cblb)1Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 RRID:RGD_2304065 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304066 KDP-Tg(CAG-Cblb)1Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown Cblb 620535 RRID:RGD_2304066 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304074 WKY.BUF-Tsr1d/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304074 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred. 2304075 ACI.BUF-Pur1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304075 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred. 2304076 WKY.BUF-Thym1, Thym2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2018-03-14) Cancer RRID:RGD_2304076 This double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (Thym1) (on chr.1) and Ten2 (Thym2)(on chr. 13) has been transferred. 2304077 WKY.BUF-Pur1s/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304077 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. 2304078 ACI.BUF-Ten1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304078 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. 2304079 WKY.BUF-Ten1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304079 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. 2304080 ACI.BUF-Aftm1/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_2304080 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred. 2304081 WKY.BUF-Pur1w/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304081 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. 2304082 WKY.BUF-Ten2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology RRID:RGD_2304082 This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. 2304083 ACI.BUF-Ten2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_2304083 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. 2304093 SHRSP.WKY-(D1Rat106-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 139471535 187092492 1 - by flanking markers 1 146068162 206277202 1 - by flanking markers 1 145140412 199254774 1 - by flanking markers 1 137184788 182418476 1 - by flanking markers RRID:RGD_2304093 Developed by the depositor 2304094 SHRSP.WKY-(D1Smu12-D1Rat44)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cardio Hypertension 1 153754139 153754250 1 - by flanking markers 1 167707459 167707569 1 - by flanking markers 1 161493758 161493868 1 - by flanking markers 1 150872626 150872737 1 - by flanking markers RRID:RGD_2304094 This is a congenic strain developed by the depositor. 2304095 W-Tg(Plcb2-WGA-EGFP)F1Abek National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo RRID:RGD_2304095 This is a transgenic strain developed by the depositor. 2304096 SHRSP.WKY-(D1Rat49-D1Arb21)/1Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 1 154464069 182418476 1 - by flanking markers RRID:RGD_2304096 Developed by the depositor 2304097 SHRSP.WKY-(D1Rat49-D1Arb21)/2Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 1 154464069 182418476 1 - by flanking markers RRID:RGD_2304097 This is a congenic strain developed by the depositor. 2304098 SHRSP.WKY-(D1Smu13-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304098 Developed by the depositor 2304099 SHRSP.WKY-(D1Smu12-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304099 This is a congenic strain developed by the depositor. 2304100 SHRSP.WKY-(D1Rat39-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 125983422 187092492 1 - by flanking markers 1 133172202 206277202 1 - by flanking markers 1 132134307 199254774 1 - by flanking markers 1 124668437 182418476 1 - by flanking markers RRID:RGD_2304100 This is a congenic strain developed by the depositor. 2304101 SHRSP.WKY-(D1Rat43-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 144634295 199254774 1 - by flanking markers 1 182418219 182418476 1 - by flanking markers RRID:RGD_2304101 This is a congenic strain developed by the depositor. 2304102 SHRSP.WKY-(D1Mgh5-D1Rat106)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 1 78430536 137184926 1 - by flanking markers RRID:RGD_2304102 This is a congenic strain developed by the depositor. 2304104 W-Tg(Plcb2-WGA-EGFP)M1Abek National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo RRID:RGD_2304104 This is a transgenic strain developed by the depositor. 2304120 SHRSP/2Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2304120 Kyo > Ta (1972) 2304121 DA.WF-(D1Mit1-D1Mit3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 1 146971846 146971983 1 - by flanking markers 1 162692213 162692800 1 - by flanking markers 1 156446196 156446783 1 - by flanking markers 1 144267353 144267916 1 - by flanking markers RRID:RGD_2304121 This congenic strain in the DA background by introgressing a segment from WF 2304122 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304122 This congenic strain in the DA background by introgressing a segment from WF 2304123 DA.WF-(D4Mit11-Nos3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nos3 3186 4 6158847 91330856 1 - by flanking markers 4 7333272 157291359 1 - by flanking markers 4 7321908 92484312 1 - by flanking markers 4 10793834 91360801 1 - by flanking markers RRID:RGD_2304123 This congenic strain in the DA background by introgressing a segment from WF 2304124 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)(D1Mit1-D1Mit3)/Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304124 This congenic strain in the DA background by introgressing a segment from WF 2304125 DRH.F344-(D1Mgh8-D1Mgh12)/Shigm National BioResource Project for the Rat in Japan, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan National BioResource Project for the Rat in Japan, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1 156124624 247322277 1 - by flanking markers 1 169999389 270717037 1 - by flanking markers 1 163796316 163796432 1 - by flanking markers 1 153136852 153136969 1 - by flanking markers RRID:RGD_2304125 desired fragment from F344 was introgressed into DRH background 2304200 W-Tg(CAG-ABO*A)32Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304200 This transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. 2304201 F344-Galntl6Tn(sb-T2/Bart3)2.311McwiRrrc PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Galntl6Tn(sb-T2/Bart3)2.311Mcwi 2304194 16 34557663 35853849 7 16 34380195 35619972 7 16 34551052 35803840 7 16 31192880 32443979 7 RRID:RRRC_00450 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene. 2304202 F344-RGD1565323Tn(sb-T2/Bart3)2.312Mcwi PhysGen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1565323Tn(sb-T2/Bart3)2.312Mcwi 2304193 17 38022396 38039975 7 17 34865901 34882646 7 17 32973695 32990440 7 17 31661713 31678816 7 RRID:RRRC_00437 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323. 2304203 W-Tg(CAG-DsRed2/GFP)1Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304203 DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. 2304204 W-Tg(CAG-ABO*B)13Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304204 This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. 2304205 W-Tg(Alb-DsRed2)34Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RGD_2304205 This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. 2304206 W-Tg(CAG-DsRed2/GFP)15Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00300 DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. 2304207 F344-LzicTn(sb-T2/Bart3)2.309Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LzicTn(sb-T2/Bart3)2.309Mcwi 2304196 5 166567412 166579423 7 5 170076617 170089776 7 5 166430305 166443485 7 5 159928260 159941512 7 RRID:RRRC_00434 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene. 2304208 F344-Rapgef4Tn(sb-T2/Bart3)2.314Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rapgef4Tn(sb-T2/Bart3)2.314Mcwi 2304197 3 54396312 54717148 7 3 65122705 65409814 7 3 58632338 58925127 7 3 56809388 57101332 7 RRID:RRRC_00479 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene. 2304209 F344-RorbTn(sb-T2/Bart3)2.304Mcwi PhysGen mutant Extinct (as of 2017-01-26) RorbTn(sb-T2/Bart3)2.304Mcwi 2304199 1 222545682 222726307 7 1 241354340 241541103 7 1 234252757 234442597 7 1 216363629 216544390 7 RRID:RGD_2304209 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene. 2304210 W-Tg(Alb-DsRed2)42Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RRRC_00260 This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. 2304211 W-Tg(CAG-cre)81Jmsk National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo (as of 2018-07-16) Development RRID:RRRC_00301 This strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School. 2304212 F344-RGD1563503Tn(sb-T2/Bart3)2.313Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1563503Tn(sb-T2/Bart3)2.313Mcwi 2304198 17 21066144 21067040 7 17 17584757 17585688 7 17 15526295 15527253 7 RRID:RRRC_00453 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503. 2304213 F344-P3h3Tn(sb-T2/Bart3)2.310Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) P3h3Tn(sb-T2/Bart3)2.310Mcwi 2304195 4 160964297 160978321 7 4 224377005 224392881 7 4 157359331 157375186 7 4 157646242 157662035 7 RRID:RRRC_00433 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene. 2304214 W-Tg(CAG-ABO*B)2Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 RRID:RGD_2304214 This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. 2304215 F344-Tg(XPO1)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer; Infectious RRID:RGD_2304215 F344/DuCrj Tg rat inoculated with human crm1 genome (BAC) 2304221 WTC-swh/Kyo Kyoto University National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-11) Dermatology EdaraddswhKyo 14398765 17 67056373 67143933 7 17 92462305 92503399 7 17 90802280 90843476 7 17 85866629 85910612 7 RRID:RGD_2304221 The rat showed abnormal hair texture and mammary gland hypoplasia which occurred in the WTC.ZI-Atrnzi colony at the National Cancer Center Research Institute in 1998. After elimination of zi allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. In 2011, Kuramoto et al. (RGD:14398762) identified a missense mutation in the Edaradd gene. 2304222 WIAR/Iar Inbred Wistar-Imamichi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism; Development RRID:RGD_2304222 Strain developed by the depositor. This strain was established by inbreeding of Wistar-Imamichi rats by sib-mating. Strain characteristic is same as that of Wistar-Imamichi. (Nov 6, 2009) 2304241 F344-Tg(CXCR4)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious CXCR4 732176 RRID:RGD_2304241 Transgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj. 2304242 WTC-Kcnq1dfkKyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-04-05) Otorhinology; Internal Organ Kcnq1|Kcnq1dfk 621503|12802344 1 203383401 203803687 7 1 223154713 223490458 7 1 216377021 216379067 8 1 198374486 198376539 8 RRID:RGD_2304242 Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-Atrnzi congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-Kcnq1dfk/Kyo rat is a mutant for circling behavior. although the Atrnzi allele of WTC.ZI-Atrnzi congenic rats was eliminated, the circling behavior remained. 2304277 SHRSP.WKY-(D1Rat36-D1Rat106)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 128874534 139471673 1 - by flanking markers 1 136045631 146282094 1 - by flanking markers 1 135022396 145354344 1 - by flanking markers 1 127453884 137184926 1 - by flanking markers RRID:RGD_2304277 Developed by the DEPOSITOR 2304278 DA-Tg(Alb-HSVtk)5Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304278 This strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in these transgenic rats causes hepatitis. 2304279 W-Tg(MT2A-Myc)1Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 RRID:RGD_2304279 This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). 2304280 SHR/Shi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension RRID:RGD_2304280 Developed by the DEPOSITOR 2304281 SERC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm (as of 2024-09-24) Neurobiology RRID:RGD_2304281 Developed by the DEPOSITOR 2304282 IEW/Ihr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Neurobiology; Ophthalmology RRID:RGD_2304282 mutant of Ihara epileptic rat. 2304283 SHRSP.WKY-(D1Mgh5-D1Wox18)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 1 78430536 94644553 1 - by flanking markers RRID:RGD_2304283 Developed by the DEPOSITOR 2304284 SHRSP.WKY-(D1Mgh5-D1Rat116)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 218467340 1 - by flanking markers 1 80946174 239429964 1 - by flanking markers 1 79689548 232297227 1 - by flanking markers 1 78430536 212458660 1 - by flanking markers RRID:RGD_2304284 Developed by the DEPOSITOR 2304285 BDIX/NemOda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown Cancer RRID:RGD_2304285 This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992. 2304286 DMYC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Cryopreserved Sperm RRID:RGD_2304286 Developed by the DEPOSITOR 2304287 ACI.F344-(D16Rat17-D16Rat15)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer RRID:RGD_2304287 F344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain. 2304288 ACI.BUF-(D20Img2-D20Rat5)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 20 17617832 17617956 1 - by flanking markers RRID:RGD_2304288 Developed by the DEPOSITOR 2304289 SHRSP.WKY-(D1Mgh5-D1Rat349)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 130788777 1 - by flanking markers 1 80946174 137735636 1 - by flanking markers 1 79689548 136742994 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2304289 Developed by the DEPOSITOR 2304290 BUF.ACI-(D20Img2-D20Rat5)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 20 17617832 17617956 1 - by flanking markers RRID:RGD_2304290 Developed by the DEPOSITOR 2304291 LEW-Tg(CAG-EGFP)1Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Development RRID:RGD_2304291 This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. 2304292 LEW-Tg((ROSA)26Sor-luc)21Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RGD_2304292 This strain expresses luciferase ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. 2304293 F344.LEC-xhs1/1Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2304293 LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay 2304294 MPOD/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cancer; Immunology RRID:RGD_2304294 Myeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait. 2304295 SHRSP.WKY-(Igf1r-D1Rat36)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Igf1r 2869 1 122704976 128874670 1 - by flanking markers 1 129985761 136045766 1 - by flanking markers 1 128924921 135022531 1 - by flanking markers 1 121549831 127454022 1 - by flanking markers RRID:RGD_2304295 Developed by the DEPOSITOR 2304296 KB/Oda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo RRID:RGD_2304296 Maintained by crossing heterozygotes of the albino locus (segregating inbred strain). 2304297 TM.KDP-Cblb/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 11 49690402 49856762 1 - by flanking markers 11 54218260 54383403 1 - by flanking markers 11 51037383 51202761 1 - by flanking markers 11 48589878 48756940 1 - by flanking markers RRID:RGD_2304297 Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). 2304298 SD-Tg(Tuba1a-EYFP)Okn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown RRID:RGD_2304298 This strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter. 2304299 LEW-Tg(Alb-GFP)6Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2304299 This strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School. 2304300 W-Tg(S100b-EGFP)Scell National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Metabolism RRID:RGD_2304300 Developed by microinjecting the transgene into Wistar rats 2304301 SHRSP.WKY-(Slco3a1-D1Rat106)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Slco3a1 620227 1 129580126 139471673 1 - by flanking markers 1 136793300 146282094 1 - by flanking markers 1 135790854 145354344 1 - by flanking markers 1 128106232 137184926 1 - by flanking markers RRID:RGD_2304301 Developed by the DEPOSITOR 2304302 SHRSP.WKY-(D1Rat44-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 1 150872626 182418476 1 - by flanking markers RRID:RGD_2304302 Developed by the DEPOSITOR 2304303 W-Tg(MT2A-Myc)2Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 RRID:RGD_2304303 This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). 2304304 SHRSP.WKY-(D1Rat209-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 142486986 199254774 1 - by flanking markers 1 134641522 182418476 1 - by flanking markers RRID:RGD_2304304 Developed by the DEPOSITOR 2304305 DOB/Oda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_2304305 This strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000. 2304306 BUF.ACI-(D20Img2-Cdkn1a)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 20 7149177 7159727 1 - by flanking markers RRID:RGD_2304306 Developed by the DEPOSITOR 2304307 ACI.BUF-(D20Img2-Cdkn1a)/Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 20 7149177 7159727 1 - by flanking markers RRID:RGD_2304307 Developed by the DEPOSITOR 2304308 ICR/Ihr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2019-08-05) Neurobiology; Ophthalmology RRID:RGD_2304308 A new rat strain has been developed, in which a spontaneous cataract occurs without exception at 3-4 months after birth and matures completely at 4-6 months of age, indicating that this strain possesses a maturity-onset cataract. 2304309 SHRSP.WKY-(D1Mgh5-D1Rat106)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 1 78430536 137184926 1 - by flanking markers RRID:RGD_2304309 Developed by the DEPOSITOR 2304310 SD-Tg(Nes/Hspa1b-EGFP)Okn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology RRID:RGD_2304310 This strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter. 2304311 LEW-Tg((ROSA)26Sor-lacZ)44JmskRrrc National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RRRC_00298 This strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. 2304312 SHRSP.WKY-(D1Mgh5-D1Rat36)(D1Rat44-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2304312 Developed by the DEPOSITOR 2304313 SHRSP.WKY-(D1Mgh5-D1Rat178)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2304313 Developed by the DEPOSITOR 2304314 BDIX.Cg-Tal/NemOda National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Osteosis RRID:RGD_2304314 Mating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain). 2304315 SHRSP.WKY-(Calca-D1Arb21)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Calca 2254 1 172686168 187092492 1 - by flanking markers 1 191158061 206277202 1 - by flanking markers 1 184184018 199254774 1 - by flanking markers 1 168878212 182418476 1 - by flanking markers RRID:RGD_2304315 Developed by the DEPOSITOR 2304316 F344.LEC-xhs1/2Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2304316 LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay 2304329 WKY/Ezo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension RRID:RGD_2304329 Deposited by the DEPOSITOR 2304330 SD-Tg(HRAS)128Ncc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-04-30) Cancer RRID:RGD_2304330 This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region. 2304331 F344-Tg(CCR5)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious RRID:RGD_2304331 Deposited by the DEPOSITOR 2304332 HER/Wkmt National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology RRID:RGD_2304332 Developed by the DEPOSITOR 2305934 F344-Spta1Tn(sb-T2/Bart3)2.315Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spta1Tn(sb-T2/Bart3)2.315Mcwi 2305932 13 89951924 90028592 7 13 96782387 96860327 7 13 92264231 92340091 7 13 86203504 86279371 7 RRID:RRRC_00439 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene. 2305935 F344-Rtn4Tn(sb-T2/Bart3)2.316Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rtn4Tn(sb-T2/Bart3)2.316Mcwi 2305933 14 110725089 110772578 7 14 113792257 113839936 7 14 114126931 114174459 7 14 103450074 103497687 7 RRID:RRRC_00476 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene. 2305939 SHRSP.WKY-(D9Mit6-D9Rat83)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305939 Developed by the DEPOSITOR 2305940 SHRSP-Chr 7WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305940 Chromosome 7 from WKY is introgressed into the genomic background of SHRSP 2305941 SHR-Chr 15WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305941 Chromosome 15 from WKY is introgressed into the genomic background of SHR 2305942 SHR-Chr 3WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305942 Chromosome 3 from WKY is introgressed into the genomic background of SHR 2305943 SHRSP-Chr 15WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305943 Chromosome 15 from WKY is introgressed into the genomic background of SHRSP 2305944 SHRSP-Chr 4WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305944 Chromosome 4 from WKY is introgressed into the genomic background of SHRSP 2305945 SHRSP-Chr 13WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305945 Chromosome 13 from WKY is introgressed into the genomic background of SHRSP 2305946 SHR-Chr 1WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305946 Chromosome 1 from WKY is introgressed into the genomic background of SHR 2305947 SHR-Chr 19WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305947 Chromosome 19 from WKY is introgressed into the genomic background of SHR 2305948 SHRSP.WKY-(D8Rat77-D8Rat16)(D8Tkyo10)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305948 Developed by the DEPOSITOR 2305949 SHRSP-Chr 1WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2305949 Chromosome 1 from WKY is introgressed into the genomic background of SHRSP 2305966 SHR.SHRSP-(D1Rat93-D1Rat269)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 1 65677942 124977364 1 - by flanking markers RRID:RGD_2305966 Developed by the DEPOSITOR 2305967 SHR.SHRSP-(D18Rat73-D18Rat11)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 18 49999958 68414117 1 - by flanking markers RRID:RGD_2305967 Developed by the DEPOSITOR 2305968 SHRSP.WKY-(D1Wox18-D1Rat39)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 94626541 125983558 1 - by flanking markers 1 101198387 133172336 1 - by flanking markers 1 100133276 132134441 1 - by flanking markers 1 94644435 124668572 1 - by flanking markers RRID:RGD_2305968 Developed by the DEPOSITOR 2305969 SHRSP.WKY-(D1Mgh5-D1Rat178)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 1 78430536 78430678 1 - by flanking markers RRID:RGD_2305969 Developed by the DEPOSITOR 2305970 DA-Tg(Alb-TTR*V30M)7Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_2305970 This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. 2305971 SHRSP.SHR-(D18Rat73-D18Rat11)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 18 49999958 68414117 1 - by flanking markers RRID:RGD_2305971 Developed by the DEPOSITOR 2305972 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)(Bcl2-D13Mgh7)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305972 Developed by the DEPOSITOR 2305973 SHRSP.SHR-(D1Rat93-D1Rat269)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 1 65677942 124977364 1 - by flanking markers RRID:RGD_2305973 Developed by the DEPOSITOR 2305974 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305974 Developed by the DEPOSITOR 2305975 SHRSP.WKY-(D1Mgh5-D1Wox18)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 1 78430536 94644553 1 - by flanking markers RRID:RGD_2305975 Developed by the DEPOSITOR 2305976 DA-Tg(Alb-TTR*V30M)9Jmsk National BioResource Project for the Rat in Japan, Rat Resource & Research Center National BioResource Project for the Rat in Japan, Rat Resource & Research Center transgenic Cryopreserved Embryo Development RRID:RRRC_00339 This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. 2305977 ACI.F344-(D16Rat12-D16Mco2)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 350121 67547357 1 - by flanking markers 16 1084304 67099528 1 - by flanking markers 16 1090054 1090164 1 - by flanking markers 16 380245 380356 1 - by flanking markers RRID:RGD_2305977 F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals. 2305978 LEW-Tg((ROSA)26Sor-DsRed*)7Jmsk National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development RRID:RGD_2305978 This strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School. 2305979 WKY.SHRSP-(D1Wox29-D1Arb21)(Bcl2-D13Mgh7)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305979 Developed by the DEPOSITOR 2305987 F344.OLETF-(D7Mgh16-D7Wox46)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 113050225 1 - by flanking markers 7 100584458 116158165 1 - by flanking markers 7 100004559 116255796 1 - by flanking markers 7 91256311 106845450 1 - by flanking markers RRID:RGD_2305987 Developed by the DEPOSITOR 2305988 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305988 Developed by the DEPOSITOR 2305989 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Z-Leprfa/Tj)F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305989 Developed by the DEPOSITOR 2305990 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305990 Developed by the DEPOSITOR 2305991 (F344.OLETF-(D7Mgh16-D7Mgh20)/Tj X F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305991 Developed by the DEPOSITOR 2305992 F344.OLETF-(D7Mit16-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 7 113886156 113886318 1 - by flanking markers RRID:RGD_2305992 Developed by the DEPOSITOR 2305993 F344.OLETF-(D14Rat23)(D14Rat12)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305993 Developed by the DEPOSITOR 2305994 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/1Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity RRID:RGD_2305994 Developed by the DEPOSITOR 2305995 F344.OLETF-(D7Got130-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305995 Developed by the DEPOSITOR 2305996 F344.Cg-Leprfa(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305996 Developed by the DEPOSITOR 2305997 (F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/2Tj x F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2305997 Developed by the DEPOSITOR 2305998 F344.Cg-Leprfa(D8Rat54-D8Mgh17)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2305998 Developed by the DEPOSITOR 2305999 F344.OLETF-(D7Mgh16-D7Rat70)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 117397170 1 - by flanking markers 7 100584458 120641361 1 - by flanking markers 7 100004559 120648531 1 - by flanking markers 7 91256311 110979877 1 - by flanking markers RRID:RGD_2305999 Developed by the DEPOSITOR 2306000 F344.OLETF-(D7Rat70-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 117396947 117397170 1 - by flanking markers 7 120641139 120641361 1 - by flanking markers 7 120648309 120648531 1 - by flanking markers 7 110979654 110979877 1 - by flanking markers RRID:RGD_2306000 Developed by the DEPOSITOR 2306001 F344.OLETF-(D7Rat176-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 111200727 111200952 1 - by flanking markers 7 114641525 114641749 1 - by flanking markers 7 114708083 114708307 1 - by flanking markers 7 105399233 105399458 1 - by flanking markers RRID:RGD_2306001 Developed by the DEPOSITOR 2306002 F344.OLETF-(D14Rat23)(D14Rat12)/1Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306002 Developed by the DEPOSITOR 2306003 F344.OLETF-(D7Wox46-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 113050053 113050225 1 - by flanking markers 7 116157993 116158165 1 - by flanking markers 7 116255624 116255796 1 - by flanking markers 7 106845277 106845450 1 - by flanking markers RRID:RGD_2306003 Developed by the DEPOSITOR 2306004 F344.OLETF-(D7Mgh16-D7Mit16)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 120746007 1 - by flanking markers 7 100584458 123587717 1 - by flanking markers 7 100004559 123602998 1 - by flanking markers 7 91256311 113886318 1 - by flanking markers RRID:RGD_2306004 Developed by the DEPOSITOR 2306013 F344.OLETF-(D14Rat8-D14Rat26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 14 30320092 65026991 1 - by flanking markers RRID:RGD_2306013 Developed by the DEPOSITOR 2306014 F344.OLETF-(D8Rat54-D8Mgh17)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 8 69349194 69349344 1 - by flanking markers RRID:RGD_2306014 Developed by the DEPOSITOR 2306015 F344.OLETF-(D12Wox5-D12Rat21)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 12 13635523 42767729 1 - by flanking markers RRID:RGD_2306015 Developed by the DEPOSITOR 2306016 F344.OLETF-(D11Mgh4-D11Mgh1)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 11 59802622 82566702 1 - by flanking markers RRID:RGD_2306016 Developed by the DEPOSITOR 2306017 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D14Rat23-D14Rat12))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306017 Developed by the DEPOSITOR 2306018 F344.OLETF-(D9Mgh8-D9Mit2)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 9 36840385 66437242 1 - by flanking markers RRID:RGD_2306018 Developed by the DEPOSITOR 2306019 F344.OLETF-(D1Mit20-D1Mgh26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 1 172711200 172711337 1 - by flanking markers RRID:RGD_2306019 Developed by the DEPOSITOR 2306020 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306020 Developed by the DEPOSITOR 2306021 SHR-Chr 2WKY/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension RRID:RGD_2306021 Developed by the DEPOSITOR 2306022 KCI/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm (as of 2024-09-24) Neurobiology Pcdh15 1590969 RRID:RGD_2306022 Rats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003. 2306023 F344-Tg(CCNT1)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious CCNT1 1322457 RRID:RGD_2306023 Developed by the DEPOSITOR 2306024 FOK/Ncu Furuyama rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_2306024 These are resistant to hot environment. 2306025 WMN/Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism RRID:RGD_2306025 Developed by the DEPOSITOR 2306026 F344.OLETF-(D16Wox4-D16Rat13)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 16 48143982 73187298 1 - by flanking markers RRID:RGD_2306026 Developed by the DEPOSITOR 2306027 WM/Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism RRID:RGD_2306027 Developed by the DEPOSITOR 2306028 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306028 Developed by the DEPOSITOR 2306029 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Leprfa(D7Mgh16-D7Mgh20))F1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306029 Developed by the DEPOSITOR 2306030 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2306030 Developed by the DEPOSITOR 2306033 SHR.Cg-Leprcp/NDmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension Leprcp 11570565 RRID:RGD_2306033 Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999. 2306034 NER.F344-(D1Mgh6-D1Rat132)(D5Rat100-D5Rat234)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology RRID:RGD_2306034 Developed by the DEPOSITOR 2306035 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Live Animals Neurobiology RRID:RGD_2306035 This double congenic strain was established by crossing F344.NER-(D1Mgh6-D1Rat73)/Kyo and F344.NER-(D5Mgh4-D5Rat36)/Kyo 2306036 F344-Apcm1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-03-14) Cancer Apc|Apcm1Kyo 2123|12792252 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RGD_2306036 F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven). 2306037 F344-Tg(CD4)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious RRID:RGD_2306037 Developed by the DEPOSITOR 2306041 F344-Scn1am2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology Scn1am2Kyo 12792284 3 48238528 48364143 7 3 59016641 59135580 7 3 52437310 52437310 8 3 50998498 50998498 8 RRID:RGD_2306041 Established by ENU mutagenesis. A point mutation in Scn1a gene. 2306042 F344-Scn1am1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Neurobiology Scn1am1Kyo 12792283 3 48238528 48364143 7 3 59016641 59135580 7 3 52408707 52408707 8 3 50969024 50969024 8 RRID:RGD_2306042 Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model. 2306043 SHR/4Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306043 Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure 2306044 SHRSP/3Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306044 Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line 2306045 SHR/2Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306045 Developed by the DEPOSITOR, one of the SHR substrains from B2 line 2306046 W-Tg(CAG-EGFP)3Ys National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo RRID:RGD_2306046 This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. 2306047 W-Tg(Gnrh1-EGFP)Nphy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Gnrh1 2720 RRID:RGD_2306047 This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence. 2306048 SHR/3Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306048 Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure 2306049 SHRSP/4Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306049 Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis 2306050 SHRSP/5Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306050 Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis 2306051 SHRSP/2Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 RRID:RGD_2306051 Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line 2306058 LEC.W-Tg(CAG-Zfml)30Ncms/Ncms National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306058 Developed by the DEPOSITOR 2306059 DA.Cg-Foxn1rnu Lystbg/Slc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Immunology; Hematology Foxn1|Lystbg 3970|598099555 RRID:RGD_2306059 Developed by the DEPOSITOR 2306060 LEC.W-Tg(CAG-Zfml)26Ncms/Ncms National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306060 Developed by the DEPOSITOR 2306061 ACI.BUF-Pur1, Thym2/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Metabolism RRID:RGD_2306061 The proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (Thym2) (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002. 2306062 W-Tg(Per1-luc)1Oa National BioResource Project for the Rat in Japan, Rat Resource and Research Center National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00273 Developed by the DEPOSITOR 2306063 LEC.W-Tg(CAG-Zfml)21Ncms/Ncms National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306063 Developed by the DEPOSITOR 2306064 MPR/Iar National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Metabolism; Osteosis Arsb|ArsbMPR 2158|12792967 RRID:RGD_2306064 Developed by the DEPOSITOR 2306070 WIC-Tg(Wap-GH1)1Mni National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism RRID:RGD_2306070 Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). 2306071 F344-Tg(CAG-EGFP)Ncco National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer; Metabolism RRID:RGD_2306071 Transgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method 2306072 ACI.F344-(D16Nkg74)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306072 A sub congenic strain of ACI/N.F344-(D16Rat12-D16Mco2)/Nkg 2306073 WIC-Tg(Wap-GH1)2Mni National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism RRID:RGD_2306073 Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). 2306076 ACI.F344-(D16Nkg9-D16Nkg38)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306076 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals. 2306077 ACI.F344-(D16Rat64-D16Nkg105)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 59398206 59398647 1 - by flanking markers 16 58966446 58966664 1 - by flanking markers 16 59285775 59285993 1 - by flanking markers 16 55711087 55711306 1 - by flanking markers RRID:RGD_2306077 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating. 2306078 KFRS4A/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2024-09-24) Neurobiology; Behavior RRID:RGD_2306078 Developed by the DEPOSITOR 2306079 ACI.F344-(D16Nkg87-D16Nkg105)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer RRID:RGD_2306079 This congenic strain was established by backcrossing ACI.F344-(D16Rat64-D16Nkg105)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals. 2306085 TCR/Ibu Toyoda Circling Rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Behavior RRID:RGD_2306085 A male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007. 2306089 ACI.BUF-(D7Wox16-D7Rat69)/Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer 7 64611964 113044228 1 - by flanking markers 7 67991394 116151991 1 - by flanking markers 7 67801457 67801690 1 - by flanking markers 7 60460452 60460686 1 - by flanking markers RRID:RGD_2306089 The thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing. 2306090 ExHC/Ta Exogenously hypercholesterolemic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2017-04-19) Metabolism RRID:RGD_2306090 Developed by the DEPOSITOR 2306098 ACI.F344-(D16Nkg30-D16Mgh6)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 16 49150370 49150515 1 - by flanking markers 16 48766016 48766115 1 - by flanking markers 16 49051407 49051506 1 - by flanking markers 16 45868397 45868497 1 - by flanking markers RRID:RGD_2306098 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. 2306099 SHR.WKY-(D15Tkyo3-D15Rat68)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 62521592 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 15 56484420 56484560 1 - by flanking markers RRID:RGD_2306099 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306100 SHR.WKY-(D3Tkyo7-D3Rat1)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 99858951 170016653 1 - by flanking markers 3 112038782 180128021 1 - by flanking markers 3 105465332 176418101 1 - by flanking markers 3 100769917 168026850 1 - by flanking markers RRID:RGD_2306100 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306101 LEC.BN-(D4Mgh16-D4Rat233)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 61646674 108329449 1 - by flanking markers 4 61427427 170105737 1 - by flanking markers 4 61708103 105384025 1 - by flanking markers 4 62933269 107032773 1 - by flanking markers RRID:RGD_2306101 Developed by the DEPOSITOR 2306102 BN.LEC-(D4Rat128-D4Rat106)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 117887968 1 - by flanking markers 4 145335315 179959894 1 - by flanking markers 4 80666353 115372927 1 - by flanking markers 4 79986873 116179656 1 - by flanking markers RRID:RGD_2306102 Developed by the DEPOSITOR 2306103 SHRSP/Sums National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_2306103 Developed by the DEPOSITOR 2306104 BN.LEC-(D4Rat184-D4Rat238)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 120665583 142160377 1 - by flanking markers 4 182854846 203361566 1 - by flanking markers 4 118283596 138891201 1 - by flanking markers 4 118928273 139725596 1 - by flanking markers RRID:RGD_2306104 Developed by the DEPOSITOR 2306105 BN.LEC-(D4Rat128-D4Rat238)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 142160377 1 - by flanking markers 4 145335315 203361566 1 - by flanking markers 4 80666353 138891201 1 - by flanking markers 4 79986873 139725596 1 - by flanking markers RRID:RGD_2306105 Developed by the DEPOSITOR 2306106 CLX/Ta Circling behavior linked to the X-chromosome (CLX) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) Behavior RRID:RGD_2306106 Developed by the DEPOSITOR 2306107 SD-Tg(Sp6)58Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-22) Dentistry; Development Sp6 1306768 RRID:RGD_2306107 The transgenic construct carrying rat Sp6 coding region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. 2306108 SHR.WKY-(D3Mit9-D3Wox16)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 26674018 89245110 1 - by flanking markers 3 39535971 100667805 1 - by flanking markers 3 34394121 94028641 1 - by flanking markers 3 30356773 90477342 1 - by flanking markers RRID:RGD_2306108 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306109 SHR.WKY-(D3Mgh6-D3Rat1)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 50522618 170016653 1 - by flanking markers 3 61249840 180128021 1 - by flanking markers 3 54630948 176418101 1 - by flanking markers 3 53184593 168026850 1 - by flanking markers RRID:RGD_2306109 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306110 IER/Sums National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Neurobiology RRID:RGD_2306110 Developed by the DEPOSITOR 2306111 LEC.BN-(D4Mgh16-D4Rat233)(D4Rat271-D4Rat238)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306111 Developed by the DEPOSITOR 2306112 ZDF-LeprfaCrlCrlj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo Diabetes Obesity Lepr 3001 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_2306112 Developed by the DEPOSITOR 2306113 SD-Tg(Sp6)6Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 RRID:RGD_2306113 Developed by the DEPOSITOR 2306114 SHR.WKY-(D3Mgh16-D3Rat110)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 3 10778704 10778823 1 - by flanking markers RRID:RGD_2306114 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306115 SHR.WKY-(D3Mgh16-D3Rat166)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 101359980 1 - by flanking markers 3 11361699 113470358 1 - by flanking markers 3 6000748 106900596 1 - by flanking markers 3 10778704 102200699 1 - by flanking markers RRID:RGD_2306115 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306116 SD-Tg(Sp6)5Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 RRID:RGD_2306116 The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. 2306117 ACI.F344-(D16Nkg9-D16Nkg27)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2306117 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. 2306118 SHR.WKY-(D15Rat95-D15Rat106)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 69469532 106177917 1 - by flanking markers 15 74166614 109944957 1 - by flanking markers 15 70559420 106550657 1 - by flanking markers 15 63180675 98288169 1 - by flanking markers RRID:RGD_2306118 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306119 F344-Tg(CD4,CCNT1)1Hik National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious RRID:RGD_2306119 Developed by the DEPOSITOR 2306120 SHR.WKY-(D4Wox27-D4Rat15)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 4 460493 47890193 1 - by flanking markers 4 3096322 48448808 1 - by flanking markers 4 3044017 48656399 1 - by flanking markers 4 5218294 50119996 1 - by flanking markers RRID:RGD_2306120 This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. 2306276 F344-Exoc4Tn(sb-T2/Bart3)2.317Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Exoc4Tn(sb-T2/Bart3)2.317Mcwi 2306273 4 60406942 61284294 7 4 60287465 61081401 7 4 60549128 61358305 7 4 61807706 62584316 7 RRID:RRRC_00456 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. 2306277 F344-Gng12Tn(sb-T2/Bart3)2.320Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gng12Tn(sb-T2/Bart3)2.320Mcwi 2306274 4 96622363 96624479 7 4 162420268 162549350 7 4 97634925 97763478 7 4 96011118 96134767 7 RRID:RRRC_00454 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene. 2306278 F344-AW915325Tn(sb-T2/Bart3)2.319Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-31) AW915325Tn(sb-T2/Bart3)2.319Mcwi 2306272 RRID:RRRC_00448 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325. 2306279 F344-Diaph3Tn(sb-T2/Bart3)2.318Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Diaph3Tn(sb-T2/Bart3)2.318Mcwi 2306275 15 68905784 69267707 7 15 73538942 74007617 7 15 69928507 70400077 7 15 62543375 63013060 7 RRID:RRRC_00446 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. 2306529 BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75808584 77809321 1 - by flanking markers 4 142052025 144005977 1 - by flanking markers 4 77380565 79326833 1 - by flanking markers 4 76721312 78654798 1 - by flanking markers RRID:RGD_2306529 Parental strain BBDR.BBDP-(D4Rhw17-ss99306861)(D4Rhw11-D4Rhw10)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenic 2306532 BBDR.F344-(D4Rat27-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306532 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306533 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/2Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RRRC_00469 Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw 2306534 BBDR.F344-(D4Rat102-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306534 Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw 2306535 BBDR.F344-(D4Rat253-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306535 Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw 2306536 BBDR.F344-(D4Arb11-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306536 Congenic substrains generated by intercrossing male BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw and female BBDR/Rhw 2306537 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/1Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306537 Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw 2306538 BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306538 Congenic substrains generated by intercrossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutation 2306539 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/3Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306539 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306540 BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306540 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306541 BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington Rat Resource and Research Center congenic Unknown RRID:RRRC_00457 BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed 2306542 BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306542 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306543 BBDR.F344-(D4Got59-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306543 BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed 2306544 BBDR.F344-(D4Rat26-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_2306544 Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA 2306709 BBDR.BBDP-(D4Mit6-D4Mit7)/3Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_2306709 This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. 2306710 F344-LmlnTn(sb-T2/Bart3)2.322Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) LmlnTn(sb-T2/Bart3)2.322Mcwi 2306701 11 69481117 69547133 7 11 73980288 74048100 7 11 70895141 70963121 7 11 67656241 67725889 7 RRID:RRRC_00447 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene. 2306711 F344-FM117003Tn(sb-T2/Bart3)2.321McwiRrrc PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm FM117003Tn(sb-T2/Bart3)2.321Mcwi 2306703 RRID:RRRC_00475 this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb 2306712 BBDR.BBDP-(D4Mit6-D4Mit7)/2Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_2306712 This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. 2306717 BBDP/WorSunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada Rat Resource and Research Center inbred Cryopreserved Sperm; Cryorecovery (as of 2018-11-12) RRID:RRRC_00787 These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada. 2306784 Kini:DA,PVG-G12 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown RRID:RGD_2306784 Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1a MHC haplotype were bred to create F1 generation, 7 couples of F1 with DA/Han and PVG/OlaHsd females founders generated F2. F3 generation originated from breeding 50 random couples 2306815 SS.SR-(D7Rat67-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111506104 113014423 1 - by flanking markers 7 114961803 116100169 1 - by flanking markers 7 115041287 115041463 1 - by flanking markers 7 105699315 105699492 1 - by flanking markers RRID:RGD_2306815 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306816 SS.SR-(D7Mco19-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112800232 113014423 1 - by flanking markers 7 115828017 116100169 1 - by flanking markers 7 115922628 115922885 1 - by flanking markers 7 106571501 106571759 1 - by flanking markers RRID:RGD_2306816 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306817 SS.SR-(D7Uia1-D7Mco19)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 112800489 1 - by flanking markers 7 112367543 115828274 1 - by flanking markers 7 112429186 115922885 1 - by flanking markers 7 103146217 106571759 1 - by flanking markers RRID:RGD_2306817 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306818 SS.SR-(D7Rat131-D7Mco7)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111882387 113014423 1 - by flanking markers 7 115334997 116100169 1 - by flanking markers 7 115421039 115421228 1 - by flanking markers 7 106074002 106074194 1 - by flanking markers RRID:RGD_2306818 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306819 SS.SR-(D7Uia1-D7Rat131)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 111882577 1 - by flanking markers 7 112367543 115335186 1 - by flanking markers 7 112429186 115421228 1 - by flanking markers 7 103146217 106074194 1 - by flanking markers RRID:RGD_2306819 Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F1 which were intercrossed and genotyped 2306820 SS.SR-(D3Arb14-D3Mco36)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 171009566 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 3 168974481 168974694 1 - by flanking markers RRID:RGD_2306820 SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome 2306823 SS.SR-(D3Arb14-D3Mco36)(D7Mco19-D7Mco7)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_2306823 SS.SR-(D3Arb14-D3Mco36)/Mco were crossed with SS.SR-(D7Mco19-D7Mco7)/Jr and then F1 rats were backcrossed with SS.SR-(D3Arb14-D3Mco36)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bred 2306840 E3.DA-(D4Wox22-D4Got132)(D12Wox5-D12Rat26)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown RRID:RGD_2306840 This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers 2306841 E3.DA-(D12Wox5-D12Rat26)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23845554 23845733 1 - by flanking markers 12 17721341 27718984 1 - by flanking markers 12 15714609 25711626 1 - by flanking markers 12 13635523 22692658 1 - by flanking markers RRID:RGD_2306841 This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers 2306842 E3.DA-(D20Rat45-D20Rat47)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6;20 133455626;1616332 133455718;5447494 1 - by flanking markers;1 - by flanking markers 20 4059279 8810333 1 - by flanking markers 20 2018654 6567533 1 - by flanking markers 20 1527842 5304690 1 - by flanking markers RRID:RGD_2306842 This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers 2306874 F344-IntuTn(sb-T2/Bart3)2.324Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) IntuTn(sb-T2/Bart3)2.324Mcwi 2306873 2 127564813 127639564 7 2 147063971 147216092 7 2 127459089 127521327 7 2 123600972 123685331 7 RRID:RRRC_00441 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene. 2306875 F344-FaslgTn(sb-T2/Bart3)2.325Mcwi PhysGen mutant Extinct (as of 2017-01-26) FaslgTn(sb-T2/Bart3)2.325Mcwi 2306872 13 77472950 77480210 7 13 84590119 84605900 7 13 79696811 79717581 7 13 74151519 74172760 7 RRID:RGD_2306875 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. 2306892 SHR.BN-(D2Rat114-D2Rat123)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 36432989 112326568 1 - by flanking markers 2 55361257 131889716 1 - by flanking markers 2 36245223 112175725 1 - by flanking markers 2 109366814 109366971 1 - by flanking markers RRID:RGD_2306892 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306893 SHR.BN-(D16Rat87-D16Mgh1)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 16 3464719 46137590 1 - by flanking markers 16 4082652 45651269 1 - by flanking markers 16 4136355 45905331 1 - by flanking markers 16 3380150 43025077 1 - by flanking markers RRID:RGD_2306893 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306894 SHR.BN-(D4Rat33-D4Rat54)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 4 80205349 121829076 1 - by flanking markers 4 146540904 184799673 1 - by flanking markers 4 81874073 119546974 1 - by flanking markers 4 81006124 120102625 1 - by flanking markers RRID:RGD_2306894 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306895 SHR.BN-(D2Rat226-D2Rat294)/Jk Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 170338294 236153712 1 - by flanking markers 2 197020226 262435073 1 - by flanking markers 2 177680772 243901375 1 - by flanking markers 2 164073756 227146641 1 - by flanking markers RRID:RGD_2306895 Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals 2306961 RLA/Verh Roman low avoidance Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown RRID:RGD_2306961 Bignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium 2306962 RHA/Verh Roman high avoidance Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown RRID:RGD_2306962 Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium 2307077 HXB4/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307077 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307078 HXB27/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307078 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307079 HXB3/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307079 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307080 HXB20/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307080 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307081 HXB31/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307081 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307082 HXB18/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307082 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307083 HXB10/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307083 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307084 HXB24/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307084 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307085 HXB17/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307085 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307086 HXB7/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307086 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307087 SHR.BN-(D18Rat32-D18Rat12)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_2307087 A segment of chr 18 from BN was introgressed into the SHR background 2307088 HXB22/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307088 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307089 HXB29/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307089 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307090 SHR.BN10/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown RRID:RGD_2307090 A segment of chr 10 from BN was introgressed into the SHR background 2307091 HXB13/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307091 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307092 HXB14/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307092 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307093 HXB23/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307093 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307094 HXB1/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307094 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307095 HXB15/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307095 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307096 HXB2/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307096 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307097 HXB21/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307097 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307098 HXB25/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307098 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307099 HXB5/Ipcv Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307099 Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 2307115 BXH5/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307115 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307116 PXO3-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307116 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307117 PXO5-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307117 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307118 PXO9/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307118 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307119 PXO7-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307119 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307120 PXO7-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307120 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307121 BXH2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307121 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307122 PXO8-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307122 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307123 BXH13/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307123 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307124 BXH10/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307124 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307125 PXO6-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307125 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307126 BXH8/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307126 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307127 BXH11/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307127 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307128 PXO5-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307128 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307129 BXH9/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307129 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307130 PXO6-3/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307130 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307131 PXO8-2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307131 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307132 PXO10/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307132 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307134 BXH3/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307134 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307135 PXO4/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307135 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307136 BXH6/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307136 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307137 PXO6-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307137 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307138 PXO1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307138 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307139 BXH12/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307139 Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 2307155 SHR/1NCrl MRC Clinical Sciences Centre, College School of Medicine, London, UK inbred Unknown RRID:RGD_2307155 To Charles River from NIH in 1973 at F32. 2307156 DA/ZtmKini Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307156 Substrain of DA, to Hannover after 1965, now at Stockholm, Sweden. 2307157 PVG.1AV1/Kini Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown RRID:RGD_2307157 Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden. 2307159 SHRSR.SHRSP-(Klk1-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 1 94378103 181133270 1 - by flanking markers RRID:RGD_2307159 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307160 SHRSR.SHRSP-(Klk1-D1Mit3)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 1 94378103 144267916 1 - by flanking markers RRID:RGD_2307160 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307161 SHRSR.SHRSP-(D1Rat134-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 1 133634986 181133270 1 - by flanking markers RRID:RGD_2307161 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307166 SHRSP.SHRSR-(Klk1-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 1 94378103 181133270 1 - by flanking markers RRID:RGD_2307166 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307167 SHRSP.SHRSR-(Klk1-D1Mit3)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 1 94378103 144267916 1 - by flanking markers RRID:RGD_2307167 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307168 SHRSR/Bbb Spontaneously Hypertensive Rat, Stroke Resistant Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown RRID:RGD_2307168 This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany. 2307169 SHRSP.SHRSR-(D1Rat134-Mt1-ps1)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 1 133634986 181133270 1 - by flanking markers RRID:RGD_2307169 SHRSP were crossed with SHRSR to give heterozygous F2 animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest 2307298 BN/HanKini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307298 Substrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany) 2307299 ACI/ZtmKini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown RRID:RGD_2307299 substrain of ACI derived from ACI/Ztm 2307300 LEW.1AV1/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown RRID:RGD_2307300 Substrain of LEW.1AV1 2307301 DA.LEW.RT1f-(D20Wox15-D20Wox13)/Rhd Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden congenic Unknown 20 2790524 6695696 1 - by flanking markers 20 5249993 10234922 1 - by flanking markers 20 3151827 8034632 1 - by flanking markers 20 2646407 6515143 1 - by flanking markers RRID:RGD_2307301 RT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markers 2307317 MHS Milan Hypertensive Strain Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy outbred Unknown RRID:RGD_2307317 Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure 2307318 BDIX/Ifz Duisburg-Essen University Medical School, Essen, Germany inbred Unknown RRID:RGD_2307318 derived from Berlin-Druckrey strain BDIX 2307319 MNS/N Milan normotensive strain Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo RRID:RRRC_00171 Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. 2307355 PXO3-1/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307355 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307356 PXO2/Cub Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown RRID:RGD_2307356 Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. 2307357 BDV/Ztm Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown RRID:RGD_2307357 Developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. 2307358 LUDW/OlaHsd Ludwig Envigo Envigo inbred Cryorecovery RRID:RGD_2307358 Wistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979. 2307359 BUF/SimRijHsd Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_2307359 Developed by Heston in 1946 from a Buffalo 2307360 DA.BI.RT1i-(D20Rat42-D20Rat31)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 4582054 10410227 1 - by flanking markers 20 6265460 12972703 1 - by flanking markers 20 4186104 10800530 1 - by flanking markers 20 4459698 10078919 1 - by flanking markers RRID:RGD_2307360 RT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han. 2307441 F344-Cyyr1Tn(sb-T2/Bart3)2.328Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyyr1Tn(sb-T2/Bart3)2.328Mcwi 2307440 11 25036792 25157304 7 11 28591553 28702298 7 11 24967936 25078740 7 11 24557620 24664007 7 RRID:RRRC_00452 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. 2307442 F344-Robo1Tn(sb-T2/Bart3)2.327Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Robo1Tn(sb-T2/Bart3)2.327Mcwi 2307439 11 10784947 11720646 7 11 13314508 13808775 7 11 9079291 10146302 7 11 10580863 11621675 7 RRID:RRRC_00451 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene. 2308816 Crl:WI(Han) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308816 Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL (under structural changed to RCC). Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system. 2308851 Crl:OP(CD) Obese Prone Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308851 Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD). 2308852 Crl:LE Long-Evans Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308852 Originated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978. 2308853 Crl:OR(CD) Obese Resistant Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2308853 Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets. 2308885 GK/CskCrljCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2308885 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006. 2308886 SS/HsdMcwiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2308886 Inbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001. 2311049 SHROB/KolGmiCrl-Leprcp/Crl Charles River Laboratories Charles River Laboratories coisogenic Unknown Leprcp 11570565 RRID:RGD_2311049 This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001. 2311051 SHRSP/A3NCrl Stroke Prone Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311051 The Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002. 2311070 BUF/CrCrl Buffalo Rat Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311070 Heston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). 2311071 ZDF-Leprfa/Crl Charles River Laboratories Charles River Laboratories coisogenic Unknown Lepr 3001 RRID:RGD_2311071 A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001. 2311072 FHH/EurMcwiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311072 An outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001. 2311073 NBL/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311073 Bogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998. 2311074 BDIX/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311074 Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). 2311078 Crl:CD-Hrhr CD hairless rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2311078 This spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic. 2311079 WF/CrCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2311079 J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). 2311082 SS-Chr 13BN/McwiCrl Charles River Laboratories Charles River Laboratories consomic Unknown RRID:RGD_2311082 Developed at the Medical College of Wisconsin. To Charles River in 2003. 2311692 F344-Myo1dTn(sb-T2/Bart3)2.334Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Myo1dTn(sb-T2/Bart3)2.334Mcwi 2311691 10 68720729 68997721 7 10 67520649 67811744 7 10 67866939 68142864 7 10 65489153 65765812 7 RRID:RRRC_00478 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene. 2311693 F344-Tmem22Tn(sb-T2/Bart3)2.332Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Tmem22Tn(sb-T2/Bart3)2.332Mcwi 2311689 8 105416072 105443969 7 8 108269643 108297339 7 8 108854134 108881519 7 8 101085579 101113339 7 RRID:RGD_2311693 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene. 2311694 F344-Fam227aTn(sb-T2/Bart3)2.333Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam227aTn(sb-T2/Bart3)2.333Mcwi 2311687 7 117441099 117469873 7 7 120839737 120881869 7 7 120846166 120891738 7 7 111174362 111216513 7 RRID:RRRC_00484 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. 2312352 LEW.1N Zentralinstitut fur Versuchstierzucht, Hannover, Germany congenic Unknown RRID:RGD_2312352 These congenic rats carry the RTln haplotype on the LEW strain genetic background. 2312447 SD-Tg(Pmp22)Kan Max Planck Institute for Experimental Medicine, Gottingen, Germany transgenic Unknown Pmp22 11125 RRID:RGD_2312447 This transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid library 2312466 Crl:LIS Lister Hooded Rat Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312466 These rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance. 2312471 Crl:ZUC(Orl)-Leprfa Charles River Laboratories Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_2312471 The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991. 2312472 Crl:WI(WU) Wistar Wu Rat Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312472 Selection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987. 2312473 BDIX/OrlCrl BDIX Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2312473 Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991. 2312474 Crl:OFA(SD) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312474 The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968. 2312498 WAG/RijCrl WAG Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2312498 A.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993. 2312499 Crl:NIH-Foxn1rnu Nude Rats Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312499 The NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs. 2312504 Crlj:WI Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312504 Wistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981) 2312511 WF/IcoCrl Wistar Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2312511 Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970. 2312512 ZSF1-Leprfa, Leprcp/Crl Genetic Models International, Indianapolis. Charles River Laboratories , Charles River Laboratories hybrid Unknown RRID:RGD_2312512 This F1 model was developed by crossing rat strains with two separate leptin receptor mutations (fa and cp), the lean female ZDF rat (+/fa) and the lean male SHHF rat (+/facp) ( RGD:401901201). Offspringcarring both mutations (fa:facp) are obese and develop insulin resistance, hyperglycaemia, and mild hypertension (ZSF1 obese). The heterozygous or wild type offspring (ZSF1 lean) are lean and exhibit no signs of obesity and diabetes. This model was developed at Genetic Models International, Indianapolis. To Charles River in 2001. The progeny that are heterozygous for leptin receptor or wild type are lean and are used as control for the obese counter part. 2312513 Crlj:DON Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312513 Dr. Sato(1952) to Nippon Rat to CRLJ(1990) 2312514 Crlj:LEC Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_2312514 Hokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991). 2312518 Crlj:ZUC-Leprfa Charles River Laboratories Charles River Laboratories outbred Unknown Leprfa 13432153 RRID:RGD_2312518 Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000) 2312577 SHR.BN-(D18Rat99-D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 31654683 73666623 1 - by flanking markers 18 32165265 72695235 1 - by flanking markers 18 32487692 73016546 1 - by flanking markers 18 30558524 70263868 1 - by flanking markers RRID:RGD_2312577 F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity 2312578 SHR.BN-(D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 73016379 73016546 1 - by flanking markers 18 70263698 70263868 1 - by flanking markers RRID:RGD_2312578 F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity 2312579 SHR.BN-(D18Rat40-D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 62106066 73666623 1 - by flanking markers 18 60695794 72695235 1 - by flanking markers 18 61499531 73016546 1 - by flanking markers 18 59330409 70263868 1 - by flanking markers RRID:RGD_2312579 F2 rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity 2312580 SHR.BN-(D18Rat113-D18Rat82)/Ipcv Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 3719547 73016546 1 - by flanking markers 18 70263698 70263868 1 - by flanking markers RRID:RGD_2312580 SHR/OlaIpcv were crossed with BN/Crl, F1 animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes 2312609 MWF-Chr 8SHR/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_2312609 MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing 2312644 DA.WOKW-(D3Mit10-D3Rat189)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 35797577 35797756 1 - by flanking markers 3 44863125 44863303 1 - by flanking markers 3 39773247 39773425 1 - by flanking markers 3 38710365 38710544 1 - by flanking markers RRID:RGD_2312644 A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background 2312645 DA.WOKW-(D16Rat88-D16Wox7)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 16 819225 63306215 1 - by flanking markers 16 1534408 62873174 1 - by flanking markers 16 1550187 63210301 1 - by flanking markers 16 832236 59492508 1 - by flanking markers RRID:RGD_2312645 A cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K background 2312646 DA.WOKW-(D5Mgh6-D5Mit5)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 5 71814715 109163425 1 - by flanking markers 5 75334610 112058005 1 - by flanking markers 5 71154828 108092802 1 - by flanking markers 5 68984307 104251008 1 - by flanking markers RRID:RGD_2312646 A cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K background 2312647 DA.WOKW-(D3Mgh5-D3Rat1)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 97523869 170016653 1 - by flanking markers 3 109733850 180128021 1 - by flanking markers 3 103141814 176418101 1 - by flanking markers 3 98535255 168026850 1 - by flanking markers RRID:RGD_2312647 A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background 2312648 DA.WOKW-(D10Mgh2-D10Rat4)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 10 106422174 107033716 1 - by flanking markers 10 105533457 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 10 102134116 102134272 1 - by flanking markers RRID:RGD_2312648 A cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K background 2312733 BN-Chr 13SS Chr 18SS/Mcwi PhysGen consomic Cryopreserved Sperm RRID:RGD_2312733 A cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed 2313181 LEW.1WR1/WorBrm Biomedical Research Models, Inc. Biomedical Research Models, Inc. congenic Unknown RRID:RGD_2313181 Obtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc. 2313209 WF.ART2/Wor Universtiy of Massachusetts, Worcester, MA congenic Unknown RRID:RGD_2313209 developed at the Universtiy of Massachusetts, Medical School 2313221 SHHF-Leprcp/Crl Charles River Laboratories Charles River Laboratories congenic Unknown Leprcp 11570565 RRID:RGD_2313221 Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001. 2313222 BN/HsdMcwiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_2313222 BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River 2313231 LEWBNF1/Crl Charles River Laboratories Charles River Laboratories hybrid Unknown RRID:RGD_2313231 This hybrid rat is a cross between a LEW female and a BN male rat. 2313232 WFF344F1/Crl Charles River Laboratories Charles River Laboratories hybrid Unknown RRID:RGD_2313232 This hybrid rat is a cross between a WF female and a F344 male rat. 2313342 BN-Chr 17LH/Mav Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2313342 Chr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped 2313343 LH-Chr 13BN/Mav Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown RRID:RGD_2313343 Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped 2313384 Wild/Nov Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia wild Unknown RRID:RGD_2313384 These are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia 2313463 F344-Ppfia2Tn(sb-T2/Bart3)2.339Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppfia2Tn(sb-T2/Bart3)2.339Mcwi 2313459 7 45140154 45616620 7 7 48563521 49058116 7 7 48548932 49045852 7 7 41765716 42240104 7 RRID:RRRC_00474 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene. 2313464 F344-LargeTn(sb-T2/Bart3)2.336Mcwi PhysGen, Transposagen mutant Extinct (as of 2017-01-26) LargeTn(sb-T2/Bart3)2.336Mcwi 2313460 19 12043818 12497663 7 19 23595328 24054765 7 19 12481563 12945320 7 19 11603129 12048930 7 RRID:RGD_2313464 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene. 2313465 F344-Pld5Tn(sb-T2/Bart3)2.340Mcwi PhysGen, Transposagen Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pld5Tn(sb-T2/Bart3)2.340Mcwi 2313462 13 91715000 92058036 7 13 98486317 98812030 7 13 94025696 94355219 7 13 87895694 88232868 7 RRID:RRRC_00483 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene. 2313466 F344-Agbl4Tn(sb-T2/Bart3)2.337Mcwi PhysGen, Transposagen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Agbl4Tn(sb-T2/Bart3)2.337Mcwi 2313461 5 134582789 135484937 7 5 130742297 131656581 7 5 125254963 126534367 7 RRID:RRRC_00473 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene. 2313588 SD-Tg(Ins2-IAPP)Soel Pfizer, Inc, Groton, Connecticut transgenic Unknown RRID:RGD_2313588 Crl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoter 2313693 SHR-Tg(PEPCK-SREBF1)2Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 RRID:RGD_2313693 SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal 2313734 SD-Tg(H1/tetO-RNAi:Insr)29Bdr Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown RRID:RGD_2313734 Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter 2313735 SD-Tg(H1/tetO-RNAi:Insr)14Bdr Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown RRID:RGD_2313735 Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter 2313922 F344-Tg(Cyp1a1-Ren2)10.LEW-(D10Rat142-D10Rat15)/Jmul Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 92448353 96667338 1 - by flanking markers 10 91113514 95243104 1 - by flanking markers 10 91345679 95508221 1 - by flanking markers 10 88207600 92238497 1 - by flanking markers RRID:RGD_2313922 F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to F344 females to produce BC-F344. After 12 backcross nerations, males and females heterozygous for F344/Lew in the reduced MOD QTLregion were brother-sister mated to generate aimals that were homozygous Lew/Lew for the MOD QTL region but homozygous F344/F344 for the rest of the genome. 2313923 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10.F344-(D10Rat99-D10Rat11)/Jmul Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 89278229 100633982 1 - by flanking markers 10 88043769 99184250 1 - by flanking markers 10 88250522 99492409 1 - by flanking markers 10 85269536 96121100 1 - by flanking markers RRID:RGD_2313923 F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to Lew females to produce BC-Lew. After 12 backcross generations, males and females heterozygous for F344/Lew in the MOD QTLregion were brother-sister mated to generate aimals that were homozygous F344/F344 for the MOD QTL region but homozygous LEW/LEW for the rest of the genome. 2313924 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10/Jmul Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK consomic Unknown RRID:RGD_2313924 F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markers 2314001 N:HS Heterogeneous stock Dept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain outbred Unknown RRID:RGD_2314001 Originated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsin 2314009 NMcwi:HS Heterogeneous stock Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin outbred Unknown RRID:RGD_2314009 25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. A rotational delay of 1 is used, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc. 2314027 SDT.Cg-Leprfa/Jtt SDT fatty Japan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, Japan congenic Unknown RRID:RGD_2314027 Leprfa allele from ZDF was introgressed into SDT rats using the speed congenic method 2314161 F344-Kuru1/Kyo Kuru1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314161 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314162 F344-Oune/Kyo Oune National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Tbx6 1307716 RRID:RGD_2314162 A mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314163 F344-Kcna1Adms/Kyo ADMS (autosomal dominant myokymia and seizures) rat The University of Tokyo, The Institute of Medical Science National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Kcna1Adms 12880383 4 163011777 163013522 7 4 226188851 226190596 7 4 159190781 159192526 7 4 159464223 159472905 7 RRID:RGD_2314163 This strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model. 2314164 F344-Kuru2/Kyo Kuru2 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314164 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314165 ACI-Chib/Kyo Chibi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology RRID:RGD_2314165 This strain was established by phenotype-driven ENU mutagenesis. 2314166 F344-Tbr2/Kyo Tsubura2 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314166 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314167 F344-Kmch/Kyo Komachi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm RRID:RGD_2314167 This strain was established by phenotype-driven ENU mutagenesis. 2314168 F344-Tbr1/Kyo Tsubura1 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314168 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314169 WTC.F344-Scn1am1Kyo/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2024-04-16) Scn1am1Kyo 12792283 RRID:RGD_2314169 This congenic strain was established by backcrossing F344-Scn1am1Kyo onto WTC/Kyo. 2314170 F344-Egrm1Kyo EGR (Excessive Grooming Rat), Kaikai, Kyo1897 National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314170 This strain was established by phenotype-driven ENU mutagenesis. 2314224 F344.OLETF-(D1Rat166-D1Rat90)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1 248393012 259647894 1 - by flanking markers RRID:RGD_2314224 Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. 2314225 F344-Chr 15OLETF/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_2314225 Developed by the depositor 2314226 WI-Tg(WSCD2)3Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314226 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314227 WI-Tg(WSCD2)4Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314227 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314228 WI-Tg(WSCD2)5Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314228 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314229 F344.OLETF-(D7Uwm22-D7Mgh20)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 123733466 123733601 1 - by flanking markers 7 126334525 126334660 1 - by flanking markers 7 126622888 126623023 1 - by flanking markers 7 116836447 116836583 1 - by flanking markers RRID:RGD_2314229 Developed by the DEPOSITOR 2314230 F344-Hrkrh/Kyo Hairless Kyoto, Hanako National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology; Urology RRID:RGD_2314230 A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). 2314231 F344.OLETF-(D5Mgh5-D5Mgh23)/2Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 5 43726656 109897936 1 - by flanking markers RRID:RGD_2314231 Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. 2314232 WI-Tg(WSCD2)1Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314232 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314243 SHR.WKY-(D1Mgh2-D1Wox10)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1 22842898 220639653 1 - by flanking markers 1 24875821 244066407 1 - by flanking markers 1 23406428 236763528 1 - by flanking markers 1 22340647 214537671 1 - by flanking markers RRID:RGD_2314243 Developed by the depositor 2314244 BCR/Nn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology RRID:RGD_2314244 In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). 2314245 WI-Tg(WSCD2)6Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 RRID:RGD_2314245 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314246 SHRSP.WKY-(D1Rat117-D1Rat90)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 219629755 267111153 1 - by flanking markers 1 240604381 289137268 1 - by flanking markers 1 233490105 281795785 1 - by flanking markers 1 213533809 259647894 1 - by flanking markers RRID:RGD_2314246 Developed by the Depositor 2314247 WI-Tg(Prl-EGFP)Yamp National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Metabolism; Development RRID:RGD_2314247 A transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats 2314313 NER.F344-(D5Rat100-D5Rat234)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 5 68843563 68843964 1 - by flanking markers 5 70180341 70180484 1 - by flanking markers 5 65696672 65696815 1 - by flanking markers 5 66174080 66174226 1 - by flanking markers RRID:RGD_2314313 The Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. 2314314 NER.F344-(D1Mgh6-D1Rat132)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 1 87656636 165996388 1 - by flanking markers 1 92524380 179788206 1 - by flanking markers 1 91394009 172789257 1 - by flanking markers 1 87790149 162457491 1 - by flanking markers RRID:RGD_2314314 The Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. 2314315 F344.NER-(D5Mgh4-D5Rat36)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 5 145186817 145187034 1 - by flanking markers 5 147610023 147610238 1 - by flanking markers 5 143846157 143846372 1 - by flanking markers 5 138113556 138113774 1 - by flanking markers RRID:RGD_2314315 The Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. 2314316 F344.NER-(D1Mgh6-D1Rat73)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 87656636 224420760 1 - by flanking markers 1 92524380 246113473 1 - by flanking markers 1 91394009 238824901 1 - by flanking markers 1 87790149 218748178 1 - by flanking markers RRID:RGD_2314316 The Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. 2314317 WTC.GRY-Cacna1agry/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-05-04) Neurobiology Cacna1a|Cacna1agry 2244|12880382 RRID:RGD_2314317 Developed by the depositor 2314339 F344-PatjTn(sb-T2/Bart3)2.343Mcwi PhysGen Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) PatjTn(sb-T2/Bart3)2.343Mcwi 2314335 5 118806744 119131114 7 5 120981525 121281044 7 5 117038548 117340308 7 5 113061985 113364807 7 RRID:RRRC_00480 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene. 2314340 F344-AcoxlTn(sb-T2/Bart3)2.342Mcwi PhysGen mutant Extinct (as of 2016-10-24) AcoxlTn(sb-T2/Bart3)2.342Mcwi 2314337 3 115365279 115687566 7 3 126606586 126919666 7 3 120414311 120724809 7 3 115061069 115367032 7 RRID:RGD_2314340 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene. 2314341 F344-Auts2Tn(sb-T2/Bart3)2.344Mcwi PhysGen mutant Extinct (as of 2016-10-24) Auts2Tn(sb-T2/Bart3)2.344Mcwi 2314338 12 25518248 25541023 7 12 24104187 25194123 7 RRID:RGD_2314341 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene. 2314342 F344-PalldTn(sb-T2/Bart3)2.341Mcwi PhysGen mutant Extinct (as of 2017-01-26) PalldTn(sb-T2/Bart3)2.341Mcwi 2314336 16 31144028 31144544 7 16 31198863 31240064 7 16 31349140 31390340 7 16 27981315 28143129 7 RRID:RGD_2314342 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene. 2314360 ACI.F344-(D16Mit5-D16Nkg27)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer RRID:RGD_2314360 This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals. 2314361 W-Tg(Slc32a1-YFP*)1Yyan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development RRID:RGD_2314361 This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. 2314362 F344-Hrdk/Kyo Hairless dominant Kyoto National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_2314362 Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven). 2314363 W-Tg(Slc32a1-YFP*)2Yyan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development RRID:RGD_2314363 This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. 2314364 ACI.F344-(D16Nkg112-D16Nkg27)/Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer RRID:RGD_2314364 This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. 2314365 KFRS2/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology Tyr|TyrsiaKyo 1589755|13207345 1 143641257 143746315 7 1 157322968 157416594 7 1 151012598 151106802 7 1 141115036 141210207 7 RRID:RGD_2314365 A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. 2314368 F344-Kcnn2Trdk/Kyo Tremor dominant Kyoto The University of Tokyo, The Institute of Medical Science National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-15) Neurobiology Kcnn2Trdk 149735330 18 39560962 39705037 7 18 38822146 38864110 7 18 39331894 39479574 7 18 37817966 38258347 7 RRID:RGD_2314368 Tremor dominant Kyoto (Trdk) mutation is an autosomal dominant mutation that appeared in 2008 in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU) (Mashimo et al., 2008). Rats heterozygous for Trdk (Trdk/+) exhibited tremor behavior that was evident around weaning. To remove latent ENU-induced mutations, the laboratory established an F344-Trdk/+ congenic strain by nine rounds of backcrossing. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2. 2314375 LE.AR-Ednrbsl/Okkm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-03-28) Internal Organ Ednrb|Ednrbsl 2536|10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_2314375 AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008). 2314376 KFRS4/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo (as of 2021-10-05) Ophthalmology; Dermatology RRID:RGD_2314376 A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14. 2314377 KFRS3B/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology RRID:RGD_2314377 A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding. 2314378 AR-Ednrbsl/Okkm Aganglionosis rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-10-31) Internal Organ Ednrb|Ednrbsl 2536|10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_2314378 Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR) 2314379 KFRS6/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals Dermatology RRID:RGD_2314379 A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo. 2314380 SD-Tg(CAG-lacZ)541Htsu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_2314380 Developed by the depositor 2314381 KFRS5A/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology Krt71Rex 11570416 7 141143396 141166531 7 7 143345201 143371346 7 7 132873532 132898975 7 RRID:RGD_2314381 A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo. 2314382 SD-Tg(CAG-HRAS*G12V)250Htsu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Cancer HRAS 730881 RRID:RGD_2314382 This transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter 2314383 KFRS3A/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology RRID:RGD_2314383 A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding. 2314396 LCR/Mco Low-capacity runners Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_2314396 Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. 2314397 HCR/Mco High-capacity runners Medical College of Ohio, Toledo, Ohio, USA inbred Unknown RRID:RGD_2314397 Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill. 2314414 LEW-Tg(H1/tetO-RNAi:Insr)87Hrjb Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 RRID:RGD_2314414 LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter 2314415 LEW-Tg(H1/tetO-RNAi:Insr)4Hrjb Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 RRID:RGD_2314415 LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter 2314477 LEW-RT1DA/Rrrc Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00391 Sprague-Dawley RT1u haplotype backcrossed onto Lewis inbred strain. 2314478 LEW-RT1.Bm1Trg/Rrrc RT1.B Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00392 ENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain. 2314492 SBN.SBH-(D1Rat148-D1Rat89)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 16325337 265343617 1 - by flanking markers 1 18951160 287349830 1 - by flanking markers 1 16470664 279986079 1 - by flanking markers 1 15760582 257976495 1 - by flanking markers RRID:RGD_2314492 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl 2314493 SBH.SBN-(D1Mgh2-D1Rat74)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 227005733 1 - by flanking markers 1 24875821 248763894 1 - by flanking markers 1 23406428 241482368 1 - by flanking markers 1 22340647 221264292 1 - by flanking markers RRID:RGD_2314493 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl 2314494 SBH.SBN-(D1Rat137-D1Rat123)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 223729371 1 - by flanking markers 1 95325941 245519018 1 - by flanking markers 1 94225372 238220385 1 - by flanking markers 1 90532338 218108781 1 - by flanking markers RRID:RGD_2314494 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl 2314495 SBN.SBH-(D1Rat27-D1Mit7)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90282040 240980321 1 - by flanking markers 1 95301716 262617374 1 - by flanking markers 1 94201400 94201552 1 - by flanking markers 1 90508614 90508767 1 - by flanking markers RRID:RGD_2314495 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl 2314496 SBH.SBN-(D1Mgh2-D1Mgh11)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 22843363 1 - by flanking markers 1 24875821 24875970 1 - by flanking markers 1 23406428 23406577 1 - by flanking markers 1 22340647 22340797 1 - by flanking markers RRID:RGD_2314496 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl 2314497 SBN.SBH-(D1Rat101-D1Rat74)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 97174943 227005733 1 - by flanking markers 1 103735751 248763894 1 - by flanking markers 1 102658741 241482368 1 - by flanking markers 1 97146283 221264292 1 - by flanking markers RRID:RGD_2314497 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl 2314498 SBH.SBN-(D1Rat137-D1Rat83)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 252133935 1 - by flanking markers 1 95325941 274017147 1 - by flanking markers 1 94225372 266587220 1 - by flanking markers 1 90532338 245701099 1 - by flanking markers RRID:RGD_2314498 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl 2314499 SBN.SBH-(D1Mgh17-D1Mgh14)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 9082836 263699089 1 - by flanking markers 1 10007292 285604895 1 - by flanking markers 1 8387052 278228889 1 - by flanking markers 1 8606496 256448636 1 - by flanking markers RRID:RGD_2314499 Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl 2314500 SBH.SBN-(D1Mgh2-D1Rat101)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 97175101 1 - by flanking markers 1 24875821 103735908 1 - by flanking markers 1 23406428 102658898 1 - by flanking markers 1 22340647 97146439 1 - by flanking markers RRID:RGD_2314500 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl 2314501 SBH.SBN-(D1Wox11-D1Rat137)/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 64145811 90306478 1 - by flanking markers 1 63399232 95326185 1 - by flanking markers 1 64407177 94225616 1 - by flanking markers 1 65832929 90532583 1 - by flanking markers RRID:RGD_2314501 Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl 2314530 SS.SHR-(D8Uia1-D8Rat90)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 8 110572032 110572221 1 - by flanking markers RRID:RGD_2314530 SS/Jr females were bred with SHR/NHsd males and their female F1 were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markers 2314531 SHR.SS-(D13Rat1-D13Mgh6)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 13 10555730 101704301 1 - by flanking markers 13 29679984 108279142 1 - by flanking markers 13 24501968 103613733 1 - by flanking markers 13 20605555 97213863 1 - by flanking markers RRID:RGD_2314531 SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers 2314532 SHR.SS-(D8Uia1-D8Rat90)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 8 110572032 110572221 1 - by flanking markers RRID:RGD_2314532 SS/Jr females were bred with SHR/NHsd males and their male F1 were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers 2314655 BRAT-Avpdi/BluHsd Brattleboro Harlan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) Avpdi 13627261 3 118205007 118206985 7 3 129615610 129627147 7 3 123117482 123119460 7 3 117793447 117805091 7 RRID:RGD_2314655 Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. 2314861 WAG/RijYcb Comparative Medicine, Yale University, Connecticut Comparative Medicine, Yale University, Connecticut inbred Unknown RRID:RGD_2314861 Substrain of WAG/Rij; from Netherlands to Yale University. 2314904 WAG-F8m1Ycb Comparative Medicine, Yale University, Connecticut Comparative Medicine, Yale University, Connecticut mutant Unknown F8m1Ycb 2314903 18 121134 162008 7 18 413447 444491 7 18 394478 394478 8 18 145719 145719 8 RRID:RGD_2314904 This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. 2314928 Slc:W Slc: Wistar SLC, Japan SLC, Japan outbred Unknown RRID:RGD_2314928 Institute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain. 2314934 WST.F344-Ker/Kyo Wistar/ST-Boo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2314934 This congenic strain was established by backcrossing F344-Ker/Kyo (NBRP No.0458) onto Slc:WST 2314935 WST.F344-Kmch/Kyo Wistar/ST-Komachi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm RRID:RGD_2314935 This congenic strain was established by backcrossing F344-Kmch/Kyo (NBRP No.0458) onto Slc:WST. 2314936 WI-Tg(WSCD2)Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-24) RRID:RGD_2314936 A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. 2314937 F344.OLETF-(D5Mgh20-D5Mgh22)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 140925168 157584492 1 - by flanking markers 5 143051962 160953783 1 - by flanking markers 5 139267814 157212422 1 - by flanking markers 5 133916727 151006154 1 - by flanking markers RRID:RGD_2314937 Developed by the depositor 2316631 F344.GK-(D1Swe8-D1Gpam-1)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown Adra2a|Pdcd4|Shoc2 2056|620816|1308146 1 259866528 259866737 1 - by flanking markers 1 281763458 281763667 1 - by flanking markers 1 274353782 274353991 1 - by flanking markers 1 252645447 252645657 1 - by flanking markers RRID:RGD_2316631 This sub-congenic strain is generated from an F2- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe 2316632 NEDH/KSim New England Deaconess Hospital Simonsen Laboratories Simonsen Laboratories inbred Unknown RRID:RGD_2316632 Inbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman 2316633 F344.GK-(D1Got251-D1Gpam-1)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 260641680 260641846 1 - by flanking markers 1 282550224 282550389 1 - by flanking markers 1 275138749 275138914 1 - by flanking markers 1 253439653 253439819 1 - by flanking markers RRID:RGD_2316633 This sub-congenic strain is generated from an F2- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe 2316653 SS.LEW-(D1Mco102-D1Got46)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 38394289;2374083 38394434;2374266 1 - by flanking markers;1 - by flanking markers 1 36290530 45656739 1 - by flanking markers 1 34888392 44326906 1 - by flanking markers 1 32249735 44011366 1 - by flanking markers RRID:RGD_2316653 A sub-congenic strain derived from SS.LEW-(D1Uia8-D1Rat18)/Mco contributing to the introgressed LEW allele 2316654 SS.LEW-(D1Mco102-D1Mco129)/1Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 1 32249735 33038814 1 - by flanking markers RRID:RGD_2316654 A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2316655 SS.LEW-(D1Mco102-D1Mco129)/2Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 1 32249735 33038814 1 - by flanking markers RRID:RGD_2316655 A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 2316925 SHR.BN-(D3Rat159-D3Rat1)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 119437175 170016653 1 - by flanking markers 3 130776038 180128021 1 - by flanking markers 3 124284647 176418101 1 - by flanking markers 3 118950053 168026850 1 - by flanking markers RRID:RGD_2316925 50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd 2316927 SHR.BN-(D6Rat40-D6Rat170)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 6 1301952 46792623 1 - by flanking markers 6 1111498 56881356 1 - by flanking markers 6 1120393 48179481 1 - by flanking markers 6 16536243 45547114 1 - by flanking markers RRID:RGD_2316927 45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd 2316928 SHR.BN-(D3Rat159-D3Rat1)(D6Rat40-D6Rat170)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_2316928 this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele 2317196 DA.PVG.1AV1-(D8Rat146-D8Got145) Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 73105403 91329867 1 - by flanking markers 8 76885501 93261060 1 - by flanking markers 8 74920991 93746162 1 - by flanking markers 8 69352596 87043114 1 - by flanking markers RRID:RGD_2317196 Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interest 2317197 DA.PVG.1AV1-(D8Rat41-D8Rat24) Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 50354908 82247243 1 - by flanking markers 8 50240107 84140836 1 - by flanking markers 8 51633707 84569318 1 - by flanking markers 8 47627235 78138314 1 - by flanking markers RRID:RGD_2317197 Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interest 2317201 DA.PVG.1AV1-(D8Rat24-D8Got145) Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 82246890 91329867 1 - by flanking markers 8 84140683 93261060 1 - by flanking markers 8 84569165 93746162 1 - by flanking markers 8 78138158 87043114 1 - by flanking markers RRID:RGD_2317201 DA.PVG.1AV1-(D8Rat146-D8Got145) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locus 2317278 Taiep/Dun Dept of Medical Sciences, University of Wisconsin-Madison, Madison, Wisconsin mutant Unknown RRID:RGD_2317278 These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 2317590 DA.PVG.1AV1-(D4Rat23-D4Rat108)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 82090355 1 - by flanking markers 4 58518376 148552304 1 - by flanking markers 4 83889402 83889539 1 - by flanking markers 4 82844048 82844186 1 - by flanking markers RRID:RGD_2317590 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317595 DA.PVG.1AV1-(D4Rat23-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 104416171 1 - by flanking markers 4 58518376 163844298 1 - by flanking markers 4 99066972 99067150 1 - by flanking markers 4 103194805 103194984 1 - by flanking markers RRID:RGD_2317595 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317596 DA.PVG.1AV1-(D4Rat103-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 82700691 104416171 1 - by flanking markers 4 149135946 163844298 1 - by flanking markers 4 84475257 99067150 1 - by flanking markers 4 83428419 103194984 1 - by flanking markers RRID:RGD_2317596 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317598 DA.PVG.1AV1-(D4Rat231-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 88462327 104416171 1 - by flanking markers 4 154593964 163844298 1 - by flanking markers 4 89777552 99067150 1 - by flanking markers 4 88656681 103194984 1 - by flanking markers RRID:RGD_2317598 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317599 DA.PVG.1AV1-(D4Got211-D4Mit12)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 79604076 104416171 1 - by flanking markers 4 145804154 163844298 1 - by flanking markers 4 81136696 99067150 1 - by flanking markers 4 80445377 103194984 1 - by flanking markers RRID:RGD_2317599 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317791 DA.PVG.1AV1-(D4Got60-D4Kini1)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 80704779 81729771 1 - by flanking markers 4 147125280 148194009 1 - by flanking markers 4 83531021 83531176 1 - by flanking markers 4 82490359 82490515 1 - by flanking markers RRID:RGD_2317791 Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini 2317812 AT.ANT-(D1Uia12-D1Rat288)/Rar University of Colorado Denver, Colorado Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 1 134007903 192038535 1 - by flanking markers 1 140949643 211567839 1 - by flanking markers 1 139972085 139972231 1 - by flanking markers 1 132214399 132214546 1 - by flanking markers RRID:RRRC_00728 F2 males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were tested 2317813 AT.ANT-(D1Rat234-D1Rat47)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 158511230 1 - by flanking markers 1 172296302 172296459 1 - by flanking markers 1 166100317 166100474 1 - by flanking markers 1 155422851 155423009 1 - by flanking markers RRID:RGD_2317813 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317814 AT.ANT-(D1Rat273-D1Rat158)/Rar University of Colorado Denver, Colorado congenic Unknown 1 140644473 153578547 1 - by flanking markers 1 147436666 167535765 1 - by flanking markers 1 146507930 161321256 1 - by flanking markers 1 138344856 150700247 1 - by flanking markers RRID:RGD_2317814 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317815 AT.ANT-(D1Rat35-D1Rat47)/Rar University of Colorado Denver, Colorado congenic Unknown 1 124748920 158511230 1 - by flanking markers 1 131958920 172296459 1 - by flanking markers 1 130917121 166100474 1 - by flanking markers 1 123479780 155423009 1 - by flanking markers RRID:RGD_2317815 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317816 AT.ANT-(D1Rat234-D1Rat158)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 153578547 1 - by flanking markers 1 167535661 167535765 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 1 150700142 150700247 1 - by flanking markers RRID:RGD_2317816 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317817 AT.ANT-(D1Rat183-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 131123181 192038535 1 - by flanking markers 1 138077032 211567839 1 - by flanking markers 1 137083889 137084126 1 - by flanking markers 1 129384185 129384427 1 - by flanking markers RRID:RGD_2317817 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317818 AT.ANT-(D1Rat273-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 140644473 192038535 1 - by flanking markers 1 147436666 211567839 1 - by flanking markers 1 146507930 146508090 1 - by flanking markers 1 138344856 138345017 1 - by flanking markers RRID:RGD_2317818 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317819 AT.ANT-(D1Rat35-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 124748920 192038535 1 - by flanking markers 1 131958920 211567839 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 1 123479780 123479925 1 - by flanking markers RRID:RGD_2317819 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317820 AT.ANT-(D1Rat158-D1Rat288)/Rar University of Colorado Denver, Colorado congenic Unknown 1 153578442 192038535 1 - by flanking markers 1 167535661 211567839 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 1 150700142 150700247 1 - by flanking markers RRID:RGD_2317820 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT 2317822 AT.ANT-(D1Rat35-D1Rat38)/Rar University of Colorado Denver, Colorado congenic Unknown 1 124748920 133567105 1 - by flanking markers 1 131958920 140507239 1 - by flanking markers 1 130917121 139524104 1 - by flanking markers 1 123479780 131763614 1 - by flanking markers RRID:RGD_2317822 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317825 AT.ANT-(D1Rat234-D1Rat35)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 124749065 1 - by flanking markers 1 131958920 131959064 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 1 123479780 123479925 1 - by flanking markers RRID:RGD_2317825 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317827 AT.ANT-(D1Rat234-D1Rat38)/Rar University of Colorado Denver, Colorado congenic Unknown 1 41225047 133567105 1 - by flanking markers 1 140507063 140507239 1 - by flanking markers 1 139523928 139524104 1 - by flanking markers 1 131763437 131763614 1 - by flanking markers RRID:RGD_2317827 This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT 2317891 SHR-Chr 6MWF/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_2317891 SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 2324631 DA.E3-(D4Wox49-D4Got136)/Rhd Medical Inflammation Research, Karolinska Institutet, Stockholm, Sweden. congenic Unknown Clec4a3 1359528 4 159060677 160528447 1 - by flanking markers 4 222438489 223964695 1 - by flanking markers 4 155414290 156945571 1 - by flanking markers 4 155828194 157232313 1 - by flanking markers RRID:RGD_2324631 This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. 2325143 SHR/NHsdMco Spontaneously Hypertensive Rat University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325143 SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. 2325145 LEW/CrlMco Lewis University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325145 These were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. 2325146 MNS/NMco Milan normotensive strain University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown RRID:RGD_2325146 These were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. 2325202 SS/JrSeac Dahl Salt-Sensitive National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio- Hypertension RRID:RGD_2325202 Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP 2325206 LEW/Seac Seac Yoshitomi, LTD Japan inbred Unknown RRID:RGD_2325206 Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan 2325209 SHRSP/Hos Sankyo Lab Service, Japan. inbred Unknown RRID:RGD_2325209 Substrain of SHRSP purchased from Sankyo Lab Service, Japan. 2325724 PVG.LEW-(D1Rat270-D1Rat68)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 130290073 193070197 1 - by flanking markers 1 136616460 212591221 1 - by flanking markers 1 135611773 205603226 1 - by flanking markers 1 128593600 188377506 1 - by flanking markers RRID:RGD_2325724 63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1 2325754 SD-Pax6Sey/Mce Department of Ophthalmology, Okayama University Medical School, Okayama, Japan mutant Unknown Pax6|Pax6Sey 3258|737688 3 91127605 91149178 7 3 102320059 102348223 7 3 95724051 95724052 8 3 92152512 92152513 8 RRID:RGD_2325754 Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. 2325773 WKY.LEW-(D13Arb15-D13Rat58)/Tja Imperial College, London, UK congenic Unknown 13 71116479 96441728 1 - by flanking markers 13 78673431 103987907 1 - by flanking markers 13 73748382 98985851 1 - by flanking markers 13 68269576 92436175 1 - by flanking markers RRID:RGD_2325773 Segment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrl 2325774 WKY.LEW-(D13Arb10-D13Arb15)(D16Rat88-D16Rat40)/Tja Imperial College, London, UK Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00707 WKY.LEW-(D13Arb10-D13Arb15) were crossed with WKY.LEW-(D16Rat88-D16Rat40), the F1 were backcrossed to WKY.LEW-(D13Arb10-D13Arb15) and then the offsprings were intercrossed 2325796 SS.LEW-(D3Rat52-D3Chm57)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 24716931 1 - by flanking markers 3 19410399 34290625 1 - by flanking markers 3 14090411 29084626 1 - by flanking markers 3 18311454 28441896 1 - by flanking markers RRID:RGD_2325796 A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat130)/Ayd 2325798 SS.LEW-(D10Got112-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79857808 87834315 1 - by flanking markers 10 78816241 86759484 1 - by flanking markers 10 78970279 86962563 1 - by flanking markers 10 76246085 84007272 1 - by flanking markers RRID:RGD_2325798 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd 2325801 SS.LEW-(D16Chm36-D16Mit2)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 890512 4304517 1 - by flanking markers 16 1604056 5038806 1 - by flanking markers 16 1619835 5098704 1 - by flanking markers 16 903314 4227730 1 - by flanking markers RRID:RGD_2325801 A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd 2325803 SS.LEW-(D16Rat112-D16Chm60)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 3165043 1 - by flanking markers 16 773329 3491557 1 - by flanking markers 16 778415 3525217 1 - by flanking markers 16 110590 3080679 1 - by flanking markers RRID:RGD_2325803 A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd 4107048 SS.SR-(D7Rat16-D7Rat189)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 120385575 1 - by flanking markers 7 112143411 123228091 1 - by flanking markers 7 112204378 123243402 1 - by flanking markers 7 102920123 113526566 1 - by flanking markers RRID:RGD_4107048 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107052 SS.SR-(D7Rat16-D7Mgh5)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 115820414 1 - by flanking markers 7 112143411 119125830 1 - by flanking markers 7 112204378 119131068 1 - by flanking markers 7 102920123 109483487 1 - by flanking markers RRID:RGD_4107052 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107055 SS.SR-(D7Rat16-D7Rat176)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 111200952 1 - by flanking markers 7 112143411 114641749 1 - by flanking markers 7 112204378 114708307 1 - by flanking markers 7 102920123 105399458 1 - by flanking markers RRID:RGD_4107055 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107057 SS.SR-(D7Mco7-D7Rat81)/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112979256 129500555 1 - by flanking markers 7 116059683 131926277 1 - by flanking markers 7 132252091 132252361 1 - by flanking markers 7 122220558 122220831 1 - by flanking markers RRID:RGD_4107057 Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment 4107063 SS.LEW-(D1Uia8-D1Rat124)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown RRID:RGD_4107063 A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele 4107065 SS.LEW-(D1Uia8-D1Rat213)/Mco Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 81548753 81548909 1 - by flanking markers 1 84537073 84537228 1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 1 81777564 81777720 1 - by flanking markers RRID:RGD_4107065 A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele 4139872 SS-Nckap5em2Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5em2Mcwi 4139862 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139872 This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6. 4139873 SS-Rag1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag1em2Mcwi 4139866 3 86780782 86791878 7 3 97866048 97877145 7 3 91212228 91212244 8 3 87922895 87922911 8 RRID:RGD_4139873 This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1. 4139874 SS-Ets1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ets1em1Mcwi 4139856 8 32481694 32545237 7 8 33798598 33921593 7 8 33851478 33851485 8 8 31045909 31168010 7 RRID:RGD_4139874 This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3. 4139875 FHH-Chr 1BN-Sorcs1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs1em1Mcwi 4139864 1 255767411 256279565 7 1 277404996 277912261 7 1 269965824 270473097 7 1 249207764 249207777 8 RRID:RGD_4139875 This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20. 4139876 SS-Mmp2em1Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Mmp2em1Mcwi 4139860 19 15246036 15275061 7 19 26629728 26658966 7 19 15542771 15570589 7 19 14154657 14182870 7 RRID:RGD_4139876 This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. 4139877 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rab38em1Mcwi 4139867 1 144783919 144864573 7 1 158385888 158466621 7 1 152072716 152153449 7 1 142182566 142262923 7 RRID:RGD_4139877 This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1. 4139878 SS-Mmp2em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Mmp2em2Mcwi 4139869 19 15246036 15275061 7 19 26646695 26646702 8 19 15542771 15570589 7 19 14154657 14182870 7 RRID:RGD_4139878 This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7. 4139879 SS-Nckap5em1Mcwi PhysGen Knockouts mutant Extinct Nckap5em1Mcwi 4139859 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139879 This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. 4139880 SS-Renem1Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Renem1Mcwi 4139863 13 46262936 46275213 7 13 55555583 55566812 7 13 50502724 50513953 7 13 44803412 44803421 8 RRID:RGD_4139880 This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. 4139881 SS-Nckap5em3Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5em3Mcwi 4139861 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_4139881 This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. 4139882 SS-Nppaem4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Nppaem4Mcwi 4139857 5 165074518 165075827 7 5 168466309 168467618 7 5 164808762 164808783 8 5 158429042 158430351 7 RRID:RGD_4139882 This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2. 4139883 SS-Nox4em2Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Nox4em2Mcwi 4139868 1 143415816 143603554 7 1 157106652 157285107 7 1 150861996 150862003 8 1 140900886 141078844 7 RRID:RGD_4139883 This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. 4139884 SS-Rag1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag1em1Mcwi 4139865 3 86780782 86791878 7 3 97866048 97877145 7 3 91212237 91212249 8 3 87922904 87922916 8 RRID:RGD_4139884 This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1. 4139885 SS-Sh2b3em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em1Mcwi 4139858 12 35954679 35958446 7 12 42132947 42136714 7 12 40262913 40262918 8 12 34750772 34750777 8 RRID:RGD_4139885 This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. 4139889 BHD/Dspe Birt-Hogg-Dube rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2018-06-06) Flcn 735088 RRID:RGD_4139889 A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. 4139890 TT/Sgn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Fkbp6 1308926 12 22474002 22544784 7 12 26363264 26435311 7 12 24365941 24438088 7 12 21318251 21390350 7 RRID:RGD_4139890 Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats. 4139891 F344-Chr 3SDT/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity RRID:RGD_4139891 This consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background. 4139892 ALD/Hyo acid lipase deficiency rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Metabolism Lipam1Hyo 150519893 RRID:RGD_4139892 In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. 4140402 W-Tg(Gh1as)Nibs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_4140402 The construct which contains of rat growth hormone (Gh1) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat Gh1 cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science. 4140403 SD-Tg(Eno2-ATXN3*64Q)29Kakiz National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140403 Background strain is Slc:SD. 4140404 ODS-Gulood/od/ShiJcl Osteogenic disorder Shionagi rat CLEA Japan, Inc CLEA Japan, Inc inbred Live Animals (as of 2021-04-29) Gulood 126848761 RRID:RGD_4140404 Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. 4140405 LEXF6A/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140405 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140406 SHRSP.WKY-(D1Wox29-D1Arb21)/IzmDmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_4140406 To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. 4140407 SDT.BN-Gluco13/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4140407 The Gluco13 (Gisdt1) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-Gluco14/Nyo (NBRP No. 0602). 4140408 LEXF8C/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140408 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140409 COP-Chr 16DA/McoRrrc University of Toledo College of Medicine, Toledo, Ohio consomic Unknown RRID:RGD_4140409 Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background 4140410 SD-Tg(Eno2-ATXN3*64Q)16Kakiz National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140410 Background strain is Slc:SD. 4140411 SDT.BN-Gluco14/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4140411 The Gluco14 (Gisdt2) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN- Gluco13/Nyo (NBRP No. 0601). 4140412 LEXF1D/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140412 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140413 LEXF1B/Stm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo RRID:RGD_4140413 The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. 4140414 WKY.SHRSP-(D1Wox29-D1Arb21)/IzmDmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1 123350408 182418476 1 - by flanking markers RRID:RGD_4140414 To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. 4140415 TRMRC/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Sperm RRID:RGD_4140415 The coisogenic control strain for the TRMR strain (NBRP No.0016). 4140416 SD-Tg(Eno2-Vcp)16Kakiz National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology RRID:RGD_4140416 This transgenic strain was generated by microinjection into Slc:SD fertilized eggs. 4140469 F344-Kmch/NSlc Komachi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown RRID:RGD_4140469 from NBRP 4142540 SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 26280781 47890193 1 - by flanking markers 4 26659360 48448808 1 - by flanking markers 4 26753655 48656399 1 - by flanking markers 4 29593287 50119996 1 - by flanking markers RRID:RGD_4142540 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142541 W-Tg(Tek-GFP)1Soh National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RGD_4142541 This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion. 4142542 BN.SDT-Gluco14/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4142542 The Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo. 4142543 BN.SDT-Gluco13/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity RRID:RGD_4142543 The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo. 4142544 WKY/Kiha National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2024-09-24) RRID:RGD_4142544 A WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University. 4142545 SHR.WKY-(D3Rat108-D3Rat166)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 3 59676608 101359980 1 - by flanking markers 3 70419858 113470358 1 - by flanking markers 3 63849481 106900596 1 - by flanking markers 3 61934079 102200699 1 - by flanking markers RRID:RGD_4142545 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142546 AMI/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Dentistry RRID:RGD_4142546 Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. 4142547 SHR.WKY-(D4Wox27-D4Rat11)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 33407710 1 - by flanking markers 4 3096322 34240072 1 - by flanking markers 4 3044017 34379894 1 - by flanking markers 4 5218294 36405277 1 - by flanking markers RRID:RGD_4142547 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142548 SHR.WKY-(D4Wox27-D4Rat10)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 26280949 1 - by flanking markers 4 3096322 26659527 1 - by flanking markers 4 3044017 26753822 1 - by flanking markers 4 5218294 29593455 1 - by flanking markers RRID:RGD_4142548 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142549 SHR.WKY-(D4Wox27-D4Rat4)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 3237361 1 - by flanking markers 4 3096322 4400584 1 - by flanking markers 4 3044017 4364885 1 - by flanking markers 4 5218294 7935781 1 - by flanking markers RRID:RGD_4142549 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142550 SHR.WKY-(D4Rat101-D4Rat15)/IzmTkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 46605924 47890193 1 - by flanking markers 4 46704280 48448808 1 - by flanking markers 4 46898276 48656399 1 - by flanking markers 4 49131906 50119996 1 - by flanking markers RRID:RGD_4142550 This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. 4142799 LEW.SS-(D2Uia5-D2Rat143)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 2 13909383 106236206 1 - by flanking markers 2 13186164 125885146 1 - by flanking markers 2 13328947 106156987 1 - by flanking markers 2 15575840 103519040 1 - by flanking markers RRID:RGD_4142799 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain 4142800 LEW.SS-(D18Chm31-D18Mit8)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 18 59796478 59796643 1 - by flanking markers RRID:RGD_4142800 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain 4143165 SD-Tg(Aqp5-GFP)ZboroRrrc Aqp5EGFP Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Aqp5 2144 RRID:RRRC_00427 This rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained. 4143456 BN.GK-(D2Wox30-D2Wox68)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown RRID:RGD_4143456 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4143457 BN.GK-(D2Rat40-D2Wox35)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 163154358 1 - by flanking markers 2 189197858 189197988 1 - by flanking markers 2 169852670 244719662 1 - by flanking markers 2 157142078 157142209 1 - by flanking markers RRID:RGD_4143457 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4143458 BN.GK-(D2Wox49-D2Rat70)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 191000085 254933362 1 - by flanking markers 2 217822782 281850471 1 - by flanking markers 2 198335799 263179188 1 - by flanking markers 2 183756199 245889826 1 - by flanking markers RRID:RGD_4143458 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4143459 BN.GK-(D2Rat40-D2Got149)/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 222343164 1 - by flanking markers 2 189197858 248391122 1 - by flanking markers 2 169852670 229036415 1 - by flanking markers 2 157142078 213653017 1 - by flanking markers RRID:RGD_4143459 This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. 4145088 SS.BN-(D6Rat119-D6Arb3)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 111239053 138260635 1 - by flanking markers 6 120420333 147057860 1 - by flanking markers 6 111134524 138065254 1 - by flanking markers 6 106752656 132339866 1 - by flanking markers RRID:RGD_4145088 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145089 SS.BN-(D6Rat149-D6Rat18)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 93374504 1 - by flanking markers 6 6959479 103168177 1 - by flanking markers 6 7009971 93706327 1 - by flanking markers 6 10894415 89763029 1 - by flanking markers RRID:RGD_4145089 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145090 SS.BN-(D6Rat149-D6Got171)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 123782965 1 - by flanking markers 6 6959479 132827005 1 - by flanking markers 6 7009971 123598338 1 - by flanking markers 6 10894415 118863044 1 - by flanking markers RRID:RGD_4145090 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145091 SS.BN-(D6Rat149-D6Arb3)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 138260635 1 - by flanking markers 6 6959479 147057860 1 - by flanking markers 6 7009971 138065254 1 - by flanking markers 6 10894415 132339866 1 - by flanking markers RRID:RGD_4145091 SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 4145374 ACI.FHH-(D1Mit18-D1Rat90)(D14Rat98-D14Hmgc18)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_4145374 Congenic strain developed by crossing ACI.FHH-(D1Rat74-D1Rat90)/Eur (Rf-1a) males to ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi (Rf-1a+4) double congenic females 4889411 SHRSP.WKY-(D1Smu13-D1Wox33)/Izm Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio- Hypertension 1;2 160754901;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 2;1 224991853;173074640 224991955;174300801 1 - by flanking markers;1 - by flanking markers 1 166884926 166885141 1 - by flanking markers 1 156170341 156170557 1 - by flanking markers RRID:RGD_4889411 About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(D1Smu13-D1Arb21)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain 4889414 WKY.SHRSP-(D1Rat171-D1Wox33)/Izm Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1;2 158964262;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 1;2 172767534;224991853 174300801;224991955 1 - by flanking markers;1 - by flanking markers 1 166577232 166577467 1 - by flanking markers 1 155866514 155866750 1 - by flanking markers RRID:RGD_4889414 About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(D1Smu13-D1Smu11)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain 4889450 DA.PVG.1AV1-(D1Rat248-D1Rat10)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 6253932 25271177 1 - by flanking markers 1 7306802 86917075 1 - by flanking markers 1 5655772 85706974 1 - by flanking markers 1 5925877 24697545 1 - by flanking markers RRID:RGD_4889450 DA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb) 4889464 GK/Ox The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK inbred Unknown RRID:RGD_4889464 Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK 4889499 CDS-Chr 4CDR/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889499 Homozygous male CDS/Ygl were bred with CDR/Ygl females; F1 heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixed 4889817 SBN-Chr 1SBH/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889817 Homozygous male SBN/Ygl were bred with SBH/Ygl females; F1 heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed 4889820 SBH-Chr 1SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889820 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889822 SBN-Chr 17SBH/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889822 Homozygous male SBN/Ygl were bred with SBH/Ygl females; F1 heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed 4889875 SBH-Chr 2SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889875 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889877 SBH-Chr 20SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889877 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889879 SBH-Chr XSBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889879 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889882 SBH-Chr 17SBN/Ygl Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown RRID:RGD_4889882 Homozygous male SBH/Ygl were bred with SBN/Ygl females; F1 heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed 4889890 DA.PVG.1AV1-(D17Rat8-D17Rat37)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Immunology 17 27618789 75802944 1 - by flanking markers 17 25486196 69844594 1 - by flanking markers 17 23522321 68114865 1 - by flanking markers 17 21782841 64759263 1 - by flanking markers RRID:RGD_4889890 DA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37 4891048 SS.LEW-(D7Rat73-D7Rat128)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 7 53612714 114528048 1 - by flanking markers RRID:RGD_4891048 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 4891051 LEW.SS-(D7Rat73-D7Rat128)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 7 53612714 114528048 1 - by flanking markers RRID:RGD_4891051 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 4891103 WMI/EerRrrc WKY most immobile Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois Rat Resource and Research Center inbred Unknown RRID:RRRC_00973 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. 4891107 WLI/EerRrrc WKY least immobile Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois Rat Resource and Research Center inbred Unknown RRID:RRRC_00967 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. 4891165 Wig/Ymas wiggling Human Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan congenic Unknown RRID:RGD_4891165 These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain 4891380 SS.SR-(D9Mco95-D9Mco98)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 80946065 1 - by flanking markers 9 81100315 81180041 1 - by flanking markers 9 75403227 75482161 1 - by flanking markers RRID:RGD_4891380 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891383 SS.SR-(D9Mco98-Resp18)/1Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 9 75481963 76771824 1 - by flanking markers RRID:RGD_4891383 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891386 SS.SR-(D9Mco98-Resp18)/2Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 9 75481963 76771824 1 - by flanking markers RRID:RGD_4891386 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891388 SS.SR-(D9Mco95-D9Mco100)/1Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 9 75403227 75990271 1 - by flanking markers RRID:RGD_4891388 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891390 SS.SR-(D9Mco95-D9Mco100)/2Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 9 75403227 75990271 1 - by flanking markers RRID:RGD_4891390 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891392 SS.SR-(D9Mco95-D9Mco102)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81641213 1 - by flanking markers 9 81100315 81878831 1 - by flanking markers 9 75403227 76175576 1 - by flanking markers RRID:RGD_4891392 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891394 SS.SR-(D9Mco101-Resp18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 81611825 82246695 1 - by flanking markers 9 81847677 82477136 1 - by flanking markers 9 76145766 76771824 1 - by flanking markers RRID:RGD_4891394 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891396 SS.SR-(D9Mco72-Resp18)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 44842118 74558151 1 - by flanking markers 9 52352690 82246695 1 - by flanking markers 9 52686874 82477136 1 - by flanking markers 9 47902208 76771824 1 - by flanking markers RRID:RGD_4891396 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891400 SS.SR-(D9Mco14-Resp18)/1Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891400 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891402 SS.SR-(D9Mco14-Resp18)/2Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891402 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4891404 SS.SR-(D9Mco14-Resp18)/3Mco Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 9 76650629 76771824 1 - by flanking markers RRID:RGD_4891404 SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F1 which were intercrossed to generate F2, these were genotyped using markers throughout 73140156-74554694 region 4892563 WF.WKY-(D5Rat26-D5Uwm42)/Uwm University of Wisconsin-Madison congenic Unknown 5 119332868 153554465 1 - by flanking markers 5 121495621 156871691 1 - by flanking markers 5 117554114 153097789 1 - by flanking markers 5 113558156 146996127 1 - by flanking markers RRID:RGD_4892563 WKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region. 5130721 HXB1/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5130721 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131094 BN-Lx/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California mutant Unknown RRID:RGD_5131094 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131095 BXH13/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131095 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131097 BXH12/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131097 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131099 BXH11/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131099 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131101 BXH10/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131101 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131104 BXH9/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131104 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131106 BXH8/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131106 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131108 BXH6/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131108 Embryo-rederived from breeder stock BXH6/Cub provided by Dr. Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131110 BXH5/CubPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131110 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131113 HXB31/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131113 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131115 HXB29/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131115 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131118 HXB27/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131118 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131120 HXB26/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131120 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131122 HXB25/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131122 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131124 HXB23/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131124 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131126 HXB20/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131126 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131128 HXB17/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131128 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131130 HXB15/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131130 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131132 HXB13/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131132 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131134 HXB10/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131134 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained by Printz laboratory for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131136 HXB7/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131136 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131138 HXB4/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131138 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131140 HXB3/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131140 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131142 HXB2/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131142 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131144 HXB18/IpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown RRID:RGD_5131144 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. 5131910 SS-Acad10em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Acad10em2Mcwi 5131905 12 36070275 36075844 7 12 42285817 42328189 7 12 40458754 40458763 8 12 34901211 34943973 7 RRID:RGD_5131910 This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2. 5131911 SS-Alms1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Alms1em1Mcwi 5131906 4 119846037 119946085 7 4 181947469 182048235 7 4 117371972 117371988 8 4 118125581 118226005 7 RRID:RGD_5131911 This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1. 5131912 SS-Aldh2em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Aldh2em2Mcwi 5131907 12 36081778 36116445 7 12 42334057 42366049 7 12 40486398 40486404 8 12 34949549 34982527 7 RRID:RGD_5131912 This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4. 5131920 SS-Apoeem8Mcwi PhysGen Knockouts mutant Extinct Apoeem8Mcwi 5131915 1 79003634 79006387 7 1 81878372 81882298 7 1 80612894 80616820 7 1 79353924 79357852 7 RRID:RGD_5131920 This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2. 5131921 SS-Apoeem7Mcwi PhysGen Knockouts mutant Extinct Apoeem7Mcwi 5131918 1 79003634 79006387 7 1 81878372 81882298 7 1 80612894 80616820 7 1 79353924 79357852 7 RRID:RGD_5131921 This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. 5131922 SS-Cdh13em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Cdh13em1Mcwi 5131919 19 48507173 49575123 7 19 61621434 62720155 7 19 50848896 50848903 8 19 46349562 47387462 7 RRID:RGD_5131922 This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1. 5131932 SS-Cyp1a1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cyp1a1em1Mcwi 5131928 8 61462207 61468237 7 8 62249046 62255081 7 8 62476212 62476230 8 8 58096021 58102130 7 RRID:RGD_5131932 This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. 5131933 SS-Cybaem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Cybaem1Mcwi 5131930 19 52713150 52721609 7 19 65959818 65967224 7 19 55257747 55257782 8 19 50487598 50495669 7 RRID:RGD_5131933 This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1. 5131934 SS-Cyp1a1em5Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Cyp1a1em5Mcwi 5131929 8 61462207 61468237 7 8 62249046 62255081 7 8 62472087 62478122 7 8 58096021 58102130 7 RRID:RGD_5131934 This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 4. 5131950 SS-Msraem3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Msraem3Mcwi 5131945 15 43509775 43756283 7 15 51307920 51550758 7 15 47488333 47800662 7 15 38676395 38676412 8 RRID:RGD_5131950 This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 1. 5131951 SS-Prokr1em2Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Prokr1em2Mcwi 5131947 4 121750651 121758116 7 4 183939201 183949822 7 4 119375790 119386551 7 4 120022301 120033367 7 RRID:RGD_5131951 This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 126-bp frameshift deletion in exon 2. 5131952 SS-Mas1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Mas1em1Mcwi 5131946 1 42154786 42185750 7 1 51644462 51675365 7 1 48076761 48108218 7 1 47910103 47910112 8 RRID:RGD_5131952 This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. 5131953 SS-Prokr1em1Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Prokr1em1Mcwi 5131948 4 121750651 121758116 7 4 183939201 183949822 7 4 119375790 119386551 7 4 120022301 120033367 7 RRID:RGD_5131953 This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2. 5131954 SS-Mstnem2Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Mstnem2Mcwi 5131949 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48452533 48458933 7 RRID:RGD_5131954 This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2. 5131963 SS-Nox4em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nox4em1Mcwi 5131428 1 143415816 143603554 7 1 157106652 157285107 7 1 150861998 150862002 8 1 140900886 141078844 7 RRID:RGD_5131963 This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7. 5131964 SS-Mstnem3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mstnem3Mcwi 5131962 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456670 8 RRID:RGD_5131964 This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. 5131965 SS-Mthfrem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mthfrem1Mcwi 5131961 5 165112850 165126885 7 5 168502556 168522350 7 5 164844642 164864360 7 5 158467728 158467755 8 RRID:RGD_5131965 This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2. 5131966 SS-Plod1em1Mcwi PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Plod1em1Mcwi 5131960 5 164987252 165012581 7 5 168379092 168405534 7 5 164720629 164747071 8 5 158340674 158367581 7 RRID:RGD_5131966 This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. 5131974 SS-Rasgrp3em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rasgrp3em1Mcwi 5131968 6 19808453 19871923 7 6 30966364 31065175 7 6 21072634 21171619 7 6 19914449 19914451 8 RRID:RGD_5131974 This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12. 5131975 SS-Ptpn11em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ptpn11em1Mcwi 5131970 12 36501886 36558055 7 12 42762630 42822760 7 12 40895515 40955999 7 12 35390381 35390397 8 RRID:RGD_5131975 This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4. 5131976 SS-Ptpn11em4Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Ptpn11em4Mcwi 5131969 12 36501886 36558055 7 12 42762630 42822760 7 12 40895515 40955999 7 12 35365436 35424925 7 RRID:RGD_5131976 This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp frameshift deletion in exon 4. 5131987 SS-Tgfb1em1Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Tgfb1em1Mcwi 5131986 1 80894705 80911020 7 1 83742151 83758472 7 1 82480875 82497196 7 1 81196532 81212848 7 RRID:RGD_5131987 This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 3. 5131988 SS-Wdr72em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Wdr72em2Mcwi 5131978 8 78891358 79050751 7 8 80586841 80744090 7 8 80965734 81125710 7 8 74838338 75020938 7 RRID:RGD_5131988 This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 5-bp frameshift deletion in exon 3. 5131989 SS-Tgfb1em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tgfb1em3Mcwi 5131980 1 80894705 80911020 7 1 83742151 83758472 7 1 82480875 82497196 7 1 81196532 81212848 7 RRID:RGD_5131989 This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3. 5131990 SS-Slc30a8em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc30a8em2Mcwi 5131981 7 88583770 88617145 7 7 92476024 92512365 7 7 91832988 91869329 7 7 83603467 83603483 8 RRID:RGD_5131990 This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2. 5131991 SS-Slc30a8em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc30a8em1Mcwi 5131979 7 88583770 88617145 7 7 92476024 92512365 7 7 91832988 91869329 7 7 83603469 83603485 8 RRID:RGD_5131991 This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2. 5134683 WF.WKY-(D7Rat171-D7Rat128)/1Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 121524220 1 - by flanking markers 7 26490428 124236725 1 - by flanking markers 7 26359973 124246733 1 - by flanking markers 7 20238970 114528048 1 - by flanking markers RRID:RGD_5134683 Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background 5134685 WF.WKY-(D7Rat171-D7Rat128)/2Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 121524220 1 - by flanking markers 7 26490428 124236725 1 - by flanking markers 7 26359973 124246733 1 - by flanking markers 7 20238970 114528048 1 - by flanking markers RRID:RGD_5134685 Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background 5134687 WF.WKY-(D7Rat51-D7Rat128)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 50833677 121524220 1 - by flanking markers 7 54558231 124236725 1 - by flanking markers 7 54534996 124246733 1 - by flanking markers 7 47251783 114528048 1 - by flanking markers RRID:RGD_5134687 Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background 5134689 WF.WKY-(D7Uwm25-D7Rat128)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 121523977 121524220 1 - by flanking markers 7 89318050 124236725 1 - by flanking markers 7 89283487 124246733 1 - by flanking markers 7 81134174 114528048 1 - by flanking markers RRID:RGD_5134689 Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background 5134692 WF.WKY-(D7Rat171-D7Rat45)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 68057251 1 - by flanking markers 7 26490428 71522360 1 - by flanking markers 7 26359973 71352127 1 - by flanking markers 7 20238970 63902784 1 - by flanking markers RRID:RGD_5134692 Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background 5134951 WF.COP-(D7Rat39-D7Uwm12)/1Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 4936703 86007499 1 - by flanking markers 7 6276388 89299904 1 - by flanking markers 7 89265543 89265715 1 - by flanking markers 7 81116229 81116402 1 - by flanking markers RRID:RGD_5134951 Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background 5134953 WF.COP-(D7Rat39-D7Uwm12)/2Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 4936703 86007499 1 - by flanking markers 7 6276388 89299904 1 - by flanking markers 7 89265543 89265715 1 - by flanking markers 7 81116229 81116402 1 - by flanking markers RRID:RGD_5134953 Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background 5135031 BN.MES-Cyba/Sna Department of Aging Biology, Institute on Aging and Adaptation, Shinshu University, Matsumoto, Japan congenic Unknown CybamesSdi 13209000 RRID:RGD_5135031 mutant Cyba gene from the MES/Slc strain is introduced into the background of BN/SsNSlc by standard procedures with seven backcrosses to BN/SsNSlc 5135472 ACI.BN-(D5Uwm70-D5Rat32)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 139659415 139659574 1 - by flanking markers 5 141933225 141933383 1 - by flanking markers 5 138123799 138123957 1 - by flanking markers 5 132686313 132686472 1 - by flanking markers RRID:RGD_5135472 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5135473 ACI.BN-(D5Uwm70-D5Got42)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 130756424 130756605 1 - by flanking markers 5 132878119 132878299 1 - by flanking markers 5 129038716 129038896 1 - by flanking markers 5 124160767 124160948 1 - by flanking markers RRID:RGD_5135473 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5135475 ACI.BN-(D5Rat60-D5Rat115)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 106262697 118138413 1 - by flanking markers 5 109291409 120337480 1 - by flanking markers 5 105304453 116395137 1 - by flanking markers 5 101467719 112419733 1 - by flanking markers RRID:RGD_5135475 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5135477 ACI.BN-(D5Uwm70-D5Mgh15)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 167844579 167844737 1 - by flanking markers 5 171364494 171364652 1 - by flanking markers 5 167739539 167739697 1 - by flanking markers 5 161165494 161165651 1 - by flanking markers RRID:RGD_5135477 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5135479 ACI.BN-(D5Rat113-D5Rat36)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 76707366 145187034 1 - by flanking markers 5 79957402 147610238 1 - by flanking markers 5 75809470 143846372 1 - by flanking markers 5 73483796 138113774 1 - by flanking markers RRID:RGD_5135479 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5135481 ACI.BN-(D5Mgh17-D5Rat98)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 14730738 100017265 1 - by flanking markers 5 19190627 103451257 1 - by flanking markers 5 14408903 99421638 1 - by flanking markers 5 14529225 95774399 1 - by flanking markers RRID:RGD_5135481 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5143940 ACI.FHH-(D1Rat74-D1Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 227005311 267111153 1 - by flanking markers 1 248763714 289137268 1 - by flanking markers 1 241482188 281795785 1 - by flanking markers 1 221264111 259647894 1 - by flanking markers RRID:RGD_5143940 Congenic substrain that originated from ACI.FHH-(D1Rat298-D1Rat90)/Eur 5143941 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_5143941 Triple congenic ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur from Erasmus Medical Center, Rotterdam, Netherlands now bred and housed at Medical College of Wisconsin 5143942 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_5143942 Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. 5143943 ACI.FHH-(D14Mit11-D14Rat82)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Cryopreserved Sperm 14 4995006 30258439 1 - by flanking markers 14 4874267 30225437 1 - by flanking markers 14 4878162 30412508 1 - by flanking markers 14 3857038 28203397 1 - by flanking markers RRID:RGD_5143943 Congenic strain generated by using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf4 QTL region of chr 14 is introgressed in this strain. 5143984 SS-Plekha7em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plekha7em1Mcwi 5143978 1 174249022 174316226 7 1 192397589 192463974 7 1 185483638 185483657 8 1 170364524 170547843 7 RRID:RGD_5143984 This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. 5143985 SS-Mstnem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mstnem1Mcwi 5143964 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456680 8 RRID:RGD_5143985 This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation deletes part of exon 2 and its splice acceptor. 5143986 SS-Ulk3em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk3em1Mcwi 5143968 8 61343722 61348824 7 8 62146130 62152150 7 8 62368548 62375229 7 8 57992396 58000220 7 RRID:RGD_5143986 This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. 5143987 SS-Gpr183em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183em3Mcwi 5143961 15 107056367 107067887 7 15 111751148 111763869 7 15 108365659 108365666 8 15 99037764 99050550 7 RRID:RGD_5143987 This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. 5143988 SS-Gpr183em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183em2Mcwi 5143955 15 107056367 107067887 7 15 111751148 111763869 7 15 108365665 108365668 8 15 99037764 99050550 7 RRID:RGD_5143988 This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. 5143989 SS-Agtrapem4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtrapem4Mcwi 5143963 5 165154252 165164570 7 5 168546202 168556520 7 5 164891661 164891744 8 5 158507427 158519036 7 RRID:RGD_5143989 This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor. 5143990 SS-Ulk3em4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk3em4Mcwi 5143971 8 61343722 61348824 7 8 62146130 62152150 7 8 62368548 62375229 7 8 57992396 58000220 7 RRID:RGD_5143990 This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 88-bp frameshift deletion in exon 5. 5143991 SS-Gpr183em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183em1Mcwi 5143957 15 107056367 107067887 7 15 111751148 111763869 7 15 108365661 108365667 8 15 99037764 99050550 7 RRID:RGD_5143991 This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 2. 5143992 SS-Rasgrp3em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rasgrp3em3Mcwi 5143946 6 19808453 19871923 7 6 30966364 31065175 7 6 21072634 21171619 7 6 19914439 19914458 8 RRID:RGD_5143992 This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 20-bp frameshift deletion in exon 12. 5143993 SS-Plcd3em4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plcd3em4Mcwi 5143954 10 92234651 92275433 7 10 90937117 90958001 7 10 91164801 91186054 8 10 88026707 88048080 7 RRID:RGD_5143993 This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor 5143994 SS-Plcd3em7Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plcd3em7Mcwi 5143976 10 92234651 92275433 7 10 90937117 90958001 7 10 91164801 91186054 8 10 88026707 88048080 7 RRID:RGD_5143994 This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon 5143995 SS-Plekha7em4Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Plekha7em4Mcwi 5143979 1 174249022 174316226 7 1 192397589 192463974 7 1 185483638 185483656 8 1 170420191 170420209 8 RRID:RGD_5143995 This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 8. 5143996 SS-Agtrapem8Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtrapem8Mcwi 5143970 5 165154252 165164570 7 5 168546202 168556520 7 5 164891578 164891677 8 5 158507427 158519036 7 RRID:RGD_5143996 This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor. 5144101 SS-Kcnq1em14Mcwi PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Kcnq1em14Mcwi 5144083 1 203383401 203803687 7 1 223154713 223490458 7 1 216293087 216630339 8 1 198291711 198624683 7 RRID:RGD_5144101 This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3. 5144102 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Asipem1Mcwi 5144099 3 145445175 145536831 7 3 156860395 156949277 7 3 150492010 150579870 7 3 143473584 143561170 7 RRID:RGD_5144102 This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2. 5144103 SS-Ldlrem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ldlrem1Mcwi 5144090 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 8 8 20270020 20292981 7 RRID:RGD_5144103 This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. 5144104 SS-Ncf2em1Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Ncf2em1Mcwi 5144089 13 67806516 67834105 7 13;13;13;13 75200283;75200283;75200283;75200283 75200287;75200287;75200287;75200287 8;8;8;8 13 70229196 70229200 8 13 64958217 64958221 8 RRID:RGD_5144104 This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 2. 5144105 SS-Hexim2em4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Hexim2em4Mcwi 5144095 10 92306494 92312256 7 10 90988728 90994491 7 10 91217079 91222841 8 10 88077870 88084776 7 RRID:RGD_5144105 This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3. 5144106 SS-Kcnq1em9Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnq1em9Mcwi 5144076 1 203383401 203803687 7 1 223154713 223490458 7 1 216293087 216630339 8 1 198291711 198624683 7 RRID:RGD_5144106 This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 3. 5144107 SS-Itga9em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Itga9em1Mcwi 5144077 8 123526904 123838241 7 8 126493359 126795566 7 8 127271029 127576709 7 8 118383417 118383503 8 RRID:RGD_5144107 This strain was produced by injecting ZFNs targeting the sequence GTCGGAGCCTTCCTGTCCgacagcGTGGTTCTCCTCAGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor. 5144108 SS-Ldlrem4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ldlrem4Mcwi 5144075 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 8 8 20270020 20292981 7 RRID:RGD_5144108 This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. 5144110 ACI.BN-(D5Mgh17-D5Mgh15)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 14730738 167844737 1 - by flanking markers 5 19190627 171364652 1 - by flanking markers 5 14408903 167739697 1 - by flanking markers 5 14529225 161165651 1 - by flanking markers RRID:RGD_5144110 This congenic strain is developed by further genotyping ACI.BN-(D5Mgh17-D5Rat205)/Shul. 5147594 FHH.PCK-(D9Rat35-D9Rat70)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Pkhd1pck 11535943 9 12916127 21667256 1 - by flanking markers 9 18672124 27914444 1 - by flanking markers 9 19794101 29075268 1 - by flanking markers 9 17220476 25268236 1 - by flanking markers RRID:RGD_5147594 A FHH/EurMcwi male was crossed with a PCK/CrljCrl-Pkhd1pck/Crl female, and the male progeny were backcrossed to FHH/EurMcwi females for five generations by marker assisted breeding. In each generation, males were genotyped by fluorescent genotyping for three markers within the Pkhd1 gene, and 98 markers evenly spaced throughout the genome. 5490515 FHH.BN(D1Rat265-D1Rat76)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Extinct 1 90448902 230411453 1 - by flanking markers 1 95453405 252243871 1 - by flanking markers 1 94364073 244992610 1 - by flanking markers 1 90664883 224569684 1 - by flanking markers RRID:RGD_5490515 desired segments from BN were introgressed in FHH background 5490516 FHH.BN(D14Rat80-D14Hmgc4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Live Animals; Cryopreserved Sperm 14 13778105 21435476 1 - by flanking markers 14 13914610 21463742 1 - by flanking markers 14 13971208 21555302 1 - by flanking markers 14 12326866 19848266 1 - by flanking markers RRID:RGD_5490516 desired segments from BN were introgressed in FHH background 5490517 FHH.BN(D14Rat78-D14Hmgc4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Live Animals; Cryopreserved Sperm 14 17564855 21435476 1 - by flanking markers 14 17417347 21463742 1 - by flanking markers 14 17499969 21555302 1 - by flanking markers 14 15995099 19848266 1 - by flanking markers RRID:RGD_5490517 desired segments from BN were introgressed in FHH background 5508304 WUN-Abcc2TR-/HsdRrrc Unilever maintained at the Amsterdam Academic Medical Center (AMC). Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-08-02) Abcc2|Abcc2TR- 2366|12792941 1 270999832 271057750 7 1 263554426 263612556 7 1 242664657 242723239 7 RRID:RRRC_00442 Spontaneous 1-bp deletion mutation occurred on a Wistar This mutation at amino acid 393 resulting a frameshift and premature stop at position 401. 5508305 F344-Dpp4DPPIV-/DchcHsdRrrc Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-16) Dpp4DPPIV 12792942 3 44279255 44360283 7 3 54957146 55038628 7 3 48291055 48372672 7 3 46962233 47043870 7 RRID:RRRC_00443 The DPP4 mutant rat was a spontaneous mutation in Fischer 344 rats, which caused a deficiency in DPPIV, was identified by Dr. Douglas C. Hixson at Rhode Island Hospital. 5508356 SS-Gucy1a3em1Mcwi PhysGen Knockouts mutant Extinct Gucy1a3em1Mcwi 5508351 2 173756824 173818316 7 2 200453480 200515219 7 2 181045694 181103321 7 2 167418615 167482293 7 RRID:RGD_5508356 This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5. 5508357 SS-Tfdp2em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tfdp2em2Mcwi 5508332 8 101256112 101392512 7 8 103489105 103629520 7 8 104040795 104181228 7 8 96760459 96901466 7 RRID:RGD_5508357 This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6. 5508358 SS-Wdr72em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Wdr72em1Mcwi 5508327 8 78891358 79050751 7 8 80586841 80744090 7 8 80965734 81125710 7 8 74838338 75020938 7 RRID:RGD_5508358 This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 5508359 SS-Pruneem3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pruneem3Mcwi 5508348 2 190165356 190192807 7 2 215924545 215954221 7 2 196427714 196457105 7 2 182859142 182859271 8 RRID:RGD_5508359 This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 130-bp frameshift deletion in exon 1. 5508360 SS-Dguokem4Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Dguokem4Mcwi 5508323 4 117697251 117725383 7 4 179770727 179798683 7 4 115180433 115208061 7 4 115987101 116014733 7 RRID:RGD_5508360 This strain was produced by injecting ZFNs targeting the sequence GTCGGTTCCTTCTGCgtagacTCCGAGCGTCTTTCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp frameshift deletion in exon 1. 5508361 SS-Bcas3em4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Bcas3em4Mcwi 5508329 10 73617547 74078190 7 10 72660671 73177317 7 10 72756587 72756593 8 10 70213710 70673080 7 RRID:RGD_5508361 This strain was produced by injecting ZFNs targeting the sequence TGGATCTGTACTCACttcgtACGGGGGAGATGGTCAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 9. 5508362 SS-Ncf2em4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ncf2em4Mcwi 5508342 13 67806516 67834105 7 13 75197561 75229600 7 13 70226441 70259019 7 13 64958078 64958221 8 RRID:RGD_5508362 This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2. 5508363 SS-Sorcs2em4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs2em4Mcwi 5508326 14 79968072 80344330 7 14 79176694 79547823 7 14 79538911 79912333 7 14 74711199 74711203 8 RRID:RGD_5508363 This strain was produced by injecting ZFNs targeting the sequence CACATCAGCTTCCGCTCTgactggGAGCTGGTCAAGGTGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 15. 5508364 SS-Pruneem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pruneem1Mcwi 5508341 2 190165356 190192807 7 2 215924545 215954221 7 2 196427714 196457105 7 2 182858954 182859151 8 RRID:RGD_5508364 This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1. 5508365 SS-Agtr1aem5Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtr1aem5Mcwi 5508318 17 40629318 40684982 7 17 37217810 37270540 7 17 35908756 35908774 8 17 34173446 34226892 7 RRID:RGD_5508365 This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 3. 5508366 SS-Tfdp2em5Mcwi PhysGen Knockouts mutant Extinct Tfdp2em5Mcwi 5508334 8 101256112 101392512 7 8 103489105 103629520 7 8 104040795 104181228 7 8 96760459 96901466 7 RRID:RGD_5508366 This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. 5508367 SS-Ulk4em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk4em3Mcwi 5508340 8 125992455 126284263 7 8 128829597 129125286 7 8 129631003 129919080 7 8 120670879 120966026 7 RRID:RGD_5508367 This strain was produced by injecting ZFNs targeting the sequence CTACCTTGTAGCTACccaggtGAGGCTGTCTGATGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 5508368 SS-Trafd1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Trafd1em1Mcwi 5508352 12 36301824 36315741 7 12 42562635 42576553 7 12 40695520 40709438 7 12 35165606 35179525 7 RRID:RGD_5508368 This strain was produced by injecting ZFNs targeting the sequence CTGTGGTGCCCGGACagagcTGTGTGGCAGCTGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 5. 5508369 SS-Myadml2em1Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Myadml2em1Mcwi 5508317 10 110039330 110040967 7 10 109418559 109420196 7 10 109822170 109827328 7 10 105922557 105927867 7 RRID:RGD_5508369 This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1. 5508370 SS-Nppbem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nppbem2Mcwi 5508324 5 165062348 165063650 7 5 168454278 168455640 7 5 164796229 164797531 8 5 158416813 158418175 7 RRID:RGD_5508370 This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2. 5508371 SS-Mylipem3Mcwi PhysGen Knockouts mutant Extinct Mylipem3Mcwi 5508336 17 25308147 25329887 7 17 21703590 21725205 7 17 19682040 19703681 7 17 19286649 19308295 7 RRID:RGD_5508371 This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1. 5508380 SS-TgTn(T2ONC)2Mcwi PhysGen Knockouts transgenic Cryopreserved Sperm RRID:RGD_5508380 These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands. 5508381 SS-TgTn(T2ONC)1Mcwi PhysGen Knockouts transgenic Cryopreserved Sperm RRID:RGD_5508381 These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands. 5508392 HsdHlr:ZUC-Leprfa Envigo Envigo outbred Unknown Leprfa 13432153 RRID:RGD_5508392 Derived from a colony obtained in 1992 from Hoffmann-la-Roche, Nutley, New Jersey. 5508393 BN/RijHsd Envigo Envigo inbred Unknown RRID:RGD_5508393 These were derived from a nucleus colony obtained directly from the TNO Institute, the Netherlands now available at Envigo. 5508394 F344BNF1/Hsd Harlan hybrid Unknown RRID:RGD_5508394 Offspring of a cross between the F344/NHsd inbred female and a BN male rat. 5508395 Hsd:RH-Foxn1rnu Athymic Nude Envigo Envigo outbred Unknown RRID:RGD_5508395 Derived from animals obtained from the Rowett Research Institute, Aberdeen, Scotland. 5508396 HsdRccHan:WIST ENVIGO outbred Unknown RRID:RGD_5508396 Derived at Biological Research Laboratories Limited (BRL), formerly RCC, now Harlan Laboratories Ltd., Fullinsdorf, Switzerland from original colony at Zentralinstitute fur Versuchstierzucht, Hannover in 1989. Transferred to Harlan Sprague-Dawley, Inc. in 1993 (nomenclature HsdHan:WIST). Harlan became Envigo in 2015. In 2004 Envigo acquired RCC Ltd. and new breeding stock was transferred in 2008 (nomenclature RccHan:WIST). Unlike competitive models, the RccHan:WIST rat has been maintained from the original nucleus of 156 breeding pairs in Hannover, Germany. 5508397 HotHsd:SD Sprague Dawley Envigo Envigo outbred Unknown RRID:RGD_5508397 Originally developed by the Holtzman Company in Madison, Wisconsin, from Sprague Dawley stock in 1947; to Harlan through acquisition in 1986. 5508398 BluHsd:LE Long Evans (Blue Spruce) Harlan/Envigo outbred Unknown RRID:RGD_5508398 From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988. Harlan became Envigo in 2015. 5509086 ACI.BN-(D5Rat72-D5Rat36)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 120983238 145187034 1 - by flanking markers 5 123027973 147610238 1 - by flanking markers 5 119124918 143846372 1 - by flanking markers 5 114973303 138113774 1 - by flanking markers RRID:RGD_5509086 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5509087 ACI.BN-(D5Rat113-D5Rat159)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 76707366 76707563 1 - by flanking markers 5 79957402 79957599 1 - by flanking markers 5 75809470 75809667 1 - by flanking markers 5 73483796 73483994 1 - by flanking markers RRID:RGD_5509087 This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background 5509988 SS-Nppbem4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Nppbem4Mcwi 5509979 5 165062348 165063650 7 5 168454278 168455640 7 5 164796229 164797531 8 5 158416813 158418175 7 RRID:RGD_5509988 This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2. 5509989 SS-Msraem4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Msraem4Mcwi 5509977 15 43509775 43756283 7 15 51307920 51550758 7 15 47488333 47800662 7 15 38676398 38676402 8 RRID:RGD_5509989 This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 1-bp frameshift deletion in exon 1. 5509990 SS-Cyp1a1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cyp1a1em2Mcwi 5509976 8 61462207 61468237 7 8 62249046 62255081 7 8 62476131 62476318 8 8 58096021 58102130 7 RRID:RGD_5509990 This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 188-bp deletion encompassing exon 4 5509991 SS-Mylipem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mylipem2Mcwi 5508333 17 25308147 25329887 7 17 21703590 21725205 7 17 19682040 19703681 7 17 19308054 19308102 8 RRID:RGD_5509991 This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp deletion and one G insertion causing frameshift deletion in exon 1. 5509992 SS-Ube2q2em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ube2q2em3Mcwi 5509987 8 58688257 58749088 7 8 58292660 58349722 7 8 59709972 59754102 7 8 55518402 55578342 7 RRID:RGD_5509992 This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7. 5509993 SS-Tcf7l2em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tcf7l2em1Mcwi 5509981 1 262031823 262226710 7 1 283387566 284118928 7 1 276686911 276730517 7 1 254785956 254978967 7 RRID:RGD_5509993 This strain was produced by injecting ZFNs targeting the sequence GGAAGCCTCCAGAGCagacaaGCCCTCAAGGATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 169-bp deletion of exon5 and intron 5. 5509994 SS-Sh2b3em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em2Mcwi 5509982 12 35954679 35958446 7 12 42132947 42136714 7 12 40261990 40265757 7 12 34750773 34750773 8 RRID:RGD_5509994 This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi. 5509995 SS-Adra2aem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Adra2aem1Mcwi 5509986 1 282178475 282181275 7 1 274766841 274766847 8 1 253061480 253064280 7 RRID:RGD_5509995 This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2. 5509996 SS-Stk39em2Mcwi PhysGen Knockouts mutant Extinct Stk39em2Mcwi 5509978 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_5509996 This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7. 5509997 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi PhysGen Knockouts mutant Extinct Nckap5em4Mcwi 5509975 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_5509997 This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. 5529230 ACI.FHH-(D1Hmgc16-D1Rat225)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 261180160 261180301 1 - by flanking markers 1 275301183 283061559 1 - by flanking markers 1 267871151 271693968 1 - by flanking markers 1 246983819 246984013 1 - by flanking markers RRID:RGD_5529230 desired segments from FHH/EurMcwi were introgressed in ACI/Eur background 5529529 ACI.FHH-(D1Hmgc1-D1Hmgc19)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 249745626 249745784 1 - by flanking markers 1 271889649 277901651 1 - by flanking markers 1 264446896 270462479 1 - by flanking markers 1 243559115 249583894 1 - by flanking markers RRID:RGD_5529529 desired segments from FHH/EurMcwi were introgressed in ACI/Eur background 5529731 ACI.FHH-(D1Hmgc20-D1Hmgc21)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 274674350 276466399 1 - by flanking markers 1 267241552 269024803 1 - by flanking markers 1 246355367 248138424 1 - by flanking markers RRID:RGD_5529731 desired segments from FHH/EurMcwi were introgressed in ACI/Eur background 5683886 SS-Chr 12BN.SS-(D12Arb13-D12Mit2)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 7382721 20932776 1 - by flanking markers 12 10334114 24663199 1 - by flanking markers 12 8249608 22650918 1 - by flanking markers 12 6833190 19611091 1 - by flanking markers RRID:RGD_5683886 These were generated by crossing SS/JrHsdMcwi with SS-Chr 12BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. 5683888 SS-Chr 12BN.SS-(D12Hmgc3-D12Rat79)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 36223785 36224090 1 - by flanking markers 12 17102817 42485122 1 - by flanking markers 12 15085585 40618007 1 - by flanking markers 12 13008296 35088624 1 - by flanking markers RRID:RGD_5683888 These were generated by crossing SS/JrHsdMcwi with SS-Chr 12BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. 5683890 SS-Chr 12BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 17102817 24300160 1 - by flanking markers 12 15085585 22283507 1 - by flanking markers 12 13008296 19212979 1 - by flanking markers RRID:RGD_5683890 These were generated by crossing SS/JrHsdMcwi with SS-Chr 12BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. 5685369 SS-Agtr1aem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Agtr1aem1Mcwi 5508331 17 40629318 40684982 7 17 37217810 37270540 7 17 35908769 35908770 8 17 34173446 34226892 7 RRID:RGD_5685369 This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3. 5686300 SS-Adra2aem1Mcwi-/- SS-Adra2aem1Mcwi-/Adra2aem1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Adra2aem1Mcwi 5509986 1 282178475 282181275 7 1 274766841 274766847 8 1 253061480 253064280 7 RRID:RGD_5686300 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686302 SS-Adra2aem1Mcwi+/+ SS-Adra2aem1Mcwi+/Adra2aem1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686302 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686304 SS-Agtrapem4Mcwi-/- SS-Agtrapem4Mcwi-/Agtrapem4Mcwi- PhysGen Knockouts mutant Cryopreserved Embryo (as of 2018-09-05) RRID:RGD_5686304 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686306 SS-Agtrapem4Mcwi+/+ SS-Agtrapem4Mcwi+/Agtrapem4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686306 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686308 SS-Hexim2em4Mcwi-/- SS-Hexim2em4Mcwi-/Hexim2em4Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686308 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686311 SS-Hexim2em4Mcwi+/+ SS-Hexim2em4Mcwi+/Hexim2em4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686311 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686314 SS-Rasgrp3em1Mcwi-/- SS-Rasgrp3em1Mcwi-/Rasgrp3em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686314 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686316 SS-Rasgrp3em1Mcwi+/+ SS-Rasgrp3em1Mcwi+/Rasgrp3em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686316 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686318 SS-Sh2b3em1Mcwi-/- SS-Sh2b3em1Mcwi-/Sh2b3em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em1Mcwi 4139858 12 35954679 35958446 7 12 42132947 42136714 7 12 40262913 40262918 8 12 34750772 34750777 8 RRID:RGD_5686318 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 . 5686320 SS-Sh2b3em1Mcwi+/+ SS-Sh2b3em1Mcwi+/Sh2b3em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686320 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686322 SS-Sh2b3em1Mcwi-/+ SS-Sh2b3em1Mcwi-/Sh2b3em1Mcwi+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em1Mcwi 4139858 12 35954679 35958446 7 12 42132947 42136714 7 12 40262913 40262918 8 12 34750772 34750777 8 RRID:RGD_5686322 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686326 SS-Ulk3em4Mcwi-/- SS-Ulk3em4Mcwi-/Ulk3em4Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686326 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686328 SS-Ulk3em4Mcwi+/+ SS-Ulk3em4Mcwi+/Ulk3em4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686328 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686330 SS-Ulk3em4Mcwi-/+ SS-Ulk3em4Mcwi-/Ulk3em4Mcwi+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686330 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686332 SS-Wdr72em2Mcwi-/- SS-Wdr72em2Mcwi-/Wdr72em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686332 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686335 SS-Wdr72em2Mcwi+/+ SS-Wdr72em2Mcwi+/Wdr72em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686335 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686652 SS-Agtr1aem1Mcwi-/- SS-Agtr1aem1Mcwi-/Agtr1aem1Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686652 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686654 SS-Agtr1aem1Mcwi+/+ SS-Agtr1aem1Mcwi+/Agtr1aem1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686654 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686657 SS-Agtr1aem5Mcwi-/- SS-Agtr1aem5Mcwi-/Agtr1aem5Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686657 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686659 SS-Agtrapem8Mcwi-/- SS-Agtrapem8Mcwi-/Agtrapem8Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686659 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686662 SS-Agtrapem8Mcwi+/+ SS-Agtrapem8Mcwi+/Agtrapem8Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686662 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686664 SS-Aldh2em2Mcwi-/- SS-Aldh2em2Mcwi-/Aldh2em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686664 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686666 SS-Aldh2em2Mcwi+/+ SS-Aldh2em2Mcwi+/Aldh2em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686666 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686668 SS-Cdh13em1Mcwi-/- SS-Cdh13em1Mcwi-/Cdh13em1Mcwi- PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686668 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686670 SS-Cdh13em1Mcwi+/+ SS-Cdh13em1Mcwi+/Cdh13em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686670 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686672 SS-Cyp1a1em1Mcwi-/- SS-Cyp1a1em1Mcwi-/Cyp1a1em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-11-06) RRID:RGD_5686672 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686676 SS-Cyp1a1em1Mcwi+/+ SS-Cyp1a1em1Mcwi+/Cyp1a1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686676 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686678 SS-Cyp1a1em2Mcwi-/- SS-Cyp1a1em2Mcwi-/Cyp1a1em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686678 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686680 SS-Cyp1a1em2Mcwi+/+ SS-Cyp1a1em2Mcwi+/Cyp1a1em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686680 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686684 SS-Cyp1a1em5Mcwi-/- SS-Cyp1a1em5Mcwi-/Cyp1a1em5Mcwi- PhysGen Knockouts mutant Extinct (as of 2018-09-05) RRID:RGD_5686684 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686687 SS-Cyp1a1em5Mcwi+/+ SS-Cyp1a1em5Mcwi+/Cyp1a1em5Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686687 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686689 SS-Prokr1em1Mcwi-/- SS-Prokr1em1Mcwi-/Prokr1em1Mcwi- PhysGen Knockouts mutant Extinct (as of 2018-09-05) RRID:RGD_5686689 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686692 SS-Prokr1em1Mcwi+/+ SS-Prokr1em1Mcwi+/Prokr1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686692 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686695 SS-Prokr1em2Mcwi-/- SS-Prokr1em2Mcwi-/Prokr1em2Mcwi- PhysGen Knockouts mutant Extinct (as of 2018-09-05) RRID:RGD_5686695 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686697 SS-Prokr1em2Mcwi+/+ SS-Prokr1em2Mcwi+/Prokr1em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686697 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686700 SS-Kcnq1em14Mcwi-/- SS-Kcnq1em14Mcwi-/Kcnq1em14Mcwi- PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686700 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686702 SS-Kcnq1em14Mcwi+/+ SS-Kcnq1em14Mcwi+/Kcnq1em14Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686702 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686704 SS-Msraem3Mcwi-/- SS-Msraem3Mcwi-/Msraem3Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686704 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686706 SS-Msraem3Mcwi+/+ SS-Msraem3Mcwi+/Msraem3Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686706 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686708 SS-Msraem4Mcwi-/- SS-Msraem4Mcwi-/Msraem4Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686708 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686710 SS-Msraem4Mcwi+/+ SS-Msraem4Mcwi+/Msraem4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686710 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686713 SS-Mstnem1Mcwi-/- SS-Mstnem1Mcwi-/Mstnem1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Mstnem1Mcwi 5143964 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456680 8 RRID:RGD_5686713 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686715 SS-Mstnem1Mcwi+/+ SS-Mstnem1Mcwi+/Mstnem1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686715 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686718 SS-Mstnem3Mcwi-/- SS-Mstnem3Mcwi-/Mstnem3Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Mstnem3Mcwi 5131962 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48456663 48456670 8 RRID:RGD_5686718 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686721 SS-Mstnem3Mcwi+/+ SS-Mstnem3Mcwi+/Mstnem3Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686721 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686723 SS-Mstnem3Mcwi-/+ SS-Mstnem3Mcwi-/Mstnem3Mcwi+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686723 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686725 SS-Nppaem4Mcwi-/- SS-Nppaem4Mcwi-/Nppaem4Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686725 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686728 SS-Nppaem4Mcwi+/+ SS-Nppaem4Mcwi+/Nppaem4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686728 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686730 SS-Nppbem2Mcwi-/- SS-Nppbem2Mcwi-/Nppbem2Mcwi- PhysGen Knockouts mutant Unknown Nppbem2Mcwi 5508324 5 165062348 165063650 7 5 168454278 168455640 7 5 164796229 164797531 8 5 158416813 158418175 7 RRID:RGD_5686730 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686732 SS-Nppbem2Mcwi+/+ SS-Nppbem2Mcwi+/Nppbem2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686732 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686734 SS-Nppbem4Mcwi-/- SS-Nppbem4Mcwi-/Nppbem4Mcwi- PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686734 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686736 SS-Nppbem4Mcwi+/+ SS-Nppbem4Mcwi+/Nppbem4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686736 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686738 SS-Plcd3em4Mcwi-/- SS-Plcd3em4Mcwi-/Plcd3em4Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686738 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686740 SS-Plcd3em4Mcwi+/+ SS-Plcd3em4Mcwi+/Plcd3em4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686740 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686742 SS-Plcd3em7Mcwi-/- SS-Plcd3em7Mcwi-/Plcd3em7Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686742 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686744 SS-Plcd3em7Mcwi+/+ SS-Plcd3em7Mcwi+/Plcd3em7Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686744 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686747 SS-Plekha7em1Mcwi-/- SS-Plekha7em1Mcwi-/Plekha7em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686747 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686749 SS-Plekha7em1Mcwi+/+ SS-Plekha7em1Mcwi+/Plekha7em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686749 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686758 SS-Plekha7em4Mcwi-/- SS-Plekha7em4Mcwi-/Plekha7em4Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Plekha7em4Mcwi 5143979 1 174249022 174316226 7 1 192397589 192463974 7 1 185483638 185483656 8 1 170420191 170420209 8 RRID:RGD_5686758 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686760 SS-Plekha7em4Mcwi+/+ SS-Plekha7em4Mcwi+/Plekha7em4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686760 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686762 SS-Plod1em1Mcwi-/- SS-Plod1em1Mcwi-/Plod1em1Mcwi- PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) RRID:RGD_5686762 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686764 SS-Plod1em1Mcwi+/+ SS-Plod1em1Mcwi+/Plod1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686764 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686766 SS-Sh2b3em2Mcwi-/- SS-Sh2b3em2Mcwi-/Sh2b3em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sh2b3em2Mcwi 5509982 12 35954679 35958446 7 12 42132947 42136714 7 12 40261990 40265757 7 12 34750773 34750773 8 RRID:RGD_5686766 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686768 SS-Slc30a8em1Mcwi-/- SS-Slc30a8em1Mcwi-/Slc30a8em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686768 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686770 SS-Slc30a8em1Mcwi+/+ SS-Slc30a8em1Mcwi+/Slc30a8em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686770 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686772 SS-Slc30a8em2Mcwi-/- SS-Slc30a8em2Mcwi-/Slc30a8em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686772 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686776 SS-Slc30a8em2Mcwi+/+ SS-Slc30a8em2Mcwi+/Slc30a8em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686776 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686778 SS-Stk39em2Mcwi-/- SS-Stk39em2Mcwi-/Stk39em2Mcwi- PhysGen Knockouts mutant Extinct (as of 2018-09-05) Stk39em2Mcwi 5509978 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_5686778 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686780 SS-Stk39em2Mcwi+/+ SS-Stk39em2Mcwi+/Stk39em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686780 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686782 SS-Stk39em2Mcwi-/+ SS-Stk39em2Mcwi-/Stk39em2Mcwi+ PhysGen Knockouts mutant Extinct (as of 2018-09-05) Stk39em2Mcwi 5509978 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_5686782 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686784 SS-Tcf7l2em1Mcwi-/- SS-Tcf7l2em1Mcwi-/Tcf7l2em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) Tcf7l2em1Mcwi 5509981 1 262031823 262226710 7 1 283387566 284118928 7 1 276686911 276730517 7 1 254785956 254978967 7 RRID:RGD_5686784 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686786 SS-Tcf7l2em1Mcwi+/+ SS-Tcf7l2em1Mcwi+/Tcf7l2em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686786 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686788 SS-Tcf7l2em1Mcwi-/+ SS-Tcf7l2em1Mcwi-/Tcf7l2em1Mcwi+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) Tcf7l2em1Mcwi 5509981 1 262031823 262226710 7 1 283387566 284118928 7 1 276686911 276730517 7 1 254785956 254978967 7 RRID:RGD_5686788 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686790 SS-Ulk3em1Mcwi-/- SS-Ulk3em1Mcwi-/Ulk3em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686790 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686792 SS-Ulk3em1Mcwi+/+ SS-Ulk3em1Mcwi+/Ulk3em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686792 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686794 SS-Ulk3em1Mcwi-/+ SS-Ulk3em1Mcwi-/Ulk3em1Mcwi+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686794 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686797 SS-Wdr72em1Mcwi-/- SS-Wdr72em1Mcwi-/Wdr72em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5686797 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686799 SS-Wdr72em1Mcwi+/+ SS-Wdr72em1Mcwi+/Wdr72em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5686799 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686826 ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown RRID:RGD_5686826 Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1, Rf-3 QTL region of chr 3, and Rf4 QTL region of chr 14 are introgressed in this strain. 5686829 ACI.FHH-(D1Mit18-D1Rat90)(D3Rat6-D3Got149)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_5686829 Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur and ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi. 5686832 ACI.FHH-(D1Mit18-D1Rat90)(D3Got102-D3Got149)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_5686832 Multicongenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur and ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi. 5687688 FHH-Tg(CAG-Rab38)1Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_5687688 A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion mapped to chromosome 14, roughly 13.2-Mbp, and was more than 100-kbp away from the nearest gene (downstream of Antrx2). 5687689 FHH-Tg(CAG-Rab38)2Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_5687689 A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion in line 2 was found to be within a long interspersed nuclear element (LINE) sequence and could not be unambiguously mapped to a specific chromosome location. 5687969 ACI.BN-(D2Rat251-D2Mgh3)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 2 6332896 63001078 1 - by flanking markers 2 6118364 81156651 1 - by flanking markers 2 6155132 63538449 1 - by flanking markers 2 8634571 62516896 1 - by flanking markers RRID:RGD_5687969 This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background. 5687971 ACI.BN-(D2Rat10-D2Rat202)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 2 35874553 51821161 1 - by flanking markers 2 54092967 70871600 1 - by flanking markers 2 34967269 52507805 1 - by flanking markers 2 36023184 51729300 1 - by flanking markers RRID:RGD_5687971 This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background. 5687973 ACI.BN-(D18Rat30-D18Rat89)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 18 5682011 63697215 1 - by flanking markers 18 5795276 62092559 1 - by flanking markers 18 5825946 62905769 1 - by flanking markers 18 5584537 60722497 1 - by flanking markers RRID:RGD_5687973 This congenic strain contains a region of BN/SsNHsd chromosome 18 transferred to the ACI/SegHsd strain background. 5687974 SS-Chr 5BN-Cyp4a2em1Mcwi PhysGen Knockouts mutant Extinct Cyp4a2em1Mcwi 5687724 5 135765673 135773006 7 5 137989327 138000302 7 5 134196910 134207888 7 5 128922355 128934188 7 RRID:RGD_5687974 This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2. 5687975 SS-Prex1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Prex1em2Mcwi 5687719 3 157693897 157863943 7 3 169494331 169575981 7 3 163329580 163477822 7 3 155306950 155456688 7 RRID:RGD_5687975 This strain was produced by injecting ZFNs targeting the sequence CAGTACTTCCGCTTCcatgcgGACGAGGAGATGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 16. 5687977 SS-Acad10em2Mcwi+/+ SS-Acad10em2Mcwi+/Acad10em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5687977 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687979 SS-Acad10em2Mcwi-/- SS-Acad10em2Mcwi-/Acad10em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-07-18) Acad10em2Mcwi 5131905 12 36070275 36075844 7 12 42285817 42328189 7 12 40458754 40458763 8 12 34901211 34943973 7 RRID:RGD_5687979 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The homozygous mutant carries a 10-bp frameshift deletion in exon 2. 5687981 SS-Alms1em1Mcwi-/- SS-Alms1em1Mcwi-/Alms1em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) Alms1em1Mcwi 5131906 4 119846037 119946085 7 4 181947469 182048235 7 4 117371972 117371988 8 4 118125581 118226005 7 RRID:RGD_5687981 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687983 SS-Alms1em1Mcwi+/+ SS-Alms1em1Mcwi+/Alms1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5687983 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687985 SS-Apoeem7Mcwi+/+ SS-Apoeem7Mcwi+/Apoeem7Mcwi+ PhysGen Knockouts mutant Extinct RRID:RGD_5687985 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687987 SS-Apoeem7Mcwi-/- SS-Apoeem7Mcwi-/Apoeem7Mcwi- PhysGen Knockouts mutant Extinct RRID:RGD_5687987 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687989 SS-Apoeem8Mcwi-/- SS-Apoeem8Mcwi-/Apoeem8Mcwi- PhysGen Knockouts mutant Extinct RRID:RGD_5687989 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687992 SS-Apoeem8Mcwi+/+ SS-Apoeem8Mcwi+/Apoeem8Mcwi+ PhysGen Knockouts mutant Extinct RRID:RGD_5687992 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687994 SS-Bcas3em4Mcwi+/+ SS-Bcas3em4Mcwi+/Bcas3em4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5687994 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687996 SS-Bcas3em4Mcwi-/- SS-Bcas3em4Mcwi-/Bcas3em4Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5687996 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687998 SS-Cybaem1Mcwi-/- SS-Cybaem1Mcwi-/Cybaem1Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5687998 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688000 SS-Cybaem1Mcwi+/+ SS-Cybaem1Mcwi+/Cybaem1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688000 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688002 SS-Chr 5BN-Cyp4a2em1Mcwi+/+ SS-Chr 5BN-Cyp4a2em1Mcwi+/Cyp4a2em1Mcwi+ PhysGen Knockouts mutant Extinct RRID:RGD_5688002 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688004 SS-Chr 5BN-Cyp4a2em1Mcwi-/- SS-Chr 5BN-Cyp4a2em1Mcwi-/Cyp4a2em1Mcwi- PhysGen Knockouts mutant Extinct RRID:RGD_5688004 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688006 SS-Chr 5BN-Cyp4a2em1Mcwi-/+ SS-Chr 5BN-Cyp4a2em1Mcwi-/Cyp4a2em1Mcwi+ PhysGen Knockouts mutant Extinct RRID:RGD_5688006 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688008 SS-Ets1em1Mcwi+/+ SS-Ets1em1Mcwi+/Ets1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688008 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688010 SS-Ets1em1Mcwi-/+ SS-Ets1em1Mcwi-/Ets1em1Mcwi+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) Ets1em1Mcwi 4139856 8 32481694 32545237 7 8 33798598 33921593 7 8 33851478 33851485 8 8 31045909 31168010 7 RRID:RGD_5688010 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688012 SS-Gpr183em1Mcwi-/- SS-Gpr183em1Mcwi-/Gpr183em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688012 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688014 SS-Gpr183em1Mcwi+/+ SS-Gpr183em1Mcwi+/Gpr183em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688014 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688016 SS-Gpr183em2Mcwi-/- SS-Gpr183em2Mcwi-/Gpr183em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688016 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688018 SS-Gpr183em2Mcwi+/+ SS-Gpr183em2Mcwi+/Gpr183em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688018 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688020 SS-Gpr183em3Mcwi-/- SS-Gpr183em3Mcwi-/Gpr183em3Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688020 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688022 SS-Gpr183em3Mcwi+/+ SS-Gpr183em3Mcwi+/Gpr183em3Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688022 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688024 SS-Itga9em1Mcwi+/+ SS-Itga9em1Mcwi+/Itga9em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688024 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688026 SS-Mas1em1Mcwi+/+ SS-Mas1em1Mcwi+/Mas1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688026 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688028 SS-Mas1em1Mcwi-/- SS-Mas1em1Mcwi-/Mas1em1Mcwi- PhysGen Knockouts mutant Cryorecovery (as of 2017-07-18) RRID:RGD_5688028 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688030 SS-Mmp2em1Mcwi-/- SS-Mmp2em1Mcwi-/Mmp2em1Mcwi- PhysGen Knockouts mutant Unknown Mmp2em2Mcwi 4139869 19 15246036 15275061 7 19 26646695 26646702 8 19 15542771 15570589 7 19 14154657 14182870 7 RRID:RGD_5688030 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. 5688032 SS-Mmp2em1Mcwi+/+ SS-Mmp2em1Mcwi+/Mmp2em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688032 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688034 SS-Mmp2em2Mcwi-/- SS-Mmp2em2Mcwi-/Mmp2em2Mcwi- PhysGen Knockouts mutant Live Animals (as of 2017-07-18) RRID:RGD_5688034 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688037 SS-Mmp2em2Mcwi+/+ SS-Mmp2em2Mcwi+/Mmp2em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688037 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688039 SS-Mthfrem1Mcwi+/+ SS-Mthfrem1Mcwi+/Mthfrem1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688039 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688041 SS-Mthfrem1Mcwi-/+ SS-Mthfrem1Mcwi-/Mthfrem1Mcwi+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688041 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688043 SS-Nckap5em1Mcwi-/- SS-Nckap5em1Mcwi-/Nckap5em1Mcwi- PhysGen Knockouts mutant Extinct (as of 2018-09-05) Nckap5em1Mcwi 4139859 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_5688043 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688045 SS-Nckap5em1Mcwi+/+ SS-Nckap5em1Mcwi+/Nckap5em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688045 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688047 SS-Nckap5em2Mcwi-/- SS-Nckap5em2Mcwi-/Nckap5em2Mcwi- PhysGen Knockouts mutant Extinct (as of 2018-09-05) Nckap5em2Mcwi 4139862 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_5688047 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688049 SS-Nckap5em2Mcwi+/+ SS-Nckap5em2Mcwi+/Nckap5em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688049 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688051 SS-Nckap5em3Mcwi-/- SS-Nckap5em3Mcwi-/Nckap5em3Mcwi- PhysGen Knockouts mutant Extinct (as of 2018-09-05) Nckap5em3Mcwi 4139861 13 38444115 39275959 7 13 47369687 48273649 7 13 42265875 43049232 7 13 37369948 38283257 7 RRID:RGD_5688051 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688053 SS-Nckap5em3Mcwi+/+ SS-Nckap5em3Mcwi+/Nckap5em3Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688053 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688059 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi-/- SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi-/Nckap5em4Mcwi- PhysGen Knockouts mutant Unknown RRID:RGD_5688059 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688061 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi+/+ SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi+/Nckap5em4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688061 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688063 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi-/+ SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi-/Nckap5em4Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688063 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688066 SS-Ncf2em1Mcwi-/- SS-Ncf2em1Mcwi-/Ncf2em1Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Ncf2em1Mcwi 5144089 13 67806516 67834105 7 13;13;13;13 75200283;75200283;75200283;75200283 75200287;75200287;75200287;75200287 8;8;8;8 13 70229196 70229200 8 13 64958217 64958221 8 RRID:RGD_5688066 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688069 SS-Ncf2em1Mcwi+/+ SS-Ncf2em1Mcwi+/Ncf2em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688069 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688074 SS-Nox4em2Mcwi-/- SS-Nox4em2Mcwi-/Nox4em2Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2019-01-03) Nox4em2Mcwi 4139868 1 143415816 143603554 7 1 157106652 157285107 7 1 150861996 150862003 8 1 140900886 141078844 7 RRID:RGD_5688074 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. This homozygous mutant carries an 8-bp frameshift deletion in exon 7 of rat Nox4. 5688077 SS-Nox4em2Mcwi+/+ SS-Nox4em2Mcwi+/Nox4em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688077 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688080 SS-Nox4em2Mcwi-/+ SS-Nox4em2Mcwi-/Nox4em2Mcwi+ PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2019-07-26) Nox4em2Mcwi 4139868 1 143415816 143603554 7 1 157106652 157285107 7 1 150861996 150862003 8 1 140900886 141078844 7 RRID:RGD_5688080 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688083 SS-Prex1em2Mcwi-/- SS-Prex1em2Mcwi-/Prex1em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688083 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688087 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi-/- FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi-/Rab38em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rab38em1Mcwi 4139867 1 144783919 144864573 7 1 158385888 158466621 7 1 152072716 152153449 7 1 142182566 142262923 7 RRID:RGD_5688087 ZFN mutant founders were backcrossed with FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. 5688090 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi+/+ FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi+/Rab38em1Mcwi+ PhysGen Knockouts mutant Unknown Rab38 628752 1 144783919 144864573 7 1 158385888 158466621 7 1 152072716 152153449 7 1 142182566 142262923 7 RRID:RGD_5688090 ZFN mutant founders were backcrossed with FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688092 SS-Rag1em1Mcwi-/- SS-Rag1em1Mcwi-/Rag1em1Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688092 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688094 SS-Rag1em1Mcwi+/+ SS-Rag1em1Mcwi+/Rag1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688094 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688096 SS-Rag1em2Mcwi-/- SS-Rag1em2Mcwi-/Rag1em2Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688096 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688098 SS-Rag1em2Mcwi+/+ SS-Rag1em2Mcwi+/Rag1em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688098 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688100 SS-Renem1Mcwi+/+ SS-Renem1Mcwi+/Renem1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688100 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688102 SS-Renem1Mcwi-/- SS-Renem1Mcwi-/Renem1Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Renem1Mcwi 4139863 13 46262936 46275213 7 13 55555583 55566812 7 13 50502724 50513953 7 13 44803412 44803421 8 RRID:RGD_5688102 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688107 FHH-Chr 1BN-Sorcs1em1Mcwi-/- FHH-Chr 1BN-Sorcs1em1Mcwi-/Sorcs1em1Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Sorcs1em1Mcwi 4139864 1 255767411 256279565 7 1 277404996 277912261 7 1 269965824 270473097 7 1 249207764 249207777 8 RRID:RGD_5688107 ZFN mutant founders were backcrossed with FHH-Chr 1BN/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is a 14-bp frameshift deletion mutation in exon 7. 5688109 FHH-Chr 1BN-Sorcs1em1Mcwi+/+ FHH-Chr 1BN-Sorcs1em1Mcwi+/Sorcs1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688109 ZFN mutant founders were backcrossed with FHH-Chr 1BN/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688111 SS-Tfdp2em2Mcwi-/- SS-Tfdp2em2Mcwi-/Tfdp2em2Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688111 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688113 SS-Tfdp2em2Mcwi+/+ SS-Tfdp2em2Mcwi+/Tfdp2em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688113 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688116 SS-Tgfb1em1Mcwi+/+ SS-Tgfb1em1Mcwi+/Tgfb1em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688116 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. 5688119 SS-Tgfb1em3Mcwi+/- SS-Tgfb1em3Mcwi+/Tgfb1em3Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-08-24) RRID:RGD_5688119 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained heterozygous breeders. 5688121 SS-Ube2q2em3Mcwi-/- SS-Ube2q2em3Mcwi-/Ube2q2em3Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688121 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688123 SS-Ube2q2em3Mcwi+/+ SS-Ube2q2em3Mcwi+/Ube2q2em3Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_5688123 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688125 SS-Ulk4em3Mcwi-/- SS-Ulk4em3Mcwi-/Ulk4em3Mcwi- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) RRID:RGD_5688125 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688396 ACI.BN-(D3Rat80-D3Rat3)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 3 32056563 162589029 1 - by flanking markers 3 41713824 175796738 1 - by flanking markers 3 36599933 169714239 1 - by flanking markers 3 35528428 160482157 1 - by flanking markers RRID:RGD_5688396 This congenic strain contains a region of BN/SsNHsd chromosome 3 transferred to the ACI/SegHsd strain background. 5688400 ACI.BN-(D4Rat5-D4Got131)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 4 9638281 162284199 1 - by flanking markers 4 10720881 224994372 1 - by flanking markers 4 10728623 157981900 1 - by flanking markers 4 14118904 158261065 1 - by flanking markers RRID:RGD_5688400 This congenic strain contains a region of BN/SsNHsd chromosome 4 transferred to the ACI/SegHsd strain background. 5688402 ACI.BN-(D6Rat148-D6Rat109)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 6 20826657 146162691 1 - by flanking markers 6 31958575 155686896 1 - by flanking markers 6 22070168 146778380 1 - by flanking markers 6 20894065 139809723 1 - by flanking markers RRID:RGD_5688402 This congenic strain contains a region of BN/SsNHsd chromosome 6 transferred to the ACI/SegHsd strain background. 5688405 ACI.COP-(D5Rat12-D5Rat205)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 70669803 70670361 1 - by flanking markers 5 74199071 74199222 1 - by flanking markers 5 70038765 70038916 1 - by flanking markers 5 67856776 67856928 1 - by flanking markers RRID:RGD_5688405 This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background. 5688407 ACI.COP-(D5Rat28-D5Rat205)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 126963761 126963962 1 - by flanking markers 5 129313212 129313302 1 - by flanking markers 5 125455818 125455908 1 - by flanking markers 5 120740824 120740915 1 - by flanking markers RRID:RGD_5688407 This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background. 5688409 ACI.COP-(D5Rat28-D5Rat36)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 126963761 145187034 1 - by flanking markers 5 129313212 147610238 1 - by flanking markers 5 125455818 143846372 1 - by flanking markers 5 120740824 138113774 1 - by flanking markers RRID:RGD_5688409 This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background. 6218997 SHR/NCrlAnra Behavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, Brazil inbred Unknown RRID:RGD_6218997 These were originally from Harvard University, Boston MA, then at UNESP, Botucatu, SP, Brazil, now maintained at Behavior Genetics Laboratory, SC, Brazil 6219002 LEW/HsdUnibAnra Behavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, Brazil inbred Unknown RRID:RGD_6219002 LEW rats originally from Harlan Sprague Dawley, IN then bred at UNICAMP (Campinas, SP Brazil) now maintained at Behavior Genetics Laboratory, SC, Brazil 6478788 STOCK-Tp53tm1(EGFP-Pac)Qly/Rrrc p53 knockout rat Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2024-04-16) Tp53|Tp53tm1(EGFP-Pac)Qly 3889|12792957 10 56399721 56411150 7 10 55932658 55944087 7 10 56186299 56198449 7 10 54300070 54311525 7 RRID:RRRC_00485 This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5 prime and 1.6- kb 3 prime homology arms and a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting F344 blastocysts. Founder animals were mated with SD rats. 6478789 LEW-Tg(CAG-EGFP)YsRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2018-07-16) RRID:RRRC_00296 Transgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegalovirus enhancer, chicken b-actin enhancer-promoter and rabbit b-globin poly(A) signal. 6478791 F344-Tg(UBC-EGFP)F455Rrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00307 This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. Animals that exhibited fluorescence of tails were mated. Offspring were bred with Lewis wild-type mates to map transgene location. Animals were backcrossed 10 generations onto F344. 6480190 NAft:HS Heterogeneous stock Psychiatry and Forensic Medicine, Institute of Neurosciences, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain outbred Unknown RRID:RGD_6480190 From Dr. Eva Redei, Center for Comparative Medicine, Northwestern University to Dr. Alberto Fernandez-Teruel, Barcelona 6480205 MWF-Chr 6SHR Chr 8SHR/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_6480205 Chr 8 and chr 6 were introgressed from albuminuria-resistant SHR/FubRkb into the sensitive isogenic background of MWF/FubRkb 6480210 SHR-Chr 8MWF/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_6480210 SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 6480218 AR-Ednrbsl/Hkv Aganglionosis rat Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan mutant Unknown Ednrbsl 10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_6480218 Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR), provided to Dr. Takashi Agui by Dr. Ozaki, National Institute for Physiological Sciences, Okazaki, Japan 6480220 LEH/Hkv Aganglionosis rat Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-11-15) Internal Medicine Ednrbsl 10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_6480220 This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. AR-derived Ednrbsl was introduced into Long-Evans by Dr. Ozaki (NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm), and this rat was provided to Dr. Agui at Hokkaido University and inbred line was established by sib mating. 6480223 F344.AR-Ednrbsl/Hkv Aganglionosis rat Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-10-28) Ednrbsl 10755424 15 87893141 87898700 7 15 91500400 91531979 7 15 88034987 88035287 8 15 80670748 80671048 8 RRID:RGD_6480223 This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. This congenic strain was established by backcrossing (over 10 generations) of AR rat to F344/NSlc. 6480863 BBDR/RhwRrrc Rat Resource & Research Center Rat Resource & Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00463 BBDR/Rhw from R. H. William Laboratory, University of Washington, Seattle, Washington to Rat Resource & Research Center 6480866 BN-Chr 13LH/MavRrrc Laboratoire de Physiologie, Lyon Cedex , France Rat Resource & Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00395 Chr 13 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped 6480868 BN-Chr 2LH/MavRrrc Laboratoire de Physiologie, Lyon Cedex , France Rat Resource & Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00396 Chr 2 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped 6480874 COP.DA-(D16Rat12-D16Rat90)/McoRrrc Rat Resource & Research Center Rat Resource & Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm 16 350121 85734479 1 - by flanking markers 16 1084304 85597057 1 - by flanking markers 16 1090054 86162972 1 - by flanking markers 16 380245 80345693 1 - by flanking markers RRID:RRRC_00444 Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. Transferred from Medical College of Toledo to Rat Resource & Research Center 6482243 WI-CitfhJjlo/Rrrc flathead rat Department of Physiology and Neurobiology, University of Connecticut Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-07-21) CitfhJjlo 13204831 12 41858134 42019601 7 12 48136329 48295119 7 12 46493042 46493042 8 12 40763699 40763699 8 RRID:RRRC_00322 Flathead rat was discovered at University of Connecticut in an inbred colony of Wistar rats. Spontaneous single G deletion in exon 1 of citron kinase (Cit) confers a premature stop codon and lack of citron kinase protein. 6482244 SS-Tg(APOA1)116OpazRrrc Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00282 SS/JrHsd embryos were microinjected with human APOA1 C3 promoter 6482245 SS-Tg(Atp1a1)24OpazRrrc Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24) RRID:RRRC_00280 SS/JrHsd embryos were microinjected with rat alpha1 Na,K-ATPase promoter (-1288 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase 6482247 FDIO/Rrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2022-10-18) RRID:RRRC_00060 Cross between F344 (lean phenotype) and SDDIO (diet-induced obese phenotype) then inbred for 6 generations with maintenance of obese phenotype. 6482252 F344-Tg(Pgk1-EGFP)/Rrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00053 Multiple random integration of EGFP gene under the control of the PGK promoter. 6482254 Gunn-Ugt1a1j/BluHsdRrrc Gunn rat Rat Resource and Research Center Rat Resource and Research Center mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-09-15) Ugt1a1j 13432064 9 87091241 87098362 7 9 94982916 94990037 7 9 95300017 95300017 8 9 88805660 88805660 8 RRID:RRRC_00341 This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. 6482256 HS/Rrrc High Self-Administration Rat Resource and Research Center Rat Resource and Research Center inbred Cryorecovery (as of 2019-02-01) RRID:RRRC_00537 Developed from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations. 6482259 LS/Rrrc Low Self-Administration Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-01-13) RRID:RRRC_00536 Developed from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations. 6482268 BRAT-Avpdi/BluHsdRrrc Brattleboro Rat Resource and Research Center mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) Avpdi 13627261 3 118205007 118206985 7 3 129615610 129627147 7 3 123117482 123119460 7 3 117793447 117805091 7 RRID:RRRC_00445 Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Brattleboro rats transferred to the RRRC in 2009. 6482271 LEW.Cg-Foxn1rnu/NRrrc Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00363 The NIH nude rat was developed in 1979-1980 at the NIH through a series of matings involving the following inbred rat strains: BN/SsN, MR/N, BUF/N, WN/N, ACI/N, WKY/N, M520/N, and F344/N. Received from the National Institute of Health by NCI in 1983. The nude mutation was subsequently backcrossed 17 generations to the Lewis inbred strain. 6482282 LEW-Tg(EGFP)463-5Rrrc Lewis- GFP transgenic Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm RRID:RRRC_00083 insertion of EGFP transgene with Ubiquitin C promoter 6482284 LEW-Tg(EGFP)456-9Rrrc Lewis- GFP transgenic Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm RRID:RRRC_00084 insertion of EGFP transgene with Ubiquitin C promoter 6482286 LEW-Tg(EGFP)458-7Rrrc Lewis- GFP transgenic Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00086 insertion of EGFP transgene with Ubiquitin C promoter 6482288 LEW-Tg(EGFP)463-1Rrrc Lewis- GFP transgenic Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm RRID:RRRC_00085 insertion of EGFP transgene with Ubiquitin C promoter 6482290 LEW-Tg(EGFP)455Rrrc Lewis- GFP transgenic Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00062 This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. 6482292 LEW-Tg((ROSA)26Sor-lacZ)15Jmsk Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-08) RRID:RRRC_00297 This strain expresses LacZ ubiquitously driven by the ROSA26 promoter established at Jichi Medical School. 6482294 LH-Chr 13BN/MavRrrc Rat Resource and Research Center Rat Resource and Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00393 Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped 6482296 LH-Chr 17BN/MavRrrc Rat Resource and Research Center Rat Resource and Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00394 Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped 6482298 MWF/ZtmRrrc Munich Wistar Fromter Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01) RRID:RRRC_00482 From outbred Wistar rats selected for large numbers of superficial glomeruli. 6482643 WIN/RhwRrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00481 Submitted to Rat Resource & Research Center 6482645 SD-Tg(Rho-S334X)3LavRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-08-17) RRID:RRRC_00539 This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated rhodopsin protein. Submitted to Rat Resource & Research Center 6482654 ACI.BN-(D7Rat36-D7Rat11)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 7 1526177 118826810 1 - by flanking markers 7 2632014 121752141 1 - by flanking markers 7 2653138 121762010 1 - by flanking markers 7 664270 112087821 1 - by flanking markers RRID:RGD_6482654 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 6482674 HIS/NdkRrrc High-Saccharin-Consuming (HiS) Rat Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00366 The Occidental HiS (high-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that voluntarily consumed high levels of saccharin.This male was mated to several Holtzman Sprague-Dawley females and offspring displaying high saccharin consumption were selected. Selective breeding was continued in which offspring with high saccharin consumption were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations. 6482676 LOS/NdkRrrc Low-Saccharin-Consuming (HiS) Rat Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm RRID:RRRC_00440 The Occidental LoS (low-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that did not voluntarily consume saccharin. This male was mated to several Holtzman Sprague-Dawley females and offspring displaying low saccharin consumption were selected. Selective breeding was continued in which offspring with low saccharin consumption (see phenotyping protocol) were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations. 6482680 SD-Tg(MMTV-Erbb2)1UwmRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-12) Erbb2 2561 RRID:RRRC_00365 Hsd:SD background carrying a transgene which produces over-expression of the rat Erbb2 proto-oncogene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat. 6483453 SS-Dguokem2Mcwi Medical College of Wisconsin, Milwaukee WI mutant Cryopreserved Sperm (as of 2021-11-03) Dguokem2Mcwi 5508354 4 117697251 117725383 7 4 179770727 179798683 7 4 115180433 115208061 7 4 115987101 116014733 7 RRID:RGD_6483453 This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110) 6483454 SS-Dguokem1Mcwi Medical College of Wisconsin, Milwaukee WI mutant Cryopreserved Sperm (as of 2017-01-26) Dguokem1Mcwi 5508345 4 117697251 117725383 7 4 179770727 179798683 7 4 115180433 115208061 7 4 115987101 116014733 7 RRID:RGD_6483454 This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105) 6483455 SS-Dguokem3Mcwi Medical College of Wisconsin, Milwaukee WI mutant Cryopreserved Sperm Dguokem3Mcwi 5508325 4 117697251 117725383 7 4 179770727 179798683 7 4 115180433 115208061 7 4 115987101 116014733 7 RRID:RGD_6483455 This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc) 6483846 HsdFcen:WI Wistar Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, Argentina outbred Unknown RRID:RGD_6483846 Descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan and now maintained at School of Science, Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, Argentina 6484519 SS-ROSA26em1(SB11)Mcwi PhysGen Knockouts mutant Cryorecovery (as of 2017-08-08) ROSA26em1(SB11)Mcwi 6484518 RRID:RGD_6484519 This strain was produced by ZFN-stimulated knockin in the rat ROSA26 locus. ZFNs targeting the sequence CCTTCCCCCTTCTTCcctcgtGATCTGCAACTGGAGTCT were injected into SS/JrHsdMcwi rat embryos along with a plasmid template incorporating the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA, and SV40 polyadenylation signal to integrate the transgene by homologous recombination. The resulting animal was confirmed by sequencing both junctions to harbor the SB11 gene knocked into the rat locus and expresses SB11 transposase in every cell by immunohistochemistry. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 6484559 SS-Slc34a1em1Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Slc34a1em1Mcwi 5687699 17 15262929 15277902 7 17 11856946 11872100 7 17 9747766 9762739 7 17 9232573 9232584 8 RRID:RGD_6484559 This strain was produced by injecting ZFNs targeting the sequence CGTGCTCAGCTCTGCCTTccaactGGCCGGAGGTAGGGCCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp deletion in exon 4. 6484560 SS-Pdcem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pdcem2Mcwi 5687695 13 64622473 64636031 7 13 72510251 72523421 7 13 67545430 67558600 8 13 62297281 62371754 7 RRID:RGD_6484560 This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 5. 6484561 SS-Comtem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Comtem1Mcwi 5687725 11 84561591 84581713 7 11 89809853 89829568 7 11 86731828 86731841 8 11 82568052 82587642 7 RRID:RGD_6484561 This strain was produced by injecting ZFNs targeting the sequence CTGTTCCAGGTCACCATCctcaatGGGGCATCCCAGGATCTT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 4. 6484562 SS-Fgf5em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fgf5em1Mcwi 5687720 14 12713971 12734634 7 14 12917742 12938879 7 14 12995240 12995246 8 14 11323827 11346164 7 RRID:RGD_6484562 This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1. 6484563 SS-Cst3em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cst3em3Mcwi 5687738 3 137650903 137654776 7 3 149628692 149632565 7 3 143223310 143223311 8 3 136336923 136340796 7 RRID:RGD_6484563 This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 1. 6484564 SS-Cd247em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Cd247em3Mcwi 5687730 13 81515383 81594699 7 13 88876046 88951003 7 13 83996234 83996246 8 13 78043302 78118437 7 RRID:RGD_6484564 This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1. 6484565 SS-Ldlrem3Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Ldlrem3Mcwi 5144082 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 7 8 20270020 20292981 7 RRID:RGD_6484565 This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 4. 6484566 SS-Slc6a12em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc6a12em1Mcwi 5687736 4 157781178 157800038 7 4 221009224 221029242 7 4 153921199 153941333 7 4 154586055 154586107 8 RRID:RGD_6484566 This strain was produced by injecting ZFNs targeting the sequence GTCTCCCTCTCCAGTatggacAGAAAGGTTACAGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion overlapping exon 2 6484567 FHH-Chr 1BN-Sorcs3em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs3em1Mcwi 5687731 1 254125935 254345330 7 1 275416357 276060204 7 1 267986305 268620331 7 1 247570408 247570435 8 RRID:RGD_6484567 This strain was produced by injecting ZFNs targeting the sequence TGCCCGCTCCATTGAcatcagtTCCCTGGTCGTCCAGGAT into FHH-Chr 1BN/Mcwi rat embryos. The resulting mutation is a 33-bp insertion in exon 7 6484568 SS-Cd247em5Mcwi PhysGen Knockouts mutant Extinct Cd247em5Mcwi 5687713 13 81515383 81594699 7 13 88876046 88951003 7 13 83996045 84071408 7 13 78043302 78118437 7 RRID:RGD_6484568 This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1. 6484569 SS-Adora2bem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Adora2bem1Mcwi 5687729 10 48421592 48437967 7 10 48358068 48374871 7 10 48569703 48569816 8 10 46940394 46956772 7 RRID:RGD_6484569 This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 114-bp deletion in exon 1 6484570 SS-Stc1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Stc1em2Mcwi 5687722 15 49566885 49577539 7 15 54622230 54632884 7 15 50891137 50901791 7 15 44299591 44311695 7 RRID:RGD_6484570 This strain was produced by injecting ZFNs targeting the sequence CAGCTGCCCAATCACttctccAACAGGTATCCTGAGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 3. 6484571 SS-Myadml2em5Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Myadml2em5Mcwi 5687726 10 110039330 110040967 7 10 109418559 109420196 7 10 109825513 109827143 8 10 105922557 105927867 7 RRID:RGD_6484571 This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp frameshift deletion in exon 1. 6484572 SS-Fgf5em5Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fgf5em5Mcwi 5687727 14 12713971 12734634 7 14 12917742 12938879 7 14 12995243 12995244 8 14 11323827 11346164 7 RRID:RGD_6484572 This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in exon 1. 6484573 SS-Clcn6em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Clcn6em2Mcwi 5687740 5 165079773 165110594 7 5 168469718 168502323 7 5 164824701 164824715 8 5 158434299 158465174 7 RRID:RGD_6484573 This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13. 6484574 SS-Umodem1Mcwi PhysGen Knockouts mutant Extinct Umodem1Mcwi 5687697 1 177729212 177742552 7 1 196127939 196141822 7 1 189186027 189199939 7 1 173816341 173829681 7 RRID:RGD_6484574 This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2. 6484575 SS-Resp18em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Resp18em3Mcwi 5687714 9 74551809 74558151 7 9 82240055 82246695 7 9 82470794 82477136 7 9 76767473 76767485 8 RRID:RGD_6484575 This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp substitution in exon 3. 6484576 SS-Adipoqem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqem1Mcwi 5687709 11 79908291 79911065 7 11 84363940 84382663 7 11 81333964 81334010 8 11 77721912 77735644 7 RRID:RGD_6484576 This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1. 6484577 SS-Gnb3em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gnb3em1Mcwi 5687696 4 160957524 160963226 7 4 224370234 224376918 7 4 157355400 157355510 8 4 157639468 157645171 7 RRID:RGD_6484577 This strain was produced by injecting ZFNs targeting the sequence GGCTCCCTCTCTCCTGGCagtccTTGTGGGACATTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 111-bp deletion overlapping exon 7. 6484578 SS-Mylipem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mylipem1Mcwi 5508347 17 25308147 25329887 7 17 21703590 21725205 7 17 19682040 19703681 8 17 19286649 19308295 7 RRID:RGD_6484578 This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1. 6484579 SS-Chr 5BN-Cyp4a3em3Mcwi PhysGen Knockouts mutant Extinct Cyp4a3em3Mcwi 5687737 5 135876140 135893753 7 5 138258628 138274813 7 5 134468666 134484851 7 5 129097571 129115488 7 RRID:RGD_6484579 This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2. 6484580 SS-Ldlrem2Mcwi PhysGen Knockouts mutant Extinct (as of 2017-01-26) Ldlrem2Mcwi 5144094 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 7 8 20270020 20292981 7 RRID:RGD_6484580 This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 123-bp frameshift deletion in exon 4. 6484581 SS-Resp18em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Resp18em2Mcwi 5687705 9 74551809 74558151 7 9 82240055 82246695 7 9 82470794 82477136 7 9 76767473 76767479 8 RRID:RGD_6484581 This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 3. 6484582 SS-Cd247em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Cd247em1Mcwi 5687703 13 81515383 81594699 7 13 88876046 88951003 7 13 83996233 83996243 8 13 78043460 78043470 8 RRID:RGD_6484582 This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1. 6484583 SS-Nr2f2em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nr2f2em1Mcwi 5687721 1 125280974 125286929 7 1 132486697 132499845 7 1 131452414 131452428 8 1 124013926 124013940 8 RRID:RGD_6484583 This strain was produced by injecting ZFNs targeting the sequence CCTTCTTCCCTGACCTGCagatcACGGACCAGGTGGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. 6484584 SS-Adipoqem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-13) Adipoqem2Mcwi 5687716 11 79908291 79911065 7 11 84363940 84382663 7 11 81333967 81333970 8 11 77721912 77735644 7 RRID:RGD_6484584 This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 1. 6484585 SS-Slc7a9em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a9em2Mcwi 5687701 1 87976440 87999102 7 1 92836837 92865759 7 1 91709034 91738492 7 1 88109517 88132653 7 RRID:RGD_6484585 This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. 6484711 SS-Atp2b1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Atp2b1em2Mcwi 6484707 7 36493661 36600280 7 7 41153926 41262537 7 7 41196115 41196231 8 7 33735595 33845226 7 RRID:RGD_6484711 This strain was produced by injecting ZFNs targeting the sequence TACCTTCTGGGTTCAgaagagGCCGTGGCTTGCTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 117-bp deletion in intron 8 and exon 9. 6484712 SS-Lpin1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Lpin1em1Mcwi 6484709 6 40253664 40297195 7 6 51532422 51638090 7 6 41799748 41870046 8 6 39309198 39417034 7 RRID:RGD_6484712 This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in exon 3. 6484713 SS-Cubnem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cubnem1Mcwi 6484705 17 87545893 87772079 7 17 82205509 82425565 7 17 80783420 80783432 8 17 76385046 76593133 7 RRID:RGD_6484713 This strain was produced by injecting ZFNs targeting the sequence CGGGAGTACCTTCAGATTcatgatGGAGACTCCTCAGCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 14. 6484714 SS-Lssem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Lssem2Mcwi 6484706 20 12507575 12534612 7 20 15000298 15338473 7 20 12844522 12870474 7 20 12118435 12118448 8 RRID:RGD_6484714 This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 12-bp deletion in exon 2. 6484715 SS-Adora2bem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Adora2bem2Mcwi 5687698 10 48421592 48437967 7 10 48358163 48358324 8 10 48569563 48586366 7 10 46940394 46956772 7 RRID:RGD_6484715 This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 162-bp deletion in exon 1 6484716 SS-Bcat1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Bcat1em2Mcwi 6484708 4 182641517 182692917 7 4 243444839 243491574 7 4 179289184 179289198 8 4 177964834 178046573 7 RRID:RGD_6484716 This strain was produced by injecting ZFNs targeting the sequence CAGTCTGTACATCCGCCCCacattCATCGGGATTGAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is 15-bp deletion in exon 5 6484717 SS-Cacna1hem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cacna1hem2Mcwi 6484703 10 14621372 14679051 7 10 14547456 14605627 7 10 14744474 14744487 8 10 14390104 14448204 7 RRID:RGD_6484717 This strain was produced by injecting ZFNs targeting the sequence CCGACCCACAGTGTCtgggagATCGTGGGGCAGGCAGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 11. 6484718 SS-Aceem2Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-13) Aceem2Mcwi 6484704 10 95361338 95381455 7 10 93922062 93965127 7 10 94174778 94174785 8 10 90910316 90930437 7 RRID:RGD_6484718 This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 6. 6484719 SS-Leprem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Leprem2Mcwi 6484701 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682269 8 5 116294409 116477904 7 RRID:RGD_6484719 This strain was produced by injecting ZFNs targeting the sequence AGCATCGTACTGCCCacaatgGGACATGGTCACAAG into SS/JrHsdMcwi rat embryos. The resulting mutation was a 16-bp deletion in exon 11, predicted nonsense stop codon 30. 6484720 SS-Lepem5Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Lepem5Mcwi 6484700 4 55943837 55945938 7 4 56085079 56099209 7 4 56346978 56351818 8 4 57661127 57675262 7 RRID:RGD_6484720 This strain was produced by injecting ZFNs targeting the sequence CTGTGCCTATCCacaaaGTCCAGGATGACACC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3. 6484721 SS-Aceem1Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-11-12) Aceem1Mcwi 6484702 10 95361338 95381455 7 10 93922062 93965127 7 10 94174776 94174782 8 10 90910316 90930437 7 RRID:RGD_6484721 This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 6. 6766770 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 4 76647384 78886189 1 - by flanking markers RRID:RGD_6766770 This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene; maintained at Medical College of Wisconsin 6893382 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1em3Mcwi PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Il1r1em3Mcwi 6893378 9 39434910 39473552 7 9 46647422 46723241 7 9 46962291 47038139 7 9 42565971 42565972 8 RRID:RGD_6893382 This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 5. 6893383 SS-Fynem6Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fynem6Mcwi 6893380 20 43501853 43695567 7 20 46160734 46353456 7 20 44577477 44577484 8 20 42767733 42960903 7 RRID:RGD_6893383 This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp deletion in exon 4. 6893384 SS-Kcnj11em9Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnj11em9Mcwi 6893381 1 96614960 96617993 7 1 103186859 103190535 7 1 102103094 102106127 8 1 96591048 96594574 7 RRID:RGD_6893384 This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1. 6893385 SS-Kcnj11em5Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnj11em5Mcwi 6893379 1 96614960 96617993 7 1 103186859 103190535 7 1 102103094 102106127 8 1 96591048 96594574 7 RRID:RGD_6893385 This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 1. 6893429 SS-Nos3em8Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nos3em8Mcwi 6893421 4 6158847 6179441 7 4 7333272 7353767 7 4 7322088 7342400 8 4 10793834 10814170 7 RRID:RGD_6893429 This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 109-bp deletion in exon 3. 6893430 SS-Nat8em4Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nat8em4Mcwi 6893413 4 120001277 120002055 7 4 117525963 117526741 8 4 117525963 117527443 7 4 118279521 118284671 7 RRID:RGD_6893430 This strain was produced by injecting ZFNs targeting the sequence CACATCCGCCAGTTCCAGgagaggGACTATGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 1. 6893431 SS-Nos3em13Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Nos3em13Mcwi 6893422 4 6158847 6179441 7 4 7333272 7353767 7 4 7321908 7342404 7 4 10811102 10811266 8 RRID:RGD_6893431 This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4 6893432 SS-Hvcn1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Hvcn1em1Mcwi 6893410 12 35536954 35556666 7 12 41702567 41731349 7 12 39829785 39829792 8 12 34341673 34370010 7 RRID:RGD_6893432 This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5. 6893433 SS-Nos3em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nos3em2Mcwi 6893418 4 6158847 6179441 7 4 7333272 7353767 7 4 7322088 7342400 8 4 10793834 10814170 7 RRID:RGD_6893433 This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3. 6893434 SS-Kcnj16em1Mcwi-/- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Kcnj16em1Mcwi 6893423 10 100514180 100515949 7 10 99027026 99087674 7 10 99330894 99391551 7 10 96018462 96018479 8 RRID:RGD_6893434 This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1. 6893435 SS-Tfdp2em6Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tfdp2em6Mcwi 6893417 8 101256112 101392512 7 8 103489105 103629520 7 8 104040795 104181228 7 8 96760459 96901466 7 RRID:RGD_6893435 This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 6. 6893436 SS-Kcnmb1em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnmb1em1Mcwi 6893415 10 18904902 18912604 7 10 18790595 18800957 7 10 18911938 18919640 8 10 18557510 18614824 7 RRID:RGD_6893436 This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a net 4-bp deletion in exon 2. 6893437 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1em1Mcwi PhysGen Knockouts mutant Extinct Il1r1em1Mcwi 6893425 9 39434910 39473552 7 9 46647422 46723241 7 9 46962291 47038139 7 9 42504917 42580958 7 RRID:RGD_6893437 This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5. 6893438 SS-Fgf1em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fgf1em2Mcwi 6893412 18 31785480 31806452 7 18 31951411 32037426 7 18 32351620 32351629 8 18 30686555 30772667 7 RRID:RGD_6893438 This strain was produced by injecting ZFNs targeting the sequence TTCCAGTTCAGCTGCAGCtcagtGCGGAAAGCGCGGGCGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion in exon 3. 6893439 SS-Hvcn1em2Mcwi-/- PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Hvcn1em2Mcwi 6893419 12 35536954 35556666 7 12 41702567 41731349 7 12 39829788 39829795 8 12 34341673 34370010 7 RRID:RGD_6893439 This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5. 6893440 SS-Fynem1Mcwi PhysGen Knockouts mutant Extinct Fynem1Mcwi 6893411 20 43501853 43695567 7 20 46160734 46353456 7 20 44436354 44630316 7 20 42767733 42960903 7 RRID:RGD_6893440 This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4. 6893441 SS-Grm7em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Grm7em2Mcwi 6893416 4 146952340 147270225 7 4 205768625 206680107 7 4 142452616 143367578 8 4 143730862 144613230 7 RRID:RGD_6893441 This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3. 6893442 SS-Ppargem1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ppargem1Mcwi 6893424 4 151492220 151617331 7 4 210640676 210640808 8 4 147274055 147399383 7 4 148423102 148548471 7 RRID:RGD_6893442 This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 6893443 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1em2Mcwi PhysGen Knockouts mutant Extinct Il1r1em2Mcwi 6893414 9 39434910 39473552 7 9 46647422 46723241 7 9 46962291 47038139 7 9 42504917 42580958 7 RRID:RGD_6893443 This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5. 6893444 SS-Kcnmb1em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnmb1em3Mcwi 6893420 10 18904902 18912604 7 10 18790595 18800957 7 10 18910586 18922856 7 10 18559674 18559694 8 RRID:RGD_6893444 This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2. 6893530 BBDR.LA-(D5Rat98-D5Rat233)/Rhw R. H. William Laboratory, University of Washington, Seattle, Washington congenic Unknown 5 100017060 124932061 1 - by flanking markers 5 103451053 127341295 1 - by flanking markers 5 99421434 123480464 1 - by flanking markers 5 95774194 118714492 1 - by flanking markers RRID:RGD_6893530 Koletsky rat leptin receptor mutant (lepr) from the LA/N-cp was introgressed into the BBDR/Rhw rats by marker-assisted breeding. This was initiated in 2001 by Dr. Hansen and completed in 2007 at the University of Washington, Seattle. 6893535 BBDR.LA-(D5Rat98-D5Rat233), BBDP-(D4Mit6-D4Mit7)/Rhw R. H. William Laboratory, University of Washington, Seattle, Washington congenic Unknown RRID:RGD_6893535 Heterozygous BBDR.LA-(D5Rat98-D5Rat233)/Rhw (DR.lepr) were crossed with homozygous BBDR.BBDP-(-(D4Mit6-D4Mit7)/Rhw (DR.Gimap5), to generate double congenic rats that had mutations for Gimap5 and Lepr genes. 6893551 DA.PVG.1AV1-(D1Rat32-D1Rat51)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 112148733 159782631 1 - by flanking markers 1 173583273 202649821 1 - by flanking markers 1 167394665 195598217 1 - by flanking markers 1 156677124 156677310 1 - by flanking markers RRID:RGD_6893551 DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program. 6893554 DA.PVG.1AV1-(D1Rat193-D1Rat68)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 183163129 193070197 1 - by flanking markers 1 201022827 212591221 1 - by flanking markers 1 193968438 205603226 1 - by flanking markers 1 178810256 188377506 1 - by flanking markers RRID:RGD_6893554 DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program. 6893599 SS-Pdcem3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pdcem3Mcwi 5687712 13 64622473 64636031 7 13 72510251 72523421 7 13 67545430 67558600 8 13 62297281 62371754 7 RRID:RGD_6893599 This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 47-bp deletion in exon 5. 6893600 SS-Abcb1bem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-07-24) Abcb1bem2Mcwi 6893598 4 21829489 21912239 7 4 22161597 22244735 7 4 22303694 22303791 8 4 25242761 25325194 7 RRID:RGD_6893600 This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4. 6902893 BB.SHR-(Acsm3-Igf2)/K Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown Igf2|Acsm3 2870|62086 1 178054386 202915231 1 - by flanking markers 1 196449042 222733868 1 - by flanking markers 1 189514504 215839081 1 - by flanking markers 1 174133260 197831802 1 - by flanking markers RRID:RGD_6902893 Congenics extablished as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats 6903879 SS/NEisSlc inbred Unknown RRID:RGD_6903879 1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan 6903881 SR/NEisSlc inbred Unknown RRID:RGD_6903881 1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan 6903902 WF.COP-(D2Uwm14-D2Uwm13)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 10539188 11957973 1 - by flanking markers 2 10116941 11387756 1 - by flanking markers 2 10246312 11522696 1 - by flanking markers 2 12654100 13840758 1 - by flanking markers RRID:RGD_6903902 A segment of chromosome 2 was transferred from COP into the WF background. 6903904 WF.COP-(D2Uwm17-D2Rat16)/Uwm University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 32051319 43376636 1 - by flanking markers 2 50381686 62691053 1 - by flanking markers 2 31224612 43643900 1 - by flanking markers 2 32373770 43665178 1 - by flanking markers RRID:RGD_6903904 A segment of chromosome 2 was transferred from COP into the WF background. 6903912 SS.SHR-(D9Mco72-D9Rat89)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 72258219 1 - by flanking markers 9 52352690 80172715 1 - by flanking markers 9 52686874 80400631 1 - by flanking markers 9 47902208 74701891 1 - by flanking markers RRID:RGD_6903912 This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903914 SS.SHR-(D9Mco72-D9Rat55)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 69875226 1 - by flanking markers 9 52352690 77741892 1 - by flanking markers 9 52686874 77966876 1 - by flanking markers 9 47902208 47902417 1 - by flanking markers RRID:RGD_6903914 This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903917 SS.SHR-(D9Mco72-D9Mco109)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 44842324 1 - by flanking markers 9 52352690 52352896 1 - by flanking markers 9 52686874 72470724 1 - by flanking markers 9 47902208 67020125 1 - by flanking markers RRID:RGD_6903917 This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903920 SS.SHR-(D9Mco72-D9Uia4)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 59247627 1 - by flanking markers 9 52352690 67265755 1 - by flanking markers 9 52686874 67451944 1 - by flanking markers 9 47902208 62072556 1 - by flanking markers RRID:RGD_6903920 This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903922 SS.SHR-(D9Mco72-D9Mco106)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 44842324 1 - by flanking markers 9 52352690 52352896 1 - by flanking markers 9 52686874 58156770 1 - by flanking markers 9 47902208 53185096 1 - by flanking markers RRID:RGD_6903922 This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903925 SS.SHR-(D9Mco72-D9Mco105)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 44842324 1 - by flanking markers 9 52352690 52352896 1 - by flanking markers 9 52686874 57216771 1 - by flanking markers 9 47902208 52283252 1 - by flanking markers RRID:RGD_6903925 This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903928 SS.SHR-(D9Rat7-D9Got111)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 89249893 1 - by flanking markers 9 83453664 96967940 1 - by flanking markers 9 97276144 97276310 1 - by flanking markers 9 90719946 90720113 1 - by flanking markers RRID:RGD_6903928 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903932 SS.SHR-(D9Rat7-D9Rat52)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 81205197 1 - by flanking markers 9 83453664 87395775 1 - by flanking markers RRID:RGD_6903932 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903934 SS.SHR-(D9Rat7-D9Mco91)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 78634594 1 - by flanking markers 9 83453664 84866878 1 - by flanking markers 9 85112340 85112539 1 - by flanking markers 9 80676321 80676524 1 - by flanking markers RRID:RGD_6903934 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6903936 SS.SHR-(D9Rat7-D9Rat84)/Mco Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 83316504 1 - by flanking markers 9 83453664 91313982 1 - by flanking markers 9 91579562 91579769 1 - by flanking markers 9 85193982 85194188 1 - by flanking markers RRID:RGD_6903936 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 6907047 WF.WKY-(D5Uwm63-D5Uwm60)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 57848236 76159022 1 - by flanking markers 5 61271852 79426001 1 - by flanking markers 5 56733010 75274687 1 - by flanking markers 5 55564549 72943679 1 - by flanking markers RRID:RGD_6907047 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). 6907054 WF.WKY-(D5Uwm67-D5Uwm98)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79919505 79919776 1 - by flanking markers 5 82897463 82897734 1 - by flanking markers 5 78777540 82587133 1 - by flanking markers 5 76369776 80145576 1 - by flanking markers RRID:RGD_6907054 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907057 WF.WKY-(D5Uwm76-D5Uwm61)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 84434303 84434576 1 - by flanking markers 5 87362775 87363048 1 - by flanking markers 5 83268986 83269259 1 - by flanking markers 5 80813116 80813390 1 - by flanking markers RRID:RGD_6907057 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907059 WF.WKY-(D5Uwm76-D5Uwm98)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82586913 82587133 1 - by flanking markers 5 80145359 80145576 1 - by flanking markers RRID:RGD_6907059 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907061 WF.WKY-(D5Uwm67-D5Uwm78)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79919505 79919776 1 - by flanking markers 5 82897463 82897734 1 - by flanking markers 5 78777540 79954846 1 - by flanking markers 5 76369776 77541025 1 - by flanking markers RRID:RGD_6907061 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907063 WF.WKY-(D5Uwm76-D5Got18)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82406661 82406827 1 - by flanking markers 5 85556660 85556825 1 - by flanking markers 5 81457871 81458036 1 - by flanking markers 5 79031392 79031558 1 - by flanking markers RRID:RGD_6907063 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907076 WF.WKY-(D5Uwm78-D5Uwm98)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82406661 82406827 1 - by flanking markers 5 85556660 85556825 1 - by flanking markers 5 79954586 81458036 1 - by flanking markers 5 77540762 79031558 1 - by flanking markers RRID:RGD_6907076 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907078 WF.WKY-(D5Uwm95-D5Uwm98)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82406661 82406827 1 - by flanking markers 5 85556660 85556825 1 - by flanking markers 5 80975875 81458036 1 - by flanking markers 5 78554205 79031558 1 - by flanking markers RRID:RGD_6907078 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907080 WF.WKY-(D5Uwm67-D5Uwm81)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79919505 79919776 1 - by flanking markers 5 82897463 82897734 1 - by flanking markers 5 78777540 80126657 1 - by flanking markers 5 76369776 77714928 1 - by flanking markers RRID:RGD_6907080 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907084 WF.WKY-(D5Uwm76-D5Uwm92)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80451098 80451339 1 - by flanking markers 5 78038840 78039084 1 - by flanking markers RRID:RGD_6907084 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907087 WF.WKY-(D5Uwm78-D5Uwm84)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79954586 80203685 1 - by flanking markers 5 77540762 77791604 1 - by flanking markers RRID:RGD_6907087 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907090 WF.WKY-(D5Uwm78-D5Uwm93)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79954586 80518802 1 - by flanking markers 5 77540762 78102136 1 - by flanking markers RRID:RGD_6907090 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907092 WF.WKY-(D5Uwm88-D5Uwm92)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80401019 80451339 1 - by flanking markers 5 77988604 78039084 1 - by flanking markers RRID:RGD_6907092 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907094 WF.WKY-(D5Uwm87-D5Uwm92)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80372955 80451339 1 - by flanking markers 5 77960535 78039084 1 - by flanking markers RRID:RGD_6907094 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907096 WF.WKY-(D5Uwm85-D5Uwm92)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80229223 80451339 1 - by flanking markers 5 77816155 78039084 1 - by flanking markers RRID:RGD_6907096 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907098 WF.WKY-(D5Uwm82-D5Uwm92)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80154593 80451339 1 - by flanking markers 5 77743239 78039084 1 - by flanking markers RRID:RGD_6907098 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907100 WF.WKY-(D5Uwm82-D5Uwm91)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80154593 80431178 1 - by flanking markers 5 77743239 78018921 1 - by flanking markers RRID:RGD_6907100 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907104 WF.WKY-(D5Uwm77-D5Uwm91)/Uwm University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79935684 80431178 1 - by flanking markers 5 77521860 78018921 1 - by flanking markers RRID:RGD_6907104 A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. 6907436 SS.BN-(D13Hmgc41-D13Hmgc23)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45282442 47299604 1 - by flanking markers 13 54236862 56238470 1 - by flanking markers 13 49168131 51182122 1 - by flanking markers 13 43830075 43830298 1 - by flanking markers RRID:RGD_6907436 These were generated by crossing SS/JrHsdMcwi with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. 6907438 SS.BN-(D13Rat77-D13Rat105)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45592985 63175600 1 - by flanking markers 13 54552997 71047437 1 - by flanking markers 13 49478067 66075827 1 - by flanking markers 13 44139595 60933518 1 - by flanking markers RRID:RGD_6907438 These were generated by crossing SS/JrHsdMcwi with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. 6907445 SS.BN-(D13Rat124-D13Rat101)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46721037 49428577 1 - by flanking markers 13 55662705 58314767 1 - by flanking markers 13 50609228 53264877 1 - by flanking markers 13 45228358 47841255 1 - by flanking markers RRID:RGD_6907445 These were generated by crossing SS/JrHsdMcwi with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. 7204133 LEW-Rag1em1Ztm Zentrales Tierlaboratorium, Medizinische Hochschule Hannover, Germany mutant Unknown Rag1em1Ztm 7204132 3 86780782 86791878 7 3 97866048 97877145 7 3 91212243 91212246 8 3 87922910 87922913 8 RRID:RGD_7204133 This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. 7204136 SD-Rag1em1Ang Institut National de la Sante et de la Recherche Medicale (INSERM) mutant Unknown Rag1em1Ang 7204135 3 86780782 86791878 7 3 97866048 97877145 7 3 91206394 91217491 7 3 87917061 87928158 7 RRID:RGD_7204136 This strain was produced by injecting ZFNs into Sprague-Dawley rat embryos. The resulting mutation is a 5-bp frameshift deletion in the Rag1 gene that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. 7207880 LEW.WKY-(D13Arb15-D13Rat58)/Tja Imperial College, London, UK congenic Unknown 13 71116479 96441728 1 - by flanking markers 13 78673431 103987907 1 - by flanking markers 13 73748382 98985851 1 - by flanking markers 13 68269576 92436175 1 - by flanking markers RRID:RGD_7207880 Segment of interest from chr 13 of WKY/NCrl was introgressed into LEW/SsNHsd 7240510 DA.PVG.1AV1-(D4Rat113-D4Kiru96)/Kiru Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 157006984 157007337 1 - by flanking markers 4 220242234 220242357 1 - by flanking markers 4 153152949 155869653 1 - by flanking markers 4 153826368 156260744 1 - by flanking markers RRID:RGD_7240510 congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini 7240512 DA.PVG.1AV1-(D4Rat113-D4Kiru80)/Kiru Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 157006984 157007337 1 - by flanking markers 4 220242234 220242357 1 - by flanking markers 4 153152949 156629648 1 - by flanking markers 4 153826368 156956242 1 - by flanking markers RRID:RGD_7240512 congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini 7240513 DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 155730927 157145363 1 - by flanking markers 4 156124880 157432020 1 - by flanking markers RRID:RGD_7240513 congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini 7240514 DA.PVG.1AV1-(D4Kiru12-D4Kiru55)/Kiru Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 155929794 156347543 1 - by flanking markers 4 156207922 156684523 1 - by flanking markers RRID:RGD_7240514 Congenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru onto the genetic background of DA/ZtmKini 7240521 DA.PVG.1AV1-(D4Kini3-D4Rat177)/Kini Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden congenic Unknown 4 114073976 114074165 1 - by flanking markers 4 175324865 175325053 1 - by flanking markers 4 110635261 110635449 1 - by flanking markers 4 112478605 112478794 1 - by flanking markers RRID:RGD_7240521 DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain 7240522 DA.PVG.1AV1-(D4Kini3-D4Mgh14)/Kini Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Viral encephalitis (HSE) 4 36592628 36592773 1 - by flanking markers 4 37534124 37534268 1 - by flanking markers 4 28161938 37685319 1 - by flanking markers 4 31021248 39505420 1 - by flanking markers RRID:RGD_7240522 DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain 7241047 LE-Lrrk1em1SageLrrk2em1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-06-06) Lrrk1em1SageLrrk2em1Sage 7241043 7 130105902 130267747 7 7 132531591 132694226 7 7 132857311 133018549 7 7 122826696 122987711 7 RRID:RGD_7241047 This strain was produced by crossing LE-Lrrk1em1Sage with LE-Lrrk2em1Sage 7241048 LE-Park7em1Sage Sigma Advanced Genetic Engineering Labs Sigma Advanced Genetic Engineering Labs mutant Unknown Park7em1Sage 7241042 5 168050149 168061616 7 5 171559202 171582476 7 5 167982438 168004724 7 5 161353718 161376993 7 RRID:RGD_7241048 This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 7241049 LE-Pink1em1Sage-/- Horizon Discovery inotiv mutant Live Animals (as of 2024-11-26) Pink1em1Sage 7241046 5 157091181 157103293 7 5 160425715 160437827 7 5 156677146 156689258 7 5 150530523 150542635 7 RRID:RGD_7241049 ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). 7241050 LE-Lrrk2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-06-06) Lrrk2em1Sage 7241045 7 130105902 130267747 7 7 132531591 132694226 7 7 132857311 133018549 7 7 122826696 122987711 7 RRID:RGD_7241050 This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30. 7241051 LE-Lrrk1em1Sage Horizon Discovery Horizon Discovery mutant Unknown Lrrk1em1Sage 7241044 1 120695657 120836324 7 1 128248473 128372456 7 1 127166866 127301053 7 1 119844360 119972885 7 RRID:RGD_7241051 This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. 7241052 LE-Prknem1Sage-/- Horizon Discovery Horizon Discovery mutant Unknown Prknem1Sage 7241041 1 43151265 44374470 7 1 49684308 50875397 7 1 48880015 50069998 7 1 48688651 49882520 7 RRID:RGD_7241052 ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT). 7241053 LE-Lrrk1em1Sage-/-Lrrk2em1Sage-/- Horizon Discovery Horizon Discovery mutant Unknown Lrrk1em1SageLrrk2em1Sage 7241043 7 130105902 130267747 7 7 132531591 132694226 7 7 132857311 133018549 7 7 122826696 122987711 7 RRID:RGD_7241053 ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous 7241054 LE-Pink1em1Sage Sigma Advanced Genetic Engineering Labs Sigma Advanced Genetic Engineering Labs mutant Unknown Pink1em1Sage 7241046 5 157091181 157103293 7 5 160425715 160437827 7 5 156677146 156689258 7 5 150530523 150542635 7 RRID:RGD_7241054 This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4. 7241055 LE-Park7em1Sage-/- Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-08) Park7em1Sage 7241042 5 168050149 168061616 7 5 171559202 171582476 7 5 167982438 168004724 7 5 161353718 161376993 7 RRID:RGD_7241055 ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA). 7241056 LE-Lrrk2em1Sage-/- Sigma Advanced Genetic Engineering Labs Sigma Advanced Genetic Engineering Labs mutant Live Animals (as of 2018-08-24) Lrrk2em1Sage 7241045 7 130105902 130267747 7 7 132531591 132694226 7 7 132857311 133018549 7 7 122826696 122987711 7 RRID:RGD_7241056 ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offsprings maintained as homozygous 7241057 LE-Lrrk1em1Sage-/- Horizon Discovery Horizon Discovery mutant Unknown Lrrk1em1Sage 7241044 1 120695657 120836324 7 1 128248473 128372456 7 1 127166866 127301053 7 1 119844360 119972885 7 RRID:RGD_7241057 ZFN mutant founders carrying a 19-bp frameshift deletion in exon 4 were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. 7241058 LE-Prknem1Sage Sigma Advanced Genetic Engineering Labs Sigma Advanced Genetic Engineering Labs mutant Unknown Prknem1Sage 7241041 1 43151265 44374470 7 1 49684308 50875397 7 1 48880015 50069998 7 1 48688651 49882520 7 RRID:RGD_7241058 This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4. 7241239 DA.BN-(D9Wox18-D9Rat20)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 18347599 47129300 1 - by flanking markers 9 24554204 54685631 1 - by flanking markers 9 25692373 54978814 1 - by flanking markers 9 22071200 50062324 1 - by flanking markers RRID:RGD_7241239 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241240 DA.BN-(D9Mit6-D9Rat29)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 1526763 22066432 1 - by flanking markers 9 28304251 28304379 1 - by flanking markers 9 29466970 29467098 1 - by flanking markers 9 25661188 25661317 1 - by flanking markers RRID:RGD_7241240 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241241 DA.BN-(D9Mit6-D9Got15)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 1526763 6948180 1 - by flanking markers 9 12615141 12615255 1 - by flanking markers 9 13683965 13684079 1 - by flanking markers 9 11735861 11735976 1 - by flanking markers RRID:RGD_7241241 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241242 DA.BN-(D9Got8-D9Rat139)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 2174611 3811711 1 - by flanking markers 9 2597055 37252772 1 - by flanking markers 9 2657610 3308009 1 - by flanking markers 9 4301731 5859822 1 - by flanking markers RRID:RGD_7241242 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241243 DA.BN-(D9Wox24-D9Rat20)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 9 47129152 47129300 1 - by flanking markers 9 9858502 54685631 1 - by flanking markers 9 10869391 54978814 1 - by flanking markers 9 1024537 50062324 1 - by flanking markers RRID:RGD_7241243 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241244 DA.BN-(D9Wox24-D9Wox18)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 18347599 18347796 1 - by flanking markers 9 9858502 24554401 1 - by flanking markers 9 10869391 25692570 1 - by flanking markers 9 1024537 22071398 1 - by flanking markers RRID:RGD_7241244 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241245 DA.BN-(D9Wox24-D9Rat139)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 2174611 2174738 1 - by flanking markers 9 9858502 37252772 1 - by flanking markers 9 3307883 10869489 1 - by flanking markers 9 1024537 5859822 1 - by flanking markers RRID:RGD_7241245 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241246 DA.BN-(D9Wox24-D9Rat44)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 2948882 2949051 1 - by flanking markers 9 2813697 9858600 1 - by flanking markers 9 2880977 10869489 1 - by flanking markers 9 1024537 5109995 1 - by flanking markers RRID:RGD_7241246 DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241247 LEW.BN-(D9Got8-D9Got22)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 3811425 12324010 1 - by flanking markers 9 2597055 17959093 1 - by flanking markers 9 2657610 19076070 1 - by flanking markers 9 4301731 16665381 1 - by flanking markers RRID:RGD_7241247 LEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241248 LEW.BN-(D9Wox24-D9Got22)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 12323882 12324010 1 - by flanking markers 9 9858502 17959093 1 - by flanking markers 9 10869391 19076070 1 - by flanking markers 9 1024537 16665381 1 - by flanking markers RRID:RGD_7241248 LEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats 7241265 SHR-Chr YWKY/Akr Universityof Akron breeding colonies, The University of Akron, Akron, Ohio consomic Unknown RRID:RGD_7241265 WKY/NHsd males were crosssed with SHR/NHsd females to get F1 animals, the hybrid animals were backcrossed with female SHR/NHsd to transfer the Y chromosome 7241267 WKY-Chr YSHR/Akr University of Akron breeding colonies, The University of Akron, Akron, Ohio consomic Unknown RRID:RGD_7241267 SHR/NHsd males were crosssed with WKY/NHsd females to get F1 animals, the hybrid animals were backcrossed with female WKY/NHsd to transfer the Y chromosome 7241271 SHR.BN-(D10Mit4-D10Wox11)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 10 36649906 53793117 1 - by flanking markers 10 36354729 53388667 1 - by flanking markers 10 36584373 53637634 1 - by flanking markers 10 35392267 51786432 1 - by flanking markers RRID:RGD_7241271 Segment of chromosome 10 from BN.Lx/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic 7241594 (SDxF344)F1-Rbm20m1Mlgw University of Wisconsin, Madison mutant Cryopreserved Sperm (as of 2017-01-25) Rbm20m1Mlgw 7241593 1 259905545 260144190 7 1 281783646 282003053 7 1 274391932 274589816 7 1 252683760 252907465 7 RRID:RGD_7241594 This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. 7241595 (SDxF344)F1xBN-Rbm20m1Mlgw+/+ University of Wisconsin, Madison mutant Cryopreserved Sperm Rbm20m1Mlgw 7241593 1 259905545 260144190 7 1 281783646 282003053 7 1 274391932 274589816 7 1 252683760 252907465 7 RRID:RGD_7241595 Heterozygous offspring were intercrossed and maintained as wild type 7241596 (SDxF344)F1-Rbm20m1Mlgw+/+ University of Wisconsin, Madison mutant Cryopreserved Sperm Rbm20m1Mlgw 7241593 1 259905545 260144190 7 1 281783646 282003053 7 1 274391932 274589816 7 1 252683760 252907465 7 RRID:RGD_7241596 Heterozygous offsprings were intercrossed and maintained as wild type 7241597 (SDxF344)F1xBN-Rbm20m1Mlgw University of Wisconsin, Madison mutant Cryopreserved Sperm (as of 2017-01-25) Rbm20m1Mlgw 7241593 1 259905545 260144190 7 1 281783646 282003053 7 1 274391932 274589816 7 1 252683760 252907465 7 RRID:RGD_7241597 This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. 7241794 SHR/Bbb Max-Delbruck Center for Molecular Medicine, Germany inbred Unknown RRID:RGD_7241794 This SHR colony is maintained at Max-Delbruck Center for Molecular Medicine, Germany 7241811 BBDP.WF-(D8Rat73-D8Sunn1467)(D13Rat124-D13Mgh5)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown RRID:RGD_7241811 a double congenic strain which has more than 38.74 Mb of chr 8 and more than 16.78 Mb of chr 13 of Wistar Furth introgressed into the gentic background of BBDP/WorSunn 7243955 DA.F344-(D4Got44-D4Arb21)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 63884916 104416123 1 - by flanking markers 4 63125453 163844250 1 - by flanking markers 4 63411811 99067102 1 - by flanking markers 4 65117277 103194936 1 - by flanking markers RRID:RGD_7243955 Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity 7243960 DA.F344-(D4Got44-D4Rat128)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 63884916 79190364 1 - by flanking markers 4 63125453 145335458 1 - by flanking markers 4 63411811 80666496 1 - by flanking markers 4 65117277 79987019 1 - by flanking markers RRID:RGD_7243960 Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity 7243963 DA.F344-(D4Uia2-D4Wox21)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 68131191 78039646 1 - by flanking markers 4 133170446 144249459 1 - by flanking markers 4 68379412 79575667 1 - by flanking markers 4 69364375 78882954 1 - by flanking markers RRID:RGD_7243963 Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity 7243965 DA.F344-(D4Arb21-D4Arb4)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 104415843 154937227 1 - by flanking markers 4 163843971 216606455 1 - by flanking markers 4 99066823 150682594 1 - by flanking markers 4 103194656 151805662 1 - by flanking markers RRID:RGD_7243965 Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity 7243966 DA.F344-(D4Arb5-D4Arb4)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 120436701 154937227 1 - by flanking markers 4 182615641 216606455 1 - by flanking markers 4 118044851 150682594 1 - by flanking markers 4 118699819 151805662 1 - by flanking markers RRID:RGD_7243966 Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity 7244374 FXLE/Stm Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan recombinant_inbred Unknown RRID:RGD_7244374 Recombinant inbred strain derived from Le/Stm (from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/DuCrlj (from Charles River Japan) and then maintained by brother-sister mating. 7244380 DA.F344(Cia3c)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown RRID:RGD_7244380 Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity 7244381 DA.F344(Cia3e)/Arb The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown RRID:RGD_7244381 Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity 7245481 SD-Tg(hsMt-LacZ)Reh Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05) RRID:RRRC_00540 presses LacZ under the transcriptional control of the mouse metallothionein regulatory sequences. Transgene expression in germ cells is constitutive; expression of the transgene can be induced in liver by zinc or cadmium. 7245482 SD-Tg((ROSA)26-EGFP)RehRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05) RRID:RRRC_00541 Strain carries a 1.8kb transgene consisting of the mouse ROSA26 regulatory sequences driving EGFP. FISH was used to localize the transgene insertion to Chromosome 11q11-q12, proximal to Grik1 and near Ncam2. The transgene is expressed exclusively in male and female germ cells throughtout development. 7245488 SD-Tg(Chat-tTA) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) RRID:RRRC_00632 Rats express a mouse tetracycline-controlled transactivator (tTA) driven by the mouse choline acetyltransferase (Chat) promotor. When mated to a second transgenic strain (RRRC:00633) that carries a target gene (TDP43) under the regulation of a tetracycline response element (TRE), the expression of TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline. 7245494 SD-Tg(TRE-TARDBP-M337V) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) TARDBP 1322081 RRID:RRRC_00633 Strain carries a transgene expressing human TDP43 with the M337V mutation under control of a tTA-dependent promoter (TRE). When mated to a second transgenic strain (RRRC:632) that carries a tetracycline-controlled transactivator driven by the mouse choline acetyltransferase (Chat) promoter, the expression of mutant TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline. 7245521 SD-Tg(Th-SNCA*)3Ins Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00634 the transgene overexpressing double-mutated human alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines. The MA3 line has pre-symptomatic olfactory deficits (beginning at 6 months of age) and motor deficits starting at a later age (19 months of age). 7245523 SD-Tg(Th-SNCA*)4Ins Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00635 the transgene overexpressing duble-mutated human alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines. This line, MA4, shows learning and memory deficits beginning at 9 months of age. It is a model for dementia with Lewy bodies. 7245527 WKHA/Edh Rat Resource and Research Center Rat Resource and Research Center inbred Unknown RRID:RRRC_00663 derived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressure 7245556 WKHT/Edh Rat Resource and Research Center Rat Resource and Research Center inbred Unknown RRID:RRRC_00664 WKHT rats are derived from a cross between SHR and WKY. Brother/sister inbreeding of the hybrids and successive generations was performed, selecting for the hypertension, but not the behavioral hyperactivity, of the SHR. 7246924 HanTacFcfiq:WH Wistar Hannover Universidade de Sao Paulo outbred Unknown RRID:RGD_7246924 Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating. 7246927 NTacFcfiq:SD Sprague Dawley Universidade de Sao Paulo outbred Unknown RRID:RGD_7246927 Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating. 7246928 NTac:NIH-Foxn1rnu nude Taconic outbred Unknown RRID:RGD_7246928 The NIH nude Spontaneous mutant model was developed by NIH in 1979-1980 by intercrossing eight strains of rats. Taconic received stock from NIH Animal Genetic Resource in 1981. The rats were derived by hysterectomy in 1987 and again in 1998. Animals are randomly bred at Taconic without selection for coat color or pigmentation. 7246929 NTacFcfiq:NIH-Foxn1rnu nude Universidade de Sao Paulo Universidade de Sao Paulo outbred Unknown RRID:RGD_7246929 Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating between homozygous male x heterozygous female. 7247278 SD-Tg(Camk2a-tTA)Xgx Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) RRID:RRRC_00655 Camk2a-tTA transgenic rats expressing tTA under regulatory control of the forebrain promotor Camk2a. Transgene expression can be blocked by administration of doxycycline to drinking water. 7247279 SD-Tg(TRE-FUS-R521C)Xgx Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) FUS 1318882 RRID:RRRC_00656 Overexpression of R521C mutant form of human FUS (Fused in Sarcoma) transgene is under regulatory control of tetracycline-responsive promoter element. 7247280 SD-Tg(TRE-LacZ)Xgx Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) RRID:RRRC_00657 LacZ gene was assembled downstream of the TRE (tetracycline-responsive promoter elements) promoter, allowing inducible gene expression. 7247286 F344-Tg(APP)21Besey Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) APP 736021 RRID:RRRC_00636 F344/NHsd embryos were microinjected with a DNA construct containing human beta amyloid precursor protein (APP), Swedish (Swe) double mutation (K670N-M671L) and Indiana (Ind) single autosomal dominant mutation (V642F). The transgene is driven by an ubiquitin-C promoter. Homozygous transgenic rats exhibit approximately 2.9-fold more expression of APP mRNA than wild-type rats. 7247289 SD-Tg(TETRA-EGFP)Besey Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) RRID:RRRC_00650 SD embryos were microinjected with a DNA construct containing the GFP gene downstream of a miniCMV promoter under the control of tetracycline response element (TRE). The pLV-Tet-GFP was generated by co-transfection of pLV-Tet-GFP, pΔ8.9 and pVSV-G into a 293FT packaging cell line 7247290 SD-Tg(Ubc-P2ry2)Besey Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-08-22) P2ry2 62088 RRID:RRRC_00627 SD embryos were microinjected with a lentiviral construct containing the rat P2ry2 gene (G protein-coupled purinergic receptor P2Y2) under control of an ubiquitin-C promoter. Results in over-expression of P2ry2 mRNA. 7247594 WKY.SHR-(D1Rat90-D1Mit18)/Iwai Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 224426266 267111153 1 - by flanking markers 1 246118980 289137268 1 - by flanking markers 1 238830408 281795785 1 - by flanking markers 1 218753689 259647894 1 - by flanking markers RRID:RGD_7247594 Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY 7248453 SS.BN-(D12Hmgc3-AU047911)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 15420627 15420833 1 - by flanking markers 12 17102817 19021770 1 - by flanking markers 12 15085585 17031347 1 - by flanking markers 12 13008296 14942487 1 - by flanking markers RRID:RGD_7248453 Subcongenic strain generated by backcrossing SS-Chr 12BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi to SS-Chr 12BN/Mcwi, intercrossing the F1 generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12BN/Mcwi and bred to homozygosity. 7248454 SS.BN-(D12Hmgc7-D12Hmgc6)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 24299715 24300160 1 - by flanking markers 12 22283062 22283507 1 - by flanking markers 12 19212614 19212979 1 - by flanking markers RRID:RGD_7248454 Subcongenic strain generated by backcrossing SS-Chr 12BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi to SS-Chr 12BN/Mcwi, intercrossing the F1 generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12BN/Mcwi and bred to homozygosity. 7248456 SS.BN-(D12Hmgc3-D12Got29)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 14395317 14395596 1 - by flanking markers 12 17102817 18009770 1 - by flanking markers 12 15085585 16012213 1 - by flanking markers 12 13008296 13925040 1 - by flanking markers RRID:RGD_7248456 Subcongenic strain generated by backcrossing SS-Chr 12BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi to SS-Chr 12BN/Mcwi, intercrossing the F1 generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12BN/Mcwi and bred to homozygosity. 7248716 NAK/Nokh Nodai aphakia Faculty of Bioindustry, Tokyo University of Agriculture in Japan inbred Live Animals RRID:RGD_7248716 This is an inbred anophthalmic rat strain derived from a Sprague-Dawley (SD) colony and designated it as Nodai aphakia (NAK) by Dr.Ryoichi Hashizume in Tokyo University of Agriculture. The NAK rats have decreased body size than wild-type rats and do not have both eyes. 7248725 ACI.BN-(D7Rat164-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7 65287247 65287381 1 - by flanking markers RRID:RGD_7248725 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248727 ACI.BN-(D7Rat164-D7Uwm30)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7 65287247 65287381 1 - by flanking markers RRID:RGD_7248727 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248729 ACI.BN-(D7Rat206-D7Uwm30)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 75357125 75357349 1 - by flanking markers 7 78786126 78786349 1 - by flanking markers 7 78758303 78758526 1 - by flanking markers 7 70840118 70840342 1 - by flanking markers RRID:RGD_7248729 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248731 ACI.BN-(D7Rat164-D7Uwm31)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7 65287247 65287381 1 - by flanking markers RRID:RGD_7248731 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248733 ACI.BN-(D7Rat164-D7Uwm33)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7 65287247 65287381 1 - by flanking markers RRID:RGD_7248733 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248736 ACI.BN-(D7Uwm32-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer RRID:RGD_7248736 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248738 ACI.BN-(D7Uwm36-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer RRID:RGD_7248738 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248740 ACI.BN-(D7Uwm38-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer RRID:RGD_7248740 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248742 ACI.BN-(D7Uwm33-D7Mit27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 7 98955068 98955278 1 - by flanking markers 7 103159379 103159589 1 - by flanking markers 7 102588240 102588450 1 - by flanking markers 7 93595631 93595843 1 - by flanking markers RRID:RGD_7248742 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248744 ACI.BN-(D7Uwm33-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer RRID:RGD_7248744 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248746 ACI.BN-(D7Uwm41-D7Mit16)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 7 113886156 113886318 1 - by flanking markers RRID:RGD_7248746 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7248748 ACI.BN-(D7Uwm28-D7Mit16)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 7 113886156 113886318 1 - by flanking markers RRID:RGD_7248748 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7257663 WI-Tlr4em1Geh University of Pittsburgh Rat Resource and Research Center mutant Unknown alcohol action, immune system function, septic shock Tlr4em1Geh 7257661 5 83564100 83577735 7 5 86690670 86704302 7 5 82587737 82587749 8 5 80146180 80146192 8 RRID:RRRC_00694 This strain was produced by TALEN mediated 13 bp deletion in Exon 1 in the rat Tlr4 gene; background strain is Crl:WI 7257722 WKY.SHR-(D1Mgh14-D1Rat77)/Iwai Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 238037373 263699089 1 - by flanking markers 1 259703519 285604895 1 - by flanking markers 1 252479838 278228889 1 - by flanking markers 1 231688927 256448636 1 - by flanking markers RRID:RGD_7257722 Fragment of the chromosome 1 derived from SHR/NCrlj and repeated backcross to WKY/NCrlCrlj 7349321 LEXF2D/Stm Saitama Cancer Center Research Institute, Saitama, Japan recombinant_inbred Unknown RRID:RGD_7349321 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 7349322 LEXF8B/Stm Saitama Cancer Center Research Institute, Saitama, Japan recombinant_inbred Unknown RRID:RGD_7349322 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 7349357 DA.PVG.1AV1-(D4Got128-D4Got136) Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 159334251 160528447 1 - by flanking markers 4 222712454 223964695 1 - by flanking markers 4 155691688 156945571 1 - by flanking markers 4 156085418 157232313 1 - by flanking markers RRID:RGD_7349357 Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. 7364879 SS-Apoeem9Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Apoeem9Mcwi 7364878 1 79003634 79006387 7 1 81878372 81882298 7 1 80614112 80614212 8 1 79353924 79357852 7 RRID:RGD_7364879 This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 7364880 SS-Cst3em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cst3em1Mcwi 5687708 3 137650903 137654776 7 3 149628692 149632565 7 3 143223300 143223317 8 3 136336923 136340796 7 RRID:RGD_7364880 This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1. 7364881 SS-Slc7a9em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a9em1Mcwi 5687700 1 87976440 87999102 7 1 92836837 92865759 7 1 91709034 91738492 7 1 88109517 88132653 7 RRID:RGD_7364881 This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6. 7364882 SS-Sorcs2em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs2em1Mcwi 5508343 14 79968072 80344330 7 14 79176694 79547823 7 14 79538911 79912333 7 14 74711197 74711230 8 RRID:RGD_7364882 This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15. 7364902 SS-Chr 2BN/1McwiAek Rat Resource and Research Center Rat Resource and Research Center consomic Cryopreserved Embryo (as of 2019-02-19) Studies of ischemia reperfusion injury or hypertension RRID:RRRC_00683 Compared to the current SS-Chr 2BN/Mcwi colony at the Medical College of Wisconsin (where this strain originated) it is a more complete consomic strain (a smaller piece of distal Chromosome 2 is of the SS genotype compared to the SS-Chr 2BN/Mcwi strain). 7364919 SS.BN-(rs64114288-rs107464428)/Aek Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) cardiac ischemia 2 4124871 233798506 1 - by flanking markers 2 6796723 217906389 1 - by flanking markers RRID:RRRC_00686 This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2BN/Mcwi from the top to ~227 Mb transferred to the SS/JrHsdMcwi strain background. 7364923 SS.BN-(rs106982173-rs65057186)/Aek Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) cardiac ischemia 2 95571004 225944289 1 - by flanking markers 2 93353642 210463377 1 - by flanking markers RRID:RRRC_00685 This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2BN/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background. 7364927 SS.BN-(rs13453786-rs66377062)/Aek Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) cardiac ischemia 2 231460803 255813030 1 - by flanking markers 2 215613858 239562817 1 - by flanking markers RRID:RRRC_00684 This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2BN/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background. 7364932 ACI.BN-(D7Rat42-D7Uwm33)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 88132195 88132315 1 - by flanking markers 6 20168871 116858395 1 - by flanking markers 6 10173862 108696915 1 - by flanking markers 7 83153392 90677661 1 - by flanking markers RRID:RGD_7364932 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7364934 ACI.BN-(rs199006987-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 101422284 101422284 1 - by flanking markers 7 92755814 92755814 1 - by flanking markers RRID:RGD_7364934 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7364936 ACI.BN-(D7Arb15-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 96648929 96649150 1 - by flanking markers 7 100740218 100740438 1 - by flanking markers 7 100160221 100160441 1 - by flanking markers 7 91412389 91412612 1 - by flanking markers RRID:RGD_7364936 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 7364938 (LE x RCS-p+/LavRrrc)F1 Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) Retinal Research Mertk 69283 RRID:RRRC_00662 RCS-p+/LavRrrc males were mated to LE females. 7364940 F344-Tp53tm1(EGFP-Pac)Qly/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown tumorigenesis model RRID:RRRC_00661 Backcrossed STOCK-Tp53tm1(EGFP-Pac)QlyRrrc with F344 using speed congenic approach to move mutation onto F344 genetic background. 7364954 DA.ACI-(D2Mit12-D2Got121)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 174730375 193841840 1 - by flanking markers 2 201404917 220662282 1 - by flanking markers 2 181990297 201193787 1 - by flanking markers 2 168358098 186483643 1 - by flanking markers RRID:RRRC_00668 Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 7 times then brother-sister mating to maintain in the homozygous state 7364956 DA.ACI-(D2Wox20-D2Mit14)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 181213221 197256313 1 - by flanking markers 2 207864396 224018437 1 - by flanking markers 2 188448030 204585731 1 - by flanking markers 2 174541858 189599348 1 - by flanking markers RRID:RRRC_00669 Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 10 times then brother-sister mating to maintain in the homozygous state 7364959 DA.ACI-(D2Uwm24-D2Rat54)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 198168347 210012267 1 - by flanking markers 2 224860752 234970326 1 - by flanking markers 2 205430606 216878775 1 - by flanking markers 2 190460423 201836059 1 - by flanking markers RRID:RRRC_00670 Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 8 times then brother-sister mating to maintain in the homozygous state 7364970 DA.ACI-(D12Mit2-D12Got49)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 12 20932559 24257553 1 - by flanking markers 12 24662983 28081151 1 - by flanking markers 12 22650702 26079250 1 - by flanking markers 12 19610870 23060532 1 - by flanking markers RRID:RRRC_00671 Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 12 times then brother-sister mating to maintain in the homozygous state 7364974 DA.F344-(D10Rat195-D10Rat92)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 10 63690620 78170722 1 - by flanking markers 10 66394066 77132664 1 - by flanking markers 10 65234285 77269936 1 - by flanking markers 10 62541890 74586024 1 - by flanking markers RRID:RRRC_00676 Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state 7364976 DA.F344-(D10Rat195-D10Arb27)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 10 63690620 69160517 1 - by flanking markers 10 66394066 67971488 1 - by flanking markers 10 65234285 68305173 1 - by flanking markers 10 62541890 65927370 1 - by flanking markers RRID:RRRC_00677 Congenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state 7364978 DA.F344-(D10Arb27-D10Rat92)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 10 69160380 78170722 1 - by flanking markers 10 67971352 77132664 1 - by flanking markers 10 68305037 77269936 1 - by flanking markers 10 65927233 74586024 1 - by flanking markers RRID:RRRC_00678 Congenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state 7364981 DA.F344-(D7Rat22-D7Rat15)/Nsi The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 7 76615341 107428439 1 - by flanking markers 7 110975825 110975995 1 - by flanking markers 7 111043360 111043530 1 - by flanking markers 7 101772987 101773158 1 - by flanking markers RRID:RRRC_00680 Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 11 times then brother-sister mating to maintain in the homozygous state 7364991 ACI/EurMcwi ACI (August × Copenhagen Irish) RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu Rat Resource & Research Center, RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-08-06) Renal disease RRID:RRRC_00284 substrain of ACI derived from ACI/Eur 7365040 SS.SR-(rs65785750-rs13452155)/Opaz Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2021-05-07) 5 105452223 136738047 1 - by flanking markers 5 101612333 131443083 1 - by flanking markers RRID:RGD_7365040 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains 7365043 SS.SR-(rs65785750-rs106808193)/Opaz Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 5 105452223 140120264 1 - by flanking markers 5 101612333 134724733 1 - by flanking markers RRID:RGD_7365043 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains 7394698 ZUC.BN-(D1Rat42-D1Rat90)/Ste University of California Davis, Davis, CA congenic Unknown 1 135418152 267111153 1 - by flanking markers 1 142342107 289137268 1 - by flanking markers 1 141381406 281795785 1 - by flanking markers 1 133587283 259647894 1 - by flanking markers RRID:RGD_7394698 homozygous lean wild-type ZUC-Lepr+Ste were crossed with BN/Crl to get F1; these were backcrossed to lean ZUC males; congenics were selected by genotyping with markers 7394818 P.NP-(D4Mgh16-D4Rat173)/Iusm Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown 4 61646674 92716873 1 - by flanking markers 4 61427427 158932336 1 - by flanking markers 4 61708103 94143659 1 - by flanking markers 4 62933269 92489678 1 - by flanking markers RRID:RGD_7394818 P.NP-(D4Rat119-D4Rat55)/Iusm and iP rats were crossed to get F1 animals which were further backcrossed to iP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection 7394821 P.NP-(Snca-D4Rat35)/Iusm Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown Snca 3729 4 89613731 91336908 1 - by flanking markers 4 155592411 157297332 1 - by flanking markers 4 90782412 92490285 1 - by flanking markers 4 89696420 91366774 1 - by flanking markers RRID:RGD_7394821 P.NP-(D4Rat119-D4Rat55)/Iusm and iP rats were crossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection 7401201 SS.SR-(D17Rat24-rs106534785)/Opaz Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 17 57724628 57727194 1 - by flanking markers 17 50489557 50489725 1 - by flanking markers 17 52424553 63306062 1 - by flanking markers 17 49567911 61149946 1 - by flanking markers RRID:RRRC_00615 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains 7401203 SS.SR-(rs105019230-D17Rat44)/Opaz Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenic Cryopreserved Sperm (as of 2021-05-07) 17 81612361 81612488 1 - by flanking markers 17 75653544 75653670 1 - by flanking markers 17 57343133 73981731 1 - by flanking markers 17 54542464 70156904 1 - by flanking markers RRID:RRRC_00616 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. Rat Resource and Research Center 7401261 LOU/NimrOlaHsd Louvain Envigo inbred Cryorecovery (as of 2023-12-14) RRID:RGD_7401261 LOU/C was selected for high immunocytoma incidence; to National Institute of Medical Research, Mill Hill; in 1985 from Nimr to Harlan 7411634 WDB/Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN inbred Unknown RRID:RGD_7411634 Crlj:WI females were bred to DA/Slc males to generate F1 pups which were bred by brother-sister mating; only black (non-agouti) pups were picked for breeding. (The genotype of the pups was checked by backcrossing to BN (for BB or Bb) and Hooded strains (for HH or Hh) genotype.) When the aaBBCCHH genotype of F2 was confirmed then the strain was maintained by brother-sister mating. 7411676 SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 3 6373335 149496698 1 - by flanking markers 3 11361699 160347840 1 - by flanking markers 3 6000748 155263151 1 - by flanking markers 3 10778704 147415807 1 - by flanking markers RRID:RGD_7411676 Congenic strain created by speed congenic strategy where the desired region from Chromosome 3 of WKY/Gcrc was introgressed into the SHRSP/Gcrc background. 7411679 SHRSP.WKY-(D2Rat13-D2Rat157)(D3Mgh16-D3Rat114)/Gcrc University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown RRID:RGD_7411679 F1 rats generated by crossing SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc and SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc were backcrossed to SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc; heterozygous animals for chr 3 fragment were crossed with homozygous animals for chr 2; animals that were homozygous for both fragments were intercrossed to get the desired bicongenic strain 7411703 SHRSP.SHR-(D1Rat93-D1Rat269)(D18Rat73-D18Rat11)/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1;18 63990899;52290789 126292805;71692408 1 - by flanking markers;1 - by flanking markers 18;1 50804228;63244295 69942605;133485967 1 - by flanking markers;1 - by flanking markers 18;1 51609032;64252881 70803264;132448306 1 - by flanking markers;1 - by flanking markers 18;1 49999958;65677942 68414117;124977364 1 - by flanking markers;1 - by flanking markers RRID:RGD_7411703 constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments 7411705 SHR.SHRSP-(D1Rat93-D1Rat269)(D18Rat73-D18Rat11)/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 1;18 63990899;52290789 126292805;71692408 1 - by flanking markers;1 - by flanking markers 18;1 50804228;63244295 69942605;133485967 1 - by flanking markers;1 - by flanking markers 18;1 51609032;64252881 70803264;132448306 1 - by flanking markers;1 - by flanking markers 18;1 49999958;65677942 68414117;124977364 1 - by flanking markers;1 - by flanking markers RRID:RGD_7411705 constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments 7411707 SHRSP.SHR-(D1Mgh5-D1Got87)/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 78134304 85828306 1 - by flanking markers 1 80946174 92291485 1 - by flanking markers 1 79689548 91156803 1 - by flanking markers 1 78430536 86030749 1 - by flanking markers RRID:RGD_7411707 male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm 7411709 SHRSP.SHR-(D1Mit30-D1Rat269)/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 94473940 126292805 1 - by flanking markers 1 101048742 133485967 1 - by flanking markers 1 99983293 132448306 1 - by flanking markers 1 94494440 124977364 1 - by flanking markers RRID:RGD_7411709 male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm 7421599 SS.LEW-(D1Chm64-D1Rat19)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 1 43872710 43872827 1 - by flanking markers 1 50173150 50173266 1 - by flanking markers 1 49578577 49578693 1 - by flanking markers 1 49393172 49393289 1 - by flanking markers RRID:RGD_7421599 A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421603 SS.LEW-(D1Rat320-D1Mgh32)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 1 119536684 247882384 1 - by flanking markers 1 126980427 269885827 1 - by flanking markers 1 125875758 262433692 1 - by flanking markers 1 118608292 241799120 1 - by flanking markers RRID:RGD_7421603 A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421606 SS.LEW-(D1Uia4-D1Rat320)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 1 64343599 119536913 1 - by flanking markers 1 63580258 126980655 1 - by flanking markers 1 64588516 125875986 1 - by flanking markers 16;9;1;5 58114204;17435338;66023617;146042096 58114246;17435380;118608521;146042138 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_7421606 A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421610 SS.LEW-(D5Mit5-D5M4Mit14)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 5 109163281 109163425 1 - by flanking markers 5 112057862 112058005 1 - by flanking markers 5 108092659 108092802 1 - by flanking markers 5 104250862 104251008 1 - by flanking markers RRID:RGD_7421610 A segment of chromosome 5 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421612 SS.LEW-(D16Chm48-D16Chm60)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 16 2116303 3165043 1 - by flanking markers 16 2471921 3491557 1 - by flanking markers 16 3524957 3525217 1 - by flanking markers 16 3080416 3080679 1 - by flanking markers RRID:RGD_7421612 A segment of chromosome 16 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421617 SS.LEW-(D17Chm14-D17Rat65)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 17 80181988 93930006 1 - by flanking markers 17 74265283 88435496 1 - by flanking markers 17 72580584 86731080 1 - by flanking markers 17 68783937 82479847 1 - by flanking markers RRID:RGD_7421617 A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421619 SS.LEW-(D17Chm85-D17Chm71)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_7421619 A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421621 SS.LEW-(D17Chm131-D17Chm93)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_7421621 A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421623 SS.LEW-(D17Rat84-D17Chm17)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 17 29603712 29604237 1 - by flanking markers 17 23473207 23473342 1 - by flanking markers 17 21490950 21491085 1 - by flanking markers 17 23653184 23653323 1 - by flanking markers RRID:RGD_7421623 A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421634 SS.MNS-(D2Got93-D2Rat222)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 140672373 145318823 1 - by flanking markers 2 160649967 164927046 1 - by flanking markers 2 140958240 145514793 1 - by flanking markers 2 135818873 140253961 1 - by flanking markers RRID:RGD_7421634 A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421636 SS.MNS-(D2Chm90-D2Rat38)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 147424195 155102371 1 - by flanking markers 2 167706439 175354471 1 - by flanking markers 2 148295267 155965721 1 - by flanking markers 2 142323368 149559726 1 - by flanking markers RRID:RGD_7421636 A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421638 SS.MNS-(D2Chm381-D2Chm225)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 156267173 156267340 1 - by flanking markers 2 177626917 177627084 1 - by flanking markers 2 158268536 158268703 1 - by flanking markers 2 150649899 150650069 1 - by flanking markers RRID:RGD_7421638 A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421640 SS.MNS-(D2Rat155-D2Chm161)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 179581946 179582150 1 - by flanking markers 2 206293779 206293982 1 - by flanking markers 2 186889035 186889238 1 - by flanking markers 2 172982062 172982266 1 - by flanking markers RRID:RGD_7421640 Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421643 SS.MNS-(D2Chm254-D2Chm161)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_7421643 Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421645 SS.MNS-(D2Rat155-D2Chm419)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 179581946 179582150 1 - by flanking markers 2 206293779 206293982 1 - by flanking markers 2 186889035 186889238 1 - by flanking markers 2 172982062 172982266 1 - by flanking markers RRID:RGD_7421645 Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421647 SS.MNS-(D2Chm161-D2Chm410)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_7421647 Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421649 SS.MNS-(D2Chm153-D2Chm410)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_7421649 Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421651 SS.MNS-(D2Chm442-D2Chm410)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_7421651 Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7421654 SS.MNS-(D2Chm366-D2Rat52)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 200866667 200866813 1 - by flanking markers 2 227502003 227502148 1 - by flanking markers 2 208081050 208081195 1 - by flanking markers 2 193094852 193094998 1 - by flanking markers RRID:RGD_7421654 Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 7771589 SS.SR-(D2Rat352-rs63922710)/Opaz Boston University School of Medicine, Boston, Massachusetts Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 2 173606885 173607092 1 - by flanking markers 2 200318348 200318555 1 - by flanking markers 2 180909971 203646445 1 - by flanking markers 2 167282560 188690312 1 - by flanking markers RRID:RRRC_00610 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains 7771600 SS.SR-(rs106870553-rs63922710)/Opaz Boston University School of Medicine, Boston, Massachusetts Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 2 183864092 203646445 1 - by flanking markers 2 170201741 188690312 1 - by flanking markers RRID:RRRC_00611 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains 7771610 SHRSP-Chr 1F344/Rkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown RRID:RGD_7771610 SHRSP/Bbb male was crossed with female F344/Crl to get F1 animals which in turn were backcrossed with female SHRSP, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing 7777135 SS.LEW-(D5Mco39-D5Mco57)/1Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_7777135 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7777138 SS.LEW-(D5Mco41-D5Mco47)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 116151523 122679716 1 - by flanking markers 5 112175328 117913688 1 - by flanking markers RRID:RGD_7777138 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7777140 SS.LEW-(D5Mco39-D5Mco57)(D5Mco41-D5Mco47)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_7777140 male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco57)/1Mco and SS.LEW-(D5Mco41-D5Mco47)/Mco were randomly selected and intercrossed to get F1; the heterozygous animals for the desired region were intercrossed to get the bicongenics 7777143 SS.LEW-(D5Mco39-D5Mco57)/2Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_7777143 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7777180 SS.LEW-(D5Mco42-D5Mco47)/1Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 116151523 120258299 1 - by flanking markers 5 112175328 116047316 1 - by flanking markers RRID:RGD_7777180 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7794691 SS.LEW-(D5Mco39-D5Mco57)(D5Mco42-D5Mco47)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_7794691 male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco57)/2Mco and SS.LEW-(D5Mco42-D5Mco47)/1Mco were randomly selected and intercrossed to get F1; the heterozygous animals for the desired region were intercrossed to get the bicongenics 7794694 SS.LEW-(D5Mco39-D5Mco57)/3Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_7794694 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7794696 SS.LEW-(D5Mco43-D5Mco47)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 116151523 116151740 1 - by flanking markers 5 112175328 112175546 1 - by flanking markers RRID:RGD_7794696 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7794698 SS.LEW-(D5Mco39-D5Mco57)(D5Mco43-D5Mco47)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_7794698 male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco57)/3Mco and SS.LEW-(D5Mco413-D5Mco47)/Mco were randomly selected and intercrossed to get F1; the heterozygous animals for the desired region were intercrossed to get the bicongenics 7794700 SS.LEW-(D5Mco39-D5Mco41)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 122679504 122679716 1 - by flanking markers 5 117913475 117913688 1 - by flanking markers RRID:RGD_7794700 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7794704 SS.LEW-(D5Mco42-D5Mco47)/2Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 116151523 120258299 1 - by flanking markers 5 112175328 116047316 1 - by flanking markers RRID:RGD_7794704 SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain 7794706 SS.LEW-(D5Mco39-D5Mco41)(D5Mco42-D5Mco47)/Mco Medical College of Ohio, Toledo, Ohio, USA congenic Unknown RRID:RGD_7794706 male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco41)/Mco and SS.LEW-(D5Mco42-D5Mco47)/2Mco were randomly selected and intercrossed to get F1; the heterozygous animals for the desired region were intercrossed to get the bicongenics 7800659 F344.Cg-Du, TyrC/Kyo downunder rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-10) Development RRID:RGD_7800659 Developed by the DEPOSITOR 7800661 F344.Cg-Du, TyrCKyo+/+ downunder rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown RRID:RGD_7800661 Developed by the DEPOSITOR 7800667 F344.Cg-Foxn1rnuKyo-/+ National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Immunology; Cancer Foxn1 3970 RRID:RGD_7800667 Jic N13 to Kyo (1988) 7800671 F344-Sv2am1Kyo Graduate School of Medicine, Kyoto University National BioResource Project for the Rat in Japan mutant Unknown Sv2a|Sv2am1Kyo 619715|12792962 2 190989187 191000859 7 2 217808165 217823872 7 2 198325507 198325507 8 2 183745872 183745872 8 RRID:RGD_7800671 Established by ENU mutagenesis. A missense mutation (L174Q) mutation in Sv2a: synaptic vesicle glycoprotein 2a, was identified. 7800673 KFRS2/Kyo-/+ KFRS2-/+ National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Ophthalmology; Dermatology Tyr|TyrsiaKyo 1589755|13207345 1 143641257 143746315 7 1 157322968 157416594 7 1 151012598 151106802 7 1 141115036 141210207 7 RRID:RGD_7800673 A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. 7800676 KFRS3A/Kyo+/+ National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown RRID:RGD_7800676 A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding. 7800692 MKO/Tami Minko Rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo RRID:RGD_7800692 MKO rat is derived from Wistar male rat which exhibited large-size and abnormal lipid metabolism. 7800694 NER.F344-(D1Rat132)(D5Rat100)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown RRID:RGD_7800694 Developed by the DEPOSITOR 7800702 KHR/Kyo-/- kaken hairless rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dermatology Oca2 2318412 1 115683593 115991040 7 1 114661970 114987433 7 1 107116278 107446093 7 RRID:RGD_7800702 Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). 7800705 KHR/Kyo-/+ kaken hairless rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dermatology Oca2 2318412 1 115683593 115991040 7 1 114661970 114987433 7 1 107116278 107446093 7 RRID:RGD_7800705 Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). 8142383 SHRSP/BbbUtx University of Texas, Houston, TX inbred Unknown RRID:RGD_8142383 Animals transferred from Harvard University/Brigham (Dr Klaus Lindpaintner) originating from SHRSP colony at University of Heidelberg 8142385 SHR/Utx University of Texas, Houston, TX inbred Unknown RRID:RGD_8142385 Animals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974 8547938 CrljJcl:SD CLEA Japan, Inc CLEA Japan, Inc outbred Live Animals (as of 2021-04-22) RRID:RGD_8547938 Sprague-Dawley from Charles River Laboratory Japan, to CLEA Japan, Inc. 8548794 F344-Tg(NC1-269B17)1Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 RRID:RGD_8548794 BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. 8548809 F344-Tg(NC1-269B17)2Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 RRID:RGD_8548809 BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. 8548812 F344-Tg(NC1-269B17)3Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 RRID:RGD_8548812 BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. 8548815 F344-Tg(NC1-269B17)4Nkg National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 RRID:RGD_8548815 BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. 8548817 KDP.PVG-RT1a/u/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity RRID:RGD_8548817 MHC haplotype (RT1.BaDa) of PVG.R23 was transferred onto the genetic background of KDP/Tky strain (RT1.BuDu). This allele has been maintained in heterozygous condition. Backcrossing has started since 2003 and afterwards maintained by sib mating 8549599 BN.LEW-(D10Rat32-D10Rat133)/Ciml Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 10 51779662 51779830 1 - by flanking markers RRID:RGD_8549599 Congenic strain created from parental BN/Rj and LEW/Rj strains. 8549776 F344-Lepm1Kyo F344 OB rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals (as of 2017-03-17) Diabetes Obesity Lep|Lepm1Kyo 3000|12792963 4 55943837 55945938 7 4 56085079 56099209 7 4 56348850 56348850 8 4 57672294 57672294 8 RRID:RGD_8549776 Established by ENU mutagenesis in F344/NSlc rats. This strain has Lep missense mutation (Q92X). 8549778 PVG.KDP-Cblb/Nyo PVG.KDP-Cblb congenic National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity Cblb 620535 RRID:RGD_8549778 Developed by the DEPOSITOR 8549779 DRU/Uubc National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_8549779 The mutant rat showing microphthalmia was found in the colony of Donryu rats at Central Institute for Experimental Animals in 1974. A pair of F3 rats was transferred to The Third Department for Anatomy, School of Medicine, Chiba University in 1975 and maintained by sib mating. F50 rats were transferred to Faculty of Agriculture, Utsunomiya University by Dr. S Sugita in 1991 8549782 SD.Gunn-Ugt1a1j/Aon National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-09-15) Neurobiology; Metabolism Ugt1a1|Ugt1a1j 3935|13432064 RRID:RGD_8549782 Developed by the DEPOSITOR 8549785 W.Gunn-Ugt1a1j/Aon National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Neurobiology; Metabolism Ugt1a1|Ugt1a1j 3935|13432064 RRID:RGD_8549785 Developed by the DEPOSITOR 8549798 WMS/SimNcp Department of cellular physiology, Institute of Nephrology, Niigata University, Niigata, Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_8549798 Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Simonsen Labs, CA via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Transferred at Nigata University from Simonsen Laboratory in 2005. at Niigata University 8551711 SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551711 A double congenic strain derived from the progenitor strain SS.LEW-(D10Rat194-D10Chm243)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551714 SS.LEW-(D10Chm10-D10Rat11)(D10Chm246-D10Chm257)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551714 A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D10Chm246-D10Chm257)/Ayd 8551716 SS.LEW-(D10Rat194-D10Chm243)(D16Chm48-D16Chm60)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551716 A double congenic strain derived from the progenitor strain SS.LEW-(D10Rat194-D10Chm243)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd 8551718 SS.LEW-(D10Chm10-D10Rat11)(D16Chm48-D16Chm60)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551718 A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd 8551721 SS.LEW-(D8Rat58-D8Chm12)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551721 A double congenic strain derived from the progenitor strain SS.LEW-(D8Rat58-D8Chm12)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551723 SS.LEW-(D8Rat58-D8Chm12)(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551723 A double congenic strain derived from the progenitor strain SS.LEW-(D8Rat58-D8Chm12)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8551725 SS.LEW-(D8Chm12-D8Rat15)(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551725 A double congenic strain derived from the progenitor strain SS.LEW-(D8Chm12-D8Rat15)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8551727 SS.LEW-(D3Rat2-D3Chm79)(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551727 A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8551730 SS.LEW-(D3Rat2-D3Chm79)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551730 A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551732 SS.LEW-(D17Chm131-D17Chm93)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551732 A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551734 SS.LEW-(D17Chm131-D17Chm93)(D17Rat84-D17Chm17)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551734 A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D17Rat84-D17Chm17)/Ayd 8551737 SS.LEW-(D2Uia5-D2Mit6)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551737 A double congenic strain derived from the progenitor strain SS.LEW-(D2Uia5-D2Mit6)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551739 SS.LEW-(D2Uia5-D2Mit6)(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551739 A double congenic strain derived from the progenitor strain SS.LEW-(D2Uia5-D2Mit6)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8551742 SS.LEW-(D16Chm48-D16Chm60)(D18Rat101-D18Rat92)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_8551742 A double congenic strain derived from the progenitor strain SS.LEW-(D16Chm48-D16Chm60)/Ayd and SS.LEW-(D18Rat101-D18Rat92)/Ayd 8551748 SS.LEW-(D3Rat17-D3Mco80)(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551748 A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat17-D3Mco80)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8551750 SS.LEW-(D1Uia4-D1Rat320)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551750 A double congenic strain derived from the progenitor strain SS.LEW-(D1Uia4-D1Rat320)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551752 SS.LEW-(D1Rat320-D1Mgh32)(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551752 A triple congenic strain derived from the progenitor strain SS.LEW-(D1Rat320-D1Mgh32)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd 8551755 SS.LEW-(D1Chm64-D1Rat19)(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551755 A triple congenic strain derived from the progenitor strain SS.LEW-(D1Chm64-D1Rat19)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd 8551757 SS.LEW-(D7Uia3-D7Mgh1)(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551757 A triple congenic strain derived from the progenitor strain SS.LEW-(D7Uia3-D7Mgh1)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd 8551759 SS.MNS-(D2Chm90-D2Rat38),LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551759 A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm90-D2Rat38)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551761 SS.MNS-(D2Chm90-D2Rat38),LEW-(D10Got112-Igfbp4)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551761 A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm90-D2Rat38)/Ayd and SS.LEW-(D10Got112-Igfbp4)/Ayd 8551763 SS.MNS-(D2Rat155-D2Chm419),LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551763 A double congenic strain derived from the progenitor strain SS.MNS-(D2Rat155-D2Chm419)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8551766 SS.MNS-(D2Rat155-D2Chm419),LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551766 A double congenic strain derived from the progenitor strain SS.MNS-(D2Rat155-D2Chm419)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551772 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D10Rat194-D10Chm243),LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551772 A triple congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd 8551774 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551774 A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd 8551776 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551776 A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8551778 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D3Rat2-D3Chm79)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8551778 A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D3Rat2-D3Chm79)/Ayd 8551782 SS.LEW-(D18Chm90-D18Chm4)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 13071222 27421017 1 - by flanking markers 18 12230011 27443258 1 - by flanking markers 18 12441876 27733166 1 - by flanking markers 18 12710576 26538225 1 - by flanking markers RRID:RGD_8551782 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 8551785 SS.LEW-(D18Wox7-D18Rat67)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 12406948 23780206 1 - by flanking markers 18 15314151 23867696 1 - by flanking markers 18 15539551 24147513 1 - by flanking markers 18 11944273 23012468 1 - by flanking markers RRID:RGD_8551785 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 8551787 SS.LEW-(D18Rat55-D18Mgh2)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 54856551 62313296 1 - by flanking markers 18 53346348 61092546 1 - by flanking markers 18 54108375 61901354 1 - by flanking markers 18 52539763 59712417 1 - by flanking markers RRID:RGD_8551787 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 8551789 SS.LEW-(D18Chm59-D18Rat1)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 69138888 86857890 1 - by flanking markers 18 66790645 86108580 1 - by flanking markers 18 67627706 87074531 1 - by flanking markers 18 65970331 83213037 1 - by flanking markers RRID:RGD_8551789 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 8551864 DA.LEW.1AV1-(D4Mgh17-D4Mgh21)/Kiru Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 116611031 116611168 1 - by flanking markers 4 177782842 177926667 1 - by flanking markers 4 113100978 179563872 1 - by flanking markers 4 114921280 114921417 1 - by flanking markers RRID:RGD_8551864 LEW.1AV1/Kini allele is introgressed into the DA/ZtmKini rats. 8551866 LEW.1AV1.DA-(D4Mgh17-D4Rat203)/Kiru Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 116611031 161435775 1 - by flanking markers 4 177782842 224843794 1 - by flanking markers 4 113100978 157826751 1 - by flanking markers 4 114921280 158112799 1 - by flanking markers RRID:RGD_8551866 DA/ZtmKini allele is introgressed into the LEW.1AV1/kini rats. 8551868 PVG.1AV1.DA-(D4Mgh17-D4Rat84)/Kiru Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 116611031 185398530 1 - by flanking markers 4 177782842 246313537 1 - by flanking markers 4 113100978 182171018 1 - by flanking markers 4 114921280 180699135 1 - by flanking markers RRID:RGD_8551868 DA/ZtmKini allele is introgressed into the PVG.1AV1/Kini rats. 8551872 DA.PVG.1AV1-(D4Rat155-D4Rat113)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 157006984 157007337 1 - by flanking markers 4 47848402 220242357 1 - by flanking markers 4 48053950 153153072 1 - by flanking markers 4 49524674 153826492 1 - by flanking markers RRID:RGD_8551872 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551874 DA.PVG.1AV1-(D4Rat63-D4Rat84)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 185398530 1 - by flanking markers 4 219683260 246313537 1 - by flanking markers 4 152598827 182171018 1 - by flanking markers 4 153274175 180699135 1 - by flanking markers RRID:RGD_8551874 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551876 DA.PVG.1AV1-(D4Rat203-D4Got130)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 161435633 166051402 1 - by flanking markers 4 224843653 227653798 1 - by flanking markers 4 157826610 162454686 1 - by flanking markers 4 158112655 162281835 1 - by flanking markers RRID:RGD_8551876 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551880 DA.PVG.1AV1-(D4Rat63-D4Rat203)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 161435775 1 - by flanking markers 4 219683260 224843794 1 - by flanking markers 4 152598827 157826751 1 - by flanking markers 4 153274175 158112799 1 - by flanking markers RRID:RGD_8551880 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551882 DA.PVG.1AV1-(D4Rat203-D4Mit22)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 161435633 175947418 1 - by flanking markers 4 224843653 236764513 1 - by flanking markers 4 157826610 172512411 1 - by flanking markers 4 158112655 171728165 1 - by flanking markers RRID:RGD_8551882 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551885 DA.PVG.1AV1-(D4Mit22-D4Rat84)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 175947270 185398530 1 - by flanking markers 4 236764366 246313537 1 - by flanking markers 4 172512264 182171018 1 - by flanking markers 4 171728017 180699135 1 - by flanking markers RRID:RGD_8551885 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551887 DA.PVG.1AV1-(D4Got126-D4Rat203)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 159298584 161435775 1 - by flanking markers 4 222677930 224843794 1 - by flanking markers 4 155657051 157826751 1 - by flanking markers 4 156050654 158112799 1 - by flanking markers RRID:RGD_8551887 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551889 DA.PVG.1AV1-(D4Rat62-D4Got136)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 157913800 160528447 1 - by flanking markers 4 221142142 223964695 1 - by flanking markers 4 154054175 156945571 1 - by flanking markers 4 154716992 157232313 1 - by flanking markers RRID:RGD_8551889 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8551892 DA.PVG.1AV1-(D4Rat113-D4Rat62)/Kiru Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 157006984 157913968 1 - by flanking markers 4 220242234 221142309 1 - by flanking markers 4 153152949 154054342 1 - by flanking markers 4 153826368 154717160 1 - by flanking markers RRID:RGD_8551892 Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. 8552235 SD-Tg(Pbsn-TAg)1Obs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-17) Pbsn 708571 RRID:RGD_8552235 SV40 Large T Antigen along with Rat probasin promoter 8552237 WI-Tg(Nanog-GFP-PuroR)22Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals RRID:RGD_8552237 mouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performance 8552239 F344.WI-Tg(Nanog-GFP-PuroR)Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_8552239 WI-Tg(Nanog-GFP-puro-R)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic background 8552242 ETR/Eis Eisai Turning Rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Behavior RRID:RGD_8552242 Developed by the DEPOSITOR 8552244 SD-Tg(Dsp-mCherry-DTR)Jfln National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_8552244 This rat carries a transgene consisting of the Dsp promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. Red fluorescence can be detected from the skin of the animals but not the brain. 8552247 SD-Tg(Neurod6-mCherry-DTR)Jfln National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-17) RRID:RGD_8552247 This rat carries a transgene consisting of the NeuroD6 promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. This model is yet to be validated. 8552249 SD-Tg(Camk2a-FLPo)Jfln National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-16) RRID:RGD_8552249 This transgene consists of approximately 6kb of the CamK2a promoter followed by a gene encoding FLP, optimised for mamalian exprssion (FLPo). This rat remains unvalidated. 8552252 ACI.BUF-Aftm1/2Mna National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo RRID:RGD_8552252 This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred. 8552255 LAP/Hshyo low alcohol preference rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_8552255 Developed by the DEPOSITOR 8552257 HAP/Hshyo high alcohol preference rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_8552257 Developed by the DEPOSITOR 8552259 F344-Ldlrm1Kyo/Ta National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo RRID:RGD_8552259 Developed by the DEPOSITOR 8552261 WIAR.MPR-Arsbabd/Ncchd National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2023-03-07) Osteology; Metabolism Arsb|ArsbMPR 2158|12792967 2 24067560 24223821 7 2 42559079 42717753 7 2 23385154 23543028 7 2 25020848 25020849 8 RRID:RGD_8552261 Developed by the DEPOSITOR. This congenic strain was established by backcrossing MPR/Iar (RGD:2306064) (provided by Dr. Kunieda, Okayama University) to WIAR/Iar (RGD:2304222) 8552267 SHRSP.WKY-(D1Rat116-D1Wox10)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 218466863 220639653 1 - by flanking markers 1 238863547 244066407 1 - by flanking markers 1 231729437 236763528 1 - by flanking markers 1 212458494 214537671 1 - by flanking markers RRID:RGD_8552267 Developed by the DEPOSITOR 8552269 SHRSP.WKY-(D1Tkyo58-D1Rat90)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 267110921 267111153 1 - by flanking markers 1 289137107 289137268 1 - by flanking markers 1 281795624 281795785 1 - by flanking markers 1 259647732 259647894 1 - by flanking markers RRID:RGD_8552269 Developed by the DEPOSITOR 8552271 SHRSP.WKY-(D1Rat27-D1Wox18)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 90282040 94626661 1 - by flanking markers 1 95301716 101198506 1 - by flanking markers 1 94201400 100133395 1 - by flanking markers 1 90508614 94644553 1 - by flanking markers RRID:RGD_8552271 Developed by the DEPOSITOR 8552273 SHRSP.WKY-(D1Tkyo57-D1Wox18)/Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 94626541 94626661 1 - by flanking markers 1 101198387 101198506 1 - by flanking markers 1 100133276 100133395 1 - by flanking markers 1 94644435 94644553 1 - by flanking markers RRID:RGD_8552273 Developed by the DEPOSITOR 8552275 F344-Lgi1m1Kyo The University of Tokyo, The Institute of Medical Science National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-03-17) Lgi1|Lgi1m1Kyo 628742|12792970 1 242593236 242634141 7 1 264436441 264477332 7 1 256996315 256996315 8 1 236083750 236083750 8 RRID:RGD_8552275 Developed by gene driven ENU mutagenesis in F344/NSlc rats. Lgi1-mutant rats carrying a missense mutation (c.1154 T > G)(L385R). 8552279 WI-Tg(Per1-luc)Ylab National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_8552279 The original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase 8552285 F344.WI-Tg(Per1-luc)Ylab National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_8552285 The original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase 8552287 F344.WIC-TgrdwKts National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-04-27) Metabolism RRID:RGD_8552287 This is a F344 congenic carrying Tgrdw derived from WIC-Tgrdw/Kts. WIC-Tgrdw/Kts was established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. 8552289 A5M/Khos National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Metabolism RRID:RGD_8552289 Developed by the DEPOSITOR 8552293 SR/JrSeac Dahl Salt-Resistant National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio- Hypertension RRID:RGD_8552293 Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP 8552296 UPL/CasTakeu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Ophthalmology RRID:RGD_8552296 Substrain of UPL 8552298 DA-Tyrem1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-03-17) Behavior; Dermatology Tyr|Tyrem1Kyo 1589755|12792972 1 143641257 143746315 7 1 157322968 157416594 7 1 151097612 151097640 8 1 141201016 141201044 8 RRID:RGD_8552298 The strain having a Endonuclease-induced 29-bp deletion mutation in Tyr gene was established by TALENs combined with Exonuclease 1. 8552303 DA-Tyrem2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Behavior; Dermatology RRID:RGD_8552303 Developed by the DEPOSITOR 8552309 ODUS/Odu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_8552309 The mutant rat showing spontaneous gingivitis was found in the colony of WKY rats in 1972. The inbred strain was established in 1991. 8552311 ODUR/Odu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo RRID:RGD_8552311 This inbred strain was established from WKY rats as a control for ODUS/Odu. 8552313 DA.PVG.1AV1-(D10Rat81-D10Rat238)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 10 49618846 62685691 1 - by flanking markers 10 49641148 61927099 1 - by flanking markers 10 49863561 62214000 1 - by flanking markers 10 48075363 60222446 1 - by flanking markers RRID:RGD_8552313 DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program. 8552315 W-Tg(Thy1-COP4/YFP*)4Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Ophthalmology; Otorhinology RRID:RGD_8552315 The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs. 8552317 W-Tg(Thy1-COP4/YFP*)5Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Ophthalmology; Otorhinology RRID:RGD_8552317 The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs. 8552319 W-Tg(Thy1-COP4/YFP*)6Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Ophthalmology; Otorhinology RRID:RGD_8552319 The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs. 8552321 SHR-Tg(APOC3-CETP)1Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Neurobiology RRID:RGD_8552321 The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC3 promoter into SHR/Izm rat fertile eggs. 8552323 SHR-Tg(APOC3-CETP)2Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Diabetes Obesity; Neurobiology RRID:RGD_8552323 The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs. 8552325 SHR-Tg(APOC3-CETP)3Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Diabetes Obesity; Neurobiology RRID:RGD_8552325 The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC5 promoter into SHR/Izm rat fertile eggs. 8552327 SHR-Tg(APOC3-CETP)4Tkyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Diabetes Obesity; Neurobiology RRID:RGD_8552327 The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs. 8552329 W-Tg(Nqo1)Kop National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Oncology; Metabolism RRID:RGD_8552329 The transgenic rats were established by injection of transgene consisting of NAD(P)H quinone oxidoreductase 1 gene derived from a DA/Slc rat strain into Wistar rat fertile eggs. 8552331 F344-Il2rgem7Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Hematology; Immunology Il2rgem7Kyo 13628732 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_8552331 The strain having a Endonuclease-induced 7 bp deletion mutation in the 2nd exon of the rat Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University. 8552337 DA.PVG.1AV1-(D10Got406-D10Rat93)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 10 68361384 81887390 1 - by flanking markers 10 67154600 80788180 1 - by flanking markers 10 67495867 80946110 1 - by flanking markers 10 65139038 78210622 1 - by flanking markers RRID:RGD_8552337 Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Animals for congenic breeding were selected from the 10th generation of an advanced intercross line (AIL) originating from the EAE-susceptible DA and EAE-resistant PVG.1AV1 rat strains. Selected males containing a PVG.1AV1 fragment in the Eae18b region (from OT24.18 to D10Rat93 marker, at 68.36 Mb and 81.9 Mb, respectively) were backcrossed with DA females for 8 generations, and offspring was genotyped using microsatellite markers in each generation. In the 8th generation, heterozygous males and females were crossed to obtain the experimental population of homozygous congenic rats and littermate controls. 8552341 DA.PVG.1AV1-(D10Got6-D10Rat184)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 10 3219701 11568211 1 - by flanking markers 10 1728277 10319475 1 - by flanking markers 10 2847625 11561989 1 - by flanking markers 10 3406320 3406594 1 - by flanking markers RRID:RGD_8552341 Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by transfer of the defined Vra4 segment selected from male donors of G8 generation of a DAxPVG1.AV1 andvanced intercross line. Subsequential backcrossing for 9 generations. 8552346 DA.PVG.1AV1-(D4Rat107-D4Got132)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 4 156090003 162362144 1 - by flanking markers 4 219336960 225566369 1 - by flanking markers 4 152249616 158564471 1 - by flanking markers 4 152925326 158841762 1 - by flanking markers RRID:RGD_8552346 Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by selective transferring of PVG alleles in the interval between D4Rat137 and D4Kiru157 onto DA background in minimum of 13 backcross generations. 8552348 DA.PVG.1AV1-(D13Rat105-D13Rat131)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 13 45592985 80755583 1 - by flanking markers 13 54552997 88144258 1 - by flanking markers 13 49478067 83263907 1 - by flanking markers 13 44139595 77313088 1 - by flanking markers RRID:RGD_8552348 Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). The congenic line was established from DA and MHC-identical PVG.A rats using a speed-congenic approach with marker assisted selection. DA females were mated with male offspring selected from F2 (DAxPVG.A) with heterozygote alleles within chromosome 13 and Eae34 QTL interval and with the lowest PVG.A background contamination using 96 microsatellite markers equally spaced throughout the genome (at 20 centimorgan cM intervals). A breeding pair selected from the N7 generation were crossed for two generations to produce homozygous DA.PVG-Eae34 congenic rats. 8552351 DA.PVG.1AV1-(D9Wox24-D9Rat44)/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 9 2948882 2949051 1 - by flanking markers 9 2813697 9858600 1 - by flanking markers 9 2880977 10869489 1 - by flanking markers 9 1024537 5109995 1 - by flanking markers RRID:RGD_8552351 Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Briefly, in each backcross generation, rats for further breeding were selected on the basis of genotyping of 8 microsatellite markers in the congenic region, from marker D9Wox24 to D9Rat20. The genetic background of rats was also screened with 100 markers. After the complete removal of the donor genome outside the congenic fragment, two heterozygous rats were intercrossed to produce the homozygous strains DA.BN-Eae4(N7F1). Subsequently, interval-specific recombinants were bred from an F2 breeding. R25 recombinant was established in 2003. 8552364 WI-Tg(L2-Venus)Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN transgenic Unknown RRID:RGD_8552364 The construct contains CAG--lox P--Neo-pA--lox P--Venus--pA (4.3 kb) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes 8552366 WI-Tg(CAG-cre)Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN transgenic Unknown RRID:RGD_8552366 The construct contains CAG--NLS-Cre--pA (3.3 kb)which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes 8552368 WI-Tg(CAG-Venus)Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN transgenic Unknown RRID:RGD_8552368 The construct contains L2-Venus ÿ CAG-Cre (CAG--lox P--Venus--pA (3.1 kb)) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes 8552371 WDB-ROSA26em1(RT2)Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Unknown RRID:RGD_8552371 This strain was produced by knock-in in the rat ROSA26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 8552996 F344/Arc Animal Resources Centre, Australia Animal Resources Centre, Australia inbred Unknown RRID:RGD_8552996 substrain of F344 bred at Animal Resources Centre Australia 8553001 ArcCrl:CD(SD) Animal Resources Centre, Australia Animal Resources Centre, Australia outbred Unknown RRID:RGD_8553001 substrain derived from Crl:CD(SD); IGS refers to animals bred using the CRL International Genetic Standard system. 8553003 ArcCrl:WI Wistar rats Animal Resources Centre, Australia Animal Resources Centre, Australia outbred Unknown RRID:RGD_8553003 From Charles River to Animal Resources Centre, Australia 8553005 BN/RijHsdArc Animal Resources Centre, Australia inbred Unknown RRID:RGD_8553005 To Animal Resources Centre, Australia from Harlan. 8553006 DA/Arc Animal Resources Centre, Australia Animal Resources Centre, Australia inbred Unknown RRID:RGD_8553006 substrain of DA bred at Animal Resources Centre, Australia 8553008 LEW/CrlArc Lewis Animal Resources Centre, Australia Animal Resources Centre, Australia inbred Unknown RRID:RGD_8553008 Developed by Dr. Lewis from Wistar stock in the early 1950s. To Animal Resources Centre, Australia from Charles River 8553010 PVG/Arc Animal Resources Centre, Australia Animal Resources Centre, Australia inbred Unknown RRID:RGD_8553010 substrain of PVG maintained at Animal Resources Centre 8553013 SHR/NCrlArc Animal Resources Centre, Australia Animal Resources Centre, Australia inbred Unknown RRID:RGD_8553013 To Animal Resources Centre from Charles River 8553015 WKY/NCrlArc Animal Resources Centre, Australia Animal Resources Centre, Australia inbred Unknown RRID:RGD_8553015 To Animal Resources Centre from Charles River 8553187 FHH.BN(D14Rat98-D14Hmgc4)/Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 14 14535071 21435476 1 - by flanking markers 14 14613528 21463742 1 - by flanking markers 14 14673206 21555302 1 - by flanking markers 14 13015311 19848266 1 - by flanking markers RRID:RGD_8553187 desired segments from BN were introgressed in FHH background 8655639 WAG/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_8655639 Substrain of WAG, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) 8655660 WAG.OXYS-(D1Rat30-D1Rat219)/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia congenic Unknown Cic|Arhgap33 1310706|2318374 1 100539980 188654926 1 - by flanking markers 1 107049754 209588735 1 - by flanking markers 1 106002252 202571904 1 - by flanking markers 1 100357752 183970443 1 - by flanking markers RRID:RGD_8655660 desired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Nov 8655663 WAG.OXYS-(D1Rat219-D1Rat81)/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia congenic Unknown Snurf|Ifit1|Zp2|Gtf3c1|Col17a1 69269|620599|620605|621048|1311130 1 188654686 250119874 1 - by flanking markers 1 209588496 272245383 1 - by flanking markers 1 202571665 264802994 1 - by flanking markers 1 183970203 243914901 1 - by flanking markers RRID:RGD_8655663 desired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Nov 8655977 W-Lepr+/+/Nin Wistar NIN lean National Institute of Nutrition (NIN), Hyderabad, India inbred Unknown RRID:RGD_8655977 The lean litter mates of WNIN-Ob (W-LeprfaNin, RGD:8655992). Both are derived from the inbred stock of Wistar rats (W/NIN) dating back to 1920 at National Institute of Nutrition (NIN), Hyderabad, India. 8655992 W-LeprfaNin National Institute of Nutrition (NIN), Hyderabad, India mutant Unknown RRID:RGD_8655992 The spontaneously developed obese rat was derived from the colony of inbred W/Nin by selective breeding. Its lean litter mate ( W-Lepr+/+/Nin, RGD:8655977) was used as a control strain in obesity related study. 8657051 F344/Nin National Institute of Nutrition (NIN), Hyderabad, India inbred Unknown RRID:RGD_8657051 Substrain of F344 maintained at National Institute of Nutrition (NIN), Hyderabad, India. 8657079 SS.LEW-(D18Chm124-D18Chm126)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown RRID:RGD_8657079 SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 8657135 SS.LEW-(D10Chm280-D10Chm216)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 76589831 76590030 1 - by flanking markers 10 74503802 74504001 1 - by flanking markers 10 75603400 75603599 1 - by flanking markers 10 73073387 73073589 1 - by flanking markers RRID:RGD_8657135 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd 8657348 SS.LEW-(D17Chm131-D17Chm93),MNS-(D2Rat155-D2Chm161),LEW-(D18Chm41-D18Rat92)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8657348 A triple congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd, SS.MNS-(D2Rat155-D2Chm161)/Ayd and SS.LEW-(D18Chm41-D18Rat92)/Ayd 8657351 SS.MNS-(D2Chm366-D2Rat52),LEW-(D18Rat61-D18Rat45),LEW-(D10Chm128-D10Chm121)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8657351 A triple congenic strain derived from the progenitor strain SS.MNS-(D2Chm366-D2Rat52)/Ayd, SS.LEW-(D18Rat61-D18Rat45)/Ayd and SS.LEW-(D10Chm128-D10Chm121)/Ayd 8657361 SS.MNS-(D2Chm254-D2Chm161),LEW-(D10Chm246-D10Chm257),LEW-(D16Chm48-D16Chm60),LEW-(D18Rat55-D18Mgh2)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8657361 A congenic strain derived from the progenitor strain SS.MNS-(D2Chm254-D2Chm161)/Ayd, SS.LEW-(D10Chm246-D10Chm257)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd and SS.LEW-(D18Rat55-D18Mgh2)/Ayd 8657392 SS.LEW-(D10Rat155-D10Chm171)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70229781 71032765 1 - by flanking markers 10 69020437 69797898 1 - by flanking markers 10 69385595 70167191 1 - by flanking markers 10 66978955 67750281 1 - by flanking markers RRID:RGD_8657392 A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. 8657399 SS.MNS-(D2Chm214-D2Chm302)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown RRID:RGD_8657399 Congenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F2 rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. 8657402 SS.LEW-(D3Rat52-D3Chm57),MNS-(D2Chm214-D2Chm302),LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown RRID:RGD_8657402 A triple congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Chm57)/Ayd, SS.MNS-(D2Chm214-D2Chm302)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd 8661233 SS-TgTn(T2GFP)53Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_8661233 This strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 15 near 35.6 Mb (rn4) 8661234 SS-TgTn(T2ePet-eGFP)11Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown RRID:RGD_8661234 This strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a serotonergic neuron-specific ePet1 promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 7 near 123.8Mb (rn4) 8661235 FHH-TgTn(T2/Rab38)1Mcwi Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown Rab38 628752 RRID:RGD_8661235 This strain was made by pronuclear microinjection of a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving the Brown Norway allele cDNA for Rab38 along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 14 near 13.2 Mb (rn4) 8662449 LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown RRID:RGD_8662449 LOU/M strain maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany 8662861 LOU.BN-(D5Rat59-D5Rat133)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 49696253 1 - by flanking markers 5 1662934 53233338 1 - by flanking markers 5 1666587 48652920 1 - by flanking markers 5 2282226 47798053 1 - by flanking markers RRID:RGD_8662861 the desired chromosomal segment from BN/Rj was introgressed into the genetic background of LOU/MBbb 8662874 LOU.BN-(D5Rat59-D5Rat127)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 27586431 1 - by flanking markers 5 1662934 31408200 1 - by flanking markers 5 1666587 26713119 1 - by flanking markers 5 2282226 26607972 1 - by flanking markers RRID:RGD_8662874 this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb 8662878 LOU.BN-(D5Rat59-D5Rat125)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 17703194 1 - by flanking markers 5 1662934 22043910 1 - by flanking markers 5 1666587 17263178 1 - by flanking markers 5 2282226 17397969 1 - by flanking markers RRID:RGD_8662878 this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb 8662925 LOU.BN-(D5Rat59-rs13448399)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 1368442 1 - by flanking markers 5 1662934 1663152 1 - by flanking markers 5 1666587 5649731 1 - by flanking markers 5 2282226 6020990 1 - by flanking markers RRID:RGD_8662925 this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb 8662933 LOU.BN-(rs65016308-D5Rat133)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 49696057 49696253 1 - by flanking markers 5 53233142 53233338 1 - by flanking markers 5 10652699 48652920 1 - by flanking markers 5 10898113 47798053 1 - by flanking markers RRID:RGD_8662933 this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb 8662955 LOU.BN-(rs13448399-D5Rat133)/Bbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 49696057 49696253 1 - by flanking markers 5 53233142 53233338 1 - by flanking markers 5 5649731 48652920 1 - by flanking markers 5 6020990 47798053 1 - by flanking markers RRID:RGD_8662955 this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb 8662958 LOU.BN-(D5Rat59-rs13448399)/Bbb-/+ Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 1368442 1 - by flanking markers 5 1662934 1663152 1 - by flanking markers 5 1666587 5649731 1 - by flanking markers 5 2282226 6020990 1 - by flanking markers RRID:RGD_8662958 this heterozygous congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb 8663453 BN.ACI-(D14Uwm4-D14Rat39)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 14 77787938 77788272 1 - by flanking markers 14 77221247 77221492 1 - by flanking markers 14 34997325 77240029 1 - by flanking markers 14 32471902 72508789 1 - by flanking markers RRID:RGD_8663453 This congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background. 8663455 BN.ACI-(D14Uwm1-D14Uwm5)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 14 34228109 36047474 1 - by flanking markers 14 31707011 33514760 1 - by flanking markers RRID:RGD_8663455 This congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background. 8663458 ACI.BN-(D7Rat164-D7Rat142)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 69506936 76323874 1 - by flanking markers 7 72918736 79648829 1 - by flanking markers 7 72752037 79629245 1 - by flanking markers 7 65287247 71789091 1 - by flanking markers RRID:RGD_8663458 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 8663462 ACI.BN-(D7Uwm32-D7Uwm43)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer RRID:RGD_8663462 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 8663464 ACI.BN-(D7Uwm33-D7Uwm43)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer RRID:RGD_8663464 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 8693598 LE-Tg(DIO-mCherry)2OttcRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery RRID:RRRC_00687 The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter. 9586448 SHR/NCrlPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California inbred Unknown RRID:RGD_9586448 Substrain of SHR originally from Charles River now maintained at University of California 9586450 SHR/OlaIpcvPrin Dept. of Pharmacology, University of California, San Diego, La Jolla, California inbred Unknown RRID:RGD_9586450 These are substrains of SHR from Czech Academy of Sciences now maintained at University of California 9587464 SD-Tg(UBC-DsRedT3-emGFP)18Narl SD-Tg(UBC-DsRedT3-emGFP)18 National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan transgenic Live Animals UBC 1346853 RRID:RGD_9587464 This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter. 9587466 SD-Tg(UBC-cre/ERT2)7Narl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan transgenic Cryopreserved Embryo (as of 2017-05-31) UBC 1346853 RRID:RGD_9587466 This strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter. 9587470 SD-Tg(UBC-DsRedT3-emGFP)26Narl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan transgenic Cryopreserved Embryo UBC 1346853 RRID:RGD_9587470 This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter. 9587473 SD-Tg(UBC-emGFP)18Narl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan transgenic Live Animals UBC 1346853 RRID:RGD_9587473 This strain was produced by microinjection of UBC-cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)18Narl 9587475 SD-Tg(UBC-DsRed-GFP)(Col1a(5A)-cre)Narl National Laboratory Animal Center, Taiwan transgenic Unknown RRID:RGD_9587475 This strain was produced by microinjection of Col1a(5A)-Cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)26Narl. As loxP-flanked DsRed is removed by Col1a(5A) promoter-driven Cre recombinase 9587825 BN/SsNNarl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) RRID:RGD_9587825 Imported from NIH, now maintained at National Laboratory Animal Center, Taiwan 9587827 F344/NNarl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) RRID:RGD_9587827 Imported from NIH, now maintained at National Laboratory Animal Center, Taiwan 9587829 LEW/SsNNarl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) RRID:RGD_9587829 Imported from NIH in 1995, now maintained at National Laboratory Animal Center, Taiwan 9587831 SHR/NCrlNarl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) RRID:RGD_9587831 Imported from NIH in 2000, now maintained at National Laboratory Animal Center, Taiwan 9587833 WKY/NCrlNarl National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) RRID:RGD_9587833 Imported from NIH in 2000, now maintained at National Laboratory Animal Center, Taiwan 9587835 CrlNarl:LE National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan outbred Live Animals (as of 2018-03-28) RRID:RGD_9587835 Imported from Charles River in 1997, now maintained at National Laboratory Animal Center, Taiwan 9588294 CrljKwl:SD Kiwa Laboratory Animals Co., Ltd. Japan Kiwa Laboratory Animals Co., Ltd. Japan outbred Unknown RRID:RGD_9588294 Sprague-Dawley from Charles River Laboratory Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1985; these were turned into SPF by caesarean section 9588298 Kwl:LE Kiwa Laboratory Animals Co.Ltd. Japan outbred Unknown RRID:RGD_9588298 Long Evans from Sasaki Institute, Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1971; these were turned into SPF by caesarean section 9588544 SHR-Ndufc2em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ndufc2em1Mcwi 9588537 1 154635889 154642112 7 1 168576274 168582497 7 1 162369993 162370001 8 1 151712157 151712165 8 RRID:RGD_9588544 This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1. 9588546 SHR-Ndufc2em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ndufc2em2Mcwi 9588541 1 154635889 154642112 7 1 168576274 168582497 7 1 162369801 162376024 7 1 151712052 151712162 8 RRID:RGD_9588546 This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1. 9588552 SD-Nfe2l2em1Mcwi PhysGen Knockouts mutant Live Animals (as of 2017-01-26) Nfe2l2em1Mcwi 9588549 3 58366693 58394116 7 3 69041641 69069190 7 3 62524893 62524933 8 3 60621570 60621610 8 RRID:RGD_9588552 This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1. 9588559 LE-Tg(DIO-iRFP)3Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery RRID:RRRC_00747 The transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter. 9588570 LE-Tg(cFos-eGFP)2Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown RRID:RRRC_00766 The transgene contains reporter rat expressing eGFP in cFos expressing cells 9588572 LE-Tg(Slc6a3-icre)1Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown dopamine neurons in drug abuse or neurodegeneration RRID:RRRC_00730 The transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neurons 9588576 LE-Tg(Slc6a3-icre)5Ottc Optogenetics and Transgenic Technology Core Optogenetics and Transgenic Technology Core transgenic Unknown RRID:RGD_9588576 The transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neurons 9588578 LE-Tg(Slc6a3-icre)6Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2017-05-31) neurodegeneration RRID:RRRC_00758 The transgene contains BAC transgenic using rat dopamine transporterSlc6a3 (DAT) promoter to express Cre recombinase in dopaminergic neurons 9588581 LE-Tg(cFos-LacZ)1Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown RRID:RRRC_00759 The transgene contains reporter rat expressing beta-galactosidase in cFos expressing cells 9588583 LE-Tg(cFos-TetO-iCre)4Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown RRID:RRRC_00760 The transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressor 9588585 LE-Tg(cFos-TetO-iCre)6Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown RRID:RRRC_00736 The transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressor 9588587 LE-Tg(EEF1A1-TetR)1Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown RRID:RRRC_00761 The transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectors 9588589 LE-Tg(EEF1A1-TetR)2Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown RRID:RRRC_00735 The transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectors 9588591 LE-Tg(Gad1-iCre)2Ottc Optogenetics and Transgenic Technology Core Optogenetics and Transgenic Technology Core transgenic Extinct (as of 2019-02-01) RRID:RGD_9588591 The transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neurons 9588593 LE-Tg(Gad1-icre)3Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Cryorecovery (as of 2025-01-27) RRID:RRRC_00751 The transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neurons 9588595 LE-Tg(Slc6a5-icre)1Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown RRID:RRRC_00750 The transgene expresses BAC transgenic using rat GlyT2 (Slc6a5) promoter to express Cre recombinase in glycinergic neurons 9589088 ACI.COP-(D3Rat130-D3Rat114)(D6Rat80-D6Rat146)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison Rat Resource and Research Center congenic Cryorecovery (as of 2019-02-26) RRID:RRRC_00743 This congenic strain contains regions of COP/CrCrl chromosome 3 and COP/CrCrl chromosome 6 transferred to the ACI/SegHsd strain background. 9590284 SS-Tg(ApoC3-CETP)25Opaz Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) RRID:RRRC_00637 SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter 9685623 SD-Pax6Sey2/Mce Department of Ophthalmology, Okayama University Medical School, Okayama, Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-02-23) Pax6Sey2 12790970 3 91127605 91149178 7 3 102320059 102348223 7 3 95700241 95728682 7 3 92128772 92157022 7 RRID:RGD_9685623 This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.)Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. 9685625 F344-Il2rgem1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-03-27) Immunology Il2rgem1Kyo 12798560 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_9685625 The strain having a zinc finger nuclease-induced 660-bp deletion mutation in Il2rg gene shows severe combined immunodeficiency and grows normally under SPF condition. 9685748 F344-Il2rgem2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-27) Immunology Il2rgem2Kyo 12798561 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_9685748 The severe combined immunodeficiency strain carries a zinc finger induced 1097-bp deletion mutation of Il2rg gene created in the F344/Stm embryos. 9685750 F344-Il2rgem3Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Immunology Il2rgem3Kyo 13464340 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_9685750 This strain shows severe combined immunodeficiency caused by a 332 bp deletion in Il2rg gene and grow normally under SPF condition. 9685752 TM-Il2rgem4Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Immunology Il2rgem4Kyo 13464339 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_9685752 The severe combined immunodeficiency strain carries a zinc finger nuclease-induced 162-bp deletion mutation in rat Il2rg gene. Grows normally under SPF condition. 9685754 TM-Il2rgem5Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Immunology Il2rgem5Kyo 12910099 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_9685754 This strain shows severe combined immunodeficiency caused by a zinc finger nuclease induced 653-bp deletion in Il2rg gene of TM/Kyo embryo. The rats grow normally under SPF condition. 9685755 W-Tg(tetO-Pou5f1,-Klf4,-Sox2,Ubc-rtTA,-EGFP)T1-3Hina National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development RRID:RGD_9685755 Doxycycline induced mouse Oct3/4, Klf4, Sox2/ Ubc-promoter EGFP was introduced into embryonic fibroblast of Wistar rat (Slc:Wistar)by replication incompetent type lentivirus vector and iPS cells were induced. Chimeric rats (male) were generated from this iPS cells, and crossed with the wild-type Wistar rat (female). 9685757 W-Il2rgem1Hina National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-03-27) Immunology Il2rgem1Hina 12798562 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_9685757 This strain was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar) 9685759 LEW.WKY-(D13Arb15-D13Rat77)(D16Rat40-D16Rat88)/Tja Imperial College, London, UK National BioResource Project for the Rat in Japan, Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 13;16 63175274;819225 96441728;60432230 1 - by flanking markers;1 - by flanking markers 16;13 1534408;71047218 59992088;103987907 1 - by flanking markers;1 - by flanking markers 16;13 1550187;66075608 60316851;98985851 1 - by flanking markers;1 - by flanking markers 16;13 832236;60933298 56733837;92436175 1 - by flanking markers;1 - by flanking markers RRID:RRRC_00709 Segment of interest from chr 13 and chr 16 of WKY/NCrl were introgressed into LEW/SsNHsd 9685785 SS.LEW-(D1Mco36-D1Mco54)/Bj Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 129013896 1 - by flanking markers 1 130267716 136181734 1 - by flanking markers 1 129208943 135158838 1 - by flanking markers 1 121833674 127592440 1 - by flanking markers RRID:RGD_9685785 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 9685787 SS.LEW-(D1Mco36-D1Rat200)/Bj Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 126939275 1 - by flanking markers 1 130267716 134204042 1 - by flanking markers 1 129208943 133164521 1 - by flanking markers 1 121833674 125611741 1 - by flanking markers RRID:RGD_9685787 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 9685791 SS.LEW-(D1Mco36-D1Mco61)/Bj Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 124296272 1 - by flanking markers 1 130267716 131494744 1 - by flanking markers 1 129208943 130446906 1 - by flanking markers 1 121833674 123041501 1 - by flanking markers RRID:RGD_9685791 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 9685793 SS.LEW-(D1Rat200-D1Mco136)/Bj Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 126938969 126939275 1 - by flanking markers 1 134116233 134204042 1 - by flanking markers 1 133076978 133164521 1 - by flanking markers 1 125611501 125611741 1 - by flanking markers RRID:RGD_9685793 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 9685795 SS.LEW-(D1Mco55-D1Wox6)/Bj Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 127933558 131956825 1 - by flanking markers 1 135124726 138778112 1 - by flanking markers 1 134089429 137787460 1 - by flanking markers 1 126540680 126540917 1 - by flanking markers RRID:RGD_9685795 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 9685797 SS.LEW-(D1Mco134-D1Wox6)/Bj Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 131956599 131956825 1 - by flanking markers 1 138777913 138778112 1 - by flanking markers 1 137787261 137787460 1 - by flanking markers RRID:RGD_9685797 This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region 9831158 Y59/Zgd University of Zagreb, Republic of Croatia inbred Live Animals (as of 2020-10-05) Immunology and transplantational research RRID:RGD_9831158 Strain developed by Prof. Borislav Nakic, Prof. Silobrcic and Prof. Andrija Kastelan from outbred Wistar rats during 1960s, maintained at Department of Animal Physiology,Faculty of Science, University of Zagreb, Republic of Croatia 9835401 ZDF-Leprm1Rll Laboratory of Human Behavior and Metabolism, Rockefeller University, New York mutant Unknown Leprm1Rll 9835400 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_9835401 The Zucker rats from Charles River (ZDF-Leprfa/Crl) carry the Leprm1Rll allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 9835403 WDF-Leprm1Rll Laboratory of Human Behavior and Metabolism, Rockefeller University, New York mutant Unknown Leprm1Rll 9835400 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_9835403 The WDF colony at Vassar College (WDF/Vc) carry the Leprm1Rll allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 9854707 SHR.WKY-(D4Rat143-D4Rat10)/Tja MRC Clinical Centre, London, UK Rat Resource and Research Center congenic Unknown Insulin Resistance 4 26280781 26280949 1 - by flanking markers 4 2432766 26659527 1 - by flanking markers 4 2380037 26753822 1 - by flanking markers 4 5867662 29593455 1 - by flanking markers RRID:RRRC_00737 This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk 9854709 SHR.WKY-(D12Rat1-D12Mit3)/Tja MRC Clinical Centre, London, UK Rat Resource and Research Center congenic Unknown Insulin Resistance, Hypertension 12;1 555108;223364189 555654;223364281 1 - by flanking markers;1 - by flanking markers 1;12 245071632;6945260 245071725;7384617 1 - by flanking markers;1 - by flanking markers RRID:RRRC_00738 This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk 9854711 SHR.WKY-(D16Rat88-D16Rat15)/Tja MRC Clinical Centre, London, UK Rat Resource and Research Center congenic Unknown Insulin Resistance 16 819225 80047126 1 - by flanking markers 16 1534408 79886465 1 - by flanking markers 16 1550187 80316424 1 - by flanking markers 16 832236 75226532 1 - by flanking markers RRID:RRRC_00739 This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk 9999141 IRL/NCr National Cancer Institute, Animal Production Program Rat Resource and Research Center inbred Unknown Pulmonary hypertension RRID:RRRC_00732 The IRL/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production program 9999143 LOU/MNCr National Cancer Institute, Animal Production Program Delisted in December 2023, Rat Resource and Research Center inbred Extinct (as of 2023-12-28) RRID:RRRC_00733 The NCI Animal Production Program received this rat strain from NIH in 1987 for production and distribution of the LOU/MNCr rat strain 9999145 F344/NCr National Cancer Institute, Animal Production Program Rat Resource and Research Center inbred Unknown Phenylketonuria RRID:RRRC_00734 The F344/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production program 10002743 DA.E3-(D20Rat42-D20Rat49)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 4582054 8286657 1 - by flanking markers 20 6265460 10844146 1 - by flanking markers 20 4186104 8654464 1 - by flanking markers 20 4459698 8042534 1 - by flanking markers RRID:RGD_10002743 A fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd. 10002745 DA.E3-(D20Rat47-AA858870)/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 1616332 5924094 1 - by flanking markers 20 4059279 9491404 1 - by flanking markers 20 2018654 7289058 1 - by flanking markers 20 1527842 5767669 1 - by flanking markers RRID:RGD_10002745 A fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd. 10002782 SHR-Sbf1m1Ipcv Institute of Biology and Medical Genetics, Charles University, Prague mutant Unknown Sbf1m1Ipcv 10002755 7 127583779 127611043 7 7 129946572 129973566 7 7 130261552 130288566 7 7 120358338 120385022 7 RRID:RGD_10002782 Spontaneous mutation in the colony of SHR/OlaIpcv in Prague. 10002787 SD-Krt71m1Yuyi Laboratory Animal Center of Zhengzhou University, Henan Province, China mutant Unknown Krt71m1Yuyi 10002785 7 141143396 141166531 7 7 143345201 143371346 7 7 132873532 132898975 7 RRID:RGD_10002787 Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified. 10002791 SD-Fahem3Mcwi PhysGen Knockouts mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-03) Fahem3Mcwi 10002790 1 140851975 140876187 7 1 147640316 147662920 7 1 146713663 146736339 7 1 138548830 138571599 7 RRID:RGD_10002791 This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3. 10002794 SD-Il2rgem2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Il2rgem2Mcwi 10002792 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66398582 66398582 8 RRID:RGD_10002794 This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2. 10043120 BBDP.ACI-(D2Mit8-D2Rat69)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 148790600 247295816 1 - by flanking markers 2 169047256 272813962 1 - by flanking markers 2 149614466 254121739 1 - by flanking markers 2 143657411 143657569 1 - by flanking markers RRID:RGD_10043120 104 Mb region from ACI.BBDP-(RT1u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm32 10043122 BBDP.ACI-(D2Mit8-D2Arb16)(D2Rat354-D2Rat69)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2;2 148790600;199719703 198312656;247295816 1 - by flanking markers;1 - by flanking markers 2;2 226390296;169047256 272813962;225003755 1 - by flanking markers;1 - by flanking markers 2;2 206966406;149614466 254121739;205573168 1 - by flanking markers;1 - by flanking markers 2;2 191987426;143657411 191987650;190602963 1 - by flanking markers;1 - by flanking markers RRID:RGD_10043122 104 Mb region from ACI.BBDP-(RT1u)(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm32 the region from D2Rat99 and D2Rat354 is from the background ACI strain 10043124 BBDP.ACI-(D2Mit8-D2Arb16)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 148790600 198312656 1 - by flanking markers 2 169047256 225003755 1 - by flanking markers 2 149614466 205573168 1 - by flanking markers 2 143657411 190602963 1 - by flanking markers RRID:RGD_10043124 104 Mb region from ACI.BBDP-(RT1u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm32 10043127 BBDP.ACI-(D2Mit8-D2Rat354)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 148790600 199719925 1 - by flanking markers 2 169047256 226390517 1 - by flanking markers 2 149614466 206966627 1 - by flanking markers 2 143657411 191987650 1 - by flanking markers RRID:RGD_10043127 104 Mb region from ACI.BBDP-(RT1u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm32 10043129 BBDP.ACI-(D2Arb16-D2Rat63)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 198312439 231465091 1 - by flanking markers 2 225003539 257699856 1 - by flanking markers 2 205572952 239166203 1 - by flanking markers 2 190602746 222436696 1 - by flanking markers RRID:RGD_10043129 104 Mb region from ACI.BBDP-(RT1u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm26 10043132 BBDP.ACI-(D2Rat50-D2Rat63)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 200390326 231465091 1 - by flanking markers 2 227035223 257699856 1 - by flanking markers 2 207612323 239166203 1 - by flanking markers 2 192625307 222436696 1 - by flanking markers RRID:RGD_10043132 104 Mb region from ACI.BBDP-(RT1u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm26 10043368 NER.F344-(D3M2Mit327-D3Arb10)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 3 0 93413837 1 - by flanking markers RRID:RGD_10043368 The chromosome 3 region (D3M2Mit327-D3Arb10) was introgressed from F344/NSlc to NER/Kyo by backcrossing.(Sep 12, 2012) 10043382 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)Lgi1m1/Kyo Graduate School of Medicine, Kyoto University National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2023-12-29) Neurobiology Lgi1 628742 1;5 87656636;145186817 224420760;145187034 1 - by flanking markers;1 - by flanking markers 5;1 147610023;92524380 147610238;246113473 1 - by flanking markers;1 - by flanking markers 5;1 143846157;91394009 143846372;238824901 1 - by flanking markers;1 - by flanking markers 5;1 138113556;87790149 138113774;218748178 1 - by flanking markers;1 - by flanking markers RRID:RGD_10043382 Triple congenic rat made by mating F344.NER-(D1Mgh6-D1Rat132)(D5Mgh4-D5Rat36)/Kyo and F344-Lgi1m1Kyo. 10043385 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)Scn1am1/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology Scn1a 69364 1;5;3 87656636;145186817;48238528 224420760;145187034;48364143 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 5;3;1 147610023;59016641;92524380 147610238;59135580;246113473 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 3;5;1 52388811;143846157;91394009 52533365;143846372;238824901 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 3;5;1 50952790;138113556;87790149 51071804;138113774;218748178 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_10043385 Triple congenic rat made by mating F344.NER-(D1Mgh6-D1Rat132)(D5Mgh4-D5Rat36)/Kyo and F344-LScn1am1Kyo. 10043617 SPRD-Anks6PKD/Fsn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2018-04-20) Anks6PKD 11534996 5 63633540 63674953 7 5 67163440 67204853 7 5 62642974 62684387 7 5 61309183 61350596 7 RRID:RGD_10043617 This strain rats was provided to University of Kansas from Central Institute for Laboratory Animal Breeding (Hanover, Germany), and then was introduced to Fujita Health University. 10043620 SHRSP.WKY-(D1Smu13)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 1 173074640 173074855 1 - by flanking markers 1 166884926 166885141 1 - by flanking markers 1 156170341 156170557 1 - by flanking markers RRID:RGD_10043620 This congenic strain was made by introducing chromosome 1 region (D1Smu13) of WKY into SHRSP/Izm. 10043791 SHRSP.SHR-(D1Mgh5-D1Rat213)/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 78134304 81548909 1 - by flanking markers 1 80946174 84537228 1 - by flanking markers 1 79689548 83282814 1 - by flanking markers 1 78430536 81777720 1 - by flanking markers RRID:RGD_10043791 male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm 10043794 WKY.SHRSP-(D1Mgh5-D1Arb21)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 78134304 187092492 1 - by flanking markers 1 80946174 206277202 1 - by flanking markers 1 79689548 199254774 1 - by flanking markers 1 78430536 182418476 1 - by flanking markers RRID:RGD_10043794 A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm. 10043808 WKY.SHRSP-(D1Mgh5-D1Arb21)(D4Mgh7-D4Rat68)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 1;4 78134304;172169471 187092492;172169650 1 - by flanking markers;1 - by flanking markers 4;1 200825021;80946174 233267140;206277202 1 - by flanking markers;1 - by flanking markers 4;1 136351734;79689548 168998263;199254774 1 - by flanking markers;1 - by flanking markers 4;1 138503169;78430536 168069246;182418476 1 - by flanking markers;1 - by flanking markers RRID:RGD_10043808 A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm. 10043811 SHRSP.MES-CybaMES/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension CybamesSdi 13209000 RRID:RGD_10043811 A congenic strain made by introducing a genetic locus of Cyba from Matsumoto Eosinophilic Shinshu (MES/Slc) rat into SHRSP/Izm rat. 10043813 SHR/HktIzm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension RRID:RGD_10043813 SHR/Kyushu rat (Kyushu University) was delivered to Shimane University in 2000 and maintained as inbred. 10043816 LEA-Tg(Pou5f1-YFP*)3Ncco National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Oncology, Development RRID:RGD_10043816 Provided from Kyoto Bioresource center. 10043826 SHR/Kpo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio-Hypertension RRID:RGD_10043826 Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963. 10043828 SHR/2Kpo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-09-24) Cardio-Hypertension RRID:RGD_10043828 Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963. 10044232 SHRSP/Kpo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension RRID:RGD_10044232 Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat. 10045545 CDS/Sasz Cohen diabetic-sensitive rat Hebrew University-Hadassah Medical School, Jerusalem, Israel inbred Unknown RRID:RGD_10045545 Original breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony. 10045548 CDR/Sasz Cohen diabetic-resistant rat Hebrew University-Hadassah Medical School, Jerusalem, Israel inbred Unknown RRID:RGD_10045548 Original breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony. 10045576 SHRSP/2Kpo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension RRID:RGD_10045576 Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat. 10045578 MSHRSP/Kpo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio-Hypertension RRID:RGD_10045578 Okamoto et al. found that a few rats developed higher blood pressure (over 230 mmHg) at 10 weeks old. They selected SHRSP rats that show severe hypertension from young age and M-SHRSP (malignant or precocious SHRSP) rat was established in 1985. 10045580 LE-Tg((ROSA)26Sor-CAG-tdTomato)24Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-15) RRID:RGD_10045580 Background strain: Long Evans | Transgene: CAG-loxP-flanked Neo/STOP cassette-tdTomato was inserted into mouse ROSA26 BAC (RP23 244D9). 10045582 ODURM/Odu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dentistry RRID:RGD_10045582 This strain shows malocclusion. 10045584 SD-Tg(CAG-HRAS*G12V)218Htsu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Oncology RRID:RGD_10045584 The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V(HrasV12)was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc. 10045589 SD-Tg(CAG-HRAS*G12V)246Htsu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Oncology RRID:RGD_10045589 The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V(HrasV12)was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc. 10045590 LEA.F344-(D20Rat47-D20Mgh4)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 20 1616332 6880472 1 - by flanking markers 20 4059279 7910747 1 - by flanking markers 20 2018654 5875448 1 - by flanking markers 20 1527842 6691706 1 - by flanking markers RRID:RGD_10045590 Long-Evans Agouti (LEA), type 2 diabetes model, dies from lymphocytic insulitis induced by radiation (4 Gy). This LEA.F344-(D20Rat47-D20Mgh4) strain is a congenic strain made by introducing a segment of chromosome 20 (D20Rat47-D20Mgh4) from F344 strain into LEA strain. 10045591 F344-Cacna1agryScn1am1Kyo/Okym National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-05-05) Neurobiology Cacna1a|Scn1am1Kyo|Cacna1agry 2244|12792283|12880382 19 25188170 25424495 1 - by flanking markers 19 36502533 36727039 1 - by flanking markers 19 25453236 25749550 1 - by flanking markers 19 23520741 23819971 1 - by flanking markers RRID:RGD_10045591 GRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) was backcrossed to F344/NSlc, and then crossed to HISS rat (HISS rat has the N1417H mutation in the Scn1a gene) to generate Scn1a/Cacna1a double mutant rats. 10045593 WIC-Dmdem1Kykn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-12-08) Neurobiology Dmdem1Kykn 10045592 X 71501362 71671414 7 X 51475950 53700033 7 X 51149358 53519271 7 X 47272324 49504219 7 RRID:RGD_10045593 By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat. The resulting mutation is a 329-bp deletion around exon 3 and 2-bp substitution in exon16. 10045597 F344-Nfe2l2em1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Neurobiology; Diabetes Obesity Nfe2l2em1Kyo 10045594 3 58366693 58394116 7 3 69041641 69069190 7 3 62499178 62499184 8 3 60595852 60595858 8 RRID:RGD_10045597 Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 7-bp deletion in Nfe2l2 (Nrf2) gene. 10045600 F344-Nfe2l2em2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Neurobiology; Diabetes Obesity Nfe2l2em2Kyo 10045598 3 58366693 58394116 7 3 69041641 69069190 7 3 62499178 62499179 8 3 60595852 60595853 8 RRID:RGD_10045600 Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nfe2l2 gene. 10045602 W-Tg(CMV-Ddx54)19Tsuy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown Neurobiology RRID:RGD_10045602 This transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007. 10045606 W-Tg(CMV-Ddx54)37Tsuy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown Neurobiology RRID:RGD_10045606 This transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007. 10046035 SS.SR-(D13Arb5-D13Arb8)/Mcwi Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 38985717 47698301 1 - by flanking markers 13 47898759 56629737 1 - by flanking markers 13 42794724 51577031 1 - by flanking markers 13 37902608 46193066 1 - by flanking markers RRID:RGD_10046035 A region of chromosome 13 containing the renin gene from the Dahl salt-resistant (Dahl R; SR/JrHsd) strain into the SS genetic background (SS/JrHsdMcwi) 10047085 SD-Fusem1Ionsz Institute of Neuroscience, Chinese Academy of Sciences Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Fusem1Ionsz 10047084 1 187250871 187264742 7 1 206435510 206449423 7 1 199412805 199426705 7 1 182576479 182590417 7 RRID:RGD_10047085 CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). 10047391 LE/OrlBarth Long-Evans/Cryptorchid A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware inbred Unknown RRID:RGD_10047391 Obtained from Centre Nationale de la Researche Scientifique, Orleans, France; then bred at A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware 10047393 SDLEF7/Barth A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware hybrid Unknown RRID:RGD_10047393 This hybrid strain was created by interbreeding Crl:SD and Crl:LE for F7 generation. 10053598 WI-Foxn1em1Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Unknown Foxn1em1Nips 10053596 10 64243323 64256847 7 10 66004940 66030134 7 10 65621142 65634666 7 10 63251400 63273710 7 RRID:RGD_10053598 Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). 10053601 WI-Foxn1em2Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Unknown Foxn1em2Nips 10053599 10 64243323 64256847 7 10 66004940 66030134 7 10 65621142 65634666 7 10 63251400 63273710 7 RRID:RGD_10053601 Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105). 10053603 WI-Foxn1em1Nips, Foxn1em2NipsF1 Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN hybrid Unknown RRID:RGD_10053603 This strain is a hybrid of WI-Foxn1em1Nips and WI-Foxn1em2Nips 10054231 HFJ/Hblac Hebei Medical University, Shijiazhuang, Hebei, China inbred Unknown RRID:RGD_10054231 bred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China) 10054233 MIJ/Hblac Hebei Medical University, Shijiazhuang, Hebei, China inbred Unknown RRID:RGD_10054233 bred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China) 10054235 MIJN/Hblac Hebei Medical University, Shijiazhuang, Hebei, China coisogenic Unknown RRID:RGD_10054235 this strain is derived from MIJ/Hblac, they do not carry the infertile gene 10054239 DA-Abcd1em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Abcd1em2Mcwi 10054237 X 159614569 159635963 7 1 152823436 152844829 7 X 157094997 157094998 8 X 151428334 151450115 7 RRID:RGD_10054239 CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in the exon1 of the Abcd1 gene of DA/OlaHsd rat embryos. 10054242 DA-Abcd1em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Extinct (as of 2016-10-24) Abcd1em4Mcwi 10054240 X 159614569 159635963 7 1 152823436 152844829 7 X 157094812 157095014 8 X 151428334 151450115 7 RRID:RGD_10054242 CRISPR/Cas9 system was used to introduce a mutation in the Abcd1 gene of DA/OlaHsd rat embryos. 10054245 SS-Adora1em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Adora1em3Mcwi 10054243 13 47160292 47192804 7 13 56097883 56132155 7 13 51075440 51075451 8 13 45658872 45695821 7 RRID:RGD_10054245 CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Adora1 gene. 10054276 SD-Vcpem1Ionsz Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Vcpem1Ionsz 10054274 5 59472100 59491508 7 5 62951999 62971402 7 5 58426548 58445953 7 5 57210167 57229571 7 RRID:RGD_10054276 CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into His 10054279 SD-Gfapem1(2A-Chr2-EYFP)Ionsz Institute of Neuroscience, Chinese Academy of Sciences Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Gfapem1Ionsz 10054277 10 92059881 92068555 7 10 90763150 90771823 7 10 90990762 90999435 7 10 87852891 87861631 7 RRID:RGD_10054279 CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap. 10054284 SS-Adora1em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Adora1em4Mcwi 10054282 13 47160292 47192804 7 13 56097883 56132155 7 13 51075409 51075445 8 13 45658872 45695821 7 RRID:RGD_10054284 CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp deletion in the Adora1 gene. 10054287 SS-Adora2aem3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Adora2aem3Mcwi 10054285 20 13815719 13834131 7 20 16457336 16457433 8 20 14265251 14282873 7 20 13315848 13333386 7 RRID:RGD_10054287 CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp deletion in the Adora2a gene. 10054292 SS-Arhgef11em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Arhgef11em4Mcwi 10054289 2 179676236 179796785 7 2 206450722 206450738 8 2 186979850 187102523 7 2 173074383 173195962 7 RRID:RGD_10054292 CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in the Arhgef11 gene. 10054296 SS-Arhgef11em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Arhgef11em5Mcwi 10054293 2 179676236 179796785 7 2 206384799 206507431 7 2 186979850 187102523 7 2 173074383 173195962 7 RRID:RGD_10054296 CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. 10054299 SS.BN-(D13Rat25-rs106935835)-Btg2em11Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Btg2em11Mcwi 10054297 13 47026986 47030745 7 13 55966299 55970058 7 13 50913185 50916944 7 13 45531881 45535642 7 RRID:RGD_10054299 CRISPR/Cas9 system was used to introduce a 16-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. 10054304 SS.BN-(D13Rat25-rs106935835)-Btg2em13Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Btg2em13Mcwi 10054302 13 47026986 47030745 7 13 55966299 55970058 7 13 50913185 50916944 7 13 45531881 45535642 7 RRID:RGD_10054304 CRISPR/Cas9 system was used to introduce a 2-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos 10054307 SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Btg2em7Mcwi 10054305 13 47026986 47030745 7 13 55966299 55970058 7 13 50913185 50916944 7 13 45535467 45535510 8 RRID:RGD_10054307 The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. 10054310 SS-Casrem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Casrem1Mcwi 10054308 11 66084169 66153292 7 11 70329456 70329457 8 11 67188204 67262261 7 11 64235251 64304811 7 RRID:RGD_10054310 CRISPR/Cas9 system was used to introduce a mutation in the Casr gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp (T) insertion in the Casr gene. 10054373 LEW-Chrna3em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown (as of 2018-10-22) Chrna3em1Mcwi 10054371 8 58570223 58583594 7 8 58186969 58186970 8 8 59594007 59607122 7 8 55401668 55415165 7 RRID:RGD_10054373 CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene. 10054376 LEW-Chrna3em9Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-11-26) Chrna3em9Mcwi 10054374 8 58570223 58583594 7 8 58176165 58189008 7 8 59594007 59607122 7 8 55412959 55412975 8 RRID:RGD_10054376 CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. 10054379 LEW-Chrna4em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-11-26) Chrna4em4Mcwi 10054377 3 170171214 170185998 7 3 180256391 180256406 8 3 176533182 176547965 7 3 168136246 168157839 7 RRID:RGD_10054379 CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 5-bp deletion in the Chrna4 gene. 10054383 LEW-Chrna4em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-11-26) Chrna4em3Mcwi 10054380 3 170171214 170185998 7 3 180256391 180256406 8 3 176533182 176547965 7 3 168136246 168157839 7 RRID:RGD_10054383 CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene. 10054386 LEW-Chrna5em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-11-26) Chrna5em1Mcwi 10054384 8 58538002 58566388 7 8 58143974 58172330 7 8 59561817 59590172 7 8 55369794 55398526 7 RRID:RGD_10054386 CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. 10054389 LEW-Chrna5em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-11-26) Chrna5em2Mcwi 10054387 8 58538002 58566388 7 8 58166756 58166775 8 8 59561817 59590172 7 8 55369794 55398526 7 RRID:RGD_10054389 CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 20-bp deletion in the Chrna5 gene. 10054398 DA-Glaem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Glaem2Mcwi 10054395 X 122044703 122056327 7 X 105301986 105302032 8 X 105405915 105417331 7 X 97769227 97780646 7 RRID:RGD_10054398 CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. 10054401 FHH-Chr 3BN-Helz2em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Helz2em3Mcwi 10054399 3 170368815 170382086 7 3 180439958 180454321 7 3 176730024 176744382 7 3 168338813 168353219 7 RRID:RGD_10054401 CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. 10054405 FHH-Chr 3BN-Helz2em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Helz2em4Mcwi 10054402 3 170368815 170382086 7 3 180439958 180454321 7 3 176730024 176744382 7 3 168338813 168353219 7 RRID:RGD_10054405 CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3BN/Mcwi rat embryos.The resulting mutation is a 1-bp insertion in the Helz2 gene. 10054408 SS-Kcnj10em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Kcnj10em1Mcwi 10054406 13 88341102 88370591 7 13 95245046 95274535 7 13 90723077 90752581 8 13 84802026 84835383 7 RRID:RGD_10054408 CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Kcnj10 gene. 10054411 SS-Kcnj10em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Kcnj10em3Mcwi 10054409 13 88341102 88370591 7 13 95245046 95274535 7 13 90723077 90752581 8 13 84802026 84835383 7 RRID:RGD_10054411 CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp deletion in the Kcnj10 gene. 10054414 SS-Mmp9em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Mmp9em4Mcwi 12743378 3 155985473 155993433 7 3 167578904 167605890 7 3 161413410 161421473 7 3 153685624 153685781 8 RRID:RGD_10054414 CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. 10054417 SS-Mmp9em6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Mmp9em6Mcwi 10054415 3 155985473 155993433 7 3 167578904 167605890 7 3 161413410 161421473 7 3 153685771 153685771 8 RRID:RGD_10054417 CRISPR/Cas9 system was used to introduce a delins sequence alteration in the Mmp9 gene of SS/JrHsdMcwi rat embryos. The mutation is a 1-bp (t) deletion and a 5-bp (cgggta) insertion in in exon 4, which causes frameshift of the coded protein and premature stop codon in exon 8. 10054420 LEW-Mrpl28em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Mrpl28em1Mcwi 10054418 10 15394360 15397270 7 10 15310467 15310468 8 10 15495616 15498527 7 10 15148698 15151581 7 RRID:RGD_10054420 CRISPR/Cas9 system was used to introduce a mutation in the Mprl28 gene of LEW/NCrl rat embryos. The resulting mutation is a 7-bp insertion in the 2-bp deletion site in the Mrpl28 gene. 10054430 LEW-Pkd1em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Pkd1em2Mcwi 10054428 10 13801445 13848212 7 10 13769504 13769511 8 10 13914057 13962008 7 10 13573779 13621138 7 RRID:RGD_10054430 CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene. 10054433 LEW-Pkd1em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Pkd1em3Mcwi 10054431 10 13801445 13848212 7 10 13769504 13769511 8 10 13914057 13962008 7 10 13573779 13621138 7 RRID:RGD_10054433 CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene. 10054436 LEW-Pkd1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Extinct (as of 2017-01-26) Pkd1em1Mcwi 10054434 10 13801445 13848212 7 10 13731035 13778993 7 10 13914057 13962008 7 10 13573779 13621138 7 RRID:RGD_10054436 CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/Crl rat embryos. The resulting mutation is a 16-bp deletion in the Pkd1 gene. 10054439 LEW-Pkd1em6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Pkd1em6Mcwi 10054437 10 13801445 13848212 7 10 13769504 13769511 8 10 13914057 13962008 7 10 13573779 13621138 7 RRID:RGD_10054439 CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene. 10054444 LEW-Rorcem3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Rorcem3Mcwi 10054442 2 189345134 189369442 7 2 195612471 195636797 7 2 182024120 182024127 8 RRID:RGD_10054444 CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Rorc gene. 10054447 LEW-Rorcem5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Rorcem5Mcwi 10054445 2 189345134 189369442 7 2 195612471 195636797 7 2 182024055 182024123 8 RRID:RGD_10054447 CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 59-bp deletion in the Rorc gene. 10054450 SS-Sirt3em25Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Sirt3em25Mcwi 10054448 1 201021391 201043756 7 1 220539132 220561380 7 1 213613502 213636061 7 1 195955354 195955366 8 RRID:RGD_10054450 CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene. 10054453 SS-Sirt3em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Sirt3em4Mcwi 10054451 1 201021391 201043756 7 1 220539132 220561380 7 1 213613502 213636061 7 1 51262005 51262008 8 RRID:RGD_10054453 CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. 10054456 T2DN-Sirt3em35Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-22) Sirt3em35Mcwi 10054454 1 201021391 201043756 7 1 220539132 220561380 7 1 213613502 213636061 7 1 195955280 195955361 8 RRID:RGD_10054456 CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene. 10054459 T2DN-Sirt3em30Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Sirt3em30Mcwi 10054457 1 201021391 201043756 7 1 220539132 220561380 7 1 213613502 213636061 7 1 195955335 195955365 8 RRID:RGD_10054459 CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 31-bp deletion in the Sirt3 gene. 10054462 SS-Stk39em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Stk39em5Mcwi 10054460 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_10054462 CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene. 10054465 SS-Stk39em6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Stk39em6Mcwi 10054463 3 50249626 50517085 7 3 60973443 61244306 7 3 54359449 54625702 7 3 52913583 53179060 7 RRID:RGD_10054465 CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Stk39 gene. 10054473 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46721037 46721269 1 - by flanking markers 13 55662705 55662936 1 - by flanking markers 13 50609228 50609459 1 - by flanking markers 13 45228358 45228590 1 - by flanking markers RRID:RGD_10054473 SS/JrHsdMcwi were crossed with SS-13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 10059570 WI;WDB-Kiss1tm1Nips National Institute for Physiological Sciences, Okazaki Aichi, JAPAN, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan mutant Unknown Kiss1tm1Nips 40902862 13 46244786 46247288 7 13 55582365 55590432 7 13 50529506 50537603 7 13 44775106 44780707 7 RRID:RGD_10059570 This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide. Founder animals were backcrossed to Crlj:WI. 10059573 SS-Adora2aem5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Adora2aem5Mcwi 10059571 20 13815719 13834131 7 20 16449385 16466147 7 20 14274138 14274144 8 20 13315848 13333386 7 RRID:RGD_10059573 CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene. 10059576 WKY-Sik2em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Sik2em4Mcwi 10059574 8 54240307 54337976 7 8 53905730 54005295 7 8 55309005 55408608 7 8 51262005 51262008 8 RRID:RGD_10059576 CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene. 10059635 W-Tg(GnRH-GFP)Mni Department of Veterinary Physiology, Veterinary Medical Science, The University of Tokyo, Tokyo Japan transgenic Unknown RRID:RGD_10059635 generated by Dr. Masugi Nishihara's group 10395226 Sim:LE Long Evans Simonsen Laboratories Simonsen Laboratories outbred Unknown RRID:RGD_10395226 Received from Dr. Evans, University of California, Berkeley - Experimental Institute of Biology in 1949. Caesarean rederived in 1997. Selection is based on the black-hooded phenotype. 10395228 Sim:WI Wistar Simonsen Laboratories Simonsen Laboratories outbred Unknown RRID:RGD_10395228 Received from the Lobund Institute, University of Notre Dame in 1957. Caesarean rederived in 1997. 10395233 Sim:SD Sprague-Dawley Derived Simonsen Laboratories Simonsen Laboratories outbred Unknown RRID:RGD_10395233 Received Sprague-Dawley derived breeding stock from Charles River Laboratory in 1958 and crossed with Sprague-Dawley rats received from ARS/Sprague-Dawley in 1975. Caesarean rederived in 1997. 10395235 F344/NSim FISCHER 344 Simonsen Laboratories Simonsen Laboratories inbred Unknown RRID:RGD_10395235 Gnotobiotic pedigreed breeders received from the NIH repository colony in 2005. Most widely used inbred rat strain, particularly for toxicology and teratology. 10395249 FHH.FHH.3BN-(3p-D3Rat98)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 3 30253942 30254280 1 - by flanking markers 3 38636977 38637167 1 - by flanking markers 3 33477354 33477544 1 - by flanking markers 3 33703347 33703538 1 - by flanking markers RRID:RGD_10395249 (FHH X FHH-3BN/Mcwi) F2 males were backcrossed with FHH-3BN/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line 10395251 FHH.FHH.3BN-(D3Hmgc24-3q)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_10395251 (FHH X FHH-3BN/Mcwi) F2 males were backcrossed with FHH-3BN/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line 10395253 FHH.FHH.3BN-(D3Hmgc24-3q)(3p-D3Rat98)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 3 30253942 30254280 1 - by flanking markers 3 38636977 38637167 1 - by flanking markers 3 33477354 33477544 1 - by flanking markers 3 33703347 33703538 1 - by flanking markers RRID:RGD_10395253 (FHH X FHH-3BN/Mcwi) F2 males were backcrossed with FHH-3BN/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line 10395297 GK/FarMcwi Goto-Kakizaki Medical College of Wisconsin, Milwaukee, Wisconsin. RGD HRDP, contact HRDP RGD HRDP, contact HRDP inbred Live Animals (as of 2024-08-06) RRID:RGD_10395297 Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. Now bred and maintained at Medical College of Wisconsin 10401195 SD-Tg(CAG.LoxP.EGFP)Zi Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm; Cryorecovery RRID:RRRC_00689 Random insertion of a Cre inducible expression cassette, controlled by the CAG promoter. LacZ is expressed constitutively, GFP only after Cre mediated recombination 10401201 LE-Tg(Th-cre)3.1Deis Stanford University Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm (as of 2017-05-31) RRID:RRRC_00659 Cre gene was introduced immediately before the ATG of the mouse tyrosine hydroxylase (Th) gene on BAC RP23-350E13 10401204 LE-Tg(ChAT-cre)5.1DeisRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm (as of 2017-05-31) RRID:RRRC_00658 Cre gene was introduced immediately before the ATG of the mouse choline acetyltransferase (Chat) gene in BAC RP23-246B12. This strain is estimated to carry 6 copies of the transgene at the integration site. 10401208 F344-Tg(Prp-APP,Prp-PS1)19/Rrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm (as of 2019-02-20) RRID:RRRC_00699 The strain was coinjected with two transgenes: one contains the human amyloid beta (A4) precursor protein (hAPP) gene with the Swedish mutation (K595N/M596L) driven by mouse prion promoter (Prp). The other contains the human presenilin 1 gene (PS1) with a deletion of exon 9, also driven by the mouse prion promoter (Prp). Based on segregation patterns, it is believed that the two transgenes have integrated at the same chromosomal site. 10401212 SD-Tg(Thy1.2-NIPA1) Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery RRID:RRRC_00700 Human NIPA1G106R mutation is made by site-directed mutagenesis and then inserted into Thy1.2-promotor cassette. Transgenic vector is injected into fertilized eggs to produce 2 independent lines (A, B) 10401835 WKY.F344-(D17Got91-D17Rat51)/Tja MRC Clinical Centre, London, UK congenic Unknown 17 82277434 96587905 1 - by flanking markers 17 76512697 91678127 1 - by flanking markers 17 74852634 90012722 1 - by flanking markers 17 71003329 85119583 1 - by flanking markers RRID:RGD_10401835 A congenic strain made by introducing a 15 Mbp segment of chromosome 17 from F344/NHsd into WKY/Cruk, this region has the distal end of Cm15 QTL 10401837 WKY.F344-(D17Got91-D17Rat47)/Tja MRC Clinical Centre, London, UK congenic Unknown 17 82277434 85072478 1 - by flanking markers 17 76512697 79573336 1 - by flanking markers 17 74852634 77922655 1 - by flanking markers 17 71003329 73951021 1 - by flanking markers RRID:RGD_10401837 A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja 10401839 WKY.F344-(D17Rat47-D17Rat51)/Tja MRC Clinical Centre, London, UK congenic Unknown 17 85072352 96587905 1 - by flanking markers 17 79573143 91678127 1 - by flanking markers 17 77922462 90012722 1 - by flanking markers 17 73950871 85119583 1 - by flanking markers RRID:RGD_10401839 A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja 10401841 WKY.F344-(D17Rat131-D17Rat51)/Tja MRC Clinical Centre, London, UK congenic Unknown 17 93347783 96587905 1 - by flanking markers 17 87712049 91678127 1 - by flanking markers 17 85994775 90012722 1 - by flanking markers 17 81903264 85119583 1 - by flanking markers RRID:RGD_10401841 A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja 10401843 WKY-Slc39a12em77Tja MRC Clinical Centre, London, UK mutant Unknown Slc39a12em77Tja 10401842 17 88525527 88605947 7 17 83202775 83288616 7 17 81455731 81541742 7 17 77353761 77440384 7 RRID:RGD_10401843 This strain was produced by injecting ZFNs targeted sequence into WKY/Cruk rat embryos. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. 10401845 WKY-Slc39a12em77Tja+/- WKY-Slc39a12em77Tja+/WKY-Slc39a12em77Tja- MRC Clinical Centre, London, UK mutant Unknown Slc39a12em77Tja 10401842 17 88525527 88605947 7 17 83202775 83288616 7 17 81455731 81541742 7 17 77353761 77440384 7 RRID:RGD_10401845 ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. 10401848 WKY-Slc39a12em77Tja-/- WKY-Slc39a12em77Tja-/WKY-Slc39a12em77Tja- MRC Clinical Centre, London, UK mutant Unknown Slc39a12em77Tja 10401842 17 88525527 88605947 7 17 83202775 83288616 7 17 81455731 81541742 7 17 77353761 77440384 7 RRID:RGD_10401848 ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. 10401851 SD-Lepem1Narl National Laboratory Animal Center, Taiwan mutant Unknown Lep 3000 4 55943837 55945938 7 4 56085079 56099209 7 4 56337695 56351818 7 4 57661127 57675262 7 RRID:RGD_10401851 CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermates 10401918 BDIX/HanHsd Envigo Envigo inbred Cryorecovery RRID:RGD_10401918 BDIX/Han maintained at Envigo (Harlan) 10402160 HCR/1Tol High-capacity runners; generation 5 University of Toledo College of Medicine and Life Sciences inbred Unknown RRID:RGD_10402160 HCR/Mco bred till the fifth generation 10402163 HCR/2Tol High-capacity runners; generation 26 University of Toledo College of Medicine and Life Sciences inbred Unknown RRID:RGD_10402163 HCR/Mco bred till the twenty-sixth generation 10402165 LCR/1Tol Low-capacity runners; generation 5 University of Toledo College of Medicine and Life Sciences inbred Unknown RRID:RGD_10402165 LCR/Mco bred till the fifth generation 10402167 LCR/2Tol Low-capacity runners; generation 26 University of Toledo College of Medicine and Life Sciences inbred Unknown RRID:RGD_10402167 LCR/Tol (LCR/Mco) bred till the twenty-sixth generation 10402390 BNW/Jer Brown Norway-wild Agricultural Omega Solutions LLC, Milwaukee, Wisconsin inbred Unknown RRID:RGD_10402390 This is a wild caught strain, characterized by Charles River Laboratories and has been bred brother x sister 10402393 HPE/Jer Hairless pink eye dilute Agricultural Omega Solutions LLC, Milwaukee, Wisconsin inbred Unknown RRID:RGD_10402393 This is a strain of unknown background, and has been bred brother x sister 10402395 HBLS/Jer Hairless black skin pigmented Agricultural Omega Solutions LLC, Milwaukee, Wisconsin inbred Unknown RRID:RGD_10402395 This is a result of a cross of the BNW and HPE, this spontaneous hairless black skin mutation was selected from the F2 offspring for the black hairless quality and subsequently bred brother x sister 10402819 DA-Tph2em2Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Tph2em2Mcwi 10402817 7 54321033 54430706 7 7 58053268 58157949 7 7 58042279 58149220 7 7 50685694 50789424 7 RRID:RGD_10402819 This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. 10402822 DA-Tph2em3Mcwi PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Tph2em3Mcwi 10402820 7 54321033 54430706 7 7 58053268 58157949 7 7 58112644 58112654 8 7 50685694 50789424 7 RRID:RGD_10402822 This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. 10402834 LEW.SS-(D7Rat27-D7Mgh1)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 7 32004504 32004684 1 - by flanking markers 7 35931747 35931926 1 - by flanking markers 7 35867729 35867908 1 - by flanking markers 7 29409683 29409863 1 - by flanking markers RRID:RGD_10402834 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 10402836 LEW.SS-(D8Chm12-D8Rat15)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 8 103548728 103548876 1 - by flanking markers 8 105836600 105836747 1 - by flanking markers 8 106394231 106394378 1 - by flanking markers 8 98968617 98968765 1 - by flanking markers RRID:RGD_10402836 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 10402839 LEW.SS-(D10Mgh6-D10Mgh1)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 10 67677924 67678060 1 - by flanking markers 10 63366082 63366218 1 - by flanking markers 10 64648175 64648311 1 - by flanking markers 10 61345276 61345413 1 - by flanking markers RRID:RGD_10402839 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 10402842 LEW.SS-(D17Rat15-D17Rat51)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 17 37727971 96587905 1 - by flanking markers 17 33949701 91678127 1 - by flanking markers 17 32055882 90012722 1 - by flanking markers 17 31368391 85119583 1 - by flanking markers RRID:RGD_10402842 LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain 10402850 LEW.SS-(D7Rat27-D7Mgh1)(D17Rat15-D17Rat51)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 17;7 37727971;32004504 96587905;32004684 1 - by flanking markers;1 - by flanking markers 17;7 33949701;35931747 91678127;35931926 1 - by flanking markers;1 - by flanking markers 17;7 32055882;35867729 90012722;35867908 1 - by flanking markers;1 - by flanking markers 17;7 31368391;29409683 85119583;29409863 1 - by flanking markers;1 - by flanking markers RRID:RGD_10402850 double congenic strain was generated by combining the two separate congenic strains 10402852 LEW.SS-(D7Rat27-D7Mgh1)(D17Rat15-D17Rat51)(D10Mgh6-D10Mgh1)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 10;7;17 67677924;32004504;37727971 67678060;32004684;96587905 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 10;17;7 63366082;33949701;35931747 63366218;91678127;35931926 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 10;7;17 64648175;35867729;32055882 64648311;35867908;90012722 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 10;17;7 61345276;31368391;29409683 61345413;85119583;29409863 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_10402852 multiple congenic strain was generated by combining the three separate congenic strains 10412325 LE-Tg(Drd1-icre)3Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) Drd1 2518 17 16655926 16658161 1 - by flanking markers 17 13211031 13215581 1 - by flanking markers 17 11099736 11104352 1 - by flanking markers 17 10540440 10544971 1 - by flanking markers RRID:RRRC_00767 The transgene expresses BAC transgenic using rat dopamine receptor 1 promoter to express Cre recombinase in D1R neurons 10412327 LE-Tg(Drd2-iCre)1Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) Drd1 2518 17 16655926 16658161 1 - by flanking markers 17 13211031 13215581 1 - by flanking markers 17 11099736 11104352 1 - by flanking markers 17 10540440 10544971 1 - by flanking markers RRID:RRRC_00768 The transgene expresses BAC transgenic using rat dopamine receptor 2 promoter to express Cre recombinase in D2R neurons 10412329 LE-Tg(Pvalb-icre)2Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) Pvalb 3457 RRID:RRRC_00773 The transgene expresses BAC transgenic using rat parvalbumin promoter to express Cre recombinase in parvalbumin expressing neurons 10413850 SD-Abcc6em1Qlju-/- Thomas Jefferson University, Philadelphia mutant Unknown Abcc6em1Qlju 10413843 1 96448588 96524655 7 1 103042723 103096453 7 1 101954786 102013252 7 1 96447224 96501464 7 RRID:RGD_10413850 This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 10413852 SD-Abcc6em2Qlju-/- Thomas Jefferson University, Philadelphia mutant Unknown Abcc6em2Qlju 10413846 1 96448588 96524655 7 1 103042723 103096453 7 1 101954786 102013252 7 1 96447224 96501464 7 RRID:RGD_10413852 This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 10413854 SD-Abcc6em3Qlju-/- Thomas Jefferson University, Philadelphia mutant Unknown Abcc6em3Qlju 10413847 1 96448588 96524655 7 1 103042723 103096453 7 1 101954786 102013252 7 1 96447224 96501464 7 RRID:RGD_10413854 This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 10413856 SD-Abcc6em4Qlju-/- Thomas Jefferson University, Philadelphia mutant Unknown Abcc6em4Qlju 10413848 1 96448588 96524655 7 1 103042723 103096453 7 1 101954786 102013252 7 1 96447224 96501464 7 RRID:RGD_10413856 This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 10413858 SD-Abcc6em5Qlju-/- Thomas Jefferson University, Philadelphia mutant Unknown Abcc6em5Qlju 10413849 1 96448588 96524655 7 1 103042723 103096453 7 1 101954786 102013252 7 1 96447224 96501464 7 RRID:RGD_10413858 This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 10450489 SD-Bsnem1Ionsz Institute of Neuroscience, Chinese Academy of Sciences Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Bsnem1Ionsz 10450488 8 113364208 113455766 7 8 116227802 116319071 7 8 116873721 116965396 7 8 108784849 108875819 7 RRID:RGD_10450489 CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn 10755350 F344.ZUC-(Leprfa),OLETF-(D14Rat23-D14Rat12)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity Lepr 3001 5;14 122320075;1764386 122503449;41707592 1 - by flanking markers;1 - by flanking markers 5;14 124380327;2222207 124556585;61886417 1 - by flanking markers;1 - by flanking markers 14;5 2227825;120503475 61783215;120682281 1 - by flanking markers;1 - by flanking markers 5;14 116294409;1217606 116477904;39153750 1 - by flanking markers;1 - by flanking markers RRID:RGD_10755350 The F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-Leprfa with F344.OLETF-( D14Rat23-D14Rat12) and then selecting Leprfa -Niddm20 (fa/fa-Nidd2/of) homozygotes 10755352 LH/MavRrrcAek Lyon Hypertensive Department of Pharmacology, University of Iowa, Iowa RGD HRDP, contact HRDP inbred Live Animals (as of 2023-10-25) RRID:RGD_10755352 Lyon Hypertensive rats maintained at Department of Pharmacology, University of Iowa 10755354 LN/MavRrrcAek lyon normotensive Department of Pharmacology, University of Iowa, Iowa RGD HRDP, contact HRDP inbred Live Animals (as of 2024-08-06) RRID:RGD_10755354 Lyon normotensive rats maintained at Department of Pharmacology, University of Iowa 10759544 SD-Gcdhem1Dba Center of Molecular Diseases, CHUV, Switzerland mutant Unknown Gcdhem1Dba 10758636 19 24919470 24925943 7 19 36976120 36982606 7 19 26000497 26006970 7 19 23263215 23269689 7 RRID:RGD_10759544 this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene. 11040455 SHR.BN-(D16Rat88-D16Rat9)/Cub Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 16 819225 22577050 1 - by flanking markers 16 1534408 22473610 1 - by flanking markers 16 1550187 22579213 1 - by flanking markers 16 832236 20872425 1 - by flanking markers RRID:RGD_11040455 Segment of chromosome 16 from BN.Lx/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic 11040519 SHR-Ndufc2em1Mcwi-/+ SHR-Ndufc2em1Mcwi-/Ndufc2em1Mcwi+ PhysGen Knockouts mutant Unknown Ndufc2em1Mcwi 9588537 1 154635889 154642112 7 1 168576274 168582497 7 1 162369993 162370001 8 1 151712157 151712165 8 RRID:RGD_11040519 ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 11040521 SHR-Ndufc2em2Mcwi-/+ SHR-Ndufc2em2Mcwi-/Ndufc2em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_11040521 ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 11040525 SHR-Ndufc2em1Mcwi+/+ SHR-Ndufc2em1Mcwi+/Ndufc2em1Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_11040525 ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 11040527 SHR-Ndufc2em2Mcwi+/+ SHR-Ndufc2em2Mcwi+/Ndufc2em2Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_11040527 ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 11040548 CrlCembe:WI Wistar rats Center for Biological Model Research (CeMBE), Pontifical Catholic University from Rio Grande do Sul (PUCRS), Brazil outbred Unknown RRID:RGD_11040548 CeMBE received breeding stock from Charles River (Crl:WI, strain code 003) in 2014, these are bred according to the Poiley rotation (1960) with permanent monogamous mating. 11040561 WI-Htr7em1Geh Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery Htr7em1Geh 14696714 1 240136279 240260620 7 1 261759122 261879914 7 1 254547964 254671811 7 1 233636442 233761063 7 RRID:RRRC_00745 CRISPR/Cas9 system was used to generate this mutant; this induced 89 base pair deletion in exon 1 of the Htr7 gene. 11040563 SD-Tg(Adra1a)Vccr Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00756 Cardiac specific overexpression of the alpha 1A adrenergic receptor, 40 fold overexpression of the receptor 11040565 LEW-Tg(CAG-OFP)Pic Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery RRID:RRRC_00746 random insertion of a transgene carrying orange fluorescent protein (OFP) driven by the CAG promoter 11040568 W-Tg(RNB1-116K03-EGFP-mRFP)3Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 3 118110320 118244326 1 - by flanking markers RRID:RGD_11040568 The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. 11040570 W-Tg(RNB1-116K03-EGFP-mRFP)20Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 3 118110320 118244326 1 - by flanking markers RRID:RGD_11040570 The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. 11040572 W-Tg(RNB1-116K03-EGFP-mRFP)21Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 3 118110320 118244326 1 - by flanking markers RRID:RGD_11040572 The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. 11040574 W-Tg(RNB1-116K03-EGFP-mRFP)22Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 3 118110320 118244326 1 - by flanking markers RRID:RGD_11040574 The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. 11040577 W-Tg(RNB1-116K03-EGFP-mRFP)41Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 3 118110320 118244326 1 - by flanking markers RRID:RGD_11040577 The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. 11040579 W-Tg(RNB1-116K03-EGFP-mRFP)104Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 3 118110320 118244326 1 - by flanking markers RRID:RGD_11040579 The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. 11040581 TRM.W-Tg(RNB1-186G14)51Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040581 F344/Stm rat BAC clone RNB1-186G14 was microinjected into embryos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. 11040675 TRM.W-Tg(RNB1-186G14)33Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040675 F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. 11040678 TRMR.W-Tg(RNB1-186G14)51Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040678 F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. 11040681 TRMR.W-Tg(RNB1-186G14)33Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm RRID:RGD_11040681 F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. 11040683 SER.TRMR.W-Tg(RNB1-186G14)51Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040683 The sperms from N2 generation rat (ID#252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) were microinjected into SER embyos. The offspring with transgese was backcrossed with SER rats. 11040916 F344-Zeb2em1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Development Zeb2 1307272 RRID:RGD_11040916 Zinc-finger nucleases (ZFNs) method taregting exon 5 of Zeb2 gene (AGCCAAAGCTTGCCTCCA and GACTACTGACTCAAG) was used; This strain has a 5-bp deletion (cagag) and a 2-bp insertion (tc) in exon7 of Nrf2 gene, resulting in a deletion of Glutamine(Q)541. Background strain: F344/Stm 11040918 WTC-furue/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology RRID:RGD_11040918 WTC-furue rat was found in a colony of WTC.ZI-Atrn congenic strain at national cancer research center in 2000. The tremor phenotype is controlled by an autosomal recessive mutation ("furue") 11040920 WTC.Cg-dmyTg(Mrs2-EGFP)39Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040920 CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 11040922 WTC.Cg-dmyTg(Mrs2-EGFP)15Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040922 CHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 11040934 WTC.Cg-dmyTg(Mrs2-EGFP)92Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040934 CHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 11040936 WTC.Cg-dmyTg(Mrs2-EGFP)131Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040936 CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 11040939 STOCK.dmyTg(CMV-Mrs2)Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Mrs2 708529 RRID:RGD_11040939 A transgene containing the CMV promoter and MRS2 gene was microinjected into the pronuclei of fertilized oocytes collected from Wistar rats. Transgenic offspring founder rats were backcrossed with WTC.DMy-dmy rats to obtain dmy/dmy homozygous and also hemizygous for the transgede (dmy/dmy, tg/+). 11040941 SD-Tg(Gfap-Tk1)Jog SD-Tg(Gfap-Tk1) National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2023-12-14) Gfap|Tk1 2679|621014 RRID:RGD_11040941 The rats were originally generated by the University of Michigan Transgenic Animal Model Core, University of Michigan. They used a Crl:CD(SD) sub strain of Sprague-Dawley rats, obtained from Charles River Laboratory (Wilmington, MA, USA). The F1 rats have been bred in the UK with Hsd:Sprague Dawley (Harlan laboratories, UK), which are direct descendants of the original 1925 SD-company colony (Madison, Wisconsin, USA). The GFAP-TK rat was generated by pronuclear injection of a Gfap-Tk Bacterial Artificial Chromosome (BAC) construct, engineered using RedET-mediated homologous recombination methods. 11040946 F344-Prkdcem1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-06-08) Prkdc|Prkdcem1Kyo 1308982|12910095 11 86951420 87169229 7 11 92347175 92565022 7 11 89293547 89510948 7 11 85040790 85258357 7 RRID:RGD_11040946 This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene, resulting a 46-deletion. Background strain: F344/Stm 11040948 F344-Prkdcem2KyoIl2rgem6Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-06-08) Il2rg|Prkdc|Prkdcem2Kyo|Il2rgem6Kyo 621466|1308982|12910096|12910097 X;11 89342055;86951420 89345715;87169229 7;7 X;11 72017856;92347175 72021516;92565022 7;7 11;X 89293547;71165378 89510948;71169078 7;7 11;X 85040790;66395330 85258357;66399026 7;7 RRID:RGD_11040948 This strain was established by Zinc-finger nucleases (ZFNs) method taregting rat Prkdc gene (227-bp deletion) and Il2rg gene (332-bp deletion). Background strain: F344/Stm 11040950 TM-Prkdcem4KyoIl2rgem5Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-07-12) Il2rg|Prkdc|Prkdcem4Kyo|Il2rgem5Kyo 621466|1308982|12910098|12910099 X;11 89342055;86951420 89345715;87169229 7;7 X;11 72017856;92347175 72021516;92565022 7;7 11;X 89293547;71165378 89510948;71169078 7;7 11;X 85040790;66395330 85258357;66399026 7;7 RRID:RGD_11040950 This strain was established by Zinc-finger nucleases (ZFNs) method causing 20-bp deletion in the exon1 of Prkdc gene and a 653-bp deletion Il2rg gene. Background strain: TM/Kyo 11040952 WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm 3;1 6373335;78134304 151449116;187092492 1 - by flanking markers;1 - by flanking markers 3;1 11361699;80946174 162886090;206277202 1 - by flanking markers;1 - by flanking markers 1;3 79689548;6000748 199254774;156656443 1 - by flanking markers;1 - by flanking markers 3;1 10778704;78430536 149313851;182418476 1 - by flanking markers;1 - by flanking markers RRID:RGD_11040952 A congenic strain made by introducing a segments of chromosome 1 and 3 from SHRSP/Izm into WKY/Izm. 11040954 LEA-Tp53tm1(AmCyan1)Ncco National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo RRID:RGD_11040954 LEA rats were provided from Kyoto Bioresource Center in 2006. Then LEA rat ES cells having Oct4-Venus gene and Oct4-Venus Tg rat strain (LEA-Tg(Pou5f1-YFP*)3Ncco) were established. 11040957 F344-Tp53m1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Tp53|Tp53m1Kyo 3889|12792955 10 56399721 56411150 7 10 55932658 55944087 7 10 56186299 56198449 7 10 54300070 54311525 7 RRID:RGD_11040957 This strain was established by ENU mutagenesis (gene-driven) using F344/NSlc and has a missense mutation(R271C). 11040959 SER.TRMR.W-tmTRMAtrnziTg(RNB1-186G14)/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11040959 The sperms from N2 generation rat (NBRP Rat No:252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP Rat No:0677) were microinjected into SER embryos. The offspring with transgene was backcrossed with SER rats. 11040962 F344-Bscl2m1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2019-01-09) Bscl2|Bscl2m1Kyo 1308135|13838727 1 211509675 211518963 7 1 231972073 231983764 7 1 225035956 225046137 7 1 205731828 205743430 7 RRID:RGD_11040962 T239A mutation was found by screening of 4608DNA sample from ENU mutagenesis library KURMA. This strain has a T239A (L80X) nonsense mutation in Bscl2 gene. 11040969 DWH/Iet Dwarfism derived from Wistar Hannover GALAS rats National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Metabolism Tg 3848 7 104035776 104220754 7 7 107399165 107602400 7 7 107467260 107652897 7 7 98418293 98603210 7 RRID:RGD_11040969 derived from Wistar Hannover GALAS rats 11040971 F344-TyrCKitH/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-07-17) Kit|Tyr 620568|1589755 1;14 143641257;34906043 143746315;34984819 7;7 1;14 157322968;34901860 157416594;34979384 7;7 14;1 35072131;151012598 35149638;151106802 7;7 14;1 32547459;141115036 32624694;141210207 7;7 RRID:RGD_11040971 1) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to black. Background strain: F344/Stm 11040974 F344-AsipATyrCKitH/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Asip|Kit|Tyr 2003|620568|1589755 1;14;3 143641257;34906043;145445175 143746315;34984819;145536831 7;7;7 14;1;3 34901860;157322968;156860395 34979384;157416594;156949277 7;7;7 3;1;14 150492010;151012598;35072131 150579870;151106802;35149638 7;7;7 3;1;14 143473584;141115036;32547459 143561170;141210207;32624694 7;7;7 RRID:RGD_11040974 1) point mutation in the exon 2 of Tyrosinase (Tyr) gene (albino phenotype), 2) 19-bp deletion in Asip gene (Agouti phenotype), and 3) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to Agouti. Background strain: F344/Stm 11040977 WI-ROSA26em1(CAG-EGFP)Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-08-08) RRID:RGD_11040977 CAG-GFP vector was knock-in into the rat ROSA26 locus by CRISPR/Cas9 system. Background strain: Crlj:WI. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 11040980 WIC-Dmdem2Kykn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-05-02) Dmd 2507 X 71501362 71671414 7 X 51475950 53700033 7 X 51149358 53519271 7 X 47272324 49504219 7 RRID:RGD_11040980 By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 11040985 WIC-Dmdem3Kykn Keitaro Yamanouchi, The University of Tokyo National BioResource Project for the Rat in Japan mutant Extinct (as of 2017-05-02) Dmd 2507 X 71501362 71671414 7 X 51475950 53700033 7 X 51149358 53519271 7 X 47272324 49504219 7 RRID:RGD_11040985 By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: Deletion of exon3 to exon16 (a part of intron 3 remain). This strain died out in 2015. 11040987 WIC-Tg(Nanog-YFP*)1Utr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Nanog 1303178 RRID:RGD_11040987 BAC (containing rat Nanog gene) vector was injected into Iar:Wistar-Imamichi rats. The construct is as follows: Venus-IRES-puromycin resistance gene. 11041106 LE-Tg(Pvalb-tTA)15Hio National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm RRID:RGD_11041106 background strain #65306; Long-Evans rat #65288; Iar:Long-Evans #65289; Transgene #65306; (1) Parvalbumin (PV) promoter #65306; mouse derived (MGI:97821). PV is calcium-binding protein. (2) tetracycline transactivator (tTA) #65306; Fusion protein of tetracycline repressor (Escherichia coli-derived) and VP16 (Herpes simplex virus-derived). In the absence of Doxycycline (Dox), tTA binds to tetracycline-responsive element (TRE) and expression of TRE-controlled genes can be induced. Vector #65306; pBlueScript (Stratagene), pBACe3.6 (CHORI) 11041108 CV/Iet National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm RRID:RGD_11041108 The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. 11041128 TM.KDP-Cblb(D9Rat13-D9Rat4)(D12Rat5-D12Rat45)(D18Mit9-D18Rat44)/Nyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity Cblb 620535 RRID:RGD_11041128 The Cblb mutation, one of the causative gene in type 1 diabetes of KDP/Tky and KDP alleles in other modifier genes were transferred onto the genetic background of TM:Kyo strain. 11041139 F344-Tg(Dct-lacZ)9Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Development Dct 1564975 RRID:RGD_11041139 The construct was made by connecting a 3,659 bp DNA fragment of rat Dct (dopachrome tautomerase) gene (5'-3237 to 422) with the upstream of lacZ gene. Dct gene was derived from F344/Stm. Background strain: F344/NSlc, plasmid: pLacZ-Basic (Clontech Laboratories) 11041143 PL/Iet National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Development RRID:RGD_11041143 A new mutant gene that causes preaxial polydactyl in the hindlimbs was found in the Jcl:Wistar -derived strain of rats with fused pulmonary lobes (FRL) at the Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology . Genetic analysis has revealed that the new mutation is not closely linked with the fpl gene. This strain was established by sib mating (over 20 generations). 11049145 SD-Crhem1Ionsz Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Crhem1Ionsz 11049142 2 104764023 104765887 7 2 124182919 124184783 7 2 104459999 104461863 7 2 102143055 102144919 7 RRID:RGD_11049145 CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh. 11073612 SS-Chr 13BN-Mir29bem1Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Mir29b1em1Mcwi 11073608 4 58100053 58100133 7 4 58344310 58344390 7 4 59650987 59651067 7 RRID:RGD_11073612 This strain was produced by injecting TALENs targeting the sequence TTTAAATAGTGATTGTCtagcaccatttgaaaTCAGTGTTCTTGGTGGA into SS-Chr 13BN/mcwi rat embryos. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequence 11073719 SD-Drd1em1Ionsz Institute of Neuroscience, Chinese Academy of Sciences Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Drd1em1Ionsz 11073717 17 16655926 16658161 7 17 13211031 13215581 7 17 11099736 11104352 7 17 10540440 10544971 7 RRID:RGD_11073719 CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. 11081142 SD-Pgrem1Soar University of Kansas Medical Center Rat Resource and Research Center mutant Unknown reproduction, neurobiology, and cancer Pgr 3317 8 5784717 5845901 7 8 7113895 7172761 7 8 7128656 7187796 7 8 6072673 6131552 7 RRID:RRRC_00741 Crispr/Cas9 targeting of Exon 3 of rat Pgr gene resulting in a deletion of Exon3 11081149 SD-Esr2em1Soar Rat Resource and Research Center Rat Resource and Research Center mutant Unknown reproduction Esr2em1Soar 40902840 6 98691167 98775299 7 6 108576398 108626196 7 6 99163953 99214711 7 6 94858438 94909630 7 RRID:RRRC_00742 Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 4 11081151 WI-Grm8em1Geh Rat Resource and Research Center Rat Resource and Research Center mutant Unknown neurologic medications, neurologic diseases, normal brain functions Grm8 619858 4 53976781 54902331 7 4 54226315 55151544 7 4 54474344 55409526 7 4 55805762 56731690 7 RRID:RRRC_00744 CRISPR/Cas9 induced 29 base pair deletion in exon 1 11081153 SD-Tg(DIO--iRFP)9Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-02-26) RRID:RRRC_00748 The transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter. 11081177 F344tl toothless (tl) University of Massachusetts Medical School. Rat Resource and Research Center mutant Unknown skeletal and osteoclast biology Csf1tl 12910954 2 203292765 203307968 7 2 229989430 230017945 7 2 210550359 210550360 8 2 195396104 195396105 8 RRID:RRRC_00749 A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon. 11084925 SD-Tg(CD59-HBA1)Bryd Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-01-26) intravascular hemolysis and related sequelae of anemia, hemoglobinemia, and hemoglobinuria CD59 736600 RRID:RRRC_00754 Transgene: human CD59 gene (cDNA) under control of alpha-globin regulatory elements (alpha-globin promoter and alpha hemoglobin locus control region). Upon administration of intermedilysin (ILY), cells expressing human CD59 will be selectively ablated 11084928 WKY-Jundem1Tja Institute of Genetics & Molecular Medicine, University of Edinburgh Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) leukemia, breast cancer Jundem1Tja 11084926 16 19239694 19241529 7 16 20342096 20343775 7 16 20486368 20486368 8 16 18734121 18735799 7 RRID:RRRC_00755 The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation. 11084931 SD-Tg(RIP7-RLuc-YFP)Vpoit Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00757 Transgene: RIP7-RLuc-YFP. This transgene expresses a renilla luciferase-YFP fusion protein under control of the rat insulin 2 gene promoter (RIP7). 11087549 LE-Tg(GFAP-TK)Hcam Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown neurogenesis RRID:RRRC_00764 random insertion of human GFAP promoter driving herpes simples virus thymidine kinase 11087551 SD-Il15em1Soar University of Kansas Medical Center Rat Resource and Research Center mutant Unknown Il15|Il15em1Soar 2887|12910491 19 27487268 27498973 7 19 34532033 34598725 7 19 23553406 23553412 8 19 25696013 25696019 8 RRID:RRRC_00769 Zinc finger nuclease mediated 7bp deletion within exon 2 of the Il15 gene, resulting in a frameshift and premature stop codon. 11087553 SD-Mmp12em1Soar Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2017-08-10) allergy and lung responses and blood coagulation Mmp12|Mmp12em1Soar 620195|12910500 8 4249938 4259675 7 8 5610392 5620294 7 8 5607502 5608165 8 8 4582695 4583358 8 RRID:RRRC_00770 TALEN mediated 664 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon 11354901 SS.SHR-(D9Mco110-D9Mco124)/Bj University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 89709209 1 - by flanking markers 9 94881322 97361568 1 - by flanking markers 9 95162214 97679852 1 - by flanking markers 9 88698037 91114199 1 - by flanking markers RRID:RGD_11354901 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354903 SS.SHR-(D9Mco110-D9Mco121)/Bj University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 89541777 1 - by flanking markers 9 94881322 97223353 1 - by flanking markers 9 95162214 97532584 1 - by flanking markers 9 88698037 90976105 1 - by flanking markers RRID:RGD_11354903 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354924 SS.SHR-(D9Mco113-D9Mco124)/Bj University of Toledo College of Medicine and Life Sciences congenic Unknown 9 87225627 89709209 1 - by flanking markers 9 95118069 97361568 1 - by flanking markers 9 95430880 97679852 1 - by flanking markers 9 91113977 91114199 1 - by flanking markers RRID:RGD_11354924 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354926 SS.SHR-(D9Mco110-D9Got111)/Bj University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 89249893 1 - by flanking markers 9 94881322 96967940 1 - by flanking markers 9 95162214 97276310 1 - by flanking markers 9 88698037 90720113 1 - by flanking markers RRID:RGD_11354926 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354928 SS.SHR-(D9Mco110-D9Mco114)/Bj University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 87252238 1 - by flanking markers 9 94881322 95143906 1 - by flanking markers 9 95162214 95162463 1 - by flanking markers 9 88698037 88698287 1 - by flanking markers RRID:RGD_11354928 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11354930 SS.SHR-(D9Mco115-D9Mco124)/Bj University of Toledo College of Medicine and Life Sciences congenic Unknown 9 89708990 89709209 1 - by flanking markers 9 95727999 97361568 1 - by flanking markers 9 96024146 97679852 1 - by flanking markers 9 89541728 91114199 1 - by flanking markers RRID:RGD_11354930 This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. 11528524 LE-Tg(Slc17a6-icre)3Ottc Optogenetics and Transgenic Technology Core Optogenetics and Transgenic Technology Core transgenic Extinct (as of 2019-02-01) RRID:RGD_11528524 The BAC-based transgene contains Cre recombinase is expressed from rat Slc17a6 promoter. 11528588 SHR.LEW-(D4Rat76-D4Mgh11)/Anra Laboratorio de Genetica do Comportamento, Departamento de Biologia Celular, Embriologia e Genetica, Centro de Ciencias Biologicas, Universidade Federal de Santa Catarina, Florianopolis, Santa Catarina, Brazil congenic Unknown 4 84886545 171204531 1 - by flanking markers 4 150964994 230565226 1 - by flanking markers 4 86312589 168047091 1 - by flanking markers 4 85253748 167139601 1 - by flanking markers RRID:RGD_11528588 This congenic strain contains a LEW chromosome 4 segment containing a QTL affecting anxiety-related response transferred to the SHR background. 11530008 CDS.CDR-(D4Rat9-D4Rat153)/Ygl Laboratory for Molecular Medicine and Israeli Rat Genome Center Barzilai University Med Ctr Campus 2 Hahistadrut St Ashkelon 78278, Israel congenic Unknown 4 23537363 23537525 1 - by flanking markers 4 23916923 23917084 1 - by flanking markers 4 23991721 23991882 1 - by flanking markers 4 26907285 26907447 1 - by flanking markers RRID:RGD_11530008 This CDS congenic containing genomic elements from CDR was created by crossing the consomic strain CDS-Chr 4CDR/Ygl(RGD:4889499) with CDS. The congenic carries QTL affecting diabeties initation. 11530011 CDS.SBN-(D13Rat85-D13Mit4)/Ygl Laboratory for Molecular Medicine and Israeli Rat Genome Center Barzilai University Med Ctr Campus 2 Hahistadrut St Ashkelon 78278, Israel congenic Unknown 13 72141292 90551272 1 - by flanking markers 13 79488981 97381801 1 - by flanking markers 13 74568378 92916783 1 - by flanking markers 13 69060519 86800898 1 - by flanking markers RRID:RGD_11530011 This CDS congenic containing the genomic element from SBN/Ygl was created by crossing the SBN/Ygl with CDS. The congenic carries QTL affecting diabeties development. 11530028 iNP-Npyem6Sage/Iusm Department of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USA mutant Unknown Npyem6Sage 11530022 4 78038013 78045187 7 4 144233753 144240956 7 4 79557856 79565059 7 4 78881294 78888495 7 RRID:RGD_11530028 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Npy into iNP/Iusm embryos. A 26-bp deletion, including 6 bp in intron 1 and 20 bp in exon 2 in rat Npy was created in the mutant founders. These mutant founders were backcrossed with iNP/Iusm to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. 11531089 SD-F8em1Sage+/-/Novo Novo Nordisk, Maaloev, Denmark mutant Unknown F8em1Sage 11531096 18 121134 162008 7 18 413447 444491 7 18 367862 399242 7 18 140848 172330 7 RRID:RGD_11531089 The heterozygous ZFN mutant rats were produced by backcrossing mutant founders (SD/Novo-F8em1Sage) with Sprague Dawley. Genotyping of the offspring was carried out by PCR amplification of the deletion fragment which caused a premature translation stop. 11531091 SD-F8em1Sage-/-/Novo Novo Nordisk, Maaloev, Denmark mutant Unknown F8em1Sage 11531096 18 121134 162008 7 18 413447 444491 7 18 367862 399242 7 18 140848 172330 7 RRID:RGD_11531091 The homozygous F8 mutant rats were produced by intercrossing the heterozygous ZFN mutants (SD-F8em1Sage+/-/Novo) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of the deletion fragment which caused a premature translation stop. 11531094 SD-F8em1Sage/Novo Novo Nordisk, Maaloev, Denmark mutant Unknown F8em1Sage 11531096 18 121134 162008 7 18 413447 444491 7 18 367862 399242 7 18 140848 172330 7 RRID:RGD_11531094 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat F8 into Sprague Dawley embryos. A premature translation stop in rat F8 was created in the mutant founders carrying a 13-bp deletion in exon 16. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. 11531104 iNP-Npyem6Sage+/-/Iusm Department of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USA mutant Unknown Npyem6Sage 11530022 4 78038013 78045187 7 4 144233753 144240956 7 4 79557856 79565059 7 4 78881294 78888495 7 RRID:RGD_11531104 The heterozygous ZFN mutant rats were produced by backcrossing mutant founders with iNP/Iusm. Genotyping of the offspring was carried out by PCR amplification of a 26-bp deleted fragment, including 6 bp in intron 1 and 20 bp in exon 2. 11531106 iNP-Npyem6Sage-/-/Iusm Department of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USA mutant Unknown Npyem6Sage 11530022 4 78038013 78045187 7 4 144233753 144240956 7 4 79557856 79565059 7 4 78881294 78888495 7 RRID:RGD_11531106 The homozygous Npy mutant rats were produced by intercrossing the heterozygous ZFN mutants (iNP-Npyem6Sage+/- /Iusm) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of a 26-bp deleted fragment, including 6 bp in intron 1 and 20 bp in exon 2. 11532753 F344.ZUC-(Leprfa),OLETF-(D5Rat166-D5Rat90)/Tj National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity RRID:RGD_11532753 The F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-Leprfa with F344.OLETF-( D5Rat166-D5Rat90) and then selecting Leprfa -Niddm24 (fa/fa-Nidd6/of) homozygotes 11535000 PKD/Mhm PKD Medical Research Centre, Klinikum Mannheim, University of Heidelberg, Mannheim, Germany inbred Unknown (as of 2016-11-29) Anks6PKD 11534996 RRID:RGD_11535000 The colony of inbred PKD/Mhm rats was established in the laboratory in Mannheim after 18 additional generations of inbreeding of the Han:SPRD (cy/+).The mutation was a C to T transition that replaces an arginine by a tryptophan at amino acid 823 in the protein sequence. 11535031 SD-Tg(hCMV-Anks6PKD)Mhm Medical Research Centre, Klinikum Mannheim, University of Heidelberg, Mannheim, Germany transgenic Unknown (as of 2016-11-29) Anks6PKD 11534996 RRID:RGD_11535031 This transgenic strain was derived by pronuclear microinjection of fertilized Sprague Dawley oocytes with a 2.8-kb mutated Anks6PKD cloned between a human cytomegalovirus promoter upstream and an intron as well as a polyadenylation signal of SV40 downstream. 11535955 Crlj:CD(SD) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_11535955 A colony of outbred CD(SD) (RGD: 734476) maintained in the Charles River Laboratories Japan. 11553848 WKY-Trpv4em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Trpv4em5Mcwi 11553847 12 43226933 43265889 7 12 49492064 49529956 7 12 47698915 47737902 7 12 41938533 41977517 7 RRID:RGD_11553848 CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene. 11553850 WKY-Trpv4em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Trpv4em4Mcwi 11553851 12 43226933 43265889 7 12 49492064 49529956 7 12 47698915 47737902 7 12 41938533 41977517 7 RRID:RGD_11553850 CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene. 11553852 SS-Vnn1em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Vnn1em2Mcwi 11553853 1 22087290 22097592 7 1 24089365 24099667 7 1 22614832 22625134 7 1 21537084 21547395 7 RRID:RGD_11553852 CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos 11553855 SS-Vnn1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Vnn1em1Mcwi 11553856 1 22087290 22097592 7 1 24089365 24099667 7 1 22621640 22621646 8 1 21537084 21547395 7 RRID:RGD_11553855 CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos 11553858 SS-Rbm20em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Rbm20em5Mcwi 11553857 1 259905545 260144190 7 1 281783646 282003053 7 1 274391932 274589816 7 1 252836316 252836436 8 RRID:RGD_11553858 ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene. 11553860 DA-Scn5aem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Scn5aem2Mcwi 11553859 8 124446479 124545301 7 8 127375781 127471879 7 8 128169191 128266681 7 8 119288929 119289038 8 RRID:RGD_11553860 ZFN system was used to introduce a mutation in the Scn5a gene of DA/MolTac rat embryos. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene. 11553862 SS-Shc1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Shc1em1Mcwi 11553854 2 181616581 181628144 7 2 208159786 208171348 7 2 188745503 188757066 7 2 174837937 174849538 7 RRID:RGD_11553862 ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene. 11553873 LE-Fmr1em2Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Autism Rat Model Resource, Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) Fmr1em2Mcwi 11553872 X 154756031 154793782 7 X 154703634 154703635 8 X 147240239 147278057 7 RRID:RGD_11553873 CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp insertion in exon 8 of the Fmr1 gene. 11553875 LE-Fmr1em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Fmr1em4Mcwi 11553874 X 154756031 154793782 7 X 154703634 154703635 8 X 147240239 147278057 7 RRID:RGD_11553875 CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp deletion in exon 8 of the Fmr1 gene. 11553877 SS-P2rx1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Extinct (as of 2017-07-18) P2rx1em1Mcwi 11553876 10 59889933 59904985 7 10 59305737 59320797 7 10 59566268 59581328 7 10 57626708 57626731 8 RRID:RGD_11553877 CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene. 11553881 SS-Rbm20em10Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Rbm20em10Mcwi 11553880 1 259905545 260144190 7 1 281783646 282003053 7 1 274391932 274589816 7 1 252836430 252836442 8 RRID:RGD_11553881 ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. 11553883 SS-Rbm20em8Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Rbm20em8Mcwi 11553882 1 259905545 260144190 7 1 281783646 282003053 7 1 274391932 274589816 7 1 252836431 252836488 8 RRID:RGD_11553883 ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene. 11553886 SD-Tp53em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Tp53em3Mcwi 11553885 10 56399721 56411150 7 10 55932658 55944087 7 10 56186299 56198449 7 10 54300070 54311525 7 RRID:RGD_11553886 ZFN system was used to introduce a mutation in the Trp53 gene of Crl:SD rat embryos.The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. 11553889 SS-Trpc3em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm; Cryorecovery (as of 2018-10-10) Trpc3em2Mcwi 11553887 2 123117180 123184016 7 2 142945309 143022844 7 2 123329954 123467574 7 2 119481313 119619333 7 RRID:RGD_11553889 CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene. 11553892 SS-Trpc3em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-10) Trpc3em1Mcwi 11553891 2 123117180 123184016 7 2 142945309 143022844 7 2 123329954 123467574 7 2 119481313 119619333 7 RRID:RGD_11553892 CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene. 11553894 SS-Tpcn2em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Tpcn2em1Mcwi 11553893 1 205702971 205732664 7 1 225286480 225316685 7 1 218419182 218448902 7 1 200416538 200446252 7 RRID:RGD_11553894 ZFN system was used to introduce a mutation in the Tpcn2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. 11553896 SHRSP-Spp1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Spp1em1Mcwi 11553895 14 6653086 6658937 7 14 6673686 6679965 7 14 5312021 5312025 8 RRID:RGD_11553896 CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. 11553899 WKY-Trpv2em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Trpv2em1Mcwi 11553898 10 48764894 48786150 7 10 48686500 48707996 7 10 48903540 48925036 7 10 47265524 47294263 7 RRID:RGD_11553899 CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. 11553902 SS-Trpc6em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Trpc6em3Mcwi 11553901 8 5472515 5577537 7 8 6799564 6904623 7 8 6811543 6917534 7 8 5759387 5864000 7 RRID:RGD_11553902 CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene. 11553904 SS-Shc1em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Shc1em3Mcwi 11553903 2 181616581 181628144 7 2 208159786 208171348 7 2 188745503 188757066 7 2 174837937 174849538 7 RRID:RGD_11553904 ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene. 11553908 SS-Trpc6em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Trpc6em4Mcwi 11553907 8 5472515 5577537 7 8 6799564 6904623 7 8 6811543 6917534 8 8 5759387 5864000 7 RRID:RGD_11553908 CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. 11553912 SS-Trpc6em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Trpc6em1Mcwi 11553911 8 5472515 5577537 7 8 6799564 6904623 7 8 6811543 6917534 7 8 5759387 5864000 7 RRID:RGD_11553912 CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. 11553914 SS-Shc1em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2017-01-26) Shc1em4Mcwi 11553913 2 181616581 181628144 7 2 208159786 208171348 7 2 188745503 188757066 7 2 174837937 174849538 7 RRID:RGD_11553914 ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of theShc1 gene. 11553916 SS-Shc1em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals (as of 2017-01-25) Shc1em5Mcwi 11553915 2 181616581 181628144 7 2 208159786 208171348 7 2 188745503 188757066 7 2 174837937 174849538 7 RRID:RGD_11553916 ZFN system was used to introduce a T>G transversion mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a substitution to generate S36A in Exon 2 of theShc1 gene. 11554327 BDIX.BDIV-D10Mit3-D10Mgh16/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Live Animals (as of 2016-10-26) RRID:RGD_11554327 The BDIX.BDIV-D10Mit3-D10Mgh16/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 11554329 BDIX.BDIV-D10Got1-D10Rat45/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Live Animals (as of 2016-10-26) 10 4697541 20233281 1 - by flanking markers 10 3662335 20046466 1 - by flanking markers 10 4835638 20170031 1 - by flanking markers 10 4765527 19816042 1 - by flanking markers RRID:RGD_11554329 The BDIX.BDIV-D10Got1-D10Rat45/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 11556280 ACI.Cg-Du/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-10) Development RRID:RGD_11556280 Downunder (Du) mutation is introduced into ACI/Kyo strain. 11556282 WKY-Tg(UBC-sb10)3Wmukf National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-10) RRID:RGD_11556282 This strtain has transgene that express SleepingBeauty transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown) 11561897 Crl:WI-Lrapem1Geh University of Colorado mutant Unknown behavior, addiction Lrapem1Geh 11561896 12 40910874 40918231 7 12 39016258 39017876 7 12 33562482 33574339 7 RRID:RGD_11561897 The CRISPR/Cas9 genome editing system was used to generate this knockout mutant rat strain. It created a 618-bp deletion in rat Lrap gene. The recipient zygotes were the Wistar rats from Charles River. 11561902 WKY-Tg(UBC-pb)5Wmukf National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-10) RRID:RGD_11561902 This strtain has transgene that expresses piggyBac transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown) 11561905 WKY-Tg(Gabrb1Tn(pb-Bhr2)1Wmukf) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-10) Gabrb1|Gabrb1Tn(pb-Bhr2)1Wmukf 2649|11561925 14 38530259 39005615 1 - by flanking markers 14 38453142 38924073 1 - by flanking markers 14 38631192 39112598 1 - by flanking markers 14 36068725 36548946 1 - by flanking markers RRID:RGD_11561905 Transposed "Bhr2" was inserted into intron 4 of Gabrb1 gene by piggyBac (pb) transposon system. 11561909 WKY-Tg(Samt4Tn(pb-Bhr7)1Wmukf) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Extinct (as of 2016-11-10) Samt4Tn(pb-Bhr7)1Wmukf 11561928 RRID:RGD_11561909 Transposed "Bhr7" was inserted into the first Met-coding exon region of rat Samt4 gene by piggyBac (pb) transposon system. 11561970 WKY-Tg(Zbtb20Tn(pb-Bhr7)1Wmukf) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-15) Zbtb20Tn(pb-Bhr7)1Wmukf 11561972 RRID:RGD_11561970 Transposed "Bhr7" was inserted into the Intron 3 of Zbtb20 gene by piggyBac (pb) transposon system. 11561976 WKY-Tg(Plcb1Tn(pb-Bhr2)1Wmukf) National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-15) Plcb1Tn(pb-Bhr2)1Wmukf 11561974 RRID:RGD_11561976 Transposed "Bhr2" was inserted into into Plcb1 gene by piggyBac (pb) transposon system. 11561979 LE-Tg((ROSA)26Sor-CAG-tdTomato)9Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown (as of 2016-11-16) RRID:RGD_11561979 Background strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien(UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato(Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9) 11564343 LE-Tg((ROSA)26Sor-CAG-tdTomato)14Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-16) RRID:RGD_11564343 Background strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien (UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato (Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9) 11564346 F344-Aspaem31Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-16) Aspaem31Kyo 11564344 10 60178509 60199207 7 10 59578788 59627450 7 10 59839693 59888244 7 10 57891704 57945267 7 RRID:RGD_11564346 The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord. 11564349 F344-Aspaem34Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-16) Aspaem34Kyo 11564348 10 60178509 60199207 7 10 59578788 59627450 7 10 59839693 59888244 7 10 57891704 57945267 7 RRID:RGD_11564349 The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord. 11564350 SCR/Sscr Shumiya Cataract Rat congenic Cryopreserved Embryo (as of 2016-11-16) Fdft1|Lss 61834|620955 RRID:RGD_11564350 Genetic Cataract rat SCR(Shumiya Cataract Rat)was segrigated from a SHR-fa strain colony that developed nuclear cataract at adult stage. This strain is a double mutant caused by recessive gene (ctr1) and dominant lethal gene (Ctr2l) and established by Dr. Shumiya at Tokyo Metropolitan Institute of Gerontology. In 2003, this strain was introduced to Kyoritsu College of Pharmacy (keio University Faculty of Pharmacy). ctr1 is lanosterol synthase (Lss) and Ctr2 is farnesyl diphosphate farnesyl transferase 1 (Fdft1). 11565091 F344-Ccdc85cem1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-18) Ccdc85cem1Kyo 11565090 6 132572485 132641431 7 6 141284186 141353658 7 6 132113806 132183434 7 6 127113440 127184328 7 RRID:RGD_11565091 TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo. Rats developed hydrocephalus and Subcortical heterotopia. Homozygous rats die within 1 month of hydrocephalus. 11565094 F344.LEC-(D4Nirs8-D4Nirs2)/Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-18) RRID:RGD_11565094 This strain was established by crossing F344.LEC-xhs1/1Nrs (NBR-rat #0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is similar to F344.LEC-xhs1/1Nrs. 11565097 F344.LEC-(D4Rat54-D4Got87)/Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-18) RRID:RGD_11565097 This strain was established by crossing F344.LEC-xhs1/1Nrs (NBRrat NO: 0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is different from F344.LEC-xhs1/1Nrs. 11565100 NMC/Nrs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-18) RRID:RGD_11565100 This strain was found in a colony of F344.LEC-xhs1/1Nrs (NBRP Rat No: 0293). As to radiosensitivity gene, D4Nirs8-D4Rat45 region is LEC type. Affected females with dominant gene on Chr10 develop mammary gland cancer after pregnancy (histological type is undetermined). In many cases, this neoplastis lesion resolve spontaneously after delivery. No homozygous female is obtained at this time. Affected male rats don't show any phenotype. 11565116 LE-Tg(Chat-tdTomato)3Yyan National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-21) RRID:RGD_11565116 Chat-tdToamto-polyA-FRT sequence was inserted into fertilized egg of Long Evans strain (Japan SLC). vector: BAC clone (RP23-246B12) from a C57BL/6J mouse genomic BAC library (BACPAC Resource Center, Oakland, CA, USA) 11565122 SHR.Cg-Leprcp-Tg(APOB)110/Dmcr National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2016-11-21) Leprcp 11570565 RRID:RGD_11565122 A BAC clone (CTD-2257F14) containing whole human APOB gene was maicroinjected into fertilized eggs of Wistar rats (Takeda Pharmaceutical Company). Then this Tg rats were backcrossed 9 times with SHR/NDmcr-cp rats (NBRP No.0446, SHR.Cg-Leprcp/NDmcr)(RGD: 2306033) 11565125 SHRSP.SHR-(D18Rat87-D18Got66)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) 18 66217583 80805774 1 - by flanking markers 18 64552961 80162163 1 - by flanking markers 18 65366908 81115720 1 - by flanking markers 18 63140870 77629361 1 - by flanking markers RRID:RGD_11565125 A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. 11565128 SHRSP.SHR-(D18Rat73-D18Rat52)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) 18 52290789 61290878 1 - by flanking markers 18 50804228 59735418 1 - by flanking markers 18 51609032 60532087 1 - by flanking markers 18 49999958 58536311 1 - by flanking markers RRID:RGD_11565128 A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. 11565130 SHRSP.SHR-(D1Rat23-D1Rat213)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) Diabetes Obesity 1 78685103 81548909 1 - by flanking markers 1 81497710 84537228 1 - by flanking markers 1 80231217 83282814 1 - by flanking markers 1 78970983 81777720 1 - by flanking markers RRID:RGD_11565130 A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm 11565132 SHRSP.SHR-(D1Rat95-D1Got87)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) Diabetes Obesity 1 66832211 85828306 1 - by flanking markers 1 73096563 92291485 1 - by flanking markers 1 71706292 91156803 1 - by flanking markers 1 68123229 86030749 1 - by flanking markers RRID:RGD_11565132 A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm 11565135 WKY.SHRSP-(D1Rat25-St8sia2)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Unknown (as of 2016-11-21) St8sia2 621843 1 72231246 129191810 1 - by flanking markers 1 67633807 136423629 1 - by flanking markers 1 66845268 135406699 1 - by flanking markers 1 72703913 127838017 1 - by flanking markers RRID:RGD_11565135 A congenic strain established by introducing segments of chromosome 1 from SHRSP/Izm into WKY/Izm. 11565826 F344-Ttnem1Sage SAGE Laboratories Duke-National University of Singapore, Singapore mutant Unknown (as of 2016-11-28) Ttnem1Sage 11565825 3 59404023 59665308 7 3 70138896 70408647 7 3 63565160 63837815 7 3 61652432 61924912 7 RRID:RGD_11565826 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence. 11565829 F344-Ttnem2Sage SAGE laboratories Duke-National University of Singapore, Singapore mutant Unknown (as of 2016-11-28) Ttnem2Sage 11565827 3 59404023 59665308 7 3 70138896 70408647 7 3 63565160 63837815 7 3 61652432 61924912 7 RRID:RGD_11565829 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0). 11567272 SD-Mecp2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2016-12-13) Autism, Rett syndrome, Cognition Mecp2em1Sage 11568035 X 159980599 160035260 7 1 152390961 152461647 7 X 156650389 156713813 7 X 151781177 151844687 7 RRID:RGD_11567272 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). 11568040 SD-Fmr1em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-09) Autism, Fragile X syndrome Fmr1em1Sage 11568041 X 154756031 154793782 7 X 154703661 154703782 8 X 147258833 147258954 8 RRID:RGD_11568040 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp. This mutant rat has a knockout of Fmr1. 11568058 SD-Nrxn1em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2018-03-22) Autism, Schizophrenia Nrxn1em1 11568059 6 14050929 15354069 7 6 23843153 25145167 7 6 13886757 15191660 7 6 3177788 4323848 7 RRID:RGD_11568058 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in exon1 resulting in knockout of Nrxn1. 11568062 SD-Ptenem1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2016-12-13) Autism, cancer Ptenem1Sage 11568063 1 236771027 236837261 7 1 258651829 258717009 7 1 251421814 251487634 7 1 230630443 230697070 7 RRID:RGD_11568062 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten. 11568067 SD-Grm5em1Sage Horizon Discovery Horizon Discovery mutant Live Animals; Cryopreserved Embryo (as of 2016-12-13) Autism, Fragile X syndrome, Cognition, Schizophrenia, Anxiety, Pain Grm5em1Sage 11568068 1 143857225 144477419 7 1 157517676 158096869 7 1 151207846 151785038 7 1 141310069 141884980 7 RRID:RGD_11568067 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot. 11568071 SD-Metem1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2016-12-07) Autism Spectrum Disorders, Synaptic Plasticity, Autoimmune disorders Metem1Sage 11568072 4 43134183 43211355 7 4 45354290 45461638 7 4 44747467 44854628 7 4 45790456 45898139 7 RRID:RGD_11568071 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met. 11568646 SD-Cntnap2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-05) Autism Spectrum Disorders, Synaptic Plasticity, Language disorders Cntnap2em1Sage 11568647 4 74277978 75440178 7 4 140006078 141697964 7 4 74700539 77025463 7 4 74109455 76366434 7 RRID:RGD_11568646 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 11568700 SD-Nlgn3em1Sage Horizon Discovery Horizon Discovery mutant Live Animals; Cryopreserved Embryo (as of 2016-12-13) Autism, Asperger's syndrome, Synaptic plasticity Nlgn3em1Sage 11568701 X 89376193 89398665 7 X 72051846 72075119 7 X 71209388 71209445 8 X 66439348 66439405 8 RRID:RGD_11568700 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. 11568703 SD-Cacna1cem1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2016-12-13) Autism, Timothy syndrome, Long QT syndrome, Schizophrenia,Bipolar disorder Cacna1cem1Sage 11568704 4 154895691 155517389 7 4 216562477 217184927 7 4 150635808 151270790 7 4 151764138 152379454 7 RRID:RGD_11568703 The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. This model contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an early stop codon in exon 6. 11667072 Sway/Rrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00538 This phenotype arose spontaneously during the third generation of selective breeding for decreased intravenous drug self-administration in Wistar rats (see RGD:6482259). After 10 weeks of age no drug administration is needed to see phenotype in which animals exhibits motor abnormalities with degenerative changes in cerebellar Purkinje cells. It appears to be transmitted in an autosomal recessive pattern. Animals have an abnormal swaying gait, which is readily identified as a slow (2 to 3 cycles per second) tremor. 11667077 SD-Esr2em2Soar Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) reproduction, neu7roscience, environmental healthg, cardiovascular RRID:RRRC_00719 Zinc finger nuclease targeting of exon 3 of the rat estrogen receptor-2 gene resulting in the deletion of exon 3. 11667079 SD-Pgrem2Soar Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Reproduction, neuroscience, environmental health, cardiovascular RRID:RRRC_00720 zinc finger nucleases were used to generate a 136 bp deletion within the first exon of the progesterone receptor, resulting in a frameshift, premature stop codon, and a null. 11667081 BDIV-Myo5a/StcRrrc Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Sperm (as of 2017-01-26) Myo5am1Stc 42721971 RRID:RRRC_00784 Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats 11667084 WCat Wistar Cataract Rat Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00704 ENU induced total juvenile cataract in inbred Wistar. 11667088 SD-Esr1em1Soar Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) A range of experimentation examining the actions of estrogen in reproduction, cancer, cardiovascular, and neurobiology. Esr1em1Soar 12910736 1 35523680 35759891 7 1 42534049 42935434 7 1 41358808 41359289 8 1 41272347 41272828 8 RRID:RRRC_00701 zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out. 11667094 W-Tg(CFH)Crl Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00705 micro-injected with a ~6 kb transgenic cassette, which contained a CMV enhancer, chicken beta-actin promoter, the full-length cDNA encoding human complement factor H, and a rabbit beta-globin poly(A) sequence that had been isolated and purified from plasmid pCAGGS-human fH. 11667096 WIST-Tulane Tulane rat Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) RRID:RRRC_00721 Male Wistar rats with inbred congenital unilateral right hydronephrosis were bred from the colony described in 1979 by Friedman et al. 12437069 SS.BN-(D13Rat25-rs198199323)-Btg2em21Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Btg2em21Mcwi 12798564 13 47026986 47030745 7 13 55966299 55970058 7 13 50913185 50916944 7 13 45535534 45535535 8 RRID:RGD_12437069 CRISPR/Cas9 system was used to introduce a mutation in the Btg2 gene of SS.BN-(D13Rat25-rs198199323)/Mcwi rat embryos. 12437071 SS.BN-(D13Rat25-rs198199323)-Btg2em24Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Btg2em24Mcwi 12798565 13 47026986 47030745 7 13 55966299 55970058 7 13 50913185 50916944 7 13 45535534 45535535 8 RRID:RGD_12437071 CRISPR/Cas9 system was used to introduce a 2-bp insertion in the exon 1 in the Btg2 gene of SS.BN-(D13Rat25-rs198199323)/Mcwi rat embryos. 12738212 SD-Tg(LRRK2*R1441C)268Rwm Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-08-22) Parkinson's Disease LRRK2 1353141 RRID:RRRC_00775 These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the R1441C mutation and fused to a YPet reporter tag. 12738218 SD-GEPR-9 Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-30) seizure RRID:RRRC_00304 Genetically Epilepsy-Prone Rats (GEPR-9) have severe levels of seizure predisposition. This colony was bred to exhibit clonic convulsions (severe seizures with an ARS of 9) following a single wild running phase in response to sound. Seizures model human generalized tonic/clonic seizures. 12738365 SD-Rag2em2Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag2em2Mcwi 12738366 3 86764810 86773438 7 3 97851318 97859615 7 3 91191837 91200134 7 3 87907941 87907942 8 RRID:RGD_12738365 This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp frameshift deletion,Atgttgagat, in exon 2. 12738372 BDIX.BDIV-D6Mit1-D6Mgh2/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown RRID:RGD_12738372 The BDIX.BDIV-D6Mit1-D6Mgh2/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 12738388 BDIX.BDIV-D6Rat132-D6Mgh3/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown RRID:RGD_12738388 The BDIX.BDIV-D6Rat132-D6Mgh3/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 12738394 BDIX.BDIV-D6Mit8-D6Rat229/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown RRID:RGD_12738394 The BDIX.BDIV-D6Mit8-D6Rat229/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 12738452 ACI.F344-ApcPircUwm University of Wisconsin-Madison, Madison, Wisconsin Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-06) ApcPirc 1554322 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RRRC_00718 This strain develops twice the number of colonic tumors as the F344-ApcPircUwm rats (RGD:1641862). Stop codon mutation at amino acid 1137 of the Apc gene. Nucleotide chr18:26,785,272 (Baylor 3.4/rn4) A to T transversion. 12738455 DA.F344-(D10Got155-D10Nsi55) The Feinstein Institute for Medical Research. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-06) 10 105131088 105131258 1 - by flanking markers 10 104692565 104692735 1 - by flanking markers 10 103609431 103609601 1 - by flanking markers 10 100299840 100300011 1 - by flanking markers RRID:RRRC_00674 The Cia5a10 (D10Got155-D10Nsi55) interval was introgressed from F344 into DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a10) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. 12738457 DA.F344-(D10Got152-D10Mcw1) The Feinstein Institute for Medical Research. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-06) 10 102307572 109926395 1 - by flanking markers 10 100889652 109306076 1 - by flanking markers 10 101211245 109712946 1 - by flanking markers 10 97730563 105813458 1 - by flanking markers RRID:RRRC_00675 DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a5)(D10Got152-D10Mcw1) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. 12738460 DA.F344-(D7Rat15-D7Mit2) The Feinstein Institute for Medical Research. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-06) 7 107428268 123191874 1 - by flanking markers 7 110975825 125794357 1 - by flanking markers 7 111043360 126080454 1 - by flanking markers 7 101772987 116294546 1 - by flanking markers RRID:RRRC_00681 The Cia4d (D7Rat15 -D7Mit2) interval was introgressed from F344 into DA/BklArb rats through 7 backcrosses into DA/BklArb rats followed by 3 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia4d) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. 12738466 DA-Asipm1 Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-06) This strain can be used to generate pigmented embryos for use with albino ES cell lines. Asipm1 12738467 3 145445175 145536831 7 3 156860395 156949277 7 3 150492010 150579870 7 3 143473584 143561170 7 RRID:RRRC_00542 Developed by Beth Bauer, University of Missouri. Spontaneous mutation of agouti gene with resultant black coat color from Sprague Dawley (SD) X Dark Agouti (DA). Albino mutation and hooded mutation have been bred out of this line so that only the agouti mutation remains. 12743611 SS-Renem1Mcwi+/- SS-Renem1Mcwi+/Renem1Mcwi- PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Renem1Mcwi 4139863 13 46262936 46275213 7 13 55555583 55566812 7 13 50502724 50513953 7 13 44803412 44803421 8 RRID:RGD_12743611 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous 12743623 BN.F344-ApcPirc Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-10) ApcPirc 1554322 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RRRC_00783 The phenotype of the BN.F344-ApcPirc congenic shows high resistance to cancer. The heterozygous animals get spontaneous intestinal lesions (small intestinal and colonic)starting at 60 days of age in males. BN animals are highly resistant to tumor development and can live over 2 years. 12743627 cNLH-Cat congenital NLH Cataract Rat Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-10) RRID:RRRC_00702 inbreeding since 2003, juvenile total cataract developed in cNLH line. cNLH = congenital non-learned helpless. congenital non-learned helpless and congenital learned helpless (cLH)lines were developed from outbred Dpargue-Dawley from Charles River. 12743630 BN-Spib spitzenborduere (spib) Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-10) RRID:RRRC_00703 Retinae display marked rosett formation in the outer nuclear layer; in the funduscopy irregular, dark pigment flecks are observed, which cannot be identified in the histology. Linkage analysis indicating at least two genes interacting. 12743640 DA.E3-(RT1-DMa-Ggnbp1) Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-13) RT1-DMa|Ggnbp1 735053|1359729 20 4843458 5271653 1 - by flanking markers 20 7302036 7690734 1 - by flanking markers 20 3935512 5625320 1 - by flanking markers 20 4707028 5116185 1 - by flanking markers RRID:RRRC_00715 The Tcs1 QTL in DA.E3-(RT1-DMa-Ggnbp1)(DA.1IR85) contains a ~0.5 Mb (min- max 0.43 - 0.63 Mb) insert from DA.1I (RGD:10002743, DA.E3-(D20Rat42-D20Rat49)/Rhd). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, inclduing the RT1-B and RT1-D genes. 12743645 DA.KHW-(RT1-Db1-RT1-DMb) Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) RT1-DMb|RT1-Db1 735096|1593282 20 4671489 4836772 1 - by flanking markers 20 6167759 7295355 1 - by flanking markers 20 3945383 4097190 1 - by flanking markers 20 4548664 4700340 1 - by flanking markers RRID:RRRC_00712 The Tcs2 QTL in DA.KHW-(RT1-Db1-RT1-DMb)(DA.1HR10) contains a ~0.2 from DA.1H [DA.KHW-RT1h]. The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available at GenBank. 12743647 DA.E3-(Btnl2-RT1-DMb) Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) Btnl2|RT1-DMb 620731|735096 20 4613726 4836772 1 - by flanking markers 20 6221727 7295355 1 - by flanking markers 20 3945383 4156365 1 - by flanking markers 20 4490169 4700340 1 - by flanking markers RRID:RRRC_00713 The Tcs2 QTL in DA.E3-(Btnl2-RT1-DMb)(DA.1UR10) contains a ~0.2 Mb fromDA.E3-(D20Rat47-AA858870)/Rhd (RGD:10002745). The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available from GenBank. The genomic sequences of DA/OlaHsd and E3 have been completed and will be available soon (Backdahl et al. BMC Genomics 2014) 12743650 DA.AS2-(Tesb-RT1-DMb) Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) RT1-DMb|Tsbp1 735096|1597063 20 4532358 4836772 1 - by flanking markers 20 6258025 7295355 1 - by flanking markers 20 3945383 4235947 1 - by flanking markers 20 4410002 4700340 1 - by flanking markers RRID:RGD_12743650 DA.F-(Tesb-RT1-DMb) (DA.1FR61) contains a ~0.4 Mb (min- max 0.25 - 0.53 Mb) insert from DA.1F (RGD:2307301). The insert spans 12-19 genes in the MHC-II/MHC-III regions, including RT1-B and RT1-D. The 12 genes in the MHC-II region have been sequenced and sequences are available from GenBank. 12743652 DA.KHW-(RT1-DMa-Mln) Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) RT1-DMa|Mln 735053|1642907 20 4843458 5451752 1 - by flanking markers 20 7302036 8814591 1 - by flanking markers 20 3935512 6571791 1 - by flanking markers 20 4707028 5308948 1 - by flanking markers RRID:RRRC_00716 The Tcs1 QTL in DA.KHW-(RT1-DMa-Mln)(DA.1HR83) contains a ~~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1H [DA.KHW-RT1h]. The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes. 12743655 DA.E3-(RT1-DMa-Mln) Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) RRID:RRRC_00717 The Tcs1 QTL in DA.E3-(RT1-DMa-Mln)(DA.1UR83) contains a ~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1U (RGD:10002745). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes. 12790593 DA.ACI-(Gtf2ird1-D12Rat8)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-16) arthritis/autoimmunity studies Gtf2ird1 620856 12 23319373 23934871 1 - by flanking markers 12 27273535 27805720 1 - by flanking markers 12 25264052 25799259 1 - by flanking markers 12 22254113 22779600 1 - by flanking markers RRID:RRRC_00672 The strain contains the Cia25 R11 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(Chr12:27462118-Chr12:27611814) [also known as DA.ACI(Cia25) R11] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. 12790595 DA.ACI-(D12Mit2-Gtf2i)/Nsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-16) arthritis/autoimmunity studies Gtf2i 727961 12 20932559 23545621 1 - by flanking markers 12 24662983 27497928 1 - by flanking markers 12 22650702 25487970 1 - by flanking markers 12 19610870 22476243 1 - by flanking markers RRID:RRRC_00673 The strain contains the Cia25 R12 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(D12Got43-Chr12:27368751)/Nsi [also known as DA.ACI(Cia25) R12] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. 12790599 WKY-Asic3em6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Asic3em6Mcwi 12790597 4 6125614 6129660 7 4 7300219 7304265 7 4 7292776 7292836 8 4 10760509 10764987 7 RRID:RGD_12790599 CRISPR/Cas9 system was used to introduce a mutation in the Asic3 gene of WKY/Ncrlrat embryos. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene. 12790602 SS-Axlem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Axlem1Mcwi 12790600 1 80964751 80994300 7 1 83812118 83840542 7 1 82579723 82579753 8 1 81265088 81296278 7 RRID:RGD_12790602 CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene. 12790604 SS-Axlem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Axlem2Mcwi 12790605 1 80964751 80994300 7 1 83812118 83840542 7 1 82579711 82579742 8 1 81265088 81296278 7 RRID:RGD_12790604 CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene. 12790608 SS-Cd14em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Cd14em1Mcwi 12790606 18 29374593 29376190 7 18 29265328 29267236 7 18 29561584 29561585 8 18 28335522 28337383 7 RRID:RGD_12790608 The CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of the Cd14 gene of SS/JrHsdMcwi rat embryos. 12790610 SS-Cd14em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Cd14em2Mcwi 12790611 18 29374593 29376190 7 18 29265328 29267236 7 18 29561568 29561607 8 18 28335522 28337383 7 RRID:RGD_12790610 CRISPR/Cas9 system was used to introduce a mutation in the Cd14 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a net 7-bp deletion of the Cd14 gene. 12790615 LEW-Chrna4em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryorecovery (as of 2017-02-17) Chrna4em5Mcwi 12790616 3 170171214 170185998 7 3 180256391 180256406 8 3 176533182 176547965 7 3 168136246 168157839 7 RRID:RGD_12790615 CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene. 12790621 SS-Cybbem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm; Cryorecovery (as of 2021-11-03) Cybbem1Mcwi 12790620 X 25514572 25547181 7 X 15359405 15391317 7 X 14581655 14581696 8 X 13358101 13392570 7 RRID:RGD_12790621 CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene. 12790623 SS-Cybbem3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Cybbem3Mcwi 12790624 X 25514572 25547181 7 X 15359405 15391317 7 X 14581662 14581696 8 X 13358101 13392570 7 RRID:RGD_12790623 CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene. 12790627 LEW-Igh-6em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Igh-6em1Mcwi 12790625 6 143205627 143206076 7 6 147233687 147233694 8 RRID:RGD_12790627 CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the exon 2 of the Igh-6 gene. 12790629 LEW-Igh-6em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Igh-6em4Mcwi 12790630 6 143205627 143206076 7 6 147233691 147233692 8 RRID:RGD_12790629 CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/Ncrl rat embryos. The resulting mutation is a 2-bp deletion in the exon 2 of the Igh-6 gene. 12790632 SS-Il2rgem1Mcwi PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Il2rgem1Mcwi 12790633 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66398567 66398585 8 RRID:RGD_12790632 This strain was produced by injecting TALENs targeting the sequence of Il2rg gene into the SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in exon 2. 12790659 SD-Il2rgem3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-02-20) Il2rgem3Mcwi 12790660 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_12790659 This strain was produced by injecting TALENs targeting the Il2rg gene into Crl:SD rat embryos. The resulting mutation is a 2-bp deletion in exon 2. 12790662 WKY-Mbem6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Mbem6Mcwi 12790663 7 115087558 115094789 7 7 118094391 118101622 7 7 118101633 118108864 7 7 108762068 108762092 8 RRID:RGD_12790662 CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene. 12790676 SS-P2rx1em6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryorecovery (as of 2017-02-20) P2rx1em6Mcwi 12790677 10 59889933 59904985 7 10 59305737 59320797 7 10 59566268 59581328 7 10 57626714 57626715 8 RRID:RGD_12790676 CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene. 12790679 PCK-P2rx7em8Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Pkhd1pck|P2rx7em8Mcwi 11535943|12790680 9;12 18833903;35074025 19338716;35117152 7;7 12;9 41242368;25025958 41808755;25593163 7;7 9;12 26164969;39353613 26736704;39396042 7;7 12 33917661 33917662 8 RRID:RGD_12790679 CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of PCK/CrljCrl-Pkhd1pck/Crl rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. 12790692 SS-Pon1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Pon1em1Mcwi 12790693 4 29936314 29964821 7 4 30174202 30174203 8 4 30249749 30276297 7 4 33294737 33325759 7 RRID:RGD_12790692 CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene. 12790695 SS-Pon1em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Extinct (as of 2017-02-20) Pon1em2Mcwi 12790696 4 29936314 29964821 7 4 30156712 30183204 7 4 30249749 30276297 7 4 33294737 33325759 7 RRID:RGD_12790695 CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene. 12790698 SS-Pon1em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Pon1em3Mcwi 12790699 4 29936314 29964821 7 4 30156712 30183204 7 4 30249749 30276297 7 4 33294737 33325759 7 RRID:RGD_12790698 CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. 12790702 SS-Pon3em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Pon3em1Mcwi 12790703 4 30000505 30027203 7 4 30218888 30245586 7 4 30311981 30338679 7 4 33356983 33383681 7 RRID:RGD_12790702 CRISPR/Cas9 system was used to introduce a mutation in the Pon3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene. 12790710 SD-Rag2em3Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag2em3Mcwi 12790711 3 86764810 86773438 7 3 97851318 97859615 7 3 91191837 91200134 7 3 87907936 87907945 8 RRID:RGD_12790710 This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp deletion in exon 2. 12790713 SS-Rag2em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rag2em1Mcwi 12790714 3 86764810 86773438 7 3 97851318 97859615 7 3 91191837 91200134 7 3 87907936 87907943 8 RRID:RGD_12790713 This strain was produced by targeting the Rag2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. 12790717 SS-Rfwd2em1Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Rfwd2em1Mcwi 12790718 13 74552876 74590608 7 13 81940125 81940125 8 13 76942883 77076015 7 13 71467164 71561826 7 RRID:RGD_12790717 This strain was produced by targeting the Rfwd2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4. 12790721 SS.BN-(D13Rat151-D13Rat197)-Serpinc1em2Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Serpinc1em2Mcwi 12790722 13 76548456 76562724 7 13 83700761 83715029 7 13 78806107 78820375 7 13 73257208 73271476 7 RRID:RGD_12790721 ZFN system was used to introduce a mutation in the Serpinc1 gene of SS.BN-(D13Rat151-D13Rat197)/Mcwi rat embryos. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene. 12790944 WKY-Sik2em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Sik2em5Mcwi 12790945 8 54240307 54337976 7 8 53905730 54005295 7 8 55309005 55408608 7 8 51262007 51262012 8 RRID:RGD_12790944 CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene. 12790947 SS-Sorcs2em7Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-02-22) Sorcs2em7Mcwi 12790948 14 79968072 80344330 7 14 79176694 79547823 7 14 79538911 79912333 7 14 74711190 74711222 8 RRID:RGD_12790947 This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 33-bp frameshift deletion in exon 15. 12790950 SS-Sorcs2em9Mcwi PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-02-22) Sorcs2em9Mcwi 12790952 14 79968072 80344330 7 14 79176694 79547823 7 14 79538911 79912333 7 14 74371089 74735943 7 RRID:RGD_12790950 This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 15. 12790954 WKY-Tertem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals (as of 2017-02-22) Tertem2Mcwi 12790955 1 30445180 30465942 7 1 33675744 33697542 7 1 32250876 32275330 7 1 29637213 29659561 7 RRID:RGD_12790954 CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of WKY/NCrl rat embryos. The resulting mutation is a 17-bp deletion in Tert gene. 12790957 SS.SR-(DXrat11-rs64754598)/Opaz Boston University School of Medicine, Boston, Massachusetts Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-22) X 62691290 62691414 1 - by flanking markers X 44619917 44620040 1 - by flanking markers X 44320616 100046443 1 - by flanking markers X 41052407 92767050 1 - by flanking markers RRID:RRRC_00651 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome X region from DXRat11 to rs64754598 was introgressed on the genetic background of SS. 12790959 SS.SR-(D1Rat68-rs65309623)/Opaz Boston University School of Medicine, Boston, Massachusetts Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-22) 1 193069836 193070197 1 - by flanking markers 1 212591076 212591221 1 - by flanking markers 1 205603081 218387917 1 - by flanking markers 1 188377360 200385273 1 - by flanking markers RRID:RRRC_00608 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from D1Rat68 to rs65309623 was introgressed on the genetic background of SS. 12790962 SS.SR-(rs106908358-rs105920659)/Opaz Boston University School of Medicine, Boston, Massachusetts Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-22) 1 141088073 141088073 1 - by flanking markers 1 133299232 133942528 1 - by flanking markers RRID:RRRC_00609 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from rs106908358 to rs105920659 was introgressed on the genetic background of SS. 12790964 SS.SR-(rs66001705-D5Mgh16)/Opaz Boston University School of Medicine, Boston, Massachusetts Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-22) 5 168005953 168006088 1 - by flanking markers 5 171522628 171522762 1 - by flanking markers 5 155945375 167946134 1 - by flanking markers 5 149810483 161317411 1 - by flanking markers RRID:RRRC_00614 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 5 region from rs66001705 to D5Mgh16 was introgressed on the genetic background of SS. 12792211 SS.BN-(D13Hmgc1048-D13Hmgc664)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 79688409 79688633 1 - by flanking markers 13 74144915 74145142 1 - by flanking markers RRID:RGD_12792211 SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792212 SS.BN-(D13Hmgc1048-D13Hmgc1045)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 75435508 75435694 1 - by flanking markers 13 82670970 82671156 1 - by flanking markers RRID:RGD_12792212 SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792213 SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown RRID:RGD_12792213 SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792214 SS.BN-(D13Hmgc1041-D13Hmgc664)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 74586260 74586404 1 - by flanking markers 13 81886999 81887143 1 - by flanking markers 13 79688409 79688633 1 - by flanking markers 13 74144915 74145142 1 - by flanking markers RRID:RGD_12792214 SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792216 SS.BN-(D13Hmgc885-D13Hmgc664)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 77913594 79688633 1 - by flanking markers 13 72402940 74145142 1 - by flanking markers RRID:RGD_12792216 SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792217 SS.BN-(D13Hmgc1041-D13Hmgc885)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 74586260 74586404 1 - by flanking markers 13 81886999 81887143 1 - by flanking markers 13 77913594 77913762 1 - by flanking markers 13 72402940 72403109 1 - by flanking markers RRID:RGD_12792217 SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792226 SS.BN-(D13Got45-D13Hmgc664)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 69494326 1 - by flanking markers 13 76974692 76974960 1 - by flanking markers 13 72031440 79688633 1 - by flanking markers 13 66706825 74145142 1 - by flanking markers RRID:RGD_12792226 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792939 SS.BN-(D13Got42-D13Rat61)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 68034927 1 - by flanking markers 13 73648968 75412480 1 - by flanking markers 13 68686589 70445080 1 - by flanking markers 13 63410813 65170683 1 - by flanking markers RRID:RGD_12792939 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792944 SS.BN-(D13Got42-D13Got45)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 69494326 1 - by flanking markers 13 73648968 76974960 1 - by flanking markers 13 68686589 72031708 1 - by flanking markers 13 63410813 66707096 1 - by flanking markers RRID:RGD_12792944 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792945 SS.BN-(D13Got42-D13Rat130)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 72283478 1 - by flanking markers 13 73648968 79590001 1 - by flanking markers 13 68686589 74672607 1 - by flanking markers 13 63410813 69163391 1 - by flanking markers RRID:RGD_12792945 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792946 SS.BN-(D13Got42-D13Hmgc354)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 76116817 1 - by flanking markers 13 63410813 70599672 1 - by flanking markers RRID:RGD_12792946 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792947 SS.BN-(D13Got42-D13Hmgc497)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 77151580 1 - by flanking markers 13 63410813 71637916 1 - by flanking markers RRID:RGD_12792947 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792948 SS.BN-(D13Got42-D13Hmgc885)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 77913762 1 - by flanking markers 13 63410813 72403109 1 - by flanking markers RRID:RGD_12792948 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792949 SS.BN-(D13Got42-D13Hmgc664)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 79688633 1 - by flanking markers 13 63410813 74145142 1 - by flanking markers RRID:RGD_12792949 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792950 SS.BN-(D13Mit5-D13Rat32)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 78070512 78189379 1 - by flanking markers 13 85176659 85295746 1 - by flanking markers 13 80285619 80403666 1 - by flanking markers 13 74741916 74862225 1 - by flanking markers RRID:RGD_12792950 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792951 SS.BN-(D13Hmgc5885-D13Rat32)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 78189125 78189379 1 - by flanking markers 13 85295639 85295746 1 - by flanking markers 13 77381168 80403666 1 - by flanking markers 13 71870085 74862225 1 - by flanking markers RRID:RGD_12792951 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792952 SS.BN-(D13Hmgc354-D13Rat32)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 78189125 78189379 1 - by flanking markers 13 85295639 85295746 1 - by flanking markers 13 76116593 80403666 1 - by flanking markers 13 70599447 74862225 1 - by flanking markers RRID:RGD_12792952 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792953 SS.BN-(D13Rat130-D13Rat32)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 72283275 78189379 1 - by flanking markers 13 79589799 85295746 1 - by flanking markers 13 74672405 80403666 1 - by flanking markers 13 69163188 74862225 1 - by flanking markers RRID:RGD_12792953 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12792954 SS.BN-(D13Got45-D13Rat32)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 78189379 1 - by flanking markers 13 76974692 85295746 1 - by flanking markers 13 72031440 80403666 1 - by flanking markers 13 66706825 74862225 1 - by flanking markers RRID:RGD_12792954 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798529 SS.BN-(D13Hmgc37-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 32396527;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 40757538;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 35643050;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 13;5 30737550;93541170 30737765;93542503 1 - by flanking markers;1 - by flanking markers RRID:RGD_12798529 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798530 SS.BN-(D13Rat115-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 35719010;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 44763184;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 39639775;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 13;5 34778619;93541170 34778759;93542503 1 - by flanking markers;1 - by flanking markers RRID:RGD_12798530 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798531 SS.BN-(D13Hmgc86-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 36367611;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 45412259;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 40295163;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 13;5 35407990;93541170 35408317;93542503 1 - by flanking markers;1 - by flanking markers RRID:RGD_12798531 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798532 SS.BN-(D13Hmgc40-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 45828608;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 48645307;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 43545977;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 13;5 38744968;93541170 38745230;93542503 1 - by flanking markers;1 - by flanking markers RRID:RGD_12798532 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798533 SS.BN-(D13Hmgc85-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 45828608;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 54791498;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 5;13 96601805;44588357 96603137;49720682 1 - by flanking markers;1 - by flanking markers 5 93541170 93542503 1 - by flanking markers RRID:RGD_12798533 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798534 SS.BN-(D13Rat77-D13Got22)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 5;13 97701780;45828608 97703112;63175600 1 - by flanking markers;1 - by flanking markers 5;13 100631702;54791498 100633034;71047437 1 - by flanking markers;1 - by flanking markers 13;5 49720575;96601805 66075827;96603137 1 - by flanking markers;1 - by flanking markers 5;13 93541170;60933298 93542503;60933518 1 - by flanking markers;1 - by flanking markers RRID:RGD_12798534 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798535 SS.BN-(D13Rat111-D13Rat115)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 35719148 1 - by flanking markers 13 40421740 44763321 1 - by flanking markers 13 35301263 39639912 1 - by flanking markers 13 30395351 34778759 1 - by flanking markers RRID:RGD_12798535 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798536 SS.BN-(D13Rat111-D13Hmgc86)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 36367935 1 - by flanking markers 13 40421740 45412583 1 - by flanking markers 13 35301263 40295487 1 - by flanking markers 13 30395351 35408317 1 - by flanking markers RRID:RGD_12798536 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798537 SS.BN-(D13Rat111-D13Rat20)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 38329229 1 - by flanking markers 13 40421740 47267192 1 - by flanking markers 13 35301263 42155682 1 - by flanking markers 13 30395351 37262232 1 - by flanking markers RRID:RGD_12798537 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12798538 SS.BN-(D13Rat111-D13Hmgc85)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 32030259 1 - by flanking markers 13 40421740 40421859 1 - by flanking markers 13 35301263 44588509 1 - by flanking markers 13 30395351 30395471 1 - by flanking markers RRID:RGD_12798538 SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12802362 SS.BN-(D13Rat25-RN34_13048990782)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46520126 48990782 1 - by flanking markers 13 55314020 55314194 1 - by flanking markers 13 50260357 50260531 1 - by flanking markers 13 45049404 45049579 1 - by flanking markers RRID:RGD_12802362 SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12802363 SS.BN-(D13Rat25-rs106935835)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46520126 46520939 1 - by flanking markers 13 55314020 55314194 1 - by flanking markers 13 50260357 50918009 1 - by flanking markers 13 45049404 45536711 1 - by flanking markers RRID:RGD_12802363 SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12802364 SS.BN-(D13Rat25-rs198199323)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46520126 46520939 1 - by flanking markers 13 55314020 55314194 1 - by flanking markers 13 50260357 50918009 1 - by flanking markers 13 45049404 45536711 1 - by flanking markers RRID:RGD_12802364 SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi (RGD:2293145), rats from F1 were intercrossed and genotyped to get the congenic strain 12802365 SS.BN-(D13Hmgc64-D13Hmgc23)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45215472 47299604 1 - by flanking markers 13 54170894 56238470 1 - by flanking markers 13 49102205 51182122 1 - by flanking markers 13 43763752 43763948 1 - by flanking markers RRID:RGD_12802365 SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12802366 SS.BN-(D13Hmgc64-4582)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45215472 46195314 1 - by flanking markers 13 54170894 54171089 1 - by flanking markers 13 49102205 49102400 1 - by flanking markers 13 43763752 43763948 1 - by flanking markers RRID:RGD_12802366 SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12802367 SS.BN-(2340-RN34_13048990782)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 47139940 48990782 1 - by flanking markers RRID:RGD_12802367 SS/JrHsdMcwi were crossed with SS-13BN(D13Rat123-D13Rat101)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain 12859278 Slc:ZUC-Leprfa-/- Zucker fatty rats Japan SLC, Inc. (Hamamatsu, Japan) outbred Unknown Lepr|Leprfa 3001|13432153 RRID:RGD_12859278 The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961.This strain was maintained at Japan SLC, Inc. (Hamamatsu, Japan.) 12859279 Ho:ZFDM-Leprfa Zucker Fatty Diabetes Mellitus rats Hoshino Laboratory Animals, Inc. (Ibaraki, Japan) outbred Unknown Lepr|Leprfa 3001|13432153 RRID:RGD_12859279 In the Zucker fatty rat colony in Hoshino Laboratory Animals, Inc, they incidentally found fa/fa homozygous male rats having reproductive ability. The Selective breeding using the fa/fa male rats that exhibited relatively high blood glucose levels at 10 weeks of age, resulting in establishment of a diabetic strain. These fa/fa male rats developed diabetes as early as 10 weeks of age, reaching 100% incidence by 21 weeks of age, while none of the fa/+ male rats developed diabetes. 12859287 ZDF-Leprfa/Drt Zucker Diabetic Fatty Rat Indiana University School of Medicine, Indianapolis. inbred Unknown Lepr 3001 RRID:RGD_12859287 "Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters. 12879386 W-Ghsrem1Ottc Optogenetics and Transgenic Technology Core, Rat Resource and Research Center Optogenetics and Transgenic Technology Core, Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2018-12-04) Ghsrem1Ottc 12880435 2 113269623 113272999 7 2 132784207 132789319 7 2 113065953 113071265 7 2 110268489 110271865 7 RRID:RRRC_00827 The CRISPR/Cas9 genome editing system was used to generate this knock out rat strain with 846- bp deletion in the rat Ghsr gene. The rat strain had Ghsr exon1 deletion in the genome and did not express detectable Ghsr mRNA in brain regions. 12879394 F344-Atmm1Kyo Atm missense rats National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-04-18) Immunology Atmm1Kyo 12879395 8 56894746 56996565 7 8 56598503 56703115 7 8 58041203 58041203 8 8 53854010 53854010 8 RRID:RGD_12879394 This strain is an Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P))rat and was established by ENU mutagenesis using F344/NSlc strain. 12879400 F344-Atmem1Kyo ZFN-Atm rats National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-04-18) neurobiology Atmem1Kyo 12879401 8 56894746 56996565 7 8 56598503 56703115 7 8 58015938 58119973 7 8 53828741 53932773 7 RRID:RGD_12879400 This rat strain was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13). Background strain: F344/Stm. 12879423 W-Tg(HCRT-cre-EGFP)B5Ahky orexin-Cre rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown RRID:RGD_12879423 This transgenic rat strain was established by Dr. Yamanaka (Nagoya University) in 2012. Background strain: Wistar rat (CLEA Japan). plasmid backbone: pCR2.1. Transgene: human HCRT gene promoter, cre recombinase, EGFP gene, 2A gene. EGFP and cre recombinase are specifically expressed in orexin neurons. 12879424 LE-ROSA26em1(CAG-COP4*/EGFP)Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-19) RRID:RGD_12879424 This strain was established at Kyoto University. ChR90/EGFP fusion gene sequence under CAG promoter is knock-in at the ROSA26 locus. Background strain: Long-Evans strain (charles river). COP4*: Stigeoclonium helveticum-derived channelrhodopsin (Chronos, ChR90). ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 12879426 ExHC.BN-(D14Got74-D14Rat132)/Kyu National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2017-04-19) 14 103289672 107101727 1 - by flanking markers 14 107489676 110102984 1 - by flanking markers 14 107428559 110402569 1 - by flanking markers 14 96644199 100147478 1 - by flanking markers RRID:RGD_12879426 This congenic strain was established by introducing a segment of chromosome14 (D14Got74-D14Rat132 including Smek2 gene) from Brown Norway(BN)/seac strain into ExHC/Seac strain. 12879428 WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Rat36-D3Rat144)(D4Mgh7-D4Rat68)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2017-04-19) 3;1;4 78808731;78134304;172169471 151449116;187092492;172169650 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 4;1;3 200825021;80946174;89999731 233267140;206277202;162886090 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 4;1;3 136351734;79689548;83300114 168998263;199254774;156656443 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 3;4;1 80367329;138503169;78430536 149313851;168069246;182418476 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers RRID:RGD_12879428 A double congenic strain bade by introducing segments of chromosome 1, 3, and 4 from SHRSP/Izm into WKY/Izm. This strain was established by mating between WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm(NBRP Rat No:0713)and WKY.SHRSP-(D1Mgh5-D1Arb21) (D4Mgh7-D4Rat68)/IzmCNBRP Rat No:0714). This strain was established and is maintained in Shimane University. 12879431 Jcl:WI Wistar rats CLEA Japan, Inc CLEA Japan, Inc outbred Live Animals (as of 2021-04-22) behavioral pharmacology, toxicity, pharmacology, drug efficacy, and safety testing. RRID:RGD_12879431 This strain is a rat strain originating from the Wistar Institute in Philadelphia (USA). The Wistar Institute was named as a memorial to the famous anatomist Professor Casper Wistar at the University of Pennsylvania. CLEA Japan, Inc. started the production and supply of this strain after it was introduced from Carworth (UK). 12879432 W-Ift140em1Kyo The Institute of Environmental Toxicology National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-04-19) Ift140em1Kyo 12879433 10 14258556 14348468 7 10 14189328 14276940 7 10 14373668 14461509 7 10 14032665 14121682 7 RRID:RGD_12879432 This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene. 12879434 W-Ift140em2Kyo The Institute of Environmental Toxicology National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-04-19) Ift140em2Kyo 12879435 RRID:RGD_12879434 This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 2 (em2) has 2-bp deletion (c.23_24del) in the exon 1 of Ift140 (intraflagellar transport 140) gene. 12879437 SHC/Ta spontaneously hypercholesterolemic rat National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Live Animals (as of 2017-04-19) Metabolism RRID:RGD_12879437 This strain (Nephropathy model) was segrigated from SD strain (CLEA Japan,Inc.) by selective mating on the basis of total cholesterol level in blood. 12879438 F344-Tg(CAG-EGFP,Acr-EGFP)2Osb National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-19) RRID:RGD_12879438 This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data). 12879439 F344-Tg(CAG-EGFP,Acr-EGFP)6Osb National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-19) RRID:RGD_12879439 This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data). 12880021 SD-Apoeem1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-01) Alzheimer's disease, Neurodegenerative diseases Apoeem1Sage 12880022 1 79003634 79006387 7 1 81878372 81882298 7 1 80612894 80616820 7 1 79353924 79357852 7 RRID:RGD_12880021 The mutant rat strain was produced by injecting zinc endonuclease targeting the exon 3 of rat Apoe into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in the gene and resulted in complete loss of Apoe protein in homozygotes. 12880026 SD-Appem1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-01) Alzheimer's disease, Neurodegenerative diseases Appem1Sage 12880027 11 24457855 24693851 7 11 28048897 28265250 7 11 24425013 24641872 7 11 24019774 24236584 7 RRID:RGD_12880026 This rat model carries a bi-allelic deletion of the amyloid precursor protein (APP) gene. 12880037 SD-Dmdem1Ang mutant Unknown Dmdem1Ang 12880032 X 71501362 71671414 7 X 51475950 53700033 7 X 52104979 52104989 8 X 48090661 48090671 8 RRID:RGD_12880037 This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation. 12902614 SS.LEW-(D10M11Mit119-D10Rat27)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 77091834 77092169 1 - by flanking markers 10 74127825 74127968 1 - by flanking markers 10 75983662 75983805 1 - by flanking markers 10 73452992 73453136 1 - by flanking markers RRID:RGD_12902614 A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. 12902616 SD-Apoetm1(APOE*)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-09) Alzheimer's disease, Neurodegenerative diseases APOE 736378 RRID:RGD_12902616 These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE gene 12902621 SD-Bdnfem1Sage+/- Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-06-20) Schizophrenia and Alzheimer's Disease Bdnfem1Sage 12902622 3 107371329 107421908 7 3 100768637 100819216 7 3 96165042 96215621 7 RRID:RGD_12902621 This ZFN model contains a monoallelic deletion of the Bdnf gene, encoding for the nerve growth factor protein BDNF. Homozygous animals carrying the Bdnf deletion are postnatal lethal. Reductions of BDNF have been observed in patients with Alzheimer's disease (AD), and this model may be useful for understanding the role of BDNF in AD. 12902625 SD-Nr1i2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-09) Xenobiotic Sensors Nr1i2em1Sage 12902626 11 64239918 64276702 7 11 67024185 67060494 7 11 65022100 65058546 7 11 62460213 62496665 7 RRID:RGD_12902625 This ZFN model contains a 20-bp deletion within the Nr1i2 gene. No induction of Cyp3a1 in the model. 12903250 SD-Ahrem1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-10) Xenobiotic Sensors Ahrem1Sage 12903271 6 54205104 54240268 7 6 64589066 64624078 7 6 54963990 55001806 7 6 52234089 52271568 7 RRID:RGD_12903250 This ZFN model contains a 760-bp deletion in the rat Ahr gene. 12903251 LH-Chr 17LN/Aek consomic Unknown RRID:RGD_12903251 Chr 17 from LN was introgressed onto the genetic background of LH by crossing LH/MRrrcAek male to LN/MRrrcAek female rats. 12903257 LH.LH-Chr 17LN-(rs199194111-rs105876746)/Aek Rat Resource & Research Center Rat Resource & Research Center congenic Unknown 17 76673662 83549032 1 - by flanking markers 17 72724339 79524188 1 - by flanking markers RRID:RRRC_00822 This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17LN/Aek from rs199194111 through rs1056876746 transferred to the LH/MRrrcAek background. 12903267 SD-Nr1i3em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-10) Xenobiotic Sensors Nr1i3em1Sage 12903268 13 87104241 87108563 7 13 94211961 94218143 7 13 89585072 89591278 7 13 83632940 83638193 7 RRID:RGD_12903267 This model contains a ZFN-induced 10-bp deletion within rat Nr1i3 gene. 12903270 SD-Nr1i2em1Sage Nr1i3em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-10) Xenobiotic Sensors Nr1i2em1Sage|Nr1i3em1Sage 12902626|12903268 11;13 64239918;87104241 64276702;87108563 7;7 11;13 67024185;94211961 67060494;94218143 7;7 13;11 89585072;65022100 89591278;65058546 7;7 13;11 83632940;62460213 83638193;62496665 7;7 RRID:RGD_12903270 This model contains two knockout genes, the 20-bp deletion within rat Nr1i2 and the ZFN-induced 10-bp deletion within rat Nr1i3 gene. 12903272 SD-Nr1i2em1Sage Nr1i3em1Sage Ahrem1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-10) Xenobiotic Sensors Nr1i2em1Sage|Nr1i3em1Sage|Ahrem1Sage 12902626|12903268|12903271 6;13;11 54205104;87104241;64239918 54240268;87108563;64276702 7;7;7 13;6;11 94211961;64589066;67024185 94218143;64624078;67060494 7;7;7 11;6;13 65022100;54963990;89585072 65058546;55001806;89591278 7;7;7 11;6;13 62460213;52234089;83632940 62496665;52271568;83638193 7;7;7 RRID:RGD_12903272 This model contains three knockout genes, the 20-bp deletion within rat Nr1i2, the ZFN-induced 10-bp deletion within rat Nr1i3 gene and the 760-bp deletion in the rat Ahr gene. 12904057 SD-Abcb1aem1Sage -/- SD-Abcb1aem1-/Abcb1aem1- Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-16) Efflux Transporter Abcb1aem1Sage 12904058 4 21709855 21796628 7 4 22276390 22448913 7 4 22339829 22517642 7 4 25357467 25529941 7 RRID:RGD_12904057 This ZFN model contains biallelic 20 bp deletion within Abcba1 gene. Animals exhibit increased oral bioavailability of P-gp-specific substrates. The homozygous knockout rats display total loss of protein via Western blot. 12904059 SD-(Abcb1a- Abcb1b)em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-16) Efflux Transporter RRID:RGD_12904059 This model carries knockout of Abcb1a and Abcb1b. 12904063 SD-Abcg2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-16) Efflux Transporter Abcg2em1Sage 12904064 4 87502584 87560017 7 4 153587206 153712481 7 4 88765441 88890268 7 4 87676241 87802757 7 RRID:RGD_12904063 This ZFN model carries a 588-bp deletion within Abcg2 gene. Homozygous knockouts display total loss of protein via Western blot 12904679 WKY-Cyp2j4em1Sage/Tja mutant Unknown Cyp2j4em1Sage 12904681 5 116702370 116729722 7 5 119130644 123455814 7 5 119546458 119564843 7 5 111179981 111207490 7 RRID:RGD_12904679 ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. 12904684 SD-Abcb1aem1Sage Abcg2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-17) Efflux Transporter Abcb1aem1Sage|Abcg2em1Sage 12904058|12904064 4;4 87502584;21709855 87560017;21796628 7;7 4;4 153587206;22276390 153712481;22448913 7;7 4;4 22339829;88765441 22517642;88890268 7;7 4;4 25357467;87676241 25529941;87802757 7;7 RRID:RGD_12904684 This model contains two knockout genes, the 20-bp deletion within rat Abcba1 and the 588-bp deletion within rat Abcg2 gene. 12904685 SD-Abcc2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-17) Efflux Transporter Abcc2em1Sage 12904687 1 270999832 271057750 7 1 263554426 263612556 7 1 242664657 242723239 7 RRID:RGD_12904685 This ZFN model contains a biallelic 726 bp deletion within the Abcc2 gene. Animals exhibit decreased transport of endogenous glutathione and hyperbilirubinemia. The homozygous knockout rats display total loss of protein via Western blot. 12904730 SD-Abcb11em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-19) Efflux Transporter Abcb11em1Sage 12904731 3 62091490 62195528 7 3 55480024 55587946 7 3 54016854 54112797 7 RRID:RGD_12904730 This ZFN induced knockout model contains biallelic 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot. 12904733 SD-Slc22a1em1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-19) Uptake Transporters Slc22a1em1Sage 12904734 1 42351239 42378295 7 1 51452604 51479610 7 1 48273639 48300645 7 1 48076657 48103679 7 RRID:RGD_12904733 This ZFN induced knockout model contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot. 12904891 SD-Slc22a2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-24) Uptake Transporters Slc22a2 61936 1 42395676 42442847 7 1 51394014 51435104 7 1 48318025 48360219 7 1 48121061 48163268 7 RRID:RGD_12904891 This ZFN model carries the knockout of the rat Slc22a2. 12904892 SD-Slc22a6em1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) Uptake Transporters Slc22a6 69338 1 211294178 211302398 7 1 231761600 231772550 7 1 224824809 224833284 7 1 205522579 205531179 7 RRID:RGD_12904892 This ZFN model carries the knockout of the rat Slc22a6. 12904893 SD-Slc22a8em1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) Uptake Transporters RRID:RGD_12904893 This ZFN model carries the knockout of the rat Slc22a8. 12904897 SD-Tp53em1Sage Horizon Discovery Horizon Discovery mutant Extinct (as of 2024-04-16) carcinogenicity Tp53em1Sage 12904898 10 56399721 56411150 7 10 55932658 55944087 7 10 56194211 56194221 8 10 54307287 54307297 8 RRID:RGD_12904897 This ZFN model carries the monoallelic 11 base pair deletion in Tp53 gene. Animals exhibit broad tumor spectrum with high degree of tumor malignancy. 12904900 SD-Rag1em1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag1em1Sage 12904901 3 86780782 86791878 7 3 97866048 97877145 7 3 91206394 91217491 7 3 87917061 87928158 7 RRID:RGD_12904900 This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Homozygous animals display loss of Rag1 protein and loss of B and T cells by FACS analysis. 12904902 F344-Rag1em1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag1em1Sage 12904901 3 86780782 86791878 7 3 97866048 97877145 7 3 91206394 91217491 7 3 87917061 87928158 7 RRID:RGD_12904902 This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Rag1 knockout rats lack mature B and T lymphocytes. 12904903 SD-Rag2em1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag2em1Sage 12904904 3 86764810 86773438 7 3 97851318 97859615 7 3 91191837 91200134 7 3 87902373 87910227 7 RRID:RGD_12904903 This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene on chromosome 3. Homozygous Rag2 knockout rats display loss of RAG2 protein via Western blot. Homozygous Rag2 knockout rats show loss of B and T cells by FACS analysis. 12904905 F344-Rag2em1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag2em1Sage 12904904 3 86764810 86773438 7 3 97851318 97859615 7 3 91191837 91200134 7 3 87902373 87910227 7 RRID:RGD_12904905 This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene.on chromosome 3 Rag2 knockout rats completely lack B and T cells. 12904907 SD-Prkdcem1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-24) immunology/Inflamation and Immunodeficient Prkdcem1Sage 151232284 11 86951420 87169229 7 11 92347175 92565022 7 11 89293547 89510948 7 11 85040790 85258357 7 RRID:RGD_12904907 This ZFN induced knockout rats carrying a shorter truncated gene, 872 by PCR vs 1627 in wild type, have severe combined immunodeficiency (SCID) and lack of both B and T cells 12904908 SD-Ldlrem1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-24) Ldlrem1Sage 12904909 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 7 8 20270020 20292981 7 RRID:RGD_12904908 In this ZFN induced model, a total of 337 bp were deleted at the junction of intron 3 and exon 4 (on chromosome 8), and 4 bp ccgt were inserted rat Ldlr gene on chromosome 8. Homozygous knockout rats display loss of LDLR protein via Western blot. Homozygous knockout rats have increased body weight as compared to wild type. Homozygous knockout rats show significantly elevated serum cholesterol levels. 12904912 SD-Lepem1Sage-/- Inotiv Inotiv mutant Cryopreserved Embryo (as of 2017-05-24) Cardiovascular Lepem1Sage 12904927 4 55943837 55945938 7 4 56085079 56099209 7 4 56347081 56347231 8 4 57670525 57670675 8 RRID:RGD_12904912 This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels 12905029 SD-Thtm1(cre)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats RRID:RGD_12905029 This ZFN knock in model expresses cre-recombinase under the control of the endogenous tyrosine hydroxylase promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of Th. The TH-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. 12905031 SD-Slc6a3tm1(cre)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats RRID:RGD_12905031 This model expresses cre-recombinase under the control of the endogenous dopamine transporter promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of DAT. The DAT-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. 12905032 LE-Camk2atm1(cre)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats RRID:RGD_12905032 This model expresses cre-recombinase under the control of the endogenous camkIIa promoter enabling specific expression in excititory neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of CamkIIa. The CamkIIa-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. 12905033 LE-Slc32a1tm1(cre)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats RRID:RGD_12905033 This model expresses cre-recombinase under the control of the endogenous solute carrier family 32 member 1 (Vgat) promoter enabling specific expression in Vgat positive GABAergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of the Vgat gene. The Vgat-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. 12905034 LE-Viptm1(cre)Sage Horizon Discovery Horizon Discovery mutant Unknown (as of 2017-05-31) Optogenetics Rats RRID:RGD_12905034 This model expresses cre-recombinase under the control of the endogenous vasoactive intestinal peptide (VIP) promoter enabling specific expression in VIP positive GABAergic interneurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the VIP gene. The VIP-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. 12905035 LE-Tph2tm1(cre)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats RRID:RGD_12905035 This model expresses cre-recombinase under the control of the endogenous Tryptophan Hydroxylase 2 (Tph2) promoter enabling specific expression in Tph2 positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the Tph2 gene. The Tph2-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. 12905036 LE-Htr3atm1(cre)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats RRID:RGD_12905036 This model expresses cre-recombinase under the control of the endogenous 5 prime-hydroxytryptamine receptor 3A (5Ht3a) promoter enabling specific expression in 5Ht3a positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the 5Ht3a gene. The 5Ht3a-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. 12905037 LE-ROSA26em1(CAG-tdTomato)1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) RRID:RGD_12905037 This CRISPR knock in model possesses the fluorophore tdTomato, sitting behind a floxed stop codon in the ROSA26 locus under control of the CAG promoter. By introducing Cre-recombinase through viral transduction or crossing with one of our Cre-driver rats, tdTomato fluorescence will be observed anywhere Cre- is expressed. The tdTomato Reporter rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 12905038 LE-ROSA26em1(CAG-tdTomato-NpHR)1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2017-05-31) RRID:RGD_12905038 This CRISPR knock in model possesses the Halorhodopsin fused to TdTomato, sitting behind a floxed stop codon in the ROSA26 locus under the control of the CAG promoter. By introducing Cre-recombinase by crossing with one of our Cre-driver rats, neuronal subtype-specific expression of halorhodopsin and TdTomato will be observed anywhere Cre- is expressed. The Halorhodopsin rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 12907568 WI-Abcb1aem2Sage mutant Unknown Abcb1aem2Sage 12907569 4 21709855 21796628 7 4 22276390 22448913 7 4 22396614 22396632 8 4 25413964 25413982 8 RRID:RGD_12907568 This model contains biallelic 19- bp deletion in exon 7 of Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. 12907570 WI-Abcb1aem3Sage mutant Unknown Abcb1aem3Sage 12907571 4 21709855 21796628 7 4 22276390 22448913 7 4 22339829 22517642 7 4 25357467 25529941 7 RRID:RGD_12907570 This model contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. 12910101 SD-Ldlrem1 mutant Unknown Ldlrem1 12910102 8 20824040 20846920 7 8 22804325 22827199 7 8 22763920 22763938 8 8 20283596 20283614 8 RRID:RGD_12910101 This model possesses a 19-bp deletion in the seventh exon of the ldlr gene by ZFN method. 12910127 SD-Tg(Th-Ghsros) transgenic Unknown Ghsr 621397 RRID:RGD_12910127 This transgenic strain carries a synthetic 108-nucleotide DNA fragment spanning the 5 prime extracellular region of GHS-R was cloned in the antisense orientation driven by tyrosine hydroxylase (Th) promoter. 12910483 Slc:SD Sprague-Dawley Derived Japan SLC, Inc. Japan SLC, Inc. outbred Unknown RRID:RGD_12910483 Derived from Charles River Laboratory Inc. USA in 1968. 12910493 LEW.1WR1-Ifnar1em1 Department of Medicine, University of Massachusetts Medical School, Worcester, MA mutant Unknown Ifnar1em1 12910495 11 31454789 31478449 7 11 35248575 35272235 7 11 31653152 31653232 8 11 30738535 30738615 8 RRID:RGD_12910493 The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion in exon 4 of Ifnar1 gene. 12910494 LEW.1WR1-Ifnar1em2 Department of Medicine, University of Massachusetts Medical School, Worcester, MA mutant Unknown Ifnar1em2 12910496 11 31454789 31478449 7 11 35248575 35272235 7 11 31640407 31666839 7 11 30725774 30752227 7 RRID:RGD_12910494 The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion and 4-bp insertion in exon 4 of Ifnar1 gene. 12910505 SD-Mmp12em2Soar mutant Unknown Mmp12em2Soar 12910506 8 4249938 4259675 7 8 5610392 5620294 7 8 5607704 5608310 8 8 4582897 4583503 8 RRID:RGD_12910505 TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon 12910514 SD-Leprem1 East China Normal University, Shanghai, China mutant Unknown Leprem1 12910515 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_12910514 This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion. 12910517 SD-Leprem2 East China Normal University, Shanghai, China mutant Unknown Leprem2 12910518 5 122320075 122503449 7 5 124380327 124556585 7 5 120581486 120581486 8 5 116372431 116372431 8 RRID:RGD_12910517 This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion. 12910519 SD-Leprem3 East China Normal University, Shanghai, China mutant Unknown Leprem3 12910546 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_12910519 This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion. 12910762 BN-KitWs mutant Unknown KitWs 12910763 14 34906043 34984819 7 14 34901860 34979384 7 14 35079269 35079280 8 14 32554595 32554606 8 RRID:RGD_12910762 A spontaneous mutant male with a large white spot and coat color dilution was identified in the BN/fMai colony in Yagi Memorial Park (kani-gun, Japan). 12910940 SD-Cdkn1bwe mutant Unknown Cdkn1bwe 12910941 4 171841705 171846506 7 4 232962218 232967323 7 4 168689043 168694159 7 4 167760067 167765177 7 RRID:RGD_12910940 The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype. 13204704 W-Myo7atnd/Hubr Wistar tornado rat Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. mutant Unknown Myo7atnd/Hubr 13204705 1 155292620 155362698 7 1 169206150 169276706 7 1 163049850 163049850 8 1 152392431 152392431 8 RRID:RGD_13204704 Male Wistar founder rats were mutagenized using ENU and mated with untreated female to establish F1 population. Selected F1 progeny were mated to produce F2 and then to breed induced mutation to homozygosity. 13204756 SS.BN-(D13Hmgc1048-D13Hmgc1050)-Pappa2em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Pappa2em4Mcwi 13204758 13 74286881 74379736 7 13 81303663 81574402 7 13 76389150 76660248 7 13 71117638 71117642 8 RRID:RGD_13204756 CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. 13204788 SS.BN-(D13Hmgc1048-D13Hmgc1050)-Pappa2em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2021-11-03) Pappa2em5Mcwi 13204789 13 74286881 74379736 7 13 81303663 81574402 7 13 76389150 76660248 7 13 71117585 71117644 8 RRID:RGD_13204788 CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. 13207339 LH.LH-Chr 17LN-(Fanccrgdv551196202-C-rs106387478)/Aek Rat Resource & Research Center Rat Resource & Research Center congenic Unknown 17 7228496 7228496 1 - by flanking markers 17 939418 939418 1 - by flanking markers 17 946321 47839901 1 - by flanking markers 17 45716725 45716725 1 - by flanking markers RRID:RRRC_00824 This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17LN/Aek from Fanccrgdv551196202-C through rs106387478 transferred to the LH/MRrrcAek background. 13207341 LH.LH-Chr 17LN-(Fanccrgdv551196202-C-rs107291522)/Aek Rat Resource & Research Center Rat Resource & Research Center congenic Unknown 17 7228496 7228496 1 - by flanking markers 17 939418 939418 1 - by flanking markers 17 946321 24556663 1 - by flanking markers 17 23930421 23930421 1 - by flanking markers RRID:RRRC_00825 This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17LN/Aek from Fanccrgdv551196202-C through rs107291522 transferred to the LH/MRrrcAek background. 13207416 LH.LH-Chr 17LN-(rgdv421102132T-rgdv413679765T)/Aek Rat Resource & Research Center Rat Resource & Research Center congenic Unknown 17 30894361 74169166 1 - by flanking markers RRID:RRRC_00826 This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17LN/Aek from Fanccrgdv551196202-C through rs106387478 transferred to the LH/MRrrcAek background. 13207488 LEW-Chrnb4em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Chrnb4em5Mcwi 13207489 8 58586961 58605545 7 8 58198875 58198878 8 8 59610489 59629073 7 8 55417583 55437027 7 RRID:RGD_13207488 CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/NCrl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. 13207491 SD-Tg(Col3a1-loxP-eGFP-loxP-TurboRFP)Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Cryopreserved Sperm (as of 2018-02-12) RRID:RGD_13207491 Bacterial artificial chromosome (BAC) Transgenic rats containing a Cre-inducible reporter switch from eGFP to TurboRFP under the control of the promoter of Col3a1 (BAC: CH230-401H12 ) 13207492 SD-Cd55em6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals (as of 2017-08-02) Cd55em6Mcwi 13207493 13 43322246 43348334 7 13 52177543 52206137 7 13 47125156 47153557 7 13 41884980 41884984 8 RRID:RGD_13207492 CRISPR/Cas9 system was used to introduce a 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 13207494 SD-Cd55em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Cd55em4Mcwi 13207495 13 43322246 43348334 7 13 52177543 52206137 7 13 47152655 47152684 8 13 41857242 41885966 7 RRID:RGD_13207494 CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. 13207497 SS-Kcnj13em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Kcnj13em1Mcwi 13207498 9 86206927 86216659 7 9 94208941 94224828 7 9 94486719 94495333 7 9 88066091 88066092 8 RRID:RGD_13207497 CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. 13207501 SS-Nlrp10em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Nlrp10em2Mcwi 13207502 1 166411647 166419204 7 1 180511615 180519172 7 1 173521412 173528969 7 1 162924483 162924493 8 RRID:RGD_13207501 CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene. 13207503 SS-Nlrp10em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Nlrp10em3Mcwi 13207504 1 166411647 166419204 7 1 180511615 180519172 7 1 173521412 173528969 7 1 162924489 162924498 8 RRID:RGD_13207503 CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene. 13207507 SS-Nlrp12em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Nlrp12em1Mcwi 13207508 1 64242875 64271212 7 1 63493575 63521356 7 1 64506750 64543908 7 1 65941549 65941550 8 RRID:RGD_13207507 CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene. 13207509 SS-P2rx1em7Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm; Cryorecovery (as of 2021-11-03) P2rx1em7Mcwi 13207510 10 59889933 59904985 7 10 59305737 59320797 7 10 59566268 59581328 7 10 57626713 57626719 8 RRID:RGD_13207509 CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene. 13207511 SS.BN-(D13Rat151-D13Rat197)-Tg(Slc12a1-Ncf2-2A-Luc)26Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Cryorecovery (as of 2017-08-03) Ncf2 1309424 RRID:RGD_13207511 A transgenic rat created by Sleeping Beauty transposon system with proximal tubule-specific overexpression of Ncf2 and Luciferase via a self cleaving 2A peptide, under control of the Slc12a1 (also known as Nkcc2) promoter produced in the line 26 strain. 13207513 SS-Tg(Slc12a1-Ncf2-2A-Luc)-Ncf2em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryorecovery (as of 2017-08-03) Ncf2em1Mcwi 5144089 13 67806516 67834105 7 13;13;13;13 75200283;75200283;75200283;75200283 75200287;75200287;75200287;75200287 8;8;8;8 13 70229196 70229200 8 13 64958217 64958221 8 RRID:RGD_13207513 This is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi. 13207514 SD-ROSA26em1(Epac-SH187)Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals (as of 2017-08-03) RRID:RGD_13207514 CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor. 13207516 SD-Rag2em3McwiIl2rgem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Il2rgem2Mcwi|Rag2em3Mcwi 10002792|12790711 3;X 86764810;89342055 86773438;89345715 7;7 3;X 97851318;72017856 97859615;72021516 7;7 3;X 91191837;71165378 91200134;71169078 7;7 3;X 87907936;66398582 87907945;66398582 8;8 RRID:RGD_13207516 This strain was produced by crossing of SD-Rag2em3Mcwi and SD-Il2rgem2Mcwi. 13207518 SHR-Hspa1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryorecovery (as of 2018-05-01) Hspa1b|Hspa1a|Hspa1l 2840|1593284|1595925 20;20 3945716;3955274 3959552;3957748 7;7 20;20;20 7032557;6956234;4802576 7038454;6962151;7033025 7;7;7 20;20;20 2699707;4877638;4879998 2701856;4880112;4965191 7;7;7 20;20;20 3855104;3848843;3870765 3859148;3855571;3873221 7;7;7 RRID:RGD_13207518 CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos. 13207525 SS-Spp1em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) spp1em3Mcwi 13207528 14 6653086 6658937 7 14 5312020 5312025 8 14 5308885 5315120 7 RRID:RGD_13207525 CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene. 13207529 SS-Spp1em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Spp1em4Mcwi 13207530 14 6653086 6658937 7 14 6673686 6679965 7 14 5308885 5315120 7 RRID:RGD_13207529 CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. 13207537 SD-Tg(Cdh5-cre)2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2017-08-04) RRID:RGD_13207537 Transgenic rat overexpressing Cre under the control of the Cdh5 (VECadherin) promoter. 13207551 SS-Tg(Nphs2-cre/ERT2)4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2017-08-04) RRID:RGD_13207551 Transgenic rat overexpressing tamoxifen inducible Cre/ERT2 under the control of the Nphs2 (Podocin) promoter 13207560 SS-Tg(Aqp2-cre/ERT2)4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2017-08-04) RRID:RGD_13207560 Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Aquaporin 2 promoter 13207563 SS-Tg(Mylpf-cre/ERT2)22Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2017-08-04) RRID:RGD_13207563 Transgenic overexpressing tamoxifen inducible CreERT2 under the control of the Mylpf (also known ad Mlc2) promoter 13207595 WKY-Tph1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Tph1em1Mcwi 13208230 1 97186071 97207551 7 1 103746878 103774100 7 1 102669868 102699442 7 1 97157375 97178415 7 RRID:RGD_13207595 CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. 13208223 LE-ROSA26em1(LTR-nLuc)Ottc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00924 The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 13208224 LE-ROSA26 em1(CAG-Cas9)Ottc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00833 The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of Cas9 under the control of CAG promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 13208231 WKY-Tph1em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Tph1em3Mcwi 13208232 1 97186071 97207551 7 1 103746878 103774100 7 1 102669868 102699442 7 1 97157375 97178415 7 RRID:RGD_13208231 CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. 13208517 SD-Nfe2l2em1Mcwi+/+ SD-Nfe2l2em1Mcwi+/Nfe2l2em1Mcwi+ PhysGen Knockouts mutant Live Animals (as of 2017-08-09) RRID:RGD_13208517 This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. 13208518 SD-Nfe2l2em1Mcwi-/- SD-Nfe2l2em1Mcwi-/Nfe2l2em1Mcwi- PhysGen Knockouts mutant Live Animals (as of 2017-08-09) Nfe2l2em1Mcwi 9588549 3 58366693 58394116 7 3 69041641 69069190 7 3 62524893 62524933 8 3 60621570 60621610 8 RRID:RGD_13208518 This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. 13208519 SD-Nfe2l2em1Mcwi+/- SD-Nfe2l2em1Mcwi+/Nfe2l2em1Mcwi- PhysGen Knockouts mutant Live Animals (as of 2017-08-09) RRID:RGD_13208519 This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. 13208537 HsdFfyb:WI Bioterio Central- Facultad de Farmacia y Bioquÿ¿mica de la Universidad de Buenos Aires. Contact: Junin 956 8 piso Ciudad Autÿ¿noma de Buenos Aires, Argentina Tel/Fax: +54 11 5287 4811 Mail: bioterio@ffyb.uba.ar Bioterio Central - FFyB - Universidad de Bs As outbred Live Animals (as of 2017-08-11) RRID:RGD_13208537 Descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan (Indianapolis).Since 1995 maintained at Bioterio Central- Facultad de Farmacia y Bioquÿ¿mica de la Universidad de Buenos Aires. Contact: Junin 956 8 piso Ciudad Autÿ¿noma de Buenos Aires, Argentina Tel/Fax: +54 11 5287 4811 Mail: bioterio@ffyb.uba.ar 13208540 CrlFfyb:SD Sprague Dawley Descendants of rats from the Charles River Laboratories (USA),then to Fvet at Buenos Aires University and since 2014 maintained at Bioterio Central of Facultad de Farmacia y Bioquimica de la Universidad de Buenos Aires. Junin 956 Ciudad Autonoma de Buenos Aires, Argentina Bioterio Central of Facultad de Farmacia y Bioquimica de la Universidad de Buenos Aires. Junin 956 Ciudad Autonoma de Buenos Aires, Argentina outbred Unknown (as of 2024-09-13) RRID:RGD_13208540 Descendants of rats from the Charles River Laboratories (USA),then to Fvet at Buenos Aires University and since 2014 maintained at Bioterio Central of Facultad de Farmacia y Bioquimica de la Universidad de Buenos Aires. Junin 956 Ciudad Autonoma de Buenos Aires, Argentina 13208571 SS-Tg(Cyp11b2-cre/ERT2)2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2019-04-26) RRID:RGD_13208571 Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Cyp11b2 promoter 13208576 SS-Tg(Slc5a2-cre/ERT2)2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2017-08-14) RRID:RGD_13208576 Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Slc12a1 (Sglt2) promoter 13208583 SS-Tg(Ubc-Wisp2)2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2017-08-14) RRID:RGD_13208583 Transgenic overexpressing Wisp2 under the control of the Ubiqutin C promoter 13208584 SS-Tg(Ubc-Wisp2)3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Live Animals (as of 2017-08-14) RRID:RGD_13208584 Transgenic overexpressing Wisp2 under the control of the Ubiqutin C promoter 13208842 SS-Ptgs2em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Ptgs2em1Mcwi 13208843 13 64427288 64432978 7 13 72315959 72324483 7 13 67351230 67356920 7 13 62165923 62165975 8 RRID:RGD_13208842 CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. 13208844 SS-Ptgs2em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Ptgs2em2Mcwi 13208845 13 64427288 64432978 7 13 72315959 72324483 7 13 67351230 67356920 7 13 62165974 62165981 8 RRID:RGD_13208844 CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion of exon 4 in the Ptgs2 gene. 13210578 SD-Lepem1 mutant Unknown Lepem1 13210580 4 55943837 55945938 7 4 56085079 56099209 7 4 56337695 56351818 7 4 57661127 57675262 7 RRID:RGD_13210578 This CRISPR/Cas9 model possesses a 3 bp(ATC) deletion resulting in the deletion of isoleucine at position 14. The Lep mutant rats exhibited similar mutant phenotypes to Lep and Lepr null rats. 13210773 ACI.BN-(Fer1l6rgdv775925951-C-D7Uwm27)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 98507649 98507649 1 - by flanking markers RRID:RGD_13210773 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 13210774 ACI.BN-(Fer1l6rgdv775925951-C-D7Uwm28)/Shul Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 98507649 98507649 1 - by flanking markers RRID:RGD_13210774 This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. 13432148 SS.ZUC-Leprfa-/-/Slc congenic Unknown Diabetes Obesity Leprfa 13432153 RRID:RGD_13432148 SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain. 13432150 SS.ZUC-Leprfa-/+/Slc congenic Unknown Diabetes Obesity Lepr|Leprfa 3001|13432153 RRID:RGD_13432150 SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain. 13432151 SS.ZUC-Leprfa+/+/Slc congenic Unknown Diabetes Obesity Lepr 3001 RRID:RGD_13432151 SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain. 13432199 SHRSP.WKY-(D3Wox20-D3Rat114)/Gcrc Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown RRID:RGD_13432199 Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. 13432200 SHRSP.WKY-(D3Mgh16-D3Rat80)/Gcrc Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown RRID:RGD_13432200 Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. 13432201 SHRSP.WKY-(D3Mgh16-D3Wox3)/Gcrc Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown RRID:RGD_13432201 Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. 13432202 SHRSP.WKY-(D3Mgh16-rs65433898)/Gcrc Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown RRID:RGD_13432202 Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. 13432203 SHRSP.WKY-(D3Mgh16-rs197649383)/Gcrc Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown RRID:RGD_13432203 Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. 13432204 SHRSP.WKY-(D3Mgh16-D3Mit10)/Gcrc Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown RRID:RGD_13432204 Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. 13437612 SS-Adamts16em1Bj University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614. mutant Unknown Adamts16em1Bj 13437613 17 2559771 2690663 7 1 36468949 36599799 7 1 35067513 35067529 8 1 32430681 32430697 8 RRID:RGD_13437612 This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. 13441557 LE-Tg(Cx3cr1-cre/ERT2)3Ottc Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00858 This strain was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. 13446407 SD-Tg(Camk2a-cre/ERT2)/ZiRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-11-07) RRID:RRRC_00688 The hemizygous rats have random insertion of calcium/calmodulin-dependent protein kinase II alpha (Camk2a)- cre/ERT2 (tamoxifen inducible Cre recombinase) transgene in the genome. This transgenic exhibits expression of cre/ERT2 fusion protein in neural populations where the mouse Camk2a promoter region found in the transgene is active. 13450922 SD-GEPR-3 Rat Resource and Research Center Rat Resource and Research Center inbred Unknown seizure RRID:RRRC_00798 Genetically Epilepsy-Prone Rats (GEPR-3) have moderate levels of seizure predisposition. This colony,initially referred to as an AGS (audiogenic response score) colony, was bred to exhibit clonic convulsions (moderate seizures with an ARS of 3) following a single wild running phase in response to sound. Siezures model human generalized tonic/clonic seizures. 13451132 BN-Crb1m1 mutant Unknown Crb1m1 13451133 13 52558317 52725099 7 13 61292273 61480872 7 13 56270519 56462893 7 13 50801484 50989261 7 RRID:RGD_13451132 This Brown Norway from Janvier rat strain spontaneously develops progressive focal retinal layer disorganization, loss of photoreceptors, cystic cavitation, and RMG abnormalities associated with early retinal vascular telangiectasia and late stage subretinal neovascularization. This phenotype bears reminiscent of human Macular telangiectasia 2. A deletion insertion mutation in exon 6 of the rat crb1 was identified to be responsible for this retinal phenotype. 13451538 FHH-Chr 1BN-Dusp5em1Mcwi mutant Unknown Dusp5em1Mcwi 13451539 1 259754234 259767645 7 1 281658075 281671486 7 1 274245184 274258595 7 1 252538408 252555320 7 RRID:RGD_13451538 This strain was produced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC-CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449 and 464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid 121. 13452382 SD-Tg(Htt*) transgenic Unknown HTT 68472 RRID:RGD_13452382 This rat model was developed by injection of SD embryos with construct containing rat huntingtin cDNA fragment with 51 CAG repeats (from HD patient) under control of the native rat huntingtin promoter. 13452406 SHR/NHsdAkr Spontaneously Hypertensive Rat University of Akron breeding colonies, Akron, Ohio inbred Unknown RRID:RGD_13452406 SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at the University of Akron breeding colonies, Akron, Ohio 13452407 WKY/NHsdAkr University of Akron breeding colonies, Akron, Ohio. inbred Unknown RRID:RGD_13452407 These animals were bought from Harlan Indianapolis, Indiana U.S.A. and maintained at the University of Akron breeding colonies, Akron, Ohio. 13462044 LE-Tg(Thy1-GCaMP6f)9Rrrc Janelia Research Campus and Princeton University Rat Resource & Research Center transgenic Unknown RRID:RRRC_00829 Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-chain kinase. 13462045 LE-Tg(Thy1-GCaMP6f)7Rrrc Janelia Research Campus and Princeton University Rat Resource & Research Center transgenic Live Animals (as of 2024-01-17) RRID:RRRC_00830 Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-chain kinase. 13464263 F344-Il2rgem1Iexas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2018-01-02) Immunology Il2rgem1Iexas 13464264 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66395330 66399026 7 RRID:RGD_13464263 This strain was established by CRISPR/Cas9 targeting rat Il2rg gene using electroporation. background strain: F344/Jcl. This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion of Il2rg gene. This strain grows normally under SPF condition. 13464268 GH/Htru National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2018-01-02) RRID:RGD_13464268 University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). Characteristics Develops hypertension, cardiac hypertrophy and vascular disease (Phelan 1968, Simpson and Phelan 1984, Simpson et al, 1994). 13464270 Seac:LIS Lister Rat, Sea:Lister Hooded National BioResource Project for the Rat in Japan outbred Cryopreserved Embryo (as of 2018-01-02) RRID:RGD_13464270 In 1990, this strain was introduced from Harlan Olac (UK) to Seiwa Institute of Experimental Animals. Then this strain was introduced to KYUDO Company in 2004. 13464272 CrljJclKud:SD National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan outbred Cryopreserved Embryo (as of 2018-01-02) RRID:RGD_13464272 In 2004, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016. 13464273 JclKud:WI Wistar rats National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan outbred Cryopreserved Embryo (as of 2018-01-02) RRID:RGD_13464273 In 1977, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016. 13464320 STOCK Aspaem34Kyo Hcn1A354V/Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan inbred Unknown Aspaem34Kyo|Hcn1A354V 11564348|13464319 RRID:RGD_13464320 This double mutant strain was established by crossing WTC/Kyo (NBRP Rat No. 0020) and F344-Aspaem34Kyo (NBRP Rat No. 0806). WTC/Kyo has a missense mutation (Hcn1A354V) in Hcn1 (Hyperpolarization-activated cyclic nucleotide-gated channel 1) gene and F344-Aspaem34Kyo has a 16-bp deletion in the exon4 of Aspa (Aspartoacylase) gene (c.622_637del). 13464326 LE.W-Tg(Slc32a1-YFP*)1Yyan/Vip National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2018-01-03) RRID:RGD_13464326 The original strain, W-Tg(Slc32a1-YFP*)1Yyan (NBRP No.0554 rat), was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006 (Uematsu et al. Cerebral Cortex (2008). This original strain rats were was crossed with Long-Evans rat (Iar:Long-Evans) for 10 generations to establish the congenic strain. 13464327 WKY.Cg-clest/Iet National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2018-01-03) RRID:RGD_13464327 When the depositor (The Institute of Environmental Toxicology ) conducted mating experiment using male Crl:CD(SD) rats, the offsprings of backcrossed-generation showed multiple malformations such as ectrodactylism, cleft palate or lip in 2013. These phenotype might be inherited in an autosomal recessive pattern. Therefore the congenic strain was established using WKY strain as the recipient strain. 13464329 FPL/Iet Fused pulmonary lobes, FPL The Institute of Environmental Toxicology National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2023-09-28) Frem2fpl 13464330 2 142464169 142604059 7 2 162430795 162568910 7 2 142782178 142782178 8 2 137637371 137637371 8 RRID:RGD_13464329 This spontaneous mutant strain wa found in a colony of Jcl:Wistar strain at the Institute of Environmental Toxicology in 1978: 3 rats out of 13 rats showed fused right pulmonary lobes with reduction deformity of middle pulmonary lobes. These rats also had the syndactylism or paten tof the eyelid. It was difficult to maintain this strain in homozygous condition, mating system has been changed to sib mating between heterozygous rats. 13503336 W;Cg-Acrtm1Osb Acr KO, Acr {tm1 Osb} National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2018-01-12) RRID:RGD_13503336 After homologous recombination using ES cells derived from hybrid (mix) breed of Slc:Wistar (female) and F344/NSlc (male), Acr KO strain was established by GLT at Osaka University. The genomic region including exon 1 to exon 3 is replaced by Neo resistance gene. After mating with Slc:Wistar, this strain is maintained by sib mating or with Slc:Wistar rats. 13506176 SS-Nox4em2Ncf2em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm; Cryorecovery (as of 2018-11-12) Nox4em2Mcwi|Ncf2em1Mcwi 4139868|5144089 13;1 67806516;143415816 67834105;143603554 7;7 13;13;13;13 75200283;75200283;75200283;75200283 75200287;75200287;75200287;75200287 8;8;8;8 13;1 70229196;150861996 70229200;150862003 8;8 13 64958217 64958221 8 RRID:RGD_13506176 Breeding together of SS-Nox4em2Mcwi (RGDID: 4139883) and SS-Ncf2em1Mcwi (RGDID: 5144104), both models were generated by ZFN mutagenesis. 13506737 GK inbred Unknown RRID:RGD_13506737 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s, GK rats were initiated with breeding pairs in several places and also commercially available from Japanese breeders Charles River Japan, Yokohama, Oriental Yeast, Tokyo, Clea Japan Inc., Osaka (GK/Clea), Japan SLC, Shizuoka (GK/SLC), Takeda Lab Ltd., Osaka (GK/Taked), and from Taconic, USA (GK/Mol/Tac). 13506738 GK/Par inbred Unknown RRID:RGD_13506738 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generation.In 1988, GK/Par substrain was established in Paris, France by initiating breeding pairs F35 from Japanese colonies . 13506739 GK/Jcl CLEA Japan, Inc CLEA Japan, Inc inbred Unknown RRID:RGD_13506739 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.This strain was introduced from Tohoku University, and CLEA Japan Inc started its production and supply as GK/Jcl. 13506831 SS-P2rx7em10Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-02-21) P2rx7em10Mcwi 13792805 12 35074025 35117152 7 12 41242368 41808755 7 12 39353613 39396042 7 12 33917656 33917666 8 RRID:RGD_13506831 CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2 13506832 SS-P2rx7em13Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) P2rx7em13Mcwi 13792806 12 35074025 35117152 7 12 41242368 41808755 7 12 39353613 39396042 7 12 33917654 33917663 8 RRID:RGD_13506832 CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2 13506918 F344/N Fischer NIH Autoimmune Rat Model Repository and Development Center inbred Unknown RRID:RGD_13506918 Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from NIH. 13506919 F344/Nctr Fischer National Center for Toxicological Research, FDA. inbred Unknown RRID:RGD_13506919 Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Center for Toxicological Research, FDA. 13508588 WI Wistar rat outbred Unknown RRID:RGD_13508588 The Wistar rat is an outbred albino rat. This breed was developed at the Wistar Institute in 1906 for use in biological and medical research, and is notably the first rat developed to serve as a model organism. 13513909 SD-Tg(Ren2)27-/- Center for Genome Research, University of Edinburgh, UK transgenic Unknown RRID:RGD_13513909 This is a littermate wild type control strain for SD-Tg(Ren2)27 (RGD:629501), which was generated by the mouse Ren2 renin gene along with its 5' and 3' flanking sequences being microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background. 13524863 LEC/Crlj Long Evans Cinnamon Japan Charles River Inc. (Yokohama, Japan) inbred Unknown RRID:RGD_13524863 The LEC/Crlj is available at Japan Charles River Inc. (Yokohama, Japan) since 1991 from the Center for Experimental Plants and Animals, Hokkaido University. 13524998 UPL inbred Unknown RRID:RGD_13524998 In 1989, a femal sprague-Dawley rat with spontaneous cataracts was observed in the Upjohn Pharmaceuticals Limited Tsukuba Research Laboratory colony. The cataract was demonstrated to be hereditary and it was determined that there are two cataract types with different onset ages. 13525002 Gunn rats segregating_inbred Unknown RRID:RGD_13525002 This mutation was observed for the first time in the breeding stock of the rat colony of the Connaught Laboratories in 1934. It is of Wistar origin. 13592602 SD-Tg(LRRK2*G2019S)418Rwm Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2018-05-14) Parkinson's Disease LRRK2 1353141 RRID:RRRC_00776 These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag. 13592603 SD-Tg(LRRK2)302Rwn Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2018-05-14) LRRK2 1353141 RRID:RRRC_00778 These rats were created using BAC constructs consisting of the entire 144kb human wild type LRRK2 locus fused to a YPet reporter tag. 13592604 SD-Tg(LRRK2*G2019S)416Rwm Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2018-05-14) Parkinson's Disease RRID:RRRC_00785 These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag. 13592605 F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561Bryd F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561 Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) RRID:RRRC_00797 The transgene consists of a SpeI fragment from plasmid pCAG-loxPSTOPloxP-ZsGreen (Addgene plasmid #51269, donated by Pawel Pelczar). Hemizygous animals contain approximately 4 copies of the transgene integrated at a site on Chromosome 2. 13602097 LE.Cg-(ROSA26) em1(CAG-Cas9*D10A)Ottc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00834 The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of CRISPR associated protein 9 (Cas9) catalytic mutant protein D10A under the control of CAG promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 13628730 SD-Il2rgem1Ang Centre de Recherche en Transplantation et Immunologie UMR1064, INSERM, University de Nantes, Nantes, France. mutant Unknown Il2rgem1Ang 13628731 X 89342055 89345715 7 X 72017856 72021516 7 X 71168483 71168562 8 X 66398441 66398520 8 RRID:RGD_13628730 TALEN targeting the 2nd exon of rat Il2rg gene was designed and mRNA coding these TALEN was microinjected into Crl:SD embyo.This strain carrying an 80 bp deletion generated a premature stop codon in the 3rd exon. No Il2rg protein was detected by western blot. 13673907 NMcwiWfsm:HS Heterogeneous stock Department of Internal Medicine, Molecular Medicine Wake Forest Baptist Medical Center outbred Unknown RRID:RGD_13673907 25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy. These HS rats were derived from NMcwi:HS at the Medical College of Wisconsin and maintained at Wake Forest Baptist Medical Center starting in 2017. 13702080 SD-Ahrem1Soar University of Kansas Medical Center Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2019-01-21) Toxicology, reproduction, cancer Ahrem1Soar 13702081 6 54205104 54240268 7 6 64589066 64624078 7 6 54963990 55001806 7 6 52234089 52271568 7 RRID:RRRC_00831 CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands. 13702084 BBDP.BBDR-Gimap5/Sunn Philippe Poussier,Sunnybrook Research Institute/University of Toronto congenic Unknown Gimap5 628871 RRID:RGD_13702084 To generated Gimap5 congenic BBDP/WorSunn rats, the laboratory introgressed the wild-type Gimap5 locus derived from BBDR (BBDR/Wor) rats (Biomedical Research Models) into BBDP/WorSunn rats. Briefly, BBDP/WorSunn and BBDR/Wor rats were crossed, and the resulting F1 animals were backcrossed to BBDP/WorSunn rats. This step was followed by 10 more, marker- assisted backcrosses of Gimap5 heterozygous progeny to BBDP/WorSunn rats. After the eleventh backcross, nonlymphopenic rats were intercrossed, and their progeny homozygous for wild-type Gimap5 were selected for establishing the congenic non-lymphopenic BBDP/WorSunn line (also called BBDP/WorSunn.BBDR-Iddm2). 13702085 BBDP.BBDR-Gimap5, WF-(D13Rat124-D13Mgh5)/Sunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada Rat Resource & Research Center congenic Cryopreserved Sperm; Cryorecovery (as of 2019-03-18) Ptprc|Gimap5 3451|628871 RRID:RRRC_00791 The Gimap5 congenic BBDP/WorSunn rats (BBDP.BBDR-Gimap5/Sunn) were corssed with the BBDP/WorSunn.WF-CD45 inbred line (BBDP.WF-(D13Rat124-D13Mgh5)/Sunn) to develop an inbred BBDP/WorSunn strain that would be congenic for both wild type Gimap5, hence non T lymphopenic (and consequently diabetes resistant), and for the WF-derived CD45.2 (RT7) allele (the original BBDP/WorSunn strain carries the CD45.1 allele). 13703119 SD-Lamp2em1 State Key Laboratory of Cancer Biology, National Clinical Research Centre for Digestive Diseases and Xijing Hospital of Digestive Diseases, Fourth Military Medical University, Xi'an, China mutant Unknown Lamp2em1 13703121 X 6908285 6951772 7 X 124809053 124852509 7 X 124722628 124766079 7 X 117173097 117222090 7 RRID:RGD_13703119 This strain was produced by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion and results in knockout of Lamp2 protein in Lamp2 y/- male. 13781890 SD-Rnaset2em1Sage mutant Unknown Rnaset2em1Sage 13781891 1 47227491 47244660 7 1 54425133 54442302 7 1 53174879 53192048 7 1 52576344 52603151 7 RRID:RGD_13781890 Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats. WT, heterozygous and homozygous (KO) rats were born in the expected Mendelian ratio, and homozygous RNaseT2 KO rats were viable and fertile. 13782128 SD-Pde4bem1Sage Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2018-08-22) Pde4bem1Sage 13782129 5 123158156 123533877 7 5 125623815 126001128 7 5 121759236 122136814 7 5 116799819 117369155 7 RRID:RGD_13782128 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 1 of rat Pde4b into Sprague Dawley embryos. The 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 in rat was created in the mutant founders. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. 13782146 SD-Bace1em1Sage-/- SD-Bace1em1Sage-/Bace1em1Sage- mutant Unknown Bace1em1Sage 13782148 8 48817824 48839681 7 8 48766005 48788272 7 8 50140092 50162388 7 8 46142060 46166268 7 RRID:RGD_13782146 Bace1 (-/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) 13782163 SD-Sncatm1(SNCA*)Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2018-08-24) RRID:RGD_13782163 This model contains a knockin of the A53T-mutated SNCA gene deeming the rat SNCA gene non-functional. The knockin contains humanized amino acids for the region spanning amino acids 53-122. The resulting model expresses a humanized A53T alpha-synuclein protein without endogenous rat alpha-synuclein. 13782164 SD-Sncaem1Sage Horizon Discovery Horizon Discovery mutant Live Animals (as of 2018-08-24) RRID:RGD_13782164 This model contains a deletion of the endogenous rat SNCA gene, encoding the alpha-synuclein protein. This model was generated using the CRISPR/Cas9 genome targeting strategy. 13782280 SS-Kcnj1em1Kasu+/+ Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,Inc mutant Unknown RRID:RGD_13782280 Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein. This strain is the wild type littermate from heterozygous cross. 13782351 SS-Kcnj1em1Kasu+/- Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,Inc mutant Unknown Kcnj1em1Kasu 13782352 8 32158243 32162370 7 8 33453597 33454750 7 8 33490280 33519127 7 8 30779883 30808607 7 RRID:RGD_13782351 Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is TCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single -cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. 13782353 SS-Kcnj1em1Kasu-/- Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,Inc mutant Unknown Kcnj1em1Kasu 13782352 8 32158243 32162370 7 8 33453597 33454750 7 8 33490280 33519127 7 8 30779883 30808607 7 RRID:RGD_13782353 Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. 13782371 SD-Cacna1f csnb congenital stationary night blindness rat mutant Unknown Cacna1f csnb 13782372 X 26908850 26937165 7 X 16504174 16532670 7 X 15712709 15741135 7 X 14868096 14896413 7 RRID:RGD_13782371 A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. 13792570 WI-Oprl1m1Hubr+/- Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Oprl1m1Hubr 13792571 3 170869862 170873417 7 3 180932344 180943574 7 3 177223779 177231663 7 3 168831934 168839920 7 RRID:RGD_13792570 The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon. 13792572 WI-Oprl1m1Hubr-/- NOPr knockout rat Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Oprl1m1Hubr 13792571 3 170869862 170873417 7 3 180932344 180943574 7 3 177223779 177231663 7 3 168831934 168839920 7 RRID:RGD_13792572 The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.NOPr is completely absent in homozygous mutants. 13792573 SD-Lepem1Sage+/- Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2018-09-13) Cardiovascular Lepem1Sage 12904927 4 55943837 55945938 7 4 56085079 56099209 7 4 56347081 56347231 8 4 57670525 57670675 8 RRID:RGD_13792573 This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels 13792575 SD-Lepem1Sage+/+ mutant Unknown (as of 2018-09-13) Cardiovascular RRID:RGD_13792575 These wild type rats are littermates of homozygous knockout rats from heterozygote matings. The Lepr knockout model possesses a 151 bp deletion spanning the exon 1/intron 1 junction of the Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels 13792606 SD-Cd59em1Ask-/- SD-Cd59em1-/Cd59em1- Cardiovascular Research Institute,University of California San Francisco, CA 94143-0521 USA mutant Unknown Cd59em1Ask 13792720 3 89243600 89245129 7 3 100650411 100668036 7 3 94010481 94028660 7 3 90459085 90477571 7 RRID:RGD_13792606 The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. 13792607 SD-Cd59em1Ask+/+ Cardiovascular Research Institute,University of California San Francisco, CA 94143-0521 USA mutant Unknown RRID:RGD_13792607 The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion in exon 3. No protein expression was detected in the blood smear of homozygous mutants. Breeding of CD59 +/- rats was done to generate wildtype (CD59+/+)and homozygous mutant (CD59-/-) rats. 13792682 SD-Abcc6em2Qlju+/- Thomas Jefferson University, Philadelphia mutant Unknown Abcc6em2Qlju 10413846 1 96448588 96524655 7 1 103042723 103096453 7 1 101954786 102013252 7 1 96447224 96501464 7 RRID:RGD_13792682 This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 13792683 SD-Abcc6em2Qlju+/+ Thomas Jefferson University, Philadelphia mutant Unknown RRID:RGD_13792683 This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. This wild type mutant is the wild type offspring from the cross of heterozygous mutants. 13792701 SD-Trpv1em1Sage-/- Horizon Discovery Horizon Discovery mutant Cryopreserved Embryo (as of 2018-09-21) Trpv1em1Sage 13792702 10 60109656 60134939 7 10 59538296 59563441 7 10 59799123 59824208 7 10 57851428 57876513 7 RRID:RGD_13792701 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created. Homozygous knockout rats exhibit complete loss of Trpv1 protein. 13792705 SD-Trpv1em1Sage+/+ mutant Unknown RRID:RGD_13792705 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created ( SD-Trpv1em1Sage-/-). This wild type mutant is the wild type offspring from the cross of heterozygous mutants. 13792727 HanRj:WI Janvier Labs Janvier Labs outbred Unknown RRID:RGD_13792727 Zentralinstitut fur Versuchstierzucht (Hannover) 1982 (from Allington Farm - UK 1964). This strain was selected by DONALDSON in 1906 at the Wistar Institute (USA), from a batch belonging to Chicago University (RUSSEL-LINDSAY, 1979). 13792794 SD-Fhem1+/- mutant Unknown Fhem1 13792797 13 91329837 91355722 7 13 98116496 98142636 7 13 93651486 93677371 7 13 87524331 87550215 7 RRID:RGD_13792794 A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. No homozygous -/- mutant was revealed in litters. 13792795 SD-Fhem1+/+ mutant Unknown RRID:RGD_13792795 A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. Breeding of Fh +/- rats was done to generate wildtype (Fh+/+)and Fh (+/-). No homozygous mutant were observed. 13792801 SS-Nlrp3em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-09-28) Nlrp3em2Mcwi 13792799 10 45850224 45874533 7 10 45648191 45674617 7 10 45893673 45893686 8 10 44326770 44353814 7 RRID:RGD_13792801 CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion of exon 1 in the Nlrp3 gene. 13792803 SS-P2rx7em12Mcwi mutant Cryopreserved Sperm (as of 2023-06-21) P2rx7em12Mcwi 13792802 12 35074025 35117152 7 12 41242368 41808755 7 12 39353613 39396042 7 12 33917654 33917663 8 RRID:RGD_13792803 This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene. 13792808 SS-Ptk2bem1Mcwi mutant Cryopreserved Sperm (as of 2021-11-03) Ptk2bem1Mcwi 13792810 15 45589222 45717866 7 15 48646476 48766708 7 15 42827306 42947796 7 15 40414764 40414771 8 RRID:RGD_13792808 CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. 13792811 SS-Ptk2bem3Mcwi mutant Unknown Ptk2bem3Mcwi 13792812 15 40414760 40414771 8 RRID:RGD_13792811 CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a7-bp deletion in exon 2. 13792813 SHRSP-Spp1em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-01) Spp1em2Mcwi 13792814 14 6653086 6658937 7 14 6673686 6679965 7 14 5312019 5312029 8 RRID:RGD_13792813 CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene. 13792821 SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1Mcwi SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1 MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Unknown RRID:RGD_13792821 The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette. 13792822 SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2Mcwi SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2 MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Unknown RRID:RGD_13792822 The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line B. 13792823 SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Unknown RRID:RGD_13792823 The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line C. 13792825 SD-Tg(CAG-loxP-stop-loxP-Mfn1-GFP)1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Unknown RRID:RGD_13792825 The Sleeping Beauty transposon system was used to introduce a Mfn1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette. This is line A. 13792827 WKY-Tg(Ubc-cre/ERT2)4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Cryopreserved Sperm (as of 2018-10-02) RRID:RGD_13792827 The Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line D.Cre activity is detected even without tamoxifen induction. 13792828 WKY-Tg(Ubc-cre/ERT2)5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Cryopreserved Sperm (as of 2018-10-02) RRID:RGD_13792828 The Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line E.Cre activity is detected even without tamoxifen induction. 13793372 SS-Tlr4em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Tlr4em1Mcwi 13793373 5 83564100 83577735 7 5 86690670 86704302 7 5 82587424 82601056 7 5 80145867 80159501 7 RRID:RGD_13793372 CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2. 13793374 DA-Tph1em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-03) Tph1em4Mcwi 13793375 1 97186071 97207551 7 1 103746878 103774100 7 1 102694238 102694238 8 1 97157375 97178415 7 RRID:RGD_13793374 CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4. 13793376 SS-Avpr2em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Embryo (as of 2018-10-03) Avpr2em4Mcwi 13793377 X 159821860 159823488 7 1 152637074 152640726 7 X 156890489 156890518 8 X 151633501 151636155 7 RRID:RGD_13793376 CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. 13793378 SS-Avpr2em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-03) Avpr2em5Mcwi 13793379 X 159821860 159823488 7 1 152637074 152640726 7 X 156890484 156890492 8 X 151633501 151636155 7 RRID:RGD_13793378 CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2. 13799346 SS-Cgnl1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-10) Cgnl1em1Mcwi 13799347 8 76088865 76241145 7 8 74800532 74950938 7 8 78232373 78232452 8 8 72273401 72424842 7 RRID:RGD_13799346 CRISPR/Cas9 system was used to introduce a 80-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryos 13799348 SS-Cgnl1em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-10) Cgnl1em2Mcwi 13799349 8 76088865 76241145 7 8 74800532 74950938 7 8 78232367 78232454 8 8 72273401 72424842 7 RRID:RGD_13799348 CRISPR/Cas9 system was used to introduce a 88-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryos 13799350 T2DN-F2rem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-10) F2rem1Mcwi 13799351 2 25985800 25989072 7 2 45254489 45257761 7 2 26118760 26135340 7 2 26872357 26872358 8 RRID:RGD_13799350 CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos. 13800555 F344/IcoCrl Charles River Charles River inbred Unknown RRID:RGD_13800555 From mating #344 of rats purchased from a local breeder (Fischer). The colony was originated by M. R. Curtis, Columbia University in 1920. To the Germ-Free Animal Laboratory at CNRS, Gif-sur-Yvette, France from the Lobund Institute, University of Notre-Dame, South Bend, Indiana, U.S.A. Subsequently introduced to Charles River France in 1970 as an axenic colony. 13800556 F344-Hsd11b2em1Jmul-/- F344-Hsd11b2em1Jmul-/Hsd11b2em1Jmul- mutant Unknown Hsd11b2em1Jmul 13800560 19 35336342 35341585 7 19 48341841 48347084 7 19 37476083 37481326 7 19 33397656 33402899 7 RRID:RGD_13800556 The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. 13800557 F344-Hsd11b2em1Jmul+/+ F344-Hsd11b2em1Jmul+/Hsd11b2em1Jmul+ mutant Unknown RRID:RGD_13800557 This is the wild-type litter mates of the Hsd11b2 F344 mutants created by ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. 13800746 SS-F8em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-17) F8em1Mcwi 13800747 18 121134 162008 7 18 413447 444491 7 18 367862 399242 7 18 140848 172330 7 RRID:RGD_13800746 CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos. 13800749 Lew-Glp1rem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Glp1rem1Mcwi 13800750 20 9225881 9264184 7 20 11768479 11808416 7 20 9586075 9626228 8 20 8972004 9010241 7 RRID:RGD_13800749 CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. 13800810 SS-Kcnq1em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-10-18) Kcnq1em5Mcwi 13800813 1 203383401 203803687 7 1 223154713 223490458 7 1 216293087 216630339 8 1 198291711 198624683 7 RRID:RGD_13800810 CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos. 13800825 FHH-Muc1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2018-10-18) Muc1em1Mcwi 13800827 2 181399482 181403640 7 2 207957206 207962396 7 2 188543137 188547874 7 2 174635989 174640738 7 RRID:RGD_13800825 CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos. 13800838 FHH-Mybphlem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Mybphlem1Mcwi 13800841 2 203934530 203948031 7 2 230628901 230643002 7 2 211158902 211173036 7 2 196005516 196005517 8 RRID:RGD_13800838 CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. 13800845 FHH-Mybphlem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2023-06-21) Mybphlem2Mcwi 13800846 2 203934530 203948031 7 2 230628901 230643002 7 2 211158902 211173036 7 2 196005534 196005535 8 RRID:RGD_13800845 CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. embryos. 13800848 SS-Nlrp3em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Nlrp3em1Mcwi 13800850 10 45850224 45874533 7 10 45648191 45674617 7 10 45884324 45918290 7 10 44329222 44329231 8 RRID:RGD_13800848 CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. 13800869 SS-P2ry2em6Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown P2ry2em6Mcwi 13800870 1 158440018 158454213 7 1 172227726 172241921 7 1 166031228 166045423 7 1 155354365 155354496 8 RRID:RGD_13800869 CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene. 13800871 SS-P2ry2em7Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown P2ry2em7Mcwi 13800873 1 158440018 158454213 7 1 172227726 172241921 7 1 166031228 166045423 7 1 155354367 155354481 8 RRID:RGD_13800871 CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene. 13800875 SS-Prltm1(PRL)Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown PRL 736187 RRID:RGD_13800875 CRISPR/Cas9 and plasmid donor containing floxed human prolactin cDNA were used to insert the human cDNA into the start coden of rat prolactin gene 13800877 LH-Chr 17LN-C17h6orf52em2Mcwi mutant Cryopreserved Sperm (as of 2018-10-18) C17h6orf52em2Mcwi 13800878 17 29733271 29746771 7 17 23581681 23595498 7 17 21600326 21615888 7 17 23767016 23767016 8 RRID:RGD_13800877 CRISPR/Cas9 system was used to introduce a net 10-bp insertion in exon 2 of rat C17h6orf52. 13825143 WKY-Gja5em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Gja5em1Mcwi 13825144 2 191824118 191843867 7 2 218648368 218669354 7 2 199181973 199181973 8 2 184602407 184621952 7 RRID:RGD_13825143 CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. 13825147 SS-Per1em3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Per1em3Mcwi 13825148 10 55687124 55696020 8 RRID:RGD_13825147 CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. 13825196 SS-Sh2b3tm1Mcwi mutant Cryopreserved Sperm (as of 2018-11-21) Sh2b3tm1Mcwi 14394610 RRID:RGD_13825196 CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exons 13825199 WI-Mc4rm1Hubr Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Mc4rm1Hubr 13825200 18 63390922 63392809 7 18 61799166 61801053 7 18 62612838 62614725 7 18 60419832 60421719 7 RRID:RGD_13825199 The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. 13838845 SD-Ahrem2Sage mutant Unknown Ahrem2Sage 126790510 6 54205104 54240268 7 6 64589066 64624078 7 6 54963990 55001806 7 6 52234089 52271568 7 RRID:RGD_13838845 ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene.This ZFN model contains a 29-bp deletion in the rat Ahr gene. 14390067 WI-Slc6a4m1Hubr-/- Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Slc6a4m1Hubr 14390068 10 67134790 67155891 7 10 62851326 62872481 7 10 63153656 63188377 7 10 61824208 61858924 7 RRID:RGD_14390067 The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The homozygoous mutant rats were generated by incrossed between heterozygous Slc6a4 knock out rats. 14390069 WI-Slc6a4m1Hubr+/- Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Slc6a4m1Hubr 14390068 10 67134790 67155891 7 10 62851326 62872481 7 10 63153656 63188377 7 10 61824208 61858924 7 RRID:RGD_14390069 The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The heterozygoous mutant rats were used to generate homozygous Slc6a4 knock out rats. 14390082 SD-Tg(Fos-LacZ)Bhope Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00865 The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Rats were rederived from frozen embryos in 2002 and bred onto SD background for >35 generations at NIDA IRP (Bruce Hope lab) 14390083 WI-Tg(Fos-LacZ)Bhope transgenic Unknown RRID:RGD_14390083 The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Initial SD rats were then bred onto Wistar background for >10 generations at NIDA IRP (Bruce Hope lab) 14392784 ACI.SD-Esr1em1Soar Rat Resource and Research Center Rat Resource and Research Center mutant Unknown (as of 2019-02-28) Esr1em1Soar 12910736 1 35523680 35759891 7 1 42534049 42935434 7 1 41358808 41359289 8 1 41272347 41272828 8 RRID:RRRC_00849 This strain was produced by backcrossing the ZFN induced 482 deletion allele (Esr1em1Soar) in HsdHot:SD to the ACI/SegHsd background for 12 generations. ACI strain is particularly sensitive to Estrogen-induced tumorigenesis. 14392813 SD-Cftrem1Sage+/- inotiv inotiv mutant Cryopreserved Embryo; Cryorecovery (as of 2023-06-06) Cftrem1Sage 14392814 4 43874852 44041870 7 4 42281040 42448571 7 4 42693263 42860679 7 4 46561269 46728759 7 RRID:RGD_14392813 Cftr ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. This Cftr heterozygous rats exhibited similar bioelectric and other characteristics to wild-type. 14392815 SD-Cftrem1Sage-/- inotiv inotiv mutant Unknown (as of 2019-03-04) Cftrem1Sage 14392814 4 43874852 44041870 7 4 42281040 42448571 7 4 42693263 42860679 7 4 46561269 46728759 7 RRID:RGD_14392815 CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats are produced by crossing the Cftr heterozygous rats. 14392817 SD-Cftrem1Sage+/+ mutant Unknown RRID:RGD_14392817 CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats and wild-type rats are produced by crossing the Cftr heterozygous rats. 14394485 SD-Bace1em1Sage mutant Unknown Bace1em1Sage 13782148 8 48817824 48839681 7 8 48766005 48788272 7 8 50140092 50162388 7 8 46142060 46166268 7 RRID:RGD_14394485 The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) 14394486 SD-Bace1em1Sage+/- SD-Bace1em1Sage+/Bace1em1Sage- mutant Unknown Bace1em1Sage 13782148 8 48817824 48839681 7 8 48766005 48788272 7 8 50140092 50162388 7 8 46142060 46166268 7 RRID:RGD_14394486 The Bace1 (+/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) 14394487 SD-Bace1em1Sage+/+ SD-Bace1em1Sage+/Bace1em1Sage+ mutant Unknown RRID:RGD_14394487 The Bace1 (+/+) rats were generated by crossing SD-Bace1em1Sage. The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) 14394488 Lew-Glp1rem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Glp1rem2Mcwi 14394489 20 9225881 9264184 7 20 11768479 11808416 7 20 9586075 9626228 8 20 8972004 9010241 7 RRID:RGD_14394488 CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 14394491 Lew-Glp1rem3Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Glp1rem3Mcwi 14394492 20 9225881 9264184 7 20 11768479 11808416 7 20 9586075 9626228 8 20 8972004 9010241 7 RRID:RGD_14394491 CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. 14394494 SS-Kcnj2em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2019-03-22) Kcnj2em2Mcwi 14394495 10 100574985 100576268 7 10 99125234 99134077 7 10 99429337 99442520 7 10 96066338 96066365 8 RRID:RGD_14394494 CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 14394496 SS-Kcnj2em4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Kcnj2em4Mcwi 14394497 10 100574985 100576268 7 10 99125234 99134077 7 10 99429337 99442520 7 10 96066345 96066346 8 RRID:RGD_14394496 CRISPR/Cas9 system was used to introduce a 2-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. 14394501 SHR-Klrb1aem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2019-03-25) Klrb1aem1Mcwi 14394503 4 165637478 165654188 7 4 227150602 227167004 7 4 161950270 161966582 7 4 161901789 161901793 8 RRID:RGD_14394501 CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. 14394504 SHR-Klrb1aem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown (as of 2019-03-25) Klrb1aem2Mcwi 14394505 4 165637478 165654188 7 4 227150602 227167004 7 4 161950270 161966582 7 4 161901790 161901891 8 RRID:RGD_14394504 CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. 14394506 SS-P2ry2em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2019-03-25) P2ry2em5Mcwi 14394507 1 155354461 155354487 8 RRID:RGD_14394506 CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3. 14394508 BBDR.BBDP-(D4Mit6-D4Mit7)-Tlr4em5Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2019-03-25) Tlr4em5Mcwi 14394509 5 83564100 83577735 7 5 86690670 86704302 7 5 82587424 82601056 7 5 80145867 80159501 7 RRID:RGD_14394508 CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos. 14394515 LE-Grin2bem1Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Autism Rat Model Resource, Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2025-02-20) Autism, Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) Grin2bem1Mcwi 14394517 4 172721895 173183187 7 4 233806406 234260360 7 4 169751704 169752731 8 4 168580824 169044110 7 RRID:RGD_14394515 CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3. 14394518 LE-Arid1bem1Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Autism Rat Model Resource, Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2025-02-20) Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) Arid1bem1Mcwi 14394519 1 40012872 40324266 7 1 47197399 47550032 7 1 46130110 46131244 8 1 45567991 45923644 7 RRID:RGD_14394518 CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4. 14394520 SS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1Mcwi SS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1 MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Unknown RRID:RGD_14394520 The Sleeping Beauty transposon system was used to introduce a Rpl10a-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette 14394616 DA-Tph2em3Mcwi+/+ PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-11-03) Tph2em3Mcwi 10402820 7 54321033 54430706 7 7 58053268 58157949 7 7 58112644 58112654 8 7 50685694 50789424 7 RRID:RGD_14394616 This wild type strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. 14394617 DA-Tph2em3Mcwi+/- PhysGen Knockouts mutant Unknown Tph2em3Mcwi 10402820 7 54321033 54430706 7 7 58053268 58157949 7 7 58112644 58112654 8 7 50685694 50789424 7 RRID:RGD_14394617 The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. 14394618 DA-Tph2em3Mcwi-/- PhysGen Knockouts mutant Unknown Tph2em3Mcwi 10402820 7 54321033 54430706 7 7 58053268 58157949 7 7 58112644 58112654 8 7 50685694 50789424 7 RRID:RGD_14394618 This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. 14394619 DA-Tph2em2Mcwi+/+ PhysGen Knockouts mutant Unknown RRID:RGD_14394619 This wild type strain was produced by crossing Tph2em2Mcwi heterozygous rats and confirmed by sequencing. The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. 14394620 DA-Tph2em2Mcwi+/- PhysGen Knockouts mutant Unknown Tph2em2Mcwi 10402817 7 54321033 54430706 7 7 58053268 58157949 7 7 58042279 58149220 7 7 50685694 50789424 7 RRID:RGD_14394620 The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. 14394621 DA-Tph2em2Mcwi-/- PhysGen Knockouts mutant Unknown Tph2em2Mcwi 10402817 7 54321033 54430706 7 7 58053268 58157949 7 7 58042279 58149220 7 7 50685694 50789424 7 RRID:RGD_14394621 The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. 14398460 SS-Cd40em1Uthal-/- University of Toledo Rat Resource and Research Center mutant Unknown Cd40em1Uthal 14398461 3 156092602 156107427 7 3 167711248 167711258 8 3 161519789 161534943 7 3 153790372 153805279 7 RRID:RRRC_00840 Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein. 14398463 SS-Prr5em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2019-04-19) Prr5em1Mcwi 40818256 7 122693577 122714377 7 7 125317939 125338782 7 7 125569791 125609340 7 7 115795351 115837880 7 RRID:RGD_14398463 CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. 14398465 SS-Prr5em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2019-04-19) Prr5em2Mcwi 40818255 7 122693577 122714377 7 7 125317939 125338782 7 7 125569791 125609340 7 7 115795351 115837880 7 RRID:RGD_14398465 CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. 14398479 SS-Xdhem1Mcwi-/- MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2024-05-29) Xdhem1Mcwi 14398480 6 21417685 21590015 7 6 34996983 35059195 7 6 25149570 25211273 7 6 21530463 21592172 7 RRID:RGD_14398479 CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. There was no Xdh protein detected in the kidney cortex tissue of 6-week old homozygous mutants. 14398481 SS-Xdhem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Xdhem2Mcwi 14398482 6 21417685 21590015 7 6 34996983 35059195 7 6 25149570 25211273 7 6 21530463 21592172 7 RRID:RGD_14398481 CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. 14398499 LE-Drd1em1(iCre)Berke Rat Resource and Research Center Rat Resource and Research Center mutant Live Animals (as of 2021-02-12) Drd1em1(iCre)Berke 14398500 17 16655926 16658161 7 17 13211031 13215581 7 17 11099736 11104352 7 17 10540440 10544971 7 RRID:RRRC_00856 The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE. 14398734 LE-Adora2aem1(iCre)Berke Rat Resource and Research Center Rat Resource and Research Center mutant Live Animals (as of 2021-02-12) Adora2aem1(iCre)Berke 14398735 RRID:RRRC_00857 The CRISPR system was used to created target insertion of iCre recombinase immediately after Adora2a gene, with P2A linker, of the embryos of BluHsd:LE. 14398825 SD-Fahem15Dlli-/- East China Normal University, Shanghai, China. mutant Unknown Fahem15Dlli-/- 14398826 1 140851975 140876187 7 1 147640316 147662920 7 1 146713663 146736339 7 1 138548830 138571599 7 RRID:RGD_14398825 This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates. 14398828 SD-Fahem10Dlli-/- East China Normal University, Shanghai, China. mutant Unknown Fahem10Dlli-/- 14398829 1 140851975 140876187 7 1 147640316 147662920 7 1 146713663 146736339 7 1 138548830 138571599 7 RRID:RGD_14398828 This strain was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates 14402419 LE-Chrna5em18Pas Strains were produced at Institut Pasteur (France), Departement de Neuroscience, Benoit Forget. The lines will be maintained at Charles River Laboratory France (CRLF). mutant Unknown Chrna5em18Pas 14402420 8 58538002 58566388 7 8 58143974 58172330 7 8 59561817 59590172 7 8 55369794 55398526 7 RRID:RGD_14402419 The Zinc Finger Nuclease system was used to create184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous. 14402421 LE-Chrna5em20(D398N)Pas Strains were produced at Institut Pasteur (France), Departement de Neuroscience, Benoit Forget. The lines will be maintained at Charles River Laboratory France (CRLF). mutant Unknown Chrna5em20(D398N)Pas 14402422 8 58538002 58566388 7 8 58143974 58172330 7 8 59561817 59590172 7 8 55369794 55398526 7 RRID:RGD_14402421 The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous. 14694847 LE-Pvalbem1(flpo)Berke/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Pvalbem1(flpo)Berke 14694849 7 116115034 116127508 7 7 119420581 119435235 7 7 119428657 119443674 7 7 109772939 109787954 7 RRID:RRRC_00859 A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. The CRISPR/Cas9 system was used to knock in the plasmid into the targeted gene in the Crl:LE embryo. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. ) 14694998 SD-Sdhbem1Ast Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00853 This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 4 bp-deletion in Sdhb. 14694999 SD-Sdhbem2Ast Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00854 This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 6 bp-deletion in Sdhb. 14695000 SD-Sdhbem3Ast Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00855 This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 15 bp-deletion in Sdhb. 14695002 SD-L1camem1Jgn Rat Resource and Research Center Rat Resource and Research Center mutant Unknown L1camem1Jgn 38599015 X 159784792 159801553 7 1 152649353 152676124 7 X 156901244 156928064 7 X 151597270 151623776 7 RRID:RRRC_00850 The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. 14695003 SD-L1camem2Jgn Rat Resource and Research Center Rat Resource and Research Center mutant Unknown L1camem2Jgn 14696788 X 159784792 159801553 7 1 152649353 152676124 7 X 156901244 156928064 7 X 151597270 151623776 7 RRID:RRRC_00851 The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. No protein expression was detected in the brain. 14695004 BBDR.F344-(D4Mgh24-D4Rhw6),BBDP-(D4Rhw6-D4Rhw10)/Rhw Rat Resource and Research Center Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-06-27) RRID:RRRC_00458 3 Mb of F344 DNA introgressed on Chr.4 between D4Mgh24 (73.75 Mb) and D4Rhw6 (76.83 Mb), and BB diabetes prone (DP) DNA introgressed from D4Rhw6 to D4Rhw10 (the most distal marker the end of the chromosome) 14695026 W-Tg(Crh-cre)Msg Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals (as of 2021-02-12) RRID:RRRC_00852 Cre recombinase has been inserted into the genome under the control of the Crh promoter. Generated on Wistar and backcrossed to Wistar every generation. 14695028 SD.DA-Kcnh2tm(EGFP-Pac)1Qly Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00847 This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.3kb 5' and 2.1kb 3' homology arm. The Kcnh2 gene 7th and 8th exons are replaced with a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain. 14695029 SD.DA-Kcnh2tm(CAG-EGFP)1Qly Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00848 This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 7.5kb 5' and 1.6kb 3' homology arm. A FRT-CAG-EGFP-IRES-Pac-FRT cassette is inserted into the intron between 8th and 9th exons of Kcnh2 gene. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain 14695030 SD.DA-Pex1tm(G843D-FRT-CAG-Pac-FRT)1Qly Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00846 This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 5.8kb 5' and 1.7kb 3' homology arms. A G843D point mutation is introduced into the Pex1 gene. The 12th and 13th exons are flanked with two loxP sites. A FRT-CAG-Pac-FRT cassette is inserted into the intron between Pex1 13th and 14th exon. This strain mimics the Peroxisomal Disorders. Heterozygote does not show any abnormalities. 14695031 SD.DA-Il2rgTm(G843D-FRT-CAG-Pac-FRT)1Qly Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00845 This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.0kb 5' and 1.8kb 3' homology arms and a FRT-CAG-Pac-FRT cassette. The FRT-CAG-Pac-FRT cassette is inserted into the intron between Il2rg 4th and 5th exon. No genomic sequence is deleted. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain. 14695032 SD-Tg(CAG-loxP-mCherry-loxP-EGFP)1Qly Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00844 A CAG-loxP-mCherry-loxP-EGFP cassette was injected into SD zygote to generate this line. The integration site is not determined. This transgenic line could be mated to other rat lines that express Cre/CreER for lineage tracing. 14695033 SD-Tg(CAG-Flpe)Qly Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00843 A CAG-Flpe cassette was injected into SD zygote to generate this line. The integration site is not determined.This transgenic line could be used to mate with other rat models that contains FRT sites to remove the cassette that is flanked by those FRT sites. 14695034 ZUC-Leprfa.BN-(D1Rat183-D1Rat90)/Ste Rat Resource and Research Center Rat Resource and Research Center congenic Unknown RRID:RRRC_00837 Congenic for distal half of Chromosome 1 from D1Rat183 to D1Rat90 from Brown Norway (BN) on the UC Davis ZUC Lepr faSte/+ strain background. The genetic backgound of the ZUC strain carries a defective leptin receptor on Chromosome 4. 14695052 ACI-Tg(ROSA26-ALPP)Rrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-07-01) ALPP 1314395 RRID:RRRC_00817 F344-Tg(ROSA26-ALPP)EpsRrrc (RGD:1566458) received in 1999 from Dr. Eric Sandgren, Univ. Wisconsin-Madison. Since 1999 bred on ACI background. 14695053 ZDF-Cnr1em1/Rrrc ZDF-Cnr1em1 Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00800 11bp deletion from genomic DNAfor the cannabinoid-1 receptor (Cnr1)using Zinc-Fingers Nucleases. Animals are resistant to the development of type-2 diabetes. 14695054 F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551Bryd F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551 Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals (as of 2019-07-01) RRID:RRRC_00795 14695055 MHS/Roman Milan Hypertensive Strain Rat Resource and Research Center Rat Resource and Research Center inbred Unknown RRID:RRRC_00794 Inbred hypertension model linked to a mutation in Add1 gene that has been validated as one of the genes linked to hypertension in numerous human genetic studies. Inbred strain originally developed by Dr. Bianchi in Milan in 1979. 14695058 SD-Add3em1Roman Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00792 frame shift deletion in an exon 12 of Add3 gene causing a stop codon and loss of function. SD outbred background. 14695059 BBDP/WorSunn.WAG-rnu/Sunn Rat Resource and Research Center Rat Resource and Research Center congenic Unknown RRID:RRRC_00789 To develop BBDP rats congenic for the rnu mutation (nude BBDP), researchers introgressed the rnu mutation from inbred rnu/rnu WAG rats (obtained from Biomedical Research Models) using marker assisted genotyping. 14695060 WKY-Tg(Eef1a1-GFP)Tja Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00780 Transgenic strain using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP) under the rat eukaryotic translation elongation factor 1 alpha (Eef1a1) promoter. Two integration sites located on chromosome 8:28170658 and chromosome 1:276465837, both located in intronic gene areas, Jam3 (RGD:1303248) intron 1 and Vti1a (RGD:621490) intron 6, respectively. The Jam3 intron 1 is 51bp long, and the transgene resides at 37kb from exon 1 and 13kb from exon 2. In Vti1a intron 6, 102 bp long, the transgene is located at 81.4 kb from exon 5 and 21 kb from exon 6. 14695061 LobRrrc:WI Lobund-Wistar Freimann Life Science Center, University of Notre Dame, Indiana Rat Resource and Research Center outbred Unknown RRID:RRRC_00962 Male L-W develop spontaneous tumors in the anterior and ventral prostate and the seminal vesicle @ an average of 20 months. Tumors can be induced with N-methylnitrosourea and testosterone propinate in an average of 10 months. A cell line of a prostate adenocarcinoma was also created from the strain (PAIII) and can be administer SC in L-W rats with palpable tumor in 7-14 days and metastasis to the lymph nodes and lungs in 28-30 days. 14695063 BN.LEW-(D10Rat258 and D10Rat51)/Ssn University of Massachusetts Medical School Deposited at Rat Resource and Research Center congenic Cryopreserved Sperm; Cryorecovery (as of 2024-01-11) 10 11212678 13365903 1 - by flanking markers 10 10039921 13302032 1 - by flanking markers 10 11278340 13486971 1 - by flanking markers 10 11072115 13146036 1 - by flanking markers RRID:RRRC_00752 Severe osteopetrosis with numerous non-functioning osteoclasts. Locus on chromosome 10. Homozygotes not fertile, need to test breed to ID heterozygotes. Homozygotes have no teeth, require ground food. One of only 4 osteopetrotic mutations in rat. Genetic lesion is not yet known but mutation is inherited in an autosomal recessive manner. The candidate gene region has been localized to Chr 10 between D10Rat258 and D10Rat51. original background strain is LEW/Ssn. 14695083 W/LnneRrrc Audiogenic Wistar rat Rat Resource and Research Center Rat Resource and Research Center inbred Unknown RRID:RRRC_00697 Wistar rats maintained at the animal facility of the Ribeirao Preto School of Medicine at the University of Sao Paulo, Brazil, were tested for audiogenic seizures, using as criteria an SI and the L1 (ref. RGD:14695082). The WAR colony foundation stock was produced by mating animals displaying at least procursive behaviors in three consecutive tests, one every 4 days (two males and four females). Each couple produced two or three lit-ters, from which selected individuals displaying the highest SI and shortest L1 were mated, at adult age,with their fathers and mothers. From the second generation on, brother and sister matings were done, in a ratio of one male to two females, selected accordingto the criteria above. 14695085 SD-Trim63em1(hiLuc)/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Trim63em1(hiLuc) 14696789 5 153059573 153073907 7 5 156292566 156306092 7 5 152533362 152547138 7 5 146533492 146547332 7 RRID:RRRC_00731 The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, can be used as a universalbiomarker of skeletal muscle atrophyin vivo, and has abioluminescent readout compatible with whole animal imagingmodalities. 14695086 Zuc/VcJw Zucker fatty Rat Resource and Research Center Rat Resource and Research Center inbred Unknown RRID:RRRC_00740 The original background strain derived from Sherman and Merck stock M rats (13 M strain). Obese animals produced by crossing homozygous obese males to heterozygous lean females. 14695088 WMS/SimfBR Munich Wistar Rat Resource and Research Center Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-07-03) RRID:RRRC_00832 Received from Munich, Germany via the V.A. San Francisco as line bred stock. Caesarean rederived when pedigreed brother x sister matings began. Selected for surface glomeruli and prominent elongated nephrons at the 6th, 12th and 18th .This strain also possess elongated nephrons. Unlike other Wistar strains with surface glomeruli, these animals do not become proteinuric as they age, which allows for the study of long term, chronic models. Age related proteinuria and spontaneous renal disease could interfere with experimentally-induced conditions. 14695547 LEW-Tg(HLA-B*2705,B2M)33-3Trg Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08) B2M|HLA-B 735892|1352836 RRID:RRRC_00624 This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 55 copies of HLA-B*2705 and 29 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center . 14695548 LEW-Tg(HLA-B*2705,B2M)21-4HTrg Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08) B2M|HLA-B 735892|1352836 RRID:RRRC_00622 This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 150 copies of HLA-B*2705 and 90 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center . 14696715 SD-Htr7em1Msu Transgenic and Genome Editing Facility, and Institute for Quantitative Health Science and Engineering, Michigan State University, East Lansing, Michigan mutant Unknown Htr7em1Msu 14696716 1 240136279 240260620 7 1 261759122 261879914 7 1 254547964 254671811 7 1 233636442 233761063 7 RRID:RGD_14696715 CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene. 14696719 F344-Trpc4Tn(sb-T2/Bart3)2.192Mcwi+/+ PhysGen, Transposagen Rat Resource and Research Center mutant Unknown RRID:RRRC_00344 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the wild type mutant. 14696720 F344-Trpc4Tn(sb-T2/Bart3)2.192Mcwi-/- PhysGen, Transposagen Rat Resource and Research Center mutant Unknown RRID:RRRC_00344 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the homozygous mutant. 14696721 F344-Trpc4Tn(sb-T2/Bart3)2.192Mcwi-/+ PhysGen, Transposagen Rat Resource and Research Center mutant Unknown RRID:RRRC_00344 These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the heterozygous mutant. 14696722 SD-Cyp3a23/3a1em1Myliu,Cyp3a2em1Myliu East China Normal University and Shanghai Changzheng Hospital Joint Research Center for Orthopedic Oncology, Shanghai Key Laboratory of Regulatory Biology Institute of Biomedical Sciences and School of Life Sciences. Shanghai, China mutant Unknown Cyp3a23-3a1em1Myliu|Cyp3a2em1Myliu 14696724|14696725 12;12 9567120;9517016 9595974;9541000 7;7 12;12 13145742;13719927 13174596;13740743 7;7 12;12 11641500;11053888 11677818;11082742 7;7 12;12 9207978;9256159 9230064;9285020 7;7 RRID:RGD_14696722 This rat strain is a double knock out for Cyp3a23/3a1 and Cyp3a2 created by using CRISPR/Cas9 targeting exons of Cyp3a23/3a1 and Cyp3a2. This strain carries a 22-bp deletion of Cyp3a23/3a1 and a 10-bp deletion of Cyp3a2 on Sprague Dawley background. 14700890 SD-Tg(Cx3cr1-cre/ERT2)3Ottc Rat Resource & Research Center Rat Resource & Research Center transgenic Live Animals (as of 2021-02-12) RRID:RRRC_00862 This strain was generated by microinjection of Sprague-Dawley embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. 14975242 ACI.FHH-(rs105487995-rs105373896)/Mcwi Medical College of Wisconsin congenic Unknown RRID:RGD_14975242 This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. 14975243 ACI.FHH-(rs105487995-rs106411696)/Mcwi Medical College of Wisconsin congenic Unknown RRID:RGD_14975243 This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. 14975244 ACI.FHH-(rgdv393055223-rs107095981)/Mcwi Medical College of Wisconsin congenic Unknown RRID:RGD_14975244 This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] ((also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. 14975245 ACI.FHH-(rgdv393055223-rs198922144)/Mcwi Medical College of Wisconsin congenic Unknown RRID:RGD_14975245 This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. 14975246 ACI.FHH-(rgdv393055223-rs198076037)/Mcwi Medical College of Wisconsin congenic Unknown RRID:RGD_14975246 This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. 14975247 ACI.FHH-(rs105373896-rgdv253272372)/Mcwi Medical College of Wisconsin congenic Unknown RRID:RGD_14975247 This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. 14975248 ACI.FHH-(rs198076037-rs105278863)/Mcwi Medical College of Wisconsin congenic Unknown RRID:RGD_14975248 This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. 14975305 F344-Bmpr2em1Sage+/- VA Palo Alto Health Care System, Stanford University School of Medicine mutant Unknown Bmpr2em1Sage 14981587 9 58327587 58436057 7 9 66371542 66486121 7 9 66568074 66683019 7 9 61192718 61307280 7 RRID:RGD_14975305 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. The strains of both sexes were confirmed Bmpr2 haplodeficiency. 14981588 F344-Bmpr2em2Sage+/- VA Palo Alto Health Care System, Stanford University School of Medicine mutant Unknown Bmpr2em2Sage 14981589 9 58327587 58436057 7 9 66371542 66486121 7 9 66568074 66683019 7 9 61192718 61307280 7 RRID:RGD_14981588 These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. The strains of both sexes were confirmed Bmpr2 haplodeficiency. 14981597 SD-Tg(SOD1*G93A)26DwcTac TACONIC transgenic Unknown SOD1 730855 RRID:RGD_14981597 SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation. Originally created by John Kulik at Wyeth. Transgenic Model of SOD1 mediated Amyotrophic Lateral Sclerosis (ALS, Lou Gehrig's Disease). Came to Taconic in April 2002 for David Howland at Wyeth for distribution as an Emerging Model. Joint collaboration between Wyeth and The ALS Association. 14985210 LE-Cyfip1em1Sage+/- mutant Unknown Cyfip1em1Sage 14985211 1 107245993 107334337 7 1 115265128 115353515 7 1 114258773 114347138 7 1 106710924 106799393 7 RRID:RGD_14985210 The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8. 14995941 Wpk Wistar polycystic kidney rat mutant Unknown Tmem67wpk 14995943 5 26324625 26377531 7 5 30371964 30424943 7 5 25666138 25721056 7 5 25567678 25567678 8 RRID:RGD_14995941 The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain. 15017093 Wpk +/- Wpk heterozygous rat mutant Unknown Tmem67wpk 14995943 5 26324625 26377531 7 5 30371964 30424943 7 5 25666138 25721056 7 5 25567678 25567678 8 RRID:RGD_15017093 The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). 15017094 Wpk -/- Wpk homozygous rat mutant Unknown Tmem67wpk 14995943 5 26324625 26377531 7 5 30371964 30424943 7 5 25666138 25721056 7 5 25567678 25567678 8 RRID:RGD_15017094 The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). 15036806 WKAH/Tj Wistar-King A, WKA inbred Unknown (as of 2019-11-18) RRID:RGD_15036806 WKAH/Tj inbred rats were bred in the Institute for Animal Experimentation, the University of Tokushima School of Medicine, under specific pathogen free conditions. 15045605 SD-Tg(Prnp-LacZ/EGFP)12084 transgenic Unknown RRID:RGD_15045605 This transgenic strain line 12084 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter. 15045606 SD-Tg(Prnp-LacZ/EGFP)12085 transgenic Unknown RRID:RGD_15045606 This transgenic strain line Tg12085 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter. 15045607 SD-Tg(Prnp-Prnp)2919 transgenic Unknown RRID:RGD_15045607 This transgenic strain line Tg2919 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter. 15045608 SD-Tg(Prnp-Prnp)2922 transgenic Unknown RRID:RGD_15045608 This transgenic strain line Tg2922 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter. 15090817 WI-Ahrem1Hyama+/- mutant Unknown Ahrem1Hyama 15090818 RRID:RGD_15090817 Heterozygous rats carrying a defective exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI. 15090819 WI-Ahrem1Hyama-/- mutant Unknown Ahrem1Hyama 15090818 RRID:RGD_15090819 The homozygous rats carrying 2 defective Ahr genes. The deletion of part of exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI. 18182944 SS-Vwfem2Mcwi-/- MCW Gene Editing Rat Resource Center, through Versiti Blood Research Institute Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals (as of 2020-01-14) Bleeding Disorders Vwfem2Mcwi 18182945 4 161723415 161854766 7 4 225098521 225229257 7 4 158085059 158219525 7 4 158360152 158491539 7 RRID:RGD_18182944 CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 18182946 SS-Vwfem3Mcwi-/- MCW Gene Editing Rat Resource Center, through Versiti Blood Research Institute Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2020-01-14) Bleeding Disorders Vwfem3Mcwi 18182947 4 161723415 161854766 7 4 225098521 225229257 7 4 158085059 158219525 7 4 158360152 158491539 7 RRID:RGD_18182946 CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos 18337282 Iar: LE Long-Evans Rats Institute for Animal Reproduction Institute for Animal Reproduction outbred Unknown Ophthalmology, Behavior RRID:RGD_18337282 This strain was established by Dr. Long and Dr. Evans in 1915. This traces its roots to Monash University to Tohoku University in 1984; to Institute for Animal Reproduction through acquisition in 1996. 19165133 F344;SD-C3em1Linf The animal facility of Lerner Research Institute, Cleveland Clinic mutant Unknown C3em1Linf 19165134 9 8728465 8754412 7 9 9721137 9747084 7 9 2087437 2114366 7 RRID:RGD_19165133 This mutant strain was created by CRISPR/Cas9 genome editing system. The mutant carried insertion of a premature termination codon in exon 2 and was predicted to result in loss of protein expression due to non-sense mediated decay of mRNA. The heterozygous knock out rats (F344/Sprague Dawley mixed background) were bred to each other, and the pups were genotyped to identify the WT and C3 homozygous knock out littermates. 19165362 WKY-Krtcap3em3Mcwi-/- MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Krtcap3em3Mcwi 19165363 6 36304329 36305898 7 6 26486391 26486394 8 6 25120938 25122522 7 RRID:RGD_19165362 CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/Ncrlrat embryos. The resulting mutation is a net 2-bp deletion in the exon 2 of the targeted gene, which led to a frameshift mutation and early termination of the KRTCAP3 protein. 19165364 WKY-Adcy3em2Mcwi MCW Gene Editing Rat Resource Center Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: lsolberg@wakehealth.edu mutant Live Animals (as of 2024-03-21) Adcy3em2Mcwi 19165365 6 27118325 27202275 7 6 38378060 38454926 7 6 28572367 28572369 8 6 27126062 27126064 8 RRID:RGD_19165364 Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 3-bp deletion resulted (rn7: chr6:27,126,062-27,126,064). 19165366 WKY-Adcy3em3Mcwi MCW Gene Editing Rat Resource Center Contact Dr. Solberg-Woods at Wake Forest University School of Medicine, Email: lsolberg@wakehealth.edu mutant Live Animals (as of 2024-03-21) Adcy3em3Mcwi 616390062 RRID:RGD_19165366 Cas9 protein and sgRNA targeting the sequence CCTTTTTGCAGAGCACGAAA within exon 2 of Adcy3 were injected into embryos of the WKY/NCrl strain. A 1-bp deletion resulted (rn7: chr6:27,126,062). 19259464 SHR-Camk2n1em1Tja-/- SHR-Camk2n1em1Tja-/Camk2n1em1Tja- mutant Unknown Camk2n1em1Tja 19259465 5 157235534 157237314 7 5 160625616 160627396 7 5 156876706 156878486 7 5 150674819 150676600 7 RRID:RGD_19259464 SHR-Camk2n1-/- knockout rats were generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1, into one-cell stage SHR/NCrl embryos that were implanted into pseudopregnant rats. Heterozygous progeny, from a founder harboring a 38bp deletion in Camk2n1, were intercrossed to generate homozygous knockout rats. 21079475 SD-Leprem4Lizh Chinese Academy of Medical Sciences & Comparative Medical Center, Peking Union Medical College, China mutant Unknown RRID:RGD_21079475 The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR. 21083604 SD-ROSA26 em1(LTR-nLuc)Ottc Optogenetics and Transgenic Technology Core Optogenetics and Transgenic Technology Core mutant Unknown RRID:RGD_21083604 The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 21409748 DA/Mmab Dark Agouti Military Medical Academy, Serbia inbred Unknown RRID:RGD_21409748 Dark Agouti rats which were bred and housed at the Military Medical Academy in Belgrade, Serbia 21409752 DA/Ibiss Dark Agouti Dark agouti rats were bred and housed at Institute for biological research Sinisa Stankovic, Belgrade, Serbia inbred Unknown RRID:RGD_21409752 25314294 MWF/Ztm Munich Wistar Fromter inbred Unknown RRID:RGD_25314294 Fromter selected from outbred Munich-Wistar rats for large numbers of superficial glomeruli. 25330087 LE-Cntnap2em1Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Autism Rat Model Resource. Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Bipolar disorder (from SFARI GENE) Cntnap2em1Mcwi 25330101 4 75691075 75691075 8 RRID:RGD_25330087 The rat strain was produced by injecting CRISPR/Cas9 targeting rat Cntnap2 into Crl:LE embryos. The result is a 1-bp deletion in exon 6 of the gene. 25330088 LE-Chd8em1Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Autism Rat Model Resource, Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals; Cryopreserved Sperm (as of 2025-02-20) Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia (from SFARI GENE) Chd8em1Mcwi 25330100 15 27642767 27704443 7 15 32423198 32482762 7 15 28646442 28646446 8 15 24905789 24965461 7 RRID:RGD_25330088 The rat strain was produced by injecting the CRISPR/Cas9 system targeting rat Chd8 gene of Crl:LE embryos. The result is a 5-bp deletion in exon 3 of rat Chd8 gene. 25330089 LE-Nrxn1em1Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Autism Rat Model Resource. Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia, Bipolar disorder (from SFARI GENE) RRID:RGD_25330089 The rat strain was produced by injecting CRISPR/Cas9 targeting rat Nrxn1 into Crl:LE embryos. The result is a 4-bp deletion in exon 1. 25330091 SS-Rictorem4Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Rictorem4Mcwi 40818254 2 55982784 56071528 7 2 75754848 75846705 7 2 56013898 56105818 7 2 55811877 55903893 7 RRID:RGD_25330091 CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene. 25330093 SD-Mir146bem1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Mir146bem1Mcwi 152600899 1 251558047 251558134 7 1 273520429 273520516 7 1 266089488 266089575 7 1 245203438 245203525 7 RRID:RGD_25330093 CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b. 25394526 LE-Dyrk1aem3Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Autism Rat Model Resource. Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) RRID:RGD_25394526 The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. 25394528 SD-Ephx2em2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2021-11-03) Ephx2em2Mcwi 25394529 15 45497660 45556101 7 15 48799823 48836848 7 15 42757278 42794189 8 15 40289901 40327632 7 RRID:RGD_25394528 CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. 25394530 LE-Scn2aem1Mcwi MCW Gene Editing Rat Resource Center Autism Rat Model Resource. Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Live Animals (as of 2025-02-20) Scn2aem1Mcwi 25394531 3 47588413 47722800 7 3 58322640 58456658 7 3 51749425 51749430 8 3 50302781 50437504 7 RRID:RGD_25394530 The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). 25394532 LE-Scn2aem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Scn2aem2Mcwi 25394533 3 47588413 47722800 7 3 58322640 58456658 7 3 51749425 51749430 8 3 50302781 50437504 7 RRID:RGD_25394532 The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 6-bp deletion in exon 5 of the gene. 25824850 NHla:SD Hilltop Lab Animals, Inc. (http://www.hilltoplabs.com/public/sd.html) Hilltop Lab Animals, Inc. outbred Unknown RRID:RGD_25824850 The colony history began with a colony of rats established by Robert Dawley around 1925. SD rats are often referred to as "Sprague-Dawley" Mr. Dawley used both his name and the maiden name, "Sprague", of his wife to create the name of the stock. The colony then went to Sprague Dawley, Inc. in 1945. NIH began a closed colony with animals obtained from Sprague Dawley, Inc. Hilltop Lab Animals, Inc. received animals from NIH in 1984. Through cesarean rederivation, the animals were fostered onto gnotobiotic rats in isolation. Descendants of these animals then became the colonies currently available. All colony histories contain some possibility of inaccuracy. This information is provided to the best of Hilltop's knowledge. 27095885 SS.BN-(D13Hmgc41-D13Rat101)-Renem2Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Renem2Mcwi 27095886 RRID:RGD_27095885 This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Rat101)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5. 30309956 SS.BN-(D13Hmgc41-D13Rat101)/Mcwi Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45282442 49428577 1 - by flanking markers 13 54236862 58314767 1 - by flanking markers 13 49168131 53264877 1 - by flanking markers 13 43830075 47841255 1 - by flanking markers RRID:RGD_30309956 These were generated by crossing SS/JrHsdMcwi with SS-Chr 13BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. 32716420 BDIX.BDIV-D6Rat132-D6Rat229/Zte Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown 6 52753065 99750142 1 - by flanking markers 6 63175341 63175567 1 - by flanking markers 6 53553892 53554118 1 - by flanking markers 6 50818445 50818672 1 - by flanking markers RRID:RGD_32716420 The BDIX.BDIV-D6Rat132-D6Rat229/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 35668858 LEW-Tg(HLA-B*2705m1,B2M)133-1TrgTg/0 transgenic Unknown RRID:RGD_35668858 This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. The strain carries 12 copies of HLA-B*2705 and 4 copies of the human beta-2-microglobulin gene. 35668859 W-Gnrh1tm1(cre)Aeh (1.) Allan Herbison at Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK.; (2.) Vincent Prevot in INSERM, Lille, France. (1.) Allan Herbison at Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK.; (2.) Vincent Prevot in INSERM, Lille, France. mutant Live Animals (as of 2020-07-09) Neuroendocrinology, Neurobiology, Development RRID:RGD_35668859 This model was generated using zinc finger nuclease (ZFN) method. Cre recombinase was expressed under the control of the endogenous Gnrh1 gene by inserting an internal ribosomal entry site (IRES)-Cre cassette 30bp downstream from the translational stop site of the Gnrh1 open reading frame. This was achieved by pronuclear co-injection of zinc finger nucleases (ATCCACAACATCCGAGTGtgacattGACGCTGAGATCCATGAC; cleavage site in lower case) along with a donor plasmid containing two 800bp homologous arms (HA) flanking IRES-Cre into a one-cell stage rat embryo. 35668861 LEW-Tg(HLA-B*2705,B2M)Tg/021-3Reh transgenic Unknown RRID:RGD_35668861 This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene. 35668863 LEW-Tg(HLA-B*2705,B2M)21-3RehTg/Tg transgenic Unknown RRID:RGD_35668863 This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 40 copies of HLA-B*2705 and 30 copies of human beta-2-microglobulin gene. Founder 21-3 was selected and carrier animals from this founder were mated and bred to homozygosity. 36174030 SD-Hamp em1Jfcol +/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-28) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em1Jfcol 38455987 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RGD_36174030 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol +/- (RGD: 36174030) is heterozygous carrying a 169-bp deletion between exons 2 & 3 of rat Hamp gene. 36174220 SD-Hamp em1Jfcol -/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em1Jfcol 38455987 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RRRC_00907 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol -/- (RGD:36174220) is homozygous carrying the 169-bp deletion between exons 2 & 3 of both rat Hamp alleles. 36174221 SD-Hamp em2Jfcol +/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em2Jfcol 38455989 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RGD_36174221 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol +/- (RGD:36174221) is heterozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene. 36174222 SD-Hamp em2Jfcol -/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em2Jfcol 38455989 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RRRC_00909 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol -/- (RGD:36174222) is homozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of both rat Hamp alleles. 36174223 SD-Hamp em3Jfcol +/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em3Jfcol 38455990 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RGD_36174223 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol +/- (RGD:36174223) is heterozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene. 36174224 SD-Hamp em3Jfcol -/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em3Jfcol 38455990 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RRRC_00911 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol -/- (RGD:36174224) is homozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of both rat Hamp alleles. 36174225 SD-Hamp em4Jfcol +/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em4Jfcol 38455991 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RGD_36174225 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol +/- (RGD:36174225) is heterozygous carrying a 15-bp deletion in exon 2 of the rat Hamp gene 36174226 SD-Hamp em4Jfcol -/- Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp em4Jfcol 38455991 1 85978120 85980059 7 1 90523506 90525473 7 1 89368021 89369960 7 1 86170926 86172865 7 RRID:RRRC_00913 Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol -/- (RGD:36174226) is homozygous carrying a 15-bp deletion in exon 2 of both rat Hamp alleles 38456008 LOU/C Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France inbred Unknown RRID:RGD_38456008 Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of immunocytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). 38500209 NISAG Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_38500209 NISAG were stress-sensitive hypertensive rats that exhibited normal systolic pressure during the first weeks after birth. The development of hypertension in these rats is accompanied by increased sensitivity of the hypothalamic-pituitary-adrenocortical and sympathoadrenal systems to stress. 38501059 SD-Cpem1Ang+/+ mutant Unknown RRID:RGD_38501059 The wild type rats were littermates of cross of heterozygotes Cp mutant rats. The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. 38501060 SD-Cpem1Ang+/- mutant Unknown Cpem1Ang 38501062 2 105086278 105135367 7 2 124467383 124524140 7 2 104744249 104803034 7 2 102439433 102498075 7 RRID:RGD_38501060 The heterozygous Cp mutant rats were created by CRISPR/Cas9. They contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. 38501061 SD-Cpem1Ang-/- mutant Unknown Cpem1Ang 38501062 2 105086278 105135367 7 2 124467383 124524140 7 2 104744249 104803034 7 2 102439433 102498075 7 RRID:RGD_38501061 The homozygous Cp mutant rats are littermates of cross of heterozygotes Cp mutant rats . The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop codon in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. 38501086 SD-Bmpr2em1Ang+/- mutant Unknown Bmpr2em1Ang 38501087 9 58327587 58436057 7 9 66371542 66486121 7 9 66568074 66683019 7 9 61192718 61307280 7 RRID:RGD_38501086 BMPR2-deficient rats were generated by using zinc-finger nucleases (Sigma, St. Louis, MO). The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates. 38508891 F344-Tg(Cx3cr1-cre/ERT2)3Ottc transgenic Unknown RRID:RGD_38508891 The transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. 38508893 F344.LE-ROSA26 em1(LTR-nLuc)Ottc mutant Unknown RRID:RGD_38508893 The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. 38543943 SD-Rag2em1Hera mutant Unknown RRID:RGD_38543943 The Rag2 gene in rat spermatogonia stem cells (SSC, SD-WT2) was targeted by TALENs and resulted in a 27-bp in-frame deletion. The genome modified SSC was transplanted to Busulfan-treated, Dazl-deficient male Sprague Dawley rats and mated with wild type female Sprague Dawley rats 70 to 81 later. The allele was then bred to homozygosity to generate the Sprague-Dawley Rag2 (SDR)-knockout rat. 38548914 SD-Rag1/Rag2em1Mlit The animal facility at Tongji University (Shanghai, China). mutant Unknown RRID:RGD_38548914 The Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2. 38548915 SD-Il2rgem1-/y/Mlit The animal facility at Tongji University (Shanghai, China). mutant Unknown RRID:RGD_38548915 The Il2rg knock-out rats were obtained by injecting Il2rg-targeting sgRNA into 1-cell embryos. The resulted mutation is 1-bp insertion (A) at 71169012 position. No protein was detected in the spleen of this Il2rg knock out. 38548916 SD-Rag1/Rag2em1MlitIl2rgem1Mlit-/y The animal facility at Tongji University (Shanghai, China). mutant Unknown RRID:RGD_38548916 The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915). 38548927 HsdCpb:WU Wistar Wu Rat ENVIGO outbred Unknown RRID:RGD_38548927 The Wistar rat is selected at the Wistar Institute, Philadelphia, USA, prior to 1910. In 1932, from Wistar Institute to Glaxo Laboratory, UK. In 1933, from Glaxo to the Dutch Institution for Nutrition, Amsterdam. In 1941, the Unilever Company, Vlaardingen, the Netherlands, obtained a breeding stock from Dutch Institution for Nutrition. Thereafter, the Unilever stock was referred as the Wistar Unilever or WU rat. In 1958, transferred from Unilever to TNO Central Institute for the Breeding of Laboratory Animals. To Harlan Laboratories through acquisition in 1986. Harlan became Envigo in 2015. 38549341 RP/AEurRijHsd inbred Unknown RRID:RGD_38549341 Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). To Harlan (?). 38549343 WKY/NIcoCrlf Charles River, France inbred Unknown RRID:RGD_38549343 A substrain of WKY from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. 38549351 HXB10/IpcvMcwi Medical College of Wisconsin, Milwaukee, Wisconsin recombinant_inbred Unknown RRID:RGD_38549351 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, and maintain by Medical College of Wisconsin. 38549352 SHR/OlaIpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) RRID:RGD_38549352 These are re-derived rats of SHR substrain (SHR/OlaIpcv, RGD:9586450) from Czech Academy of Sciences now maintained at Medical College of Wisconsin. 38549353 SD-Defb23em1Mlit School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb23em1Mlit 38599011 3 142780126 142784338 7 3 154275191 154279834 7 3 147928201 147932413 7 3 140923474 140927715 7 RRID:RGD_38549353 CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. 38549354 SD-Defb26em1Mlit School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb26em1Mlit 38599012 3 142834066 142837469 7 3 154391632 154395035 7 3 147982213 147985616 7 3 140977214 140980949 7 RRID:RGD_38549354 CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. 38549355 SD-Defb42em1Mlit School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb42em1Mlit 38599013 15 42247668 42254485 7 15 49925455 49932279 7 15 46159511 46166335 7 15 37234662 37241621 7 RRID:RGD_38549355 CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. 38549356 SD-Defb23em2MlitDefb26em2Mlit School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb23em2MlitDefb26em2Mlit 38599014 RRID:RGD_38549356 CRISPR/Cas9 system was used to generate this double-gene knockout. The Slc:SD zygotes were injected with sgRNAs that containing 4 sgRNAs (5 ng/ml each) targeting 2 adjacent sites (target sites 1 and 2) of each of the 2 genes. The resulting mutations are 317 bp (Defb23) and 380 bp (Defb26) fragments which were deleted in the Defb23/Defb26 double-mutant strain. 38549357 SD-Defb23em2MlitDefb26em2MlitDefb42em1Mlit School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb42em1Mlit|Defb23em2MlitDefb26em2Mlit 38599013|38599014 15 42247668 42254485 7 15 49925455 49932279 7 15 46159511 46166335 7 15 37234662 37241621 7 RRID:RGD_38549357 CRISPR/Cas9 system was used to generate the Defb23, Defb26 double-gene knockout (RGD:38549356) and Defb42 (RGD:38549355). The triple-KO rats were generated by crossing the heterozygous Defb23/26 mutation rats with the heterozygous Defb42 mutation rats. 38549372 SD-Eif2ak4em1 mutant Unknown Eif2ak4em1 38599016 3 104870871 104875529 7 3 116705333 116791037 7 3 110159624 110245382 7 3 105356261 105441630 7 RRID:RGD_38549372 The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. 38596327 WI-Tbc1d4em1Gdcz Unit for Laboratory Animal Medicine, University of Michigan. mutant Unknown Tbc1d4em1 38596330 15 85359159 85561229 7 15 89695614 89871879 7 15 85927978 86105829 7 15 78256030 78434168 7 RRID:RGD_38596327 The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) . 38596339 SD-Rarres2em1Msu Department of Pharmacology and Toxicology, Michigan State University, East Lansing, Michigan, USA. mutant Unknown Rarres2em1Msu 38596341 4 76659507 76662465 7 4 142869493 142872619 7 4 78205809 78208956 7 4 77522549 77525733 7 RRID:RGD_38596339 Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2. 38599146 BN-Aireem1Ang-/- Centre de Recherche en Transplantation et Immunologie UMR 1064, ITUN, 30 Boulevard Jean Monnet, 44093 Nantes Cedex 01, France mutant Unknown Aireem1Ang 38599148 20 10980031 10996102 7 20 13535776 13550486 7 20 11365630 11380636 7 20 10636058 10651060 7 RRID:RGD_38599146 The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. 38599147 SD.BN-Aireem1Ang-/- Centre de Recherche en Transplantation et Immunologie UMR 1064, ITUN, 30 Boulevard Jean Monnet, 44093 Nantes Cedex 01, France mutant Unknown Aireem1Ang 38599148 20 10980031 10996102 7 20 13535776 13550486 7 20 11365630 11380636 7 20 10636058 10651060 7 RRID:RGD_38599147 The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. 38599152 WI-Lpin1m1Hubr From the Hubrecht Institute-KNAW and University Medical Center Utrecht, 3584 CT Utrecht, The Netherlands, mutant Unknown Lpin1m1Hubr 38599153 6 40253664 40297195 7 6 51532422 51638090 7 6 41796214 41905149 7 6 39309198 39417034 7 RRID:RGD_38599152 The mutant rats were created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5'-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity. 38599155 BN-Themism1Adej UMR Inserm, U1043, Toulouse, France, UMR CNRS, U5282, Toulouse, France, Universit de Toulouse, UPS, Centre de Physiopathologie de Toulouse Purpan (CPTP), Toulouse, France mutant Unknown Themism1Adej 38599156 1 17032677 17226924 7 1 18308043 18532366 7 1 17152973 17378225 7 1 16433906 16623889 7 RRID:RGD_38599155 This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption. 38599157 F344-Depdc5em1Kyo+/- National Bio Resource Project Rat in Japan mutant Unknown Depdc5em1Kyo 38599194 14 83484354 83614818 7 14 83775510 83906381 7 14 83089000 83219576 7 14 77732297 77862924 7 RRID:RGD_38599157 TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 38599158 F344-Depdc5em2Kyo+/- National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Depdc5em2Kyo 38599195 14 83484354 83614818 7 14 83775510 83906381 7 14 83089000 83219576 7 14 77732297 77862924 7 RRID:RGD_38599158 TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. 38599187 SHRSP.SHR-(D1Mgh5-D1Got87)(D18Rat73-D18Rat11)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-14) Hypertension and cerebral apoplexy 18;1 52290789;78134304 71692408;85828306 1 - by flanking markers;1 - by flanking markers 18;1 50804228;80946174 69942605;92291485 1 - by flanking markers;1 - by flanking markers 1;18 79689548;51609032 91156803;70803264 1 - by flanking markers;1 - by flanking markers 1;18 78430536;49999958 86030749;68414117 1 - by flanking markers;1 - by flanking markers RRID:RGD_38599187 A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University. 38599188 SHRSP.SHR-(D1Rat23-D1Rat213)(D18Rat73-D18Rat11)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-14) Hypertension and cerebral apoplexy 18;1 52290789;78685103 71692408;81548909 1 - by flanking markers;1 - by flanking markers 18;1 50804228;81497710 69942605;84537228 1 - by flanking markers;1 - by flanking markers 1;18 80231217;51609032 83282814;70803264 1 - by flanking markers;1 - by flanking markers 1;18 78970983;49999958 81777720;68414117 1 - by flanking markers;1 - by flanking markers RRID:RGD_38599188 A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University. 38599189 F344-Rag2em1Iexas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2020-09-14) immunology/Inflamation and Immunodeficient Rag2em1Iexas 38599191 3 86764810 86773438 7 3 97851318 97859615 7 3 91191837 91200134 7 3 87902373 87910227 7 RRID:RGD_38599189 This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. 38599190 F344-Il2rgem1IexasRag2em1Iexas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2020-09-14) severe combined immunodeficiency Il2rgem1Iexas|Rag2em1Iexas 13464264|38599191 X;3 89342055;86764810 89345715;86773438 7;7 X;3 72017856;97851318 72021516;97859615 7;7 3;X 91191837;71165378 91200134;71169078 7;7 3;X 87902373;66395330 87910227;66399026 7;7 RRID:RGD_38599190 This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late. 38599197 W.F344-Lepm1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2020-09-14) Obesity Lepm1Kyo 12792963 4 55943837 55945938 7 4 56085079 56099209 7 4 56348850 56348850 8 4 57672294 57672294 8 RRID:RGD_38599197 This cocngenic strain was made by backcrossing F344-Lepm1Kyo(RGD: 8549776, F344/NSlc rats having an induced mutation in the Lep gene by ENU mutagenesis) to W/Kyo (RGD:1302672). 38599201 SHRSP.SHR-(D18Rat73-D18Rat8)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-15) Hypertension and cerebral apoplexy 18 52290789 72450442 1 - by flanking markers 18 50804228 70825941 1 - by flanking markers 18 51609032 71692768 1 - by flanking markers 18 49999958 69140759 1 - by flanking markers RRID:RGD_38599201 A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. 38599202 SHRSP.SHR-(D1Rat23-D1Rat213)(D18Rat73-D18Rat52)/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-15) Hypertension and cerebral apoplexy 18;1 52290789;78685103 61290878;81548909 1 - by flanking markers;1 - by flanking markers 18;1 50804228;81497710 59735418;84537228 1 - by flanking markers;1 - by flanking markers 1;18 80231217;51609032 83282814;60532087 1 - by flanking markers;1 - by flanking markers 1;18 78970983;49999958 81777720;58536311 1 - by flanking markers;1 - by flanking markers RRID:RGD_38599202 A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. 38599203 LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A/YFP*)2Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-15) RRID:RGD_38599203 The transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 3, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number. 38599204 LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A/YFP*)1Jfhy National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-15) RRID:RGD_38599204 The transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 1, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number. 38599206 SHR-Prdx2em2Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-15) RRID:RGD_38599206 This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 6-bp deletion (5'-CTCCGG-3', c.6_12del6) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT). 38599208 SHR-Prdx2em1Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-15) RRID:RGD_38599208 This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion (5'-CTCCGGC-3', c.6_13del7) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT). 38599241 SD;DA-Tg(Thy1-APP*)1Dspb National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia RRID:RGD_38599241 Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are different among Lines (12>1>14>6). 38599242 SD;DA-Tg(Thy1-APP*)6Dspb National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia RRID:RGD_38599242 Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6). 38599243 SD;DA-Tg(Thy1-APP*)12Dspb National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia RRID:RGD_38599243 Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6). 38599244 SD;DA-Tg(Thy1-APP*)14Dspb National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia RRID:RGD_38599244 Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6). 38599245 LE-Tg(Tac1-cre)6-7Koba National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) RRID:RGD_38599245 Background strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs. This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)6-7Koba are lower than in LE-Tg(Tac1-cre)4-1Koba (RGD:38599247) 38599247 LE-Tg(Tac1-cre)4-1Koba National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) RRID:RGD_38599247 Background strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs.This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)4-1Koba are higher than in LE-Tg(Tac1-cre)6-7Koba (RGD:38599245). 38676250 F344-Hcn1em3Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) RRID:RGD_38676250 TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 13-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. 38676251 F344-Hcn1em2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) RRID:RGD_38676251 TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 24-bp deletion in the exon4 of Hcn1 gene. It is predicted that 8 amino-acid deleted HCN1 protein is expressed. 38676253 F344-Hcn1em1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) Hcn1em1Kyo 150429632 2 49525949 49939066 7 2 68473431 68874494 7 2 50099576 50499799 7 2 49495771 49899983 7 RRID:RGD_38676253 TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. 38676254 F344-Ppargm1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) Ppargm1Kyo 127285617 4 151492220 151617331 7 4 210562928 210688585 7 4 147274055 147399383 7 4 148423102 148548471 7 RRID:RGD_38676254 By using ENU mutagenesis followed by MuT-POWER screening of the KURMA (Kyoto University Rat Mutant Archive) samples, the depositors generated a heterozygous PPARg mutant (Ppargmkyo/+) rat with a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg. The PpargG488T homozygous rats are embryonic lethal. Heterozygous Ppargmkyo/+ rats showed reduced fat mass with adipocyte hypertrophy and insulin resistance, which were highly predictable from known actions of Pparg agonists and phenotypes of patients with the PPARG mutation. 38676255 F344-Hcn1em4Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) RRID:RGD_38676255 TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed. 38676310 RjHan:SD Janvier Labs, France outbred Live Animals (as of 2020-09-17) RRID:RGD_38676310 The outbred strain [Sprague-Dawley] was created by R. W. Dawley in 1925, from a hooded male hybrid of unknown origin and an albino female (probably Wistar), and was crossed with the female's progeny for 7 generations. Janvier Labs received from Zentralinstitut fur Versuchstierzucht (Hannover) in1982. 38676445 W-Tg(Slc32a1-cre)1_4Fusa National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-17) RRID:RGD_38676445 This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system. 38676446 W-Tg(Slc32a1-cre)2_5Fusa National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-17) RRID:RGD_38676446 This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system. 38676447 W-Tg(Slc32a1-cre)5_9Fusa National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-17) RRID:RGD_38676447 This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system. 38676448 W-Trpa1em1Kcrd National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2020-09-17) Trpa1em1Kcrd 38676449 5 3531163 3584401 7 5 3764339 3818781 7 5 3783247 3836485 7 5 4379862 4434133 7 RRID:RGD_38676448 This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. 38676450 F344-Phf24em2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2021-07-01) RRID:RGD_38676450 In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation. 38676451 W-Phf24em11Iexas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-17) RRID:RGD_38676451 This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. 38676452 W-Phf24em24Iexas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-17) RRID:RGD_38676452 This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. 38676453 F344; W-Phf24em6(EGFP)Iexas National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-17) RRID:RGD_38676453 This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc. 38676459 HHR/Hat Hirosaki hairless rat Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine mutant Unknown RRID:RGD_38676459 Hirosaki hairless rat (HHR) is a mutant strain spontaneously derived from Sprague-Dawley rats, and its inheritance is autosomal recessive. . These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster. HHR attain sexualmaturity at approximately 10 weeks of age and give birth to young but are not able to nurse them. 38676461 HiSER/Hat Hirosaki small-eye rat Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine mutant Unknown RRID:RGD_38676461 HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. 38676463 HHSE/Hat National BioResource Project for the Rat in Japan ;Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine National BioResource Project for the Rat in Japan ;Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-09-18) Cryba1Hiser 38676462 10 63758929 63765451 7 10 66458061 66480390 7 10 65160777 65167504 7 10 62608373 62614726 7 RRID:RGD_38676463 HHSE/Hat was derived from Hirosaki hairless rat (HHR) and Hirosaki small-eye rat (HiSER), which are Sprague-Dawley rat (SDR)mutant lines. HHR was established in 1984 as a spontaneous mutant of SDR that has been inbred in Department of Biochemistry and Genome Biology Hirosaki University Graduate School of Medicine. Whole body shows hypotrichosis, abnormal differentiation of thymus, and regressed mammary gland in females. These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster and the lectin-like receptor gene Ly49s3. HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat maintained in our course in the same way as HHR/Hat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. 38676464 WIC-Cspg4em1Kyst National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-18) RRID:RGD_38676464 By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. 38676495 BN-Lx/CubMcwi Brown Norway with polydactyly-luxate RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu mutant Live Animals; Cryopreserved Embryo (as of 2024-08-06) The Hybrid Rat Diversity Panel RRID:RGD_38676495 These are re-derived rats of BN-Lx/Cub now maintained at Medical College of Wisconsin. The parent strain was derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. 39128162 WIC-Cspg4em2Kyst National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) RRID:RGD_39128162 By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. 39128163 WIC-Cspg4em3Kyst National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) RRID:RGD_39128163 By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 2 bp insertion on Exon1. 39128166 WIC-Sparcem1Kykn National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) RRID:RGD_39128166 By CRISPR/Cas9 system, mutation was introduced in Sparc gene of Wistar-Imamichi rat. 7 bp deletion around Exon7. 39128167 W-Tg(Grp-YFP*)14Hskmt National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm (as of 2020-09-23) RRID:RGD_39128167 This strain was generated by microinjecting YFP* (Venus): yellow fluorescent protein variant, which is inserted at downstream of Grp-promoter (4 kb) to Wistar rat zygotes. The number of inserted gene is approximately 100 copy. 39128170 SHRSP-Stim1em1Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) RRID:RGD_39128170 "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence. The sequence of the guide RNA target site is as follows, Stim1: 5'-GCAGGGTAGCTGAAACACAC-3' The sequence of the ssODN for homologous recombination is as follows, 5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" 39128171 LE-Tg(Pvalb-cre)2-28Koba National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2020-09-23) RRID:RGD_39128171 This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs. 39128172 W-Tg(Slc32a1-cre)3_5Fusa National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-23) RRID:RGD_39128172 This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT(Slc32a1: mouse, Kanamycin resistance gene(E. coli), Cre(P1 phage), polyA signal(SV40 virus). Mouse BAC clone: RP23-392-P11 39128239 GK/CskCrlj Charles River Laboratories Japan inbred Unknown RRID:RGD_39128239 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. 39128242 SD-Vwfem1Mcwi-/- MCW Gene Editing Rat Resource Center, through Versiti Blood Research Institute Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2020-10-09) Vwfem1Mcwi 39457948 4 161723415 161854766 7 4 225098521 225229257 7 4 158085059 158219525 7 4 158360152 158491539 7 RRID:RGD_39128242 CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon. 39131285 SD-Tg(DIO-mCherry)2Ottc Optogenetics and Transgenic Technology Core Optogenetics and Transgenic Technology Core transgenic Unknown RRID:RGD_39131285 This Cre recombinase reporter rat expressing mCherry was generated by backcrossing Sprague-Dawley to LE-Tg(DIO-mCherry)2Ottc (RGD:8693598). The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter. 39456105 F344/StmMcwi RGD HRDP, contact Hybrid Rat Diversity program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_39456105 F344/StmMcwi was redelivered from F344/Stm which was derived from F344/DuCrlj. 39456107 LE/StmMcwi RGD HRDP, contact Hybrid Rat Diversity program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_39456107 The LE/StmMcwi was rederived from LE/Stm and maintained at Medical College of Wisconsin. The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50. 39456108 SD-Trpv4em1Sage mutant Unknown Trpv4em1Sage 39456109 12 43226933 43265889 7 12 49492064 49529956 7 12 47698915 47737902 7 12 41938533 41977517 7 RRID:RGD_39456108 TRPV4 gene?specific zinc finger constructs directed against exon 13, containing the coding sequence for part of TM5, the pore region, and TM6, were injected in zygotes from Sprague-Dawley rats. An animal with an 899 bp deletion in the TRPV4 gene was selected as a founder for further breeding. This deletion completely removes exon 13, plus parts of intron 12-13 and intron 13-14 . 39457682 LCR-mtHCR/Tol University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614 conplastic Unknown RRID:RGD_39457682 Mitochodrial genome of LCR/ was selectively replaced by HCR to create this conplastic strain; these have the mitochondrial genome of HCRl on LCR nuclear genetic background 39457683 HCR-mtLCR/Tol University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614 conplastic Unknown RRID:RGD_39457683 Mitochodrial genome of HCR/ was selectively replaced by LCR to create this conplastic strain; these have the mitochondrial genome of LCRl on HCR nuclear genetic background 39457699 LCR/Tol Low-capacity runners University of Toledo College of Medicine and Life Sciences, Toledo, Ohio. inbred Unknown RRID:RGD_39457699 Artificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. 39457701 HCR/Tol High-capacity runners University of Toledo College of Medicine and Life Sciences, Toledo, Ohio. inbred Unknown RRID:RGD_39457701 Artificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for high capacity based on distance run to exhaustion on a motorized treadmill. 39457945 WI- Lpar1m1Hubr Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Lpar1m1Hubr 126848739 5 76449470 76571458 7 5 79707131 79825313 7 5 75557038 75678067 7 5 73229047 73347874 7 RRID:RGD_39457945 The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. The founder animal was mated with wild type Msh6 females. The Msh6 mutated allele was eliminated by systematic selection of F2. 39457947 SD-Bckdkm1Dbsa Spring Valley Laboratories, Inc (Woodbine,MD) mutant Unknown RRID:RGD_39457947 The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk. 39457950 SD-Ngly1em1Ta-/- National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-22) Ngly1em1Ta 149735565 15 10704196 10750564 7 15 14450836 14501356 7 15 10405453 10455973 7 15 9153738 9210228 7 RRID:RGD_39457950 The homozygous Ngly1 mutant rats are littermates of cross of heterozygotesNgly1 mutant rats . The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. By the time of deposition, this strain was crossed twice to Crl:CD (SD). "Homozygous rats are obtained by crossing between heterozygous rats. Maintain the strain by crossing between heterozygous rats or by backcrossing to Crl:CD (SD) rats. Homozygous rats, both females and males, have no record of pregnancy and reproduction. They are more likely to be infertile." 40818253 LE-Dyrk1aem1Mcwi Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown RRID:RGD_40818253 The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 14-bp deletion in exon 3 40818401 M520/NRrrcMcwi RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) RRID:RGD_40818401 To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. It was then sent to Rat Resource and Research Center (RRRC). Medical College of Wisconsin received live animals from cryo-resuscitated pairs at RRRC in 2009. 40924649 Beta IIM School of Medicine at Rosario, Argentina inbred Unknown RRID:RGD_40924649 Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' were separated in 1958 and raised at the School of Medicine at Rosario. In 1976, some degree of overweight was found in the original 'b' group and in 1980, the obesity group was identified as Beta line. 40924650 Alpha IIM School of Medicine at Rosario, Argentina inbred Unknown RRID:RGD_40924650 Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' and 'alpha' were separated in 1958 and 1972 respectively and raised at the School of Medicine at Rosario. This line alpha (Alpha IIM) ), obtained from the F1 'a' X 'd', was used as control for the obese Beta line (RGD:40924649). 40924656 BN.ZUC-Leprfa mutant Unknown (as of 2021-01-19) Leprfa 13432153 5 122320075 122503449 7 5 124380327 124556585 7 5 120597857 120597857 8 5 116389200 116389200 8 RRID:RGD_40924656 Established as congenics by introducing fa from 13M/Vc to BN/Crl 40924661 LA-cp/NRll mutant Unknown Leprcp 11570565 5 122320075 122503449 7 5 124380327 124556585 7 5 120503475 120682281 7 5 116294409 116477904 7 RRID:RGD_40924661 This corpulent rat used by Rudolph L Leibel's laboratory was developed at the National Institutes of Health (NIH). It was a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. This congenic carrying the recessive Leprcp (RGD:11570565) identified in in the obese spontaneously hypertensive Koletsky rat. 41404646 SD-Lrp5em1Vari mutant Unknown Lrp5em1Vari 41404647 1 206102750 206206350 7 1 225689353 225793075 7 1 218816833 218920147 7 1 200814247 200917581 7 RRID:RGD_41404646 CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 41404648 SD-Lrp5em2Vari mutant Unknown Lrp5em2Vari 41404650 1 206102750 206206350 7 1 225689353 225793075 7 1 218816833 218920147 7 1 200814247 200917581 7 RRID:RGD_41404648 CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 41404651 SD-Lrp5em3Vari mutant Unknown Lrp5em3Vari 41404652 1 206102750 206206350 7 1 225689353 225793075 7 1 218816833 218920147 7 1 200814247 200917581 7 RRID:RGD_41404651 CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. 41404660 GK/Jpe Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal inbred Unknown RRID:RGD_41404660 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s, 41404661 W/Jpe Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal inbred Unknown RRID:RGD_41404661 Inbred Wistar rats maintained at Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal 41404705 SD-Shank3em1Bux SAGE Labs (Boyertown, PA). Mount Sinai Medical Center, New York NY 10029 USA mutant Unknown Shank3em1Bux 41404706 7 127817026 127877875 7 7 130159246 130220171 7 7 130474278 130534679 7 7 120568707 120630796 7 RRID:RGD_41404705 The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon. 41404723 DA.W-Ncf1W/Rhd Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown Ncf1W 41404724 RRID:RGD_41404723 The Wistar Ncf1 (Ncf1W) allele was backcrossed to the DA background for 10 generations 41408337 DA.F344-Dpp4DPPIV/SvH Hannover Medical School, Hannover, Germany mutant Unknown Dpp4DPPIV 12792942 3 44279255 44360283 7 3 54957146 55038628 7 3 48291055 48372672 7 3 46962233 47043870 7 RRID:RGD_41408337 Generation of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient congenic DA strain is maintained via brother=sister mating 41408339 WI.SD-PcloTn(sb-B-Geo)Fkh University of Texas Southwestern Medical Center, Dallas TX mutant Unknown PcloTn(sb-B-Geo)Fkh 41408340 4 15911051 16269090 7 4 16428814 17031648 7 4 16454904 17058921 7 4 19691439 20050015 7 RRID:RGD_41408339 The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame. 41410881 WI-Grm2em1 Transposagen Biopharmaceutical mutant Unknown Grm2em1 41410882 8 111837086 111850133 7 8 114705123 114718193 7 8 115344999 115358628 7 8 107280099 107293159 7 RRID:RGD_41410881 This mutant rat strain was produced by Transposagen Biopharmaceutical and available in mGluR2+/- breeding pairs. The genome modification created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional. 41412170 BBDR/RhwMcwi Medical College of Wisconsin, Milwaukee WI inbred Unknown RRID:RGD_41412170 This strain was given to Medical College of Wisconsin by Ake Lernmark and maintained there. 41412172 BBDR.BBDP-(D4Mit6-D4Mit24)/RhwMcwi Medical College of Wisconsin, Milwaukee, WI, USA congenic Unknown 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 4 76647384 78882945 1 - by flanking markers RRID:RGD_41412172 The lymphopenia locus from diabetic proned BBDP rat was transferred onto the genome of diabetic-resistant BB rat by marker-assisted selection in nine cycles of cross-intercross breeding. This congenic strain from Ake Lernmark, Laboratory, University of Washington, Seattle, Washington to Medical College of Wisconsin. 41412186 BBDP/Wor inbred Unknown RRID:RGD_41412186 Diabetic prone BB rats. The Biobreeding rats (BB) spontaneously developed autoimmune diabetes mellitus were found in a closed colony of outbred WI (Wistar) rats at the Bio-Breeding Laboratories, Ottawa, Ontario in 1974. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and and 2 strains were produced: disease prone (DP) and disease resistant (DR) by selected progenies were diabetic (DP) or remained diabtes free (DR). 41457452 WI-Prdm14em10Nips Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24) Prdm14em10Nips 41457453 5 10550222 10570255 7 5 5710076 5730560 7 5 6082163 6092712 7 RRID:RGD_41457452 Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. 42721973 LEW/SsNArc inbred Unknown RRID:RGD_42721973 This strain is now maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The LEW rats were received from National Institutes of Health, Bethesda MD, USA. 42721974 LEW-Nek8lpk/Arc mutant Unknown Nek8lpkArc 42721975 10 64458886 64470044 7 10 66196993 66230588 7 10 65404489 65439059 7 10 63060868 63073546 7 RRID:RGD_42721974 The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene. 42721977 SD-Pde6bem1Baek Asan Institute for Life Sciences, University of Ulsan College of Medicine, Asan Medical Center, Seoul, Republic of Korea mutant Unknown Pde6bem1Baek 42721979 14 1871037 1914170 7 14 2327104 2370811 7 14 2328690 2371913 7 14 1323310 1366450 7 RRID:RGD_42721977 Cpf1 mRNA (50 ng per uL) and CRISPR RNA (100 ng per uL) were co-microinjected into the cytoplasm of pronuclear stage embryos; surviving embryos were transplanted into the oviducts of pseudo-pregnant surrogate mothers to generate live animals. A Pde6b-mutant rat line with an 11-bp deletion in exon 1 was established. Western blot analysis confirmed deficiency of Pde6b protein in the homozygous mutant retina, indicating successful generation of Pde6b-deficient rats with Cpf1-mediated gene targeting. 42722004 F344-Tg(HIV)1Hsd transgenic Unknown RRID:RGD_42722004 Noninfectious clone containing gag-pol-deleted HIV-1 provirus under the viral LTR promoter was microinjected into fertilized one-cell Sprague�Dawley � Fisher 344/NHsd F1. Female founder with opaque cataracts was mating with wil-type Fischer 344/NHsd. Tg rats from line 1 contained 20�25 copies. 45073130 SD-Fmr1em1Mzhe The laboratory animal center of Peking University. mutant Unknown Fmr1em1Mzhe 124715480 X 154756031 154793782 7 X 154684924 154722369 7 X 147240239 147278057 7 RRID:RGD_45073130 The CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of the rat Fmr1 gene of outbred Sprague- Dawley embryos. The resulting mutation is a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification results in a frame-shift starting from the second Agenet-like 2 domain in the Fmr1 protein. 45073133 SD-Pon1em1Lizh Institute of Laboratory Animal Science of Peking Union Medical College mutant Unknown Pon1em1Lizh 124715481 4 29936314 29964821 7 4 30156712 30183204 7 4 30249749 30276297 7 4 33294737 33325759 7 RRID:RGD_45073133 CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague- Dawley embryos. The destruction of Pon1 gene caused the absence of the the expression of Pon1 mRNA, protein in liver, spleen and thymus in the Pon1 homozygous knock-out rat. 53621137 SD-Tg(Wnt1-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Live Animals (as of 2024-01-10) RRID:RRRC_00868 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT2 56677892 SD-Tg(GFAP-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Live Animals (as of 2024-01-05) RRID:RRRC_00876 The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent. 58366897 SD-Tg(Tie2-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Live Animals (as of 2024-01-10) RRID:RRRC_00877 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2 124713544 W-Cyp27b1em1Thka mutant Unknown Cyp27b1em1Thka 124713545 7 70512763 70517707 7 7 70333150 70340006 7 7 62869340 62876242 7 RRID:RGD_124713544 This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes. 124713546 W-Vdrem1Thka mutant Unknown Vdrem1Thka 124713547 7 136567614 136617280 7 7 139536241 139585928 7 7 139344452 139394138 7 7 128987981 129037677 7 RRID:RGD_124713546 This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr (R270L) rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2 diet partially reversed their rickets symptoms. Homozygotes Vdr(R270L mutants were maintained bymating of heterozygotes. 124713548 W-Vdrem2Thka mutant Unknown Vdrem2Thka 124713550 7 136567614 136617280 7 7 139536241 139585928 7 7 139344452 139394138 7 7 128987981 129037677 7 RRID:RGD_124713548 This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes. 125093746 SD-Disc1em1Rst University of Wisconsin-Madison School of Medicine and Public Health mutant Unknown Disc1em1Rst 125093747 19 55265116 55449375 7 19 68529791 68769050 7 19 57818838 58069992 7 19 53014201 53223617 7 RRID:RGD_125093746 CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation. 125097486 SD-Nr3c1em1Kuan Department Pharmacology and Systems Physiology, University of Cincinnati, Cincinnati, United States mutant Unknown Nr3c1em1Kuan 125097487 18 32371496 32459145 7 18 31408742 32348480 7 18 31728373 32704022 7 18 31271681 31393320 7 RRID:RGD_125097486 The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. The LoxP sequences were inserted in the 5prime and 3prime sides of exon 3. For CaMKIIa cell-specific knockdown, 0.1 ul of AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40 (CaMKIIa Cre) [Penn Vector Core] was injected bilaterally and allowed a minimal of 3 weeks to incubate. The Cre induced condition mutant had exon 3 deletion in the neuron in the brain. 125097491 WI;WDB-Prdm14tm1(H2BVenus)Nips Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Prdm14tm1(H2BVenus)Nips 126781696 5 10550222 10570255 7 5 5710076 5730560 7 5 6082163 6092712 7 RRID:RGD_125097491 Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation . Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype. 125097492 WI-Sall1em1Nips Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN. mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Sall1em1Nips 126781694 19 19277337 19293298 7 19 34377838 34395131 7 19 23387737 23405025 7 19 18005782 18022705 7 RRID:RGD_125097492 Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 125097494 WI;WDB-Sall1tm4(tdTomato)Nips Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, JAPAN mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Sall1tm4(tdTomato)Nips 126781695 19 19277337 19293298 7 19 34377838 34395131 7 19 23387737 23405025 7 19 18005782 18022705 7 RRID:RGD_125097494 Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation.Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats..These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1. 125097496 Iar:WIC Iar:Wistar-Imamichi Institute for Animal Reproduction in Japan Institute for Animal Reproduction in Japan outbred Unknown Metabolism; Development RRID:RGD_125097496 125097497 WIC;WI;WDB-Kiss1tm8Nips Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Kiss1tm8Nips 126781693 13 46244786 46247288 7 13 55582365 55590432 7 13 50529506 50537603 7 13 44775106 44780707 7 RRID:RGD_125097497 This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination. Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Iar:Wistar-Imamichi rats to produce heterozygous founder rats. This rat strain is being maintained by crossing the founder rat with Iar:Wistar-Imamichi rats. 126777684 W-Mkxem1Asah mutant Unknown Mkxem1Asah 126777685 17 63631540 63710138 7 17 62321329 62332471 7 17 60537615 60553284 7 17 55077073 55156877 7 RRID:RGD_126777684 The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 14- bp deletion causing frameshift mutation in the gene. 126777687 WKY-Dnd1ter/Ztm Institute for Laboratory Animal Science, Hannover Medical School (MHH), Germany mutant Unknown Dnd1ter 150340622 18 29464691 29467315 7 18 29312395 29315019 7 18 29608588 29611212 7 18 28378692 28381316 7 RRID:RGD_126777687 A spontaneous mutation (ter) leading to the formation of congenital ovarian and testicular tumors was detected in the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. This recessive ter mutation has a complete penetrance of teratocarcinogenesis and infertility of both sexes in homozygous genotype. 126779578 LOU/MWsl Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs 30.56 Bruxelles 1200 BELGIUM inbred Unknown RRID:RGD_126779578 A substrain of LOU/M maintained in the laboratory of Dr. H. Bazin at Universite de Louvain. 126779586 SD-Csf1rtm(EGFP)+/-/Tset University of Edinburgh, United Kingdom mutant Unknown Csf1rtm(EGFP)Tset 126781692 18 57080324 57107295 7 18 55662670 55689297 7 18 56414493 56458300 7 18 54546673 54590418 7 RRID:RGD_126779586 Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients 126779587 DA-Csf1rtm(EGFP)+/-/Hume Department of Microbiology, University of Queensland, Brisbane, Queensland 4072 Australia mutant Unknown Csf1rtm(EGFP)Tset 126781692 18 57080324 57107295 7 18 55662670 55689297 7 18 56414493 56458300 7 18 54546673 54590418 7 RRID:RGD_126779587 Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. 126779591 SD-Csf1rtm(EGFP)-/-/Tset University of Edinburgh, United Kingdom mutant Unknown Csf1rtm(EGFP)Tset 126781692 18 57080324 57107295 7 18 55662670 55689297 7 18 56414493 56458300 7 18 54546673 54590418 7 RRID:RGD_126779591 Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. The homozygotes were obtained by crossing of heterozygotes. 126779592 DA-Csf1rtm(EGFP)-/-/Hume Department of Microbiology, University of Queensland, Brisbane, Queensland 4072 Australia mutant Unknown Csf1rtm(EGFP)Tset 126781692 18 57080324 57107295 7 18 55662670 55689297 7 18 56414493 56458300 7 18 54546673 54590418 7 RRID:RGD_126779592 Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. The homozygotes were obtained by crossing of heterozygotes 126781838 SD-Tg(PDGFB-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2024-01-10) RRID:RRRC_00869 The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent. 126781839 SD-Tg(Olfr16-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2024-01-05) RRID:RRRC_00870 The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent. 126781841 SD-Tg(Mnx1-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2024-01-10) RRID:RRRC_00872 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2 126781842 SD-Tg(Drd1-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2024-01-05) RRID:RRRC_00873 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neurons 126781843 SD-Tg(Gad1-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2024-01-05) RRID:RRRC_00874 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes. 126781844 SD-Tg(SMHC-cre/ERT2)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Live Animals (as of 2024-01-04) RRID:RRRC_00878 This mutant strain was created by injecting embryos from 'docking site ready (DSR)' rat strains. The DSR rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. The DSR embryos were microinjected with integrase, a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, and a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The vascular smooth muscle tissue-specific expression of a CreERT2 is tamoxifen-dependent." 126781845 SD-Tg(CAG-GFP-LacZ)AppscRrrc Applied StemCell, Inc., Milpitas, CA, USA Rat Resource and Research Center transgenic Unknown RRID:RRRC_00879 A transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 line 126790464 SD-Ube3aem1Jue mutant Unknown Ube3aem1Jue 126790465 1 110729142 110816491 7 1 117745283 117834011 7 1 116586901 116678161 7 1 110070260 110161675 7 RRID:RGD_126790464 The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos and inserted into a surrogate. Two genomic RNAs (gRNAs) were designed to target the 5ʹ-end of the Ube3a gene (upstream of the Ube3a coding sequence) and two gRNAs target sequences downstream of Ube3a. gRNA pairs were used on each end of the deletion to maximize the probability of a complete deletion of the 90-kb region encompassing the Ube3a gene. The 90 kb deletion in Ube3a was confirmed by genome sequencing. Only pups with maternal inheritance of the deletion carried traits for model of Angleman Syndrome. 126790469 F344.Cg-Foxn1rnu-/-/Jcl CLEA Japan, Inc CLEA Japan, Inc congenic Live Animals (as of 2021-04-22) Immuno deficiency RRID:RGD_126790469 This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats. 126790472 F344.Cg-Foxn1rnu-/+/Jcl CLEA Japan, Inc CLEA Japan, Inc congenic Live Animals (as of 2021-04-22) Immuno deficiency RRID:RGD_126790472 This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats. 126790496 SD-Shank2em13Sage mutant Unknown Shank2em13Sage 126790499 1 204399856 204855474 7 1 222118530 224450737 7 1 217149156 217593950 7 1 199146210 199590962 7 RRID:RGD_126790496 The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA 126790511 Jcl:WIST CLEA Japan, Inc outbred Live Animals (as of 2021-04-23) RRID:RGD_126790511 CLEA Japan, Inc., Taconic Farms Inc. (USA), and Taconic Europe (Denmark) created the Global Alliance for Laboratory Animal Standardization (GALASTM) agreement in collaboration with the Central Institute for Experimental Animals to promote the international standardization of outbred stocks usable for safety testing in the field of toxicity and pharmacology. Based on these activities,Wistar Hannover GALAS rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.). At and after the end of 1998, RCC Ltd. gave more than 50 pairs of pedigreed BrlHan:WIST rats to each GALAS member to use as seed rats for the Wistar Hannover GALAS strain. 126790547 SD-Rin1em1-/-Hcz Department of Histology and Embryology, Basic Medical College, China Medical University, Shenyang 110122, China mutant Unknown Rin1em1Hcz 126790548 1 207671502 207676150 7 1 227359504 227364152 7 1 220335036 220342319 7 1 202355729 202362731 7 RRID:RGD_126790547 This strain was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene. 126848737 WI- Msh6m1Hubr Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Msh6m1Hubr 126848738 6 11525292 11542592 7 6 21616672 21634338 7 6 11644565 11662389 7 6 6562631 6579995 7 RRID:RGD_126848737 The Msh6 knockout mutant rat line was generated by target-selected ENU-driven mutagenesis on Crl:WI rats. The founder rat carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene was bred to obtain homozygous animals. 126848740 SDT.Cg-Leprfa/JttJcl SDT fatty CLEA Japan, Inc CLEA Japan, Inc congenic Live Animals (as of 2021-05-06) RRID:RGD_126848740 Leprfa allele from ZDF was introgressed into SDT rats using the speed congenic method. The newly establised congenic strain of a SDT rat for Leprfa was maintained by intercross between fa-heterozygous littermates in Japan CLEA Inc. 126848751 RCS-Mertkrdyp/LavJcl CLEA Japan, Inc CLEA Japan, Inc congenic Live Animals (as of 2021-04-28) Mertkrdy 40902839 RRID:RGD_126848751 This strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for a deletion in the Mertk gene. 126848763 ODS-Gulood+/+/ShiJcl Osteogenic disorder Shionagi rat, wild type CLEA Japan, Inc CLEA Japan, Inc inbred Live Animals (as of 2021-04-29) RRID:RGD_126848763 This is the wild type control for ODS-Gulood/od/ShiJcl (RGD:4140404) . Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. 126848776 RCS-Mertkrdy+p/LavJcl CLEA Japan, Inc CLEA Japan, Inc congenic Live Animals (as of 2021-04-30) RRID:RGD_126848776 This strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for wild type Mertk gene. 126848777 SD-Tg(HRAS)128NccJcl CLEA Japan, Inc CLEA Japan, Inc transgenic Live Animals (as of 2021-04-30) RRID:RGD_126848777 Hras128 is a transgenic rat, introduced human proto-type c-Ha-ras gene to Jcl:SD rat fertilized egg by Dr. Hiroyuki Tsuda, Natl. Cancer Center, in 1998. The strain has been kept by CLEA Japan from its creation and supplied to the related research organization after concluded an agreement with Natl. Cancer Center and Japan Science and Technology Agency (JST). This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region. 126848778 SD-Tg(CAG-KRAS*G12V)301Jcl CLEA Japan, Inc CLEA Japan, Inc transgenic Live Animals (as of 2021-04-30) Oncology RRID:RGD_126848778 The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-Kras*G12V (KrasV12) was injected into embryos of SD rat (RGD:8547938). This strain was generated at CLEA Japan,Inc. This strain is introduced 3 copies of hemagglutinin (HA) epitope tag connected HA-K-rasv12 gene expression cassette by using Cre/loxP system for controlling term/location expression of human mutated form K-rasv12 gene (changing glycine to valine at the 12 amino acid sequence) that normally floxed rat does not express K-rasv12 gene. 126848793 SS-Gper1em1Bj-/- University of Toledo College of Medicine and life Sciences OH mutant Unknown Gper1em1Bj 151347865 12 15718615 15719893 7 12 19296086 19301691 7 12 17309122 17315267 7 12 15217217 15222679 7 RRID:RGD_126848793 CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. RNA validation performed via deletion PCR using a sense primer at the 5' end and an antisense primer at the 3' end showed a deletion PCR product of 544 bps versus wild-type PCR product of 1484 bps. The homozygous founders had complete deletion of Gper1 was confirmed by DNA sequenching. 126848794 SHR-Zbtb16em1Ipcv+/- Institute of Biology and Medical Genetics, Charles University, Prague mutant Unknown Zbtb16em1Ipcv 150340624 8 51931530 52094813 7 8 51573252 51740759 7 8 52980226 53146765 7 8 48989376 49177011 7 RRID:RGD_126848794 TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. The founder was bred with SHR to generate more heterozygous animals. The homozygous animals die perinatally because of multiple developmental abnormalities. 126848804 F344-Trpc4Tn(sb)1Bni Laboratorium voor Fysiologie, Campus Gasthuisberg, KU Leuven, B-3000 Leuven Belgium mutant Unknown Trpc4Tn(sb)Tngen 126848808 2 143350286 143485716 7 2 163115873 163282223 7 2 143433102 143605757 7 2 138307676 138476856 7 RRID:RGD_126848804 The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. Trpc4 knock-out (510 bp) and wild-type allele (905 bp) were confirmed using PCR and gel electrophoresis 126908010 SD-Kcnk3em1Ang-/- mutant Unknown Kcnk3em1Ang 126908015 6 25745923 25782144 7 6 36969843 37005778 7 6 27154274 27190209 7 6 25761487 25799153 7 RRID:RGD_126908010 The homozygous Kcnk3 mutant rats are littermates of cross of heterozygotesKcnk3 mutant rats . The mutation created by CRISPR/Cas9 contained a 94- bp deletion in exon1 of resulted a premature stop codon. 126908013 SD-Kcnk3em1Ang-/+ mutant Unknown Kcnk3em1Ang 126908015 6 25745923 25782144 7 6 36969843 37005778 7 6 27154274 27190209 7 6 25761487 25799153 7 RRID:RGD_126908013 The heterozygous Kcnk3 mutant rats were created by CRISPR/Cas9. The mutated allele contained a 94- bp deletion in exon1 of resulted a premature stop codon. 126925134 SD-Il36rntm1(Myh6-cre)Mhzh Nanjing University Model Animal Center. mutant Unknown Il36rntm1(Myh6-cre)Mhzh 126925161 3 2530402 2536999 7 3 1378833 1385430 7 3 1385256 1392275 7 3 7044419 7051016 7 RRID:RGD_126925134 This line was produced by mating rats carrying Il36rnf/f allele and Myh6-cre-allele. The expression of Il36rn was knockout in cardiomyocytes. 126925135 SD-Il1rl2tm1(Myh6-cre)Mhzh Nanjing University Model Animal Center. mutant Unknown Il1rl2tm1(Myh6-cre)Mhzh 126925159 9 39492187 39537792 7 9 46733619 46778352 7 9 47044870 47093679 7 9 42591658 42639351 7 RRID:RGD_126925135 This line was produced by mating rats carrying IIl1rl2f/f allele and Myh6-cre-allele. The expression of Il1rl2 was knockout in cardiomyocytes. 126925136 SD-Mstnem1Cqin mutant Unknown Mstnem1Cqin 151347430 9 45426831 45431658 7 9 52977371 52982198 7 9 53310977 53315804 7 9 48452533 48458933 7 RRID:RGD_126925136 ZFN constructs were designed to target the genomic region of rat Mstn exon 1. A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376). ZFN mutant founders were backcrossed to Spargue Dawley rats to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 126925137 SD-Ogdhem1Yuyi Laboratory Animal Center of Zhengzhou university mutant Unknown Ogdhem1Yuyi 126925168 14 87022994 87090768 7 14 87376110 87442862 7 14 86414924 86481903 7 14 81150021 81217479 7 RRID:RGD_126925137 The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. No homozygous rats were obtained from mating of heterozygotes that suggests embryonic lethal for the homozygotic mutant. 126925138 SD-Ubdem1 Department of Cardiovascular Medicine, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006 mutant Unknown Ubdem1 126925166 20 1475944 1477895 7 20 3917777 3919728 7 20 1876175 1878126 7 20 1385487 1387438 7 RRID:RGD_126925138 This Ubd (FAT10) knockout rat strain was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd. 126925139 SD-Dnmt1tm1(Myh6-cre)Cqin Beijing Engineering Research Center for Experimental Animal Models of Human Diseases, Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College (ZLF18003), Beijing, China mutant Unknown Dnmt1tm1(Myh6-cre)Cqin 126925165 8 19926995 19973256 7 8 21978830 22024656 7 8 21922515 21968495 7 8 19440611 19486659 7 RRID:RGD_126925139 To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats 126925196 F344-Slc6a3m1Span Central Institute of Mental Health Department of Psychopharmacology Central Institute of Mental Health Mannheim, mutant Unknown Slc6a3m1Span 126925197 1 30516568 30557540 7 1 33745060 33788878 7 1 32323011 32363983 7 1 29709443 29750413 7 RRID:RGD_126925196 This strain was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence. 126925212 WI- Drd1m1Hubr Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. mutant Unknown Drd1m1Hubr 126925213 17 16655926 16658161 7 17 13211031 13215581 7 17 11099736 11104352 7 17 10540440 10544971 7 RRID:RGD_126925212 The Drd1 mutant rat line was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein. 126925756 SD-Cryba1Nuc1Dbsa The Johns Hopkins University School of Medicine The Wilmer Eye Institute The Johns Hopkins University School of Medicine Baltimore mutant Unknown Cryba1Nuc1Dbsa 126925758 10 63758929 63765451 7 10 66458061 66480390 7 10 65160777 65167504 7 10 62608373 62614726 7 RRID:RGD_126925756 This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1. 126925949 SD-Myh7bem1Blar+/- Beijing Laboratory Animal Research Center of Chinese Academy of Medical Sciences. mutant Unknown Myh7bem1Blar 126925953 3 146115687 146139441 7 3 157472519 157518151 7 3 151105038 151150621 7 3 144076911 144122714 7 RRID:RGD_126925949 The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. 126925952 SD-Myh7bem1Blar-/- Beijing Laboratory Animal Research Center of Chinese Academy of Medical Sciences. mutant Unknown Myh7bem1Blar 126925953 3 146115687 146139441 7 3 157472519 157518151 7 3 151105038 151150621 7 3 144076911 144122714 7 RRID:RGD_126925952 The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. 126925978 SD-Ercc6em1Cgen Key Laboratory of Neurological Function and Health, School of Basic Medical Science, Guangzhou Medical University, Guangzhou 511436, China. mutant Unknown Ercc6em1Cgen 126925980 16 8024881 8091587 7 16 10699983 10770565 7 16 8779715 8779715 8 16 7810692 7810692 8 RRID:RGD_126925978 The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA). A silent mutation (ACC to ACG) was also introduced to prevent the binding and re-cutting of the sequence by gRNA after HDR. Founder animals harboring the expected single-nucleotide substitution were bred to produce heterozygous and homozygous rats.The heterozygous rats had phenotypes similar to the wild type littermates. 126925992 SD-Cftrem1Ang INSERM 1151 INEM Universite de Paris Paris France. mutant Unknown Cftrem1Ang 126925993 4 43874852 44041870 7 4 42281040 42448571 7 4 42693263 42860679 7 4 46561269 46728759 7 RRID:RGD_126925992 The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification. 126925994 SD-Cftrem2Ang INSERM 1151 INEM Universite de Paris Paris France. mutant Unknown Cftrem2Ang 126925995 4 43874852 44041870 7 4 42281040 42448571 7 4 42693263 42860679 7 4 46561269 46728759 7 RRID:RGD_126925994 The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon. Two knockout founders ( referred as MUKORAT8.3 and MUKORAT 6.4) exhibit no difference in phenotypes and were pooled for study. 126928141 SD-F8em1Sage/Novo-Tg(ITGA2B-F8*)Mcwi Blood Research Institute 8733 W Watertown Plank Road Milwaukee, WI 53226 transgenic Unknown F8em1Sage 11531096 RRID:RGD_126928141 This transgenic was produced by crossing the SD transgenic rat carrying Lentivirus constructs containing the 2bF8 vector [B-domain deleted human FVIII under control of ITGA2B (IIb) promoter] with an F8 knockout rat SD-F8em1Sage-/-/Novo (RGD:11531091). This transgenic rat strain expressed B-domain deleted human F8 under the control of ITGA2B promoter in the absence of rat F8 product. 126928146 ACI.Cg.-Cdkn1bem1Musc Transgenic and Gene Function Core, Medical University of South Carolina, Charleston, South Carolina, United States of America mutant Unknown Cdkn1bem1Musc 126928147 4 171841705 171846506 7 4 232962218 232967323 7 4 168689043 168694159 7 4 167760067 167765177 7 RRID:RGD_126928146 The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1bem1Musc harbors 32-bp deletion of Cdkn1b exhibits same phenotype as the em4Musc with 65-bp deletion 126928150 ACI.Cg.-Cdkn1bem4Musc Transgenic and Gene Function Core, Medical University of South Carolina, Charleston, South Carolina, United States of America mutant Unknown Cdkn1bem4Musc 126928151 4 171841705 171846506 7 4 232962218 232967323 7 4 168689043 168694159 7 4 167760067 167765177 7 RRID:RGD_126928150 The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1bem4Musc harbors 65-bp deletion of Cdkn1b exhibits same phenotype as the em1Musc with 32-bp deletion 127284837 GK/Wnsm University of Wales College of Medicine (Cardiff, UK) inbred Unknown RRID:RGD_127284837 The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations. This GK/Wnsm colony was established at the University of Wales College of Medicine (Cardiff, UK) after received breeding pairs provided by Professor Y Goto (Tohoku University School of Medicine, Sendai, Japan). 127284865 F344-Nppcem1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Nppcem1Kyo 127284866 9 85434254 85438454 7 9 93458753 93462953 7 9 93731436 93735636 7 9 87320051 87324251 7 RRID:RGD_127284865 This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem1Kyo strain ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). 127284868 F344-Nppcem2Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Nppcem2Kyo 127284869 9 85434254 85438454 7 9 93458753 93462953 7 9 93731436 93735636 7 9 87320051 87324251 7 RRID:RGD_127284868 This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem2Kyo strain ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194, NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc 127284870 F344-Nppcem3Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Nppcem3Kyo 127284871 9 85434254 85438454 7 9 93458753 93462953 7 9 93731436 93735636 7 9 87320051 87324251 7 RRID:RGD_127284870 This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem3Kyo strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) 127284872 F344-Nppcem4Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown Nppcem4Kyo 127284873 9 85434254 85438454 7 9 93458753 93462953 7 9 93731436 93735636 7 9 87320051 87324251 7 RRID:RGD_127284872 This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppcem4Kyo strain ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats. 127284883 SD-Aqp4em1Hrt Department of Anatomy and Histology, School of Basic Medical Sciences, Peking University, Beijing, China mutant Unknown Aqp4em1Hrt 127284884 18 6626313 6642766 7 18 6720759 6737703 7 18 6766009 6782757 7 18 6507903 6524558 7 RRID:RGD_127284883 The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate Aqp4-deficient rats. The synthesized TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. The founder animal lacking three base pairs was crossed with wild-type rat to produced the F1 generration and the heterozygous offspring of F1 were corssed to produce mutant strains and confirmed by sequencing analysis of PCR products of modified genome region. 127285380 SD-Mir31em1Sage Department of Cancer Biology and Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, OH 43210; mutant Unknown RRID:RGD_127285380 CRISPR/Cas9 system was used to introduce the gene knockout of Mir31 in the Sprague Dawley embryos. 127285404 SHR-Cfbem1Tja Centre for Genomic and Experimental Medicine, MRC Institute for Genetics and Molecular Medicine, Edinburgh, United Kingdom mutant Unknown Cfbem1Tja 127285405 20 6616005 6621872 7 20 4536206 4542073 7 20 3970643 3976510 7 RRID:RGD_127285404 This strain was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion. 127285409 SD-Abcc8em1Cgen Department of Endocrinology, Shandong University, Jinan, China Cyagen Biosciences Inc., Guangzhou, China mutant Unknown Abcc8em1Cgen 127285598 1 96622574 96703723 7 1 103194473 103275508 7 1 102110708 102191287 7 1 96598568 96679563 7 RRID:RGD_127285409 TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This strain carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats is homozygous. No Abcc8 protein was detected in the liver and muscle tissues. 127285661 SD-Adgrl3em1Huyc Department of Pediatrics, University of Cincinnati College of Medicine, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH mutant Unknown Adgrl3em1Huyc 127285662 14 28385112 28854677 7 14 28183727 29040121 7 14 28362176 29226085 7 14 26336320 27104060 7 RRID:RGD_127285661 The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. 127285810 SD-Trpa1em1Gne Department of Neuroscience, Genentech, 1 DNA Way, South San Francisco, CA 94080 USA mutant Unknown Trpa1em1Gne 127285812 5 3531163 3584401 7 5 3764339 3818781 7 5 3783247 3836485 7 5 4379862 4434133 7 RRID:RGD_127285810 This Trpa1-deleted Sprague Dawley strain was generated by using CRISPR/Cas9. Rats harboring a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901 were identified. 127338473 WM/Nem The research institute of Environmental Medicine, Nagoya University. inbred Unknown RRID:RGD_127338473 This Strain was from the National Institute of Genetics., Mishima, Japan to the research institute of Environmental Medicine, Nagoya University. 127338474 BDIX/Nem inbred Unknown RRID:RGD_127338474 This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 127345097 SD-Muc1em1Cgen Cyagen Biosciences Inc., Guangzhou, China mutant Unknown Muc1em1Cgen 127345099 2 181399482 181403640 7 2 207957206 207962396 7 2 188543137 188547874 7 2 174635989 174640738 7 RRID:RGD_127345097 The Muc1 knock out Sprague Dawley rats were produced by targeted gene mutation at rat Muc1 gene. The deletion was made by microinjection of TALENs and located in the exon 1 of rat Muc1 gene (Gen Bank: NM_012602.1). Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5′-CTAGCAAGCCTAAAAGGTGAGAGGT-3′ and reverse primer 5′-ACGAAGAGCATTTGCCTACTC-3′, followed by DNA sequencing analysis. 127345123 F344-Angptl8em1Kyo-/- Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan National BioResource Project for the Rat in Japan mutant Unknown Angptl8em1Kyo 127345127 8 20948070 20950087 7 8 22910979 22913005 7 8 22855495 22858565 7 8 20376462 20378488 7 RRID:RGD_127345123 This line #1 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3' (sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. 127345124 F344-Angptl8em1Kyo+/- Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan National BioResource Project for the Rat in Japan mutant Unknown Angptl8em1Kyo 127345127 8 20948070 20950087 7 8 22910979 22913005 7 8 22855495 22858565 7 8 20376462 20378488 7 RRID:RGD_127345124 This line #1 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. 127345125 F344-Angptl8em2Kyo-/- Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan National BioResource Project for the Rat in Japan mutant Unknown Angptl8em2Kyo 127345128 RRID:RGD_127345125 This line #2 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon. 127345126 F344-Angptl8em2Kyo+/- Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan National BioResource Project for the Rat in Japan mutant Unknown Angptl8em2Kyo 127345128 RRID:RGD_127345126 This line #2 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon. 149735334 SD-Wfs1em1Ptsn Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu, mutant Unknown Wfs1em1Ptsn 149735335 14 79379680 79404003 7 14 78606172 78630689 7 14 78640707 78665224 7 14 73810478 73834993 7 RRID:RGD_149735334 Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em1 rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine). 149735336 SD-Wfs1em2Ptsn Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu, mutant Unknown Wfs1em2Ptsn 149735337 14 79379680 79404003 7 14 78606172 78630689 7 14 78640707 78665224 7 14 73810478 73834993 7 RRID:RGD_149735336 Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em2 rats carry a 27 amino acids deletion in exon 5 (aa212-238). 149735338 SD-Wfs1em3Ptsn Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu, mutant Unknown Wfs1em3Ptsn 149735339 14 79379680 79404003 7 14 78606172 78630689 7 14 78640707 78665224 7 14 73810478 73834993 7 RRID:RGD_149735338 Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em3 rats carry a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226) into YCMNTI in the WFS1 protein. 149735356 SD-Tg(Wnt1-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA Deposited at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) RRID:RGD_149735356 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT2 149735357 SD-Tg(PDGFB-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA Deposited at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19) RRID:RGD_149735357 The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent. 149735358 SD-Tg(Olfr16-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA Deposited at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19) RRID:RGD_149735358 The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent. 149735359 SD-Tg(Mnx1-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA Deposited at at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2024-01-10) RRID:RGD_149735359 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2 149735361 SD-Tg(Drd1-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA deposited at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) RRID:RGD_149735361 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neurons 149735362 SD-Tg(Gad1-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA Deposited at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) RRID:RGD_149735362 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes. 149735363 SD-Tg(GFAP-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA deposited at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) RRID:RGD_149735363 The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent. 149735364 SD-Tg(Tie2-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA deposited at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) RRID:RGD_149735364 The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2 149735365 SD-Tg(SMHC-cre/ERT2)Appsc Applied StemCell, Inc., Milpitas, CA, USA deposited at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) RRID:RGD_149735365 The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent. 149735366 SD-Tg(CAG-GFP-LacZ)Appsc Applied StemCell, Inc., Milpitas, CA, USA Deposited at Rat Resource and Research Center transgenic Unknown RRID:RGD_149735366 A transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 line 149735371 SHR-C3em1Kyo National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan advanced_intercross_line Cryopreserved Embryo (as of 2021-07-20) C3em1Kyo 149735372 RRID:RGD_149735371 ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The DNA of 10 day old pups was extracted and screened for ZFN-induced mutations. Briefly, DNA extracted from ear tissue was amplified using primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'-AATAGAGGCCACCAATGCAC-3'). This mutant revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg). 149735516 LL/MavRrrcAek Lyon hypotensive Department of Pharmacology, University of Iowa, Iowa RGD HRDP, contact HRDP inbred Live Animals (as of 2024-08-06) RRID:RGD_149735516 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. The strain from Rat Resource & Research Center was maintained at Department of Pharmacology, University of Iowa 149735517 LEXF10A/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_149735517 These are re-derived rats of LEXF10A/Stm now maintained at Medical College of Wisconsin. The parent strain was derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. 149735518 HXB4/IpcvMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_149735518 These are re-derived rats of HXB4/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 149735519 HXB31/IpcvMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_149735519 These are re-derived rats of HXB31/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub 149735520 HXB2/IpcvMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_149735520 These are re-derived rats of HXB2/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub. 149735521 HXB20/IpcvMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_149735521 These are re-derived rats of HXB20/Ipcv now maintained at Medical College of Wisconsin. The parent strain wasDerived from founder strains SHR/OlaIpcv and BN-Lx/Cub 149735530 BXH2/CubMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_149735530 These are re-derived rats of BXH2/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv 149735533 BXH3/CubMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_149735533 These are re-derived rats of BXH3/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv. 149735557 LE-Tg(Pdyn-cre)2-9Koba Kazuto Kobayashi Fukushima Medical University National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2024-01-26) RRID:RGD_149735557 This strain was produced by injecting a modified BAC, in which a Cre recombinase was inserted into the third exon of the rat Pdyn gene, into rat zygotes (Iar:Long-Evans, RGD:18337282). This strain is a transgenic rat that expresses Cre recombinase under the control of the Pdyn gene. 149735558 F344.LEA-Ugl/Okt National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2021-07-22) RRID:RGD_149735558 A congenic strain in which the ugl locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the ugl locus, which contains a 13 bp deletion in the Ctns gene.Cystinosis model rat. 149735559 F344.LEA-Idao/Okt National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2021-07-22) RRID:RGD_149735559 A congenic strain in which the Idao locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the Idao locus, which contains a 54.1 kb deletion in the Dao gene. 149735560 LE-Gad1em15Yyan Gunma University Graduate School of Medicine National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-22) Gad1em15Yyan 149735561 3 52789370 52830038 7 3 63479963 63519879 7 3 56861440 56902139 7 3 55386152 55386442 8 RRID:RGD_149735560 Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes. 149735562 LE-Gad2em24Yyan Gunma University Graduate School of Medicine National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-22) Gad2em24Yyan 149735563 17 96259430 96321857 7 17 90851699 90914893 7 17 89171576 89234770 7 17 84763740 84764054 8 RRID:RGD_149735562 Knockout rats in which the Gad2 gene was disrupted using the TALEN. In this strain, the Gad2 gene encoding GAD65 was knocked out. In homozygous rats, a high rate of epileptic seizures was observed at 2 to 3 weeks of age. 149735570 F344-Atg16l1em8Rrrc RRRC mutant Live Animals (as of 2021-07-23) Inflammatory Bowel Disease, autophagy Atg16l1em8Rrrc 149735571 9 86712122 86747370 7 9 94599174 94634551 7 9 94879876 94915231 7 9 88420737 88457530 7 RRID:RGD_149735570 CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. 149735895 LEW-Tg(Col2a1-luc,-mCherry)RmptRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown Skeletal Regenerative Medicine RRID:RRRC_00942 Random insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferin 149735896 LEW-Tg(Col2a1-luc,-mCherry)Rmpt This transgenic was created by Dr. Ryan Porter at University of Arkansas for Medical Sciences. Rat Resource and Research Center transgenic Unknown Skeletal Regenerative Medicine RRID:RGD_149735896 Random insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferin 149735897 F344-Cacna1agry/Okym National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2021-07-29) Neurobiology RRID:RGD_149735897 This strain is derived from GRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) provided from NBRP-Rat. GRY/Idr was backcrossed to F344/NSlc. 149735898 SD-Myh7bem1Blar+/+ Beijing Laboratory Animal Research Center of Chinese Academy of Medical Sciences. mutant Unknown RRID:RGD_149735898 This is the homozygous wild type littermate from crossing of heterozygous SD-Myh7b mutants. The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. 149735906 RCCHan:WIST outbred Unknown RRID:RGD_149735906 Wistar Hannover rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.) 150340617 SHRSP.SHR-(rs197197017 -rs198445122)/Utx University of Texas, Houston, TX congenic Unknown 1 156969388 198720287 1 - by flanking markers 1 146197289 181894275 1 - by flanking markers RRID:RGD_150340617 A congenic strain made by introducing B2 fragment (a segment of chromosome 1, 154.7 Mb - 203 Mb) from SHR/Utx into SHRSP/BbbUtx.The B2 fragment contains wild-type Stim1 as confirmed by sequencing. 150340629 SS-Tgfb1em3Mcwi+/+ SS-Tgfb1em3Mcwi+/Tgfb1em3Mcwi+ PhysGen Knockouts mutant Unknown RRID:RGD_150340629 ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed to produce homozygous wild type and heterozygous mutant littermates. 150404267 LEW-Myo15aci2/Ztm Institute of Laboratory Animal Science, Hannover Medical School, Hannover, Germany mutant Unknown Myo15aci2 150404269 10 46742535 46798928 7 10 46595676 46660835 7 10 46840098 46897362 7 10 45277619 45335953 7 RRID:RGD_150404267 LEW/Ztm-ci2 rat is an animal model for syndromal deafness that arose from a spontaneous mutation. Base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region. 150429598 SS-Vwfem4Mcwi Rat Genetic Models, through Versiti Blood Research Institute Rat Genetic Models, through Versiti Blood Research Institute mutant Unknown Type I von Willebrand Disease Vwfem4Mcwi 150429599 4 161723415 161854766 7 4 225098521 225229257 7 4 158085059 158219525 7 4 158360152 158491539 7 RRID:RGD_150429598 The rat strain was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting rat strain has a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. Some mRNA must make it through to translation, because low levels of VWF protein are detectable via ELISA (<10%). Both homozygous pairs and heterozygous pairs were used for breeding. 150429601 MWF.SHR-(D6Rat1-D6Rat30)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 48631043 144152572 1 - by flanking markers 6 58374821 153672040 1 - by flanking markers 6 49695264 144745573 1 - by flanking markers 6 47370564 137801795 1 - by flanking markers RRID:RGD_150429601 The congenic MWF.SHR-(D6Rat1-D6Rat30)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429602 MWF.SHR-(D6Rat1-D6Rat106)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 68036028 144152572 1 - by flanking markers 6 78348236 153672040 1 - by flanking markers 6 68781170 144745573 1 - by flanking markers 6 65531555 137801795 1 - by flanking markers RRID:RGD_150429602 The congenic MWF.SHR-(D6Rat1-D6Rat106)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429603 MWF.SHR-(D6Rat1-D6Mit8)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 97561873 144152572 1 - by flanking markers 6 107370981 153672040 1 - by flanking markers 6 97949772 144745573 1 - by flanking markers 6 93701310 137801795 1 - by flanking markers RRID:RGD_150429603 The congenic MWF.SHR-(D6Rat1-D6Mit8)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429604 MWF.SHR-(D6Rat1-D6Rat121)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 99651951 144152572 1 - by flanking markers 6 109506414 153672040 1 - by flanking markers 6 100120078 144745573 1 - by flanking markers 6 95760211 137801795 1 - by flanking markers RRID:RGD_150429604 The congenic MWF.SHR-(D6Rat1-D6Rat121)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429605 MWF.SHR-(D6Rat1-D6Mgh4)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 108503674 144152572 1 - by flanking markers 6 117391806 153672040 1 - by flanking markers 6 108154445 144745573 1 - by flanking markers 6 104085867 137801795 1 - by flanking markers RRID:RGD_150429605 The congenic MWF.SHR-(D6Rat1-D6Mgh4)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429606 MWF.SHR-(D6Rat1-D6Rat81)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 111967597 144152572 1 - by flanking markers 6 120994890 153672040 1 - by flanking markers 6 111715478 144745573 1 - by flanking markers 6 107351142 137801795 1 - by flanking markers RRID:RGD_150429606 The congenic MWF.SHR-(D6Rat1-D6Rat81)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429607 MWF.SHR-(D6Rat1-D6Rat115)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 116550201 144152572 1 - by flanking markers 6 125802476 153672040 1 - by flanking markers 6 116576030 144745573 1 - by flanking markers 6 111837996 137801795 1 - by flanking markers RRID:RGD_150429607 The congenic MWF.SHR-(D6Rat1-D6Rat115)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429608 MWF.SHR-(D6Rat1-D6Rat184)/Rkb Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 121381065 144152572 1 - by flanking markers 6 130448688 153672040 1 - by flanking markers 6 121224054 144745573 1 - by flanking markers 6 116506292 137801795 1 - by flanking markers RRID:RGD_150429608 The congenic MWF.SHR-(D6Rat1-D6Rat184)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. 150429614 FHH-Tg(CAG-Add3)McwiRoman Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi transgenic Unknown Add3 2043 RRID:RGD_150429614 A full-length rat wild type Add3 cDNA obtained from an expression plasmid pCMV6-entry-Add3 purchased from Origene (Rockville, MD) was inserted in a sleeping beauty transposon vector. The expression of wild type ADD3 in the transposon vector was driven by a CAG promoter. The construct was injected into the pronucleus ofoocytes collected from female FHH/EurMcwi rats along with SB100 transposase mRNA. A single-transgene insertion was identified on chromosome 10, which is located .64 kbp away from the protein shisa-6 homolog precursor at its 59 end and .360 kbp away from the phosphoinositide-interacting protein at the 3 prime end. Heterozygous founders were intercrossed to derive a homozygous transgenic line that was used for studies. 150429615 SD-Add3em1Mcwi/ Roman Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi mutant Unknown (as of 2021-09-09) Add3em1Mcwi 150429617 1 259347673 259455407 7 1 281267424 281375203 7 1 273854195 273961982 7 1 252147341 252255126 7 RRID:RGD_150429615 ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used 150429618 FHH-Chr 1BN-Add3em2Mcwi /Roman Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi mutant Unknown Add3em2Mcwi 150429619 1 259347673 259455407 7 1 281267424 281375203 7 1 273854195 273961982 7 1 252147341 252255126 7 RRID:RGD_150429618 ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used 150429634 F344 -Aspaem34Kyo Hcn1em1Kyo Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606-8501, Japan mutant Unknown Aspaem34Kyo|Hcn1em1Kyo 11564348|150429632 2;10 49525949;60178509 49939066;60199207 7;7 2;10 68473431;59578788 68874494;59627450 7;7 10;2 59839693;50099576 59888244;50499799 7;7 10;2 57891704;49495771 57945267;49899983 7;7 RRID:RGD_150429634 F344-Aspaem34Kyo (RGD:11564349) and F344-Hcn1em1Kyo (RGD:38676253) rats from the National BioResource Project-Rat were intercrossed to produce F1 hybrids and then to obtain F2 progeny. Rats homozygous for both Aspa and Hcn1 knockout alleles were selected from among F2 progeny and were used to generate the F344-Aspaem34Kyo/Hcn1em1Kyo double- knockout strain. 150429707 SD-Cyp2c11em1Nju mutant Unknown Cyp2c11em1Nju 150429708 1 243281320 243320945 7 1 265418158 265454574 7 1 257676172 258004428 7 1 236762719 236799069 7 RRID:RGD_150429707 CRISPR/Cas9 system containing two pairs of single guide RNA (sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG- TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC- 39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39; reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. 150429760 SHRSP.SHR-(rs198233821-rs198932221)/Utx University of Texas, Houston, TX congenic Unknown 6 137021260 145293041 1 - by flanking markers 6 131516676 138350465 1 - by flanking markers RRID:RGD_150429760 A congenic strain made by introducing IgH haplotype block (a segment of chr6:146,030,387 to 154,214,590 ,Rn5 assembly of the rat genome). from SHR-B2 (SHR/Utx) into SHR-A3 (SHRSP/BbbUtx). The igH block contains sequences that are highly divergent between of SHR-A3 and SHR-B2 . 150429814 SD-Gnalem1Hpng+/- Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, Germany mutant Unknown Gnalem1Hpng 150429816 18 63595606 63735803 7 18 61991738 62131420 7 18 62805406 62946133 7 18 60622311 60762599 7 RRID:RGD_150429814 The heterozygousGnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids . 150429815 SD-Gnalem1Hpng+/+ Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, Germany mutant Unknown RRID:RGD_150429815 The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids . 150429817 SD-Gnalem1Hpng-/- Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, Germany mutant Unknown Gnalem1Hpng 150429816 18 63595606 63735803 7 18 61991738 62131420 7 18 62805406 62946133 7 18 60622311 60762599 7 RRID:RGD_150429817 Thehomozygous Gnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids. Only 5% of homozygous Gnal knockout mice could survive till maturity 150429818 BN/HsdMcwiRrrc Rat Resource & Research Center Rat Resource & Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-09-30) RRID:RRRC_00562 Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115). This strain was maintained at RRRC. 150429825 SD-Scn9a*tm1Amgn/Crl This Sprague Dawley (SD) rat model was designed by Amgen, adapted and executed by SAGE Labs, Sigma-Aldrich. Charles River Laboratories mutant Unknown Scn9a*tm1Amgn 150429827 3 48438725 48518893 7 3 59207264 59286961 7 3 52583953 52664209 7 3 51145148 51293342 7 RRID:RGD_150429825 Exon 25 of the rat Scn9a gene was replaced with the human SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase). 150429828 SD-Tspoem1Vpl McGill University and Genome Quebec Innovation Centre (Montreal, Canada) mutant Unknown Tspoem1Vpl 150429831 7 121597084 121599342 7 7 124449361 124459090 7 7 124460358 124470610 7 7 114720188 114730450 7 RRID:RGD_150429828 Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and 273 bp for the mutant,(89 bp deletion). 150429830 SD-Tspoem2Vpl McGill University and Genome Quebec Innovation Centre (Montreal, Canada) mutant Unknown Tspoem2Vpl 150429832 7 121597084 121599342 7 7 124449361 124459090 7 7 124460358 124470610 7 7 114720188 114730450 7 RRID:RGD_150429830 Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30. Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion). 150429960 WIC-Wwoxlde/Fta Laboratory of Veterinary Physiology, Nippon Veterinary and Life Science University, Tokyo mutant Unknown Wwoxlde 150429961 19 44516391 44829849 7 19 57582172 58503008 7 19 46761353 47695247 7 19 42432141 43360278 7 RRID:RGD_150429960 Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting severe dwarfism, short lifespan (early postnatal lethality), and high incidence of epileptic seizures. Mutant rats showed growth retardation after 3 d of age, and at 21 d their weight was about 56% that of normal rats. Sequencing of the full-length Wwox transcript identified a 13-bp deletion in exon 9 in lde/lde rats. This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal. 150429963 WI-Pmchm1Hubr Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Pmchm1Hubr 150429964 7 24778133 24779449 7 7 28764993 28766309 7 7 28655206 28656522 7 7 22511934 22513250 7 RRID:RGD_150429963 The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. 150429965 SD-Apoa4em1Bcgen Beijing Biocytogen Co., Ltd. (Beijing, China). mutant Unknown Apoa4em1Bcgen 150429966 8 49233142 49233431 7 8 49163055 49165333 7 8 50536983 50539371 7 8 46539083 46541464 7 RRID:RGD_150429965 TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp. 150429988 SHR-Tg(EEF1A1-Wars2)Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Wars2 1593417 RRID:RGD_150429988 This strain was derived by microinjecting fertilized eggs with a mix of the Sleeping Beauty construct containing BN Wars2 cDNA under control of the universal EF-1α (human EEF1A1) promoter and mRNA of the SB100X transposase (Ivics et al. 2014). Transgenic rats were detected using PCR with the following primers: Wars2-F 5'-TGT GCT ACA AGT CCA CAC AC-3' and Wars2-R 5'-GCA GAA GGG TCA CGA AGA GA-3'. 150517549 SS.SHR-(D2Rat46- D2Mco48)/Mco University of Toledo Toledo, Ohio congenic Unknown 2;20 174932771;29853888 190428097;29855558 1 - by flanking markers;1 - by flanking markers 2;20 201609408;34115408 201609573;34116469 1 - by flanking markers;1 - by flanking markers 2 182194909 182195074 1 - by flanking markers 2 168559501 168559667 1 - by flanking markers RRID:RGD_150517549 This SS congenic carries the chromosomal fragment from the spontaneously hypertensive rat (SHR). Recombinant Progeny Testing (RPT) was used to fine-map the proteinuria locus. The congenic was developed from the recombinant families by fixing the transferred genomic interval (D2Rat46- D2Mco48) in the homozygous SHR/SHR state 150517550 SS.SHR-(D2Rat127- D2Rat230)/Mco University of Toledo Toledo, Ohio congenic Unknown 2 177914620 177914774 1 - by flanking markers 2 204650681 204650836 1 - by flanking markers RRID:RGD_150517550 This SS congenic carries the chromosomal fragment from the spontaneously hypertensive rat (SHR). Recombinant Progeny Testing (RPT) was used to fine-map the proteinuria locus. The congenic was developed from the recombinant families by fixing the transferred genomic interval (D2Rat127- D2Rat230) in the homozygous SHR/SHR state 150519895 SD-Gfapem1Mes+/- /Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Gfapem1Mes 150519905 10 92059881 92068555 7 10 90763150 90771823 7 10 90990762 90999435 7 10 87852891 87861631 7 RRID:RRRC_00932 The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human disease. The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The current background srain is Crl:CD (SD). This mutant strain serves as a model for Alexander disease. knockins have post-weaning failure to thrive and ~10% mortality by 12 weeks, but afterwards are viable and can breed . 150519896 SD-Gfapem2Mes /Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Gfapem2Mes 150519906 10 92059881 92068555 7 10 90763150 90771823 7 10 90990762 90999435 7 10 87852891 87861631 7 RRID:RRRC_00931 CRISPR/Cas9 mediated single nucleotide deletion resulting in a frameshift that creates a premature stop and generates a null allele. This strain serves as a model for Alexander disease - nulls are of interest for traumatic brain injury and many other studies of CNS disease and astrocyte response. 150519899 F344-Prkar1bem1Tua Department of Animal Science Faculty of Agriculture Tokyo University of Agriculture 1737 Funako Atsugi Kanagawa 243-0034 Japan mutant Unknown Prkar1bem1Tua 150519902 12 16025867 16131129 7 12 19611694 19708682 7 12 17614536 17713567 7 12 15492233 15624942 7 RRID:RGD_150519899 CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant strain F344-Prkar1bem1Tua carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 150519901 F344-Prkar1bem2Tua Department of Animal Science Faculty of Agriculture Tokyo University of Agriculture 1737 Funako Atsugi Kanagawa 243-0034 Japan mutant Unknown Prkar1bem2Tua 150519903 12 16025867 16131129 7 12 19611694 19708682 7 12 17614536 17713567 7 12 15492233 15624942 7 RRID:RGD_150519901 CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant strain F344-Prkar1bem2Tua carried a 13-bp frameshift deletion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants. 150520049 WBN-Ht/Kob congenic Unknown RRID:RGD_150520049 The hairless rat was orginially found in JCL:Wistar rats at Ishikawa Laboratory Animal company, Saitama, Japan. Thereafter, hairless rats were backcrossed with WBN rats for 8 generations and the congenic strain of hairless rats has been established with a background of WBN at the company. 150520052 SS-Mlycdem1Mcwi Medical College of Wisconsin Please contact: mcwcustomrats@mcw.edu mutant Unknown RRID:RGD_150520052 CRISPR/Cas9 system was used to introduce a mutation in the Mlycd gene of SS/JrHsdMcwi rat embryos. This resulted in a global knock-out of the rat Mlycd gene. 150520162 Kwl:Wistar Kiwa Laboratory Animals Co., Ltd. Japan Kiwa Laboratory Animals Co., Ltd. Japan outbred Unknown RRID:RGD_150520162 150520182 LE-ROSA26em1(CAG-tdTomato)Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Live Animals (as of 2023-08-01) RRID:RRRC_00938 The DNA construct was made by replacing ZsGreen with TdTomato in plasmid pCAG-loxP-STOP-loxP-ZsGreen (Addgene plasmid #51269, donated by Pawel Pelczar). CRISPR/Cas9 genome editing technology was used to knock in the DNA construct into the rat ROSA26 locus in the embryos from outbred BluHsd:LE. Reporter line that can be crossed with Cre-expressing strains. In presence of Cre, the floxed "STOP" upstream of the TdTomato gene is deleted allowing expression of the red fluorescent TdTomato protein. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 150520183 BDIX.BDIV-Mss1c/ZteRrrc Rat Resource and Research Center Rat Resource and Research Center congenic Unknown RRID:RRRC_00904 strain haboring on a BDIX background a 22,3 MB BDIV Fragment called Mss1c which covers part of the Mss1 fragment. Homozygous rats of both sexes display resistence towards ENU-induced development of PNS tumors in terms of survival time and incidence. 150520185 SD-Ldlrem1Dlli mutant Unknown Ldlrem1Dlli 150520193 8 20824040 20846920 7 8 22804325 22827199 7 8 22750425 22773305 7 8 20270020 20292981 7 RRID:RGD_150520185 Zygotes of SD rats were microinjected with CRISPR/Cas9 system targeting Ldlr . This mutant possesses a 118-bp deletion from No.22759599bp to 22759716bp in the Ldlr gene (NC_005107.4), resulting in a termination codon TAG, and deletion of 768 amino acids of Ldlr. 150520186 SD-Apoeem1Dlli Shanghai Key Laboratory of Regulatory Biology East China Normal University, Shanghai, China mutant Unknown RRID:RGD_150520186 carried a 130 bp deletion from No.80613571bp to 80613700bp in Apoe gene (NC_005100.4), resulting in a termination codon TAA, and deletion of 231 amino acids of ApoE. 150520187 LE-Apoeem1DlliLdlrem1Ldlr mutant Unknown RRID:RGD_150520187 This Apoe/Ldlr double knock-out (DKO) was derived from cross-breeding of SD-Apoeem1Dlli (RGD:150520186) and SD-Ldlrem1Dlli (150520185). 150520189 SD-Apoeem1Ejt Purdue Center for Cancer Research, 201 South University Street, Purdue University, West Lafayette, Indiana, 47907, United States mutant Unknown Apoeem1Ejt 150520190 1 79003634 79006387 7 1 81878372 81882298 7 1 80612894 80616820 7 1 79353924 79357852 7 RRID:RGD_150520189 The mutant rat strain was produced by injecting TALEN system targeting the exon 4 of rat Apoe into Sprague Dawley (Hsd:SD) embryos. This mutant rat has a 16-bp deletion in the gene third coding exon) located on chromosome 1; frameshift mutation resulted (p.Glu178fs) 150520204 SHR/OlaIpcv-mtLEW/Ipcv Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic conplastic Unknown RRID:RGD_150520204 Mitochodrial genome of SHR/OlaIpcv was selectively replaced by LEW/Ipcv to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of LEW/Ipcv on SHR/OlaIpcv nuclear genetic background. 150520205 SHR-Gja8m1+/-Cub Department of Biology, Charles University in Prague, Prague, Czech Republic mutant Unknown Gja8m1Cub 12791992 2 218536831 218538447 7 2 199052374 199052374 8 2 184492360 184492360 8 RRID:RGD_150520205 This strain is derived from SHR/OlaIpcv where a spontaneous mutation was observed in the NH2-terminal cytosolic domain of Cx50, L7Q. The connexin50 mutation in heterozygous state affects significantly the lipid profile and the oxidative stress parameters in SHR rats. 150520206 SHR-Tg(EEF1A1-Folr1 )Ipcv Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown RRID:RGD_150520206 Generated by microinjecting SHR/OlaIpcv zygotes with wild type Folr1 cDNA from BN-Lx/Cub under control of EF-1α (human EEF1A1) universal promoter 150520207 F344-ROSA26em1(AttP)Davis/Rrrc Rat Resource and Research Center (RRRC) mutant Cryopreserved Sperm (as of 2021-11-05) Tool rat for creating other trasngenic rat models RRID:RRRC_00939 The CRISPR/Cas9 system was used to introduce 2 AttP landing sites in the ROSA26 locus of F344/NHsd rat embryos. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 150520208 ACI-Pvt1em1Shul Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison mutant Live Animals (as of 2021-11-05) RRID:RGD_150520208 Using CRISPR/Cas9, exon 1b of the Pvt1 gene was excised from the ACI/SegHsd genome in a 1165bp deletion. 150520209 ACI-Pvt1em1Shul/Rrrc Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. This strain is now maintained at Rat Resource and Research Center. mutant Unknown RRID:RGD_150520209 The ACI-Pvt1em1Shul was created using CRISPR/Cas9 by Shull laboratory at UW madison. The exon 1b of the Pvt1 gene was excised from the ACI/SegHsd genome in a 1165bp deletion. 150520210 ACI-Pvt1em2Shul Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison mutant Live Animals (as of 2021-11-05) RRID:RGD_150520210 Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3. 150520211 ACI-Pvt1em2Shul/Rrrc The strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. This strain is maintained at Rat Resource and Research Center. mutant Unknown (as of 2021-11-09) RRID:RGD_150520211 Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3. 150520212 ACI-Pvt1em3Shul Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison mutant Live Animals (as of 2021-11-05) RRID:RGD_150520212 using CRISPR/Cas9, exon 8 of the pvt1 gene was deleted from the ACI genome. Resulting in a total excision of 588bp. 150520213 ACI-Pvt1em3Shul/Rrrc The strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. This strain is maintained at Rat Resource and Research Center. mutant Live Animals (as of 2021-11-05) RRID:RGD_150520213 using CRISPR/Cas9, exon 8 of the pvt1 gene was deleted from the ACI genome. Resulting in a total excision of 588bp. 150520214 ACI-Pvt1em4Shul Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison mutant Live Animals (as of 2021-11-05) RRID:RGD_150520214 CRISPR/Cas9 was used to delete miR1208 in a 763bp excision in ACI rat embryos. 150520215 ACI-Pvt1em4Shul/Rrrc The strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. This strain is maintained at Rat Resource and Research Center. mutant Unknown RRID:RGD_150520215 CRISPR/Cas9 was used to delete miR1208 in a 763bp excision in ACI rat embryos. 150520216 ACI-Pvt1em5Shul Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison mutant Live Animals (as of 2021-11-05) RRID:RGD_150520216 Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos. 150520217 ACI-Pvt1em5Shul/Rrrc The strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. This strain is maintained at Rat Resource and Research Center. mutant Unknown RRID:RGD_150520217 Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos. 150520220 SD-Ccdc39em1Jgn Cincinnati Children's Hospital Medical Center, Cincinnati, OH mutant Unknown Ccdc39em1Jgn 150521525 2 120117112 120154958 7 2 139933049 139971476 7 2 120278605 120367829 7 2 116665651 116703354 7 RRID:RGD_150520220 The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene. 150520221 SD-Slco1b2em1Myliu Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences and School of Life Sciences, East China Normal University, Shanghai 200241, China mutant Unknown Slco1b2em1Myliu 150521524 4 179045586 179118680 7 4 240035313 240103015 7 4 175814118 175881775 7 4 174551463 174619988 7 RRID:RGD_150520221 The Sprague Dawley embryos were injected with CRISPR/Case9 system targeting the first exon of the rat Slco1b2 gene. A Slco1b2 knockout was created with 11-bp deletion. 150521538 SD-Uoxem1Cya Yunnan University of Traditional Chinese Medicine,and Kunming Medical University, Kunming, Yunnan, China. mutant Unknown Uoxem1Cya 150521540 2 244795552 244832143 7 2 270978811 271015097 7 2 252452282 252488497 7 2 235486867 235523053 7 RRID:RGD_150521538 The CRISPR/Cas9 system targeting exons 2 to 4 was injected into Sprague Dawley embryos. The resulting mutation was complete deletion of exons 2, 3 and 4. 150521556 SD-Trpm4em1Sage Laboratory of Biological Psychology, Brain and Cognition, Katholieke Universiteit Leuven (KUL), Tiensestraat 102, 3000 Leuven, Belgium mutant Unknown RRID:RGD_150521556 Trpm4 gene specific Zinc finger constructs directed against exons 18-19, which contain the coding sequence for TM3-5 and the pore region of the TRPM4 protein, were injected in zygotes from Sprague-Dawley rats. This mutant rat with a 514 bp deletion which includes completely removes exon 18 and a piece of exon 19 from the Trpm4 gene, plus the intron 18-19. The deletion was confirmed via genomic sequencing and western blotting. 150521559 LEW.SD-CD8am1Trg University of Texas Southwestern Medical Center, 5323 mutant Unknown RRID:RGD_150521559 Male SD rats were treated with the mutagen N-ethyl-N-nitrosourea (60 mg/kg intraperitoneally) at ages 9 and 10 weeks. A heterozygous mutant founder carrying a T to C transition that encoded a substitution of a proline residue (CCA) for a highly conserved serine residue (TCA) at amino acid position 94 was identified. This mutant male was mated to a LEW female and phenotyping by the expression of CD8a and CD8ab. 150521599 SD-Tshrem1Mlit Animal Center of Tongji University; Tongji University School of Medicine, Shanghai, 200065, China mutant Unknown Tshrem1Mlit 150521600 6 115024999 115162531 7 6 124509406 124561916 7 6 115170290 115306871 7 6 110341585 110475297 7 RRID:RGD_150521599 CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478). 150521602 OFA(SD)-Dsg4hr/Crl Iffa Credo (L'Arbresle Cedex, France; www.criver.com/ ico/iffa_reachus.html). mutant Unknown Dsg4hr 150521603 18 12173507 12209833 7 18 11853980 11888828 7 18 12056113 12092858 7 18 11720844 11757927 7 RRID:RGD_150521602 This Iffa Credo ( IC) hairless strain was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message. 150521604 WKY-Tnfrsf14em1Tja/Rrrc This strain was created by Tim Aitman at University of Edinburgh. Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2021-11-11) RRID:RRRC_00796 This strain was produced by injecting ZFNs targeted sequence into WKY/Cruk rat embryos. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. 150521605 W/Lnne Audiogenic Wistar rat Norberto Garcia-Cairasco at University of Sao Paulo inbred Unknown audiogenic seizures RRID:RGD_150521605 Wistar rats maintained at the animal facility of the Ribeirao Preto School of Medicine at the University of Sao Paulo, Brazil, were tested for audiogenic seizures, using as criteria an SI and the L1 (ref. RGD:14695082). The WAR colony foundation stock was produced by mating animals displaying at least procursive behaviors in three consecutive tests, one every 4 days (two males and four females). Each couple produced two or three lit-ters, from which selected individuals displaying the highest SI and shortest L1 were mated, at adult age,with their fathers and mothers. From the second generation on, brother and sister matings were done, in a ratio of one male to two females, selected accordingto the criteria above. 150521606 SD-Lrp5em2Vari/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Lrp5em2Vari 41404650 1 206102750 206206350 7 1 225689353 225793075 7 1 218816833 218920147 7 1 200814247 200917581 7 RRID:RRRC_00880 CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 150521608 SD-Lrp5em3Vari/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Lrp5em3Vari 41404652 1 206102750 206206350 7 1 225689353 225793075 7 1 218816833 218920147 7 1 200814247 200917581 7 RRID:RRRC_00881 CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. 150521610 SD-Lrp5em1Vari/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Lrp5em1Vari 41404647 1 206102750 206206350 7 1 225689353 225793075 7 1 218816833 218920147 7 1 200814247 200917581 7 RRID:RRRC_00867 CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 150521611 BDIX.BDIV-D6Mit8-D6Rat229/ZteRrrc Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany Rat Resource and Research Center congenic Unknown RRID:RRRC_00899 The BDIX.BDIV-D6Mit8-D6Rat229/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 150521612 BDIX.BDIV-Mss1b/ZteRrrc Rat Resource and Research Center Rat Resource and Research Center congenic Unknown RRID:RRRC_00905 strain haboring on a BDIX background two BDIV Fragments generated by a double recombination, 37,3 and 20,0 Mb long,Mss1b1 and Mss1b2 both covering parts of the Mss1 fragment. Homozygous rats of both sexes display susceptibility towards ENU-induced development of PNS tumors in terms of survival time and incidence. Through the Mss1b1 and Mss1b2 fragments and the Mss1c fragment the Mss1 locus was fine-mapped between 82.9 and 85.2Mb 150521613 BDIX.BDIV-D6Mit1-D6Mgh2/ZteRrrc Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany. Rat Resource and Research Center congenic Unknown RRID:RRRC_00901 The BDIX.BDIV-D6Mit1-D6Mgh2/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 150521614 BDIX.BDIV-D10Got1-D10Rat45/ZteRrrc Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany Rat Resource and Research Center congenic Unknown RRID:RRRC_00902 The BDIX.BDIV-D10Got1-D10Rat45/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 150521616 BDIX.BDIV-D10Mit3-D10Mgh16/ZteRrrc Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany Rat Resource and Research Center congenic Live Animals (as of 2021-11-12) RRID:RRRC_00903 The BDIX.BDIV-D10Mit3-D10Mgh16/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. 150521617 BDIX/IfzRrrc Duisburg-Essen University Medical School, Essen, Germany Rat Resource and Research Center inbred Unknown RRID:RRRC_00900 BDIX/IFZ rats have been inbred in the Institute of Cell Biology, Essen and later in the Central Animal Facility,Essen for about 45 years. The BDIX/Ifz rats are extremely susceptible to ENU-induced development of tumors of the peripheral and central nervous system. 150521619 BDIV/lfzRrrc Rat Resource and Research Center Rat Resource and Research Center inbred Unknown RRID:RRRC_00898 Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971). BDIV/IFZ rats have been inbred in the Institute of Cell Biology, Essen and later in the Central Animal Facility for about 45 years. BDIX/Ifz rats are extremely resistant to ENU-induced development of tumors of the peripheral nervous System. 150521659 FHH-Chr 1BN-Dusp5em1Mcwi/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-11-15) RRID:RGD_150521659 This strain was produced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC-CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449 and 464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid 121. 150521660 LE-Tg(DIO-mCherry)2Ottc A Rrrc substrain available at Rat Resource and Research Center A Rrrc substrain available at Rat Resource and Research Center transgenic Unknown RRID:RGD_150521660 The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter. 150521661 SD-Tg(DIO-mCherry)2OttcRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00928 The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter. Expresses mCherry in cells of the brain transduced with a Cre-expression virus. Currently in SD background generated by backcrossing to LE-Tg(DIO-mCherry)2Ottc 150521675 BN/NHsdShul Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison inbred Live Animals (as of 2021-11-16) RRID:RGD_150521675 Inbred substrain derived from BN/SsNHsd(RGD:10008) 150521676 ACI/SegHsdShul Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison inbred Live Animals (as of 2021-11-16) RRID:RGD_150521676 Inbred substrain of ACI of ACI derived from ACI/SegHsd 150521677 BN/HsdShulRrrc This substrain is transferred from Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison to Rat Reource & Research Center in 2021. inbred Unknown RRID:RGD_150521677 Inbred substrain derived from BN/SsNHsd(RGD:10008) 150521708 SD-Tbc1d1Tn(sb)1Fkh University of Texas Southwestern Medical Center, Dallas TX mutant Unknown Tbc1d1Tn(sb)1Fkh 150521709 14 46594874 46781813 7 14 45404208 45603325 7 14 45598753 45797650 7 14 43936820 44135133 7 RRID:RGD_150521708 The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley. 150523755 SD-Ighmem1Ang Platform Rat Transgenesis IBiSA-CNRS, Nantes, France. mutant Unknown Ighmem1Ang 150523756 RRID:RGD_150523755 The mutation in this rat strain (line 19) comprised a 64 bp deletion of the IgM CH1 domain and generation of a stop codon. This strain carries deletion in both alleles has truncated Cmu. 150523757 SD-Ighmem2Ang Platform Rat Transgenesis IBiSA-CNRS, Nantes, France. mutant Unknown Ighmem2Ang 150523758 RRID:RGD_150523757 Microinjection of Sprague-Dawley rat zygotes with ZFN mRNA specific for the JH locus resulted in the generation of a mutant animal with a 2465 bp DNA deletion, spanning the entire locus 150523775 LEW-Tg(HLA-B*2705,B2M)Tg/021-3Reh Rrrc Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2022-03-10) RRID:RRRC_00916 This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene. 150523778 LEW-Tg(B2M)283-2RehRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2022-03-10) RRID:RRRC_00917 This strain carries 35 copies of genomic human B2-microglobulin gene. When crossed with the 21-3 line (RRRC:00 916), the F1 males develop a spontaneous disease mimicking human spondyloarthritis. 150523780 LEW-Erap1em1Reh2786/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-11-19) RRID:RRRC_00918 The ZFN mRNA targeting exon 2 of Erap1 was microinjected into both the pronuclei and the cytoplasm of fertilized LEW eggs. This strain was heterozygous for a 2-bp deletion within the targeted AGGAGA sequence of Erap1. 150523781 LEW-Erap1em1Reh2786 University of Texas Southwestern Medical Center mutant Unknown RRID:RGD_150523781 The ZFN mRNA targeting exon 2 of Erap1 was microinjected into both the pronuclei and the cytoplasm of fertilized LEW eggs. This strain was heterozygous for a 2-bp deletion within the targeted AGGAGA sequence of Erap1. 150524338 SD-Tg(ERAP1*)2793RehRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-11-29) RRID:RRRC_00919 This transgenic rat carrying the human " II or *002" allele of ERAP1 under mouse H-2K promoter control. The construct was made by Dr. Edd James, University of Southampton, UK. The II allele is generally considered to be a risk allele for ankylosing spondylitisThe original background strain is SD and the current background strain is mixed Lewis x SD. 150526804 AZK/Misiv Azman Kamal rats Forest Research Institute Malaysia inbred Live Animals (as of 2021-12-01) Wound healing RRID:RGD_150526804 The rat was derived from inbreeding of Sprague Dawley rats for 3 years. Because of longer inbreeding process we got SD progenies without fur. So, this rat is used for wound healing study in our facility. 150526809 SD-Artfm/Rrrc Donated by Cynthia Jordan from Michigan State University Rat Resource and Research Center mutant Unknown RRID:RRRC_00940 This spontaneous mutant strain was originally derived from King Holtzman background and now maintained in Sprague Dawley background. A single nucleotide mutation was identified in the androgen receptor gene. The tfm males are sterile so the mutation is carried via females who breed normally. 150527860 BDIX/OrlIco BDIX Rats Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_150527860 Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans (Orl) acquired by IFFA CREDO later (Ico). 150573816 SD-Nkx3-1em1Pjhak+/- Department of Laboratory Animal Medicine College of Veterinary Medicine Seoul National University mutant Unknown Nkx3-1em1Pjhak 150573819 15 49743313 49745905 7 15 54796102 54798694 7 15 51065316 51067908 7 15 44473851 44476443 7 RRID:RGD_150573816 A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein. 150573818 SD-Nkx3-1em1Pjhak-/- Department of Laboratory Animal Medicine College of Veterinary Medicine Seoul National University mutant Unknown Nkx3-1em1Pjhak 150573819 15 49743313 49745905 7 15 54796102 54798694 7 15 51065316 51067908 7 15 44473851 44476443 7 RRID:RGD_150573818 A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein. 151347605 SD-Ddah1em1Ywxu Cardiovascular Department, Shanghai Tenth People's Hospital, Tongji University, School of Medicine, Shanghai, China mutant Unknown Ddah1em1Ywxu 151347606 2 243932221 244069832 7 2 270160842 270289319 7 2 251634368 251766009 7 2 234667499 234800322 7 RRID:RGD_151347605 CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3'). 151347873 Slc:ZUC-Leprfa+ Zucker lean rats Japan SLC, Inc. (Hamamatsu, Japan) outbred Unknown Lepr 3001 RRID:RGD_151347873 The Zucker lean rats were siblings of Zucker fatty rats. They were used as lean controls for Zucker fatty rats studies. This strain was available at Japan SLC, Inc. (Hamamatsu, Japan.) 151356741 SD-Tg(Alb-TAg)Mlcr McArdle Laboratory for Cancer Research, Medical School, University of Wisconsin, Madison, Wisconsin 53706-1599, USA. transgenic Unknown RRID:RGD_151356741 This transgenic strain was generated by microinjection into outbred Sprague-Dawley from Harlan Sprague-Dawley (Hsd:SD) fertilized eggs and carries simian virus T Antigen drived by the enhancer/promoter region of the mouse albumin gene. 151356945 LE-ROSA26em1(EF1a-TetR, Fos-iCre)/Bhope NIDA IRP (Hope lab). mutant Unknown RRID:RGD_151356945 Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EF1a promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab). 151356946 LE-ROSA26em1(EEF1A1-TetR, Fos-iCre)/BhopeRrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00953 Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EEF1A1 promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab). 151356950 WI-Tg(Fos-LacZ)BhopeRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00952 The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Initial SD rats were then bred onto Wistar background for >10 generations at NIDA IRP (Bruce Hope lab) 151356957 Sah:SD North Terrace Adelaide SA 5000 Australia outbred Unknown RRID:RGD_151356957 Sprague-Dawley maintained at South Australian Health and Medical Research Institute 151356958 SD-Cftrem1Apb Organization: Australian Phenomics Facility, Australian National University mutant Unknown Cftrem1Apb 151660342 4 43874852 44041870 7 4 42281040 42448571 7 4 42693263 42860679 7 4 46561269 46728759 7 RRID:RGD_151356958 The CRISPR/Cas9 system was used to target exon 11 to create a deletion at codon F508 which was injected into Sprague-Dawley one-cell embryos (C076 line). One rat had an allele that contained the desired homology-directed repair edited TTT deletion and was designated the Phe508del founder (c.1522_1524delTTT). 151356959 SD-Cftrem2Apb Organization: Australian Phenomics Facility, Australian National University mutant Unknown Cftrem2Apb 151660343 4 43874852 44041870 7 4 42281040 42448571 7 4 42693263 42860679 7 4 46561269 46728759 7 RRID:RGD_151356959 The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell embryos (C076 line). A rat with an 8-bp deletion upstream of the TTT site (c.1514_1521delATATCATC) was used to establish the KO strain. 151356971 RjOrl:LE Janvier Janvier outbred Live Animals; Cryopreserved Embryo (as of 2022-02-21) RRID:RGD_151356971 This model was developed by Dr Long and Dr Evans in 1915. The LONG EVANS rat is the result of a cross between a female albino from the WISTAR Institute and a wild male (Rattus norvegicus) captured near Berkeley and offspring selection. The LONG EVANS rat is small and resistant to oncogenesis. This strain is widely used in behavioral, learning, ageing (visual acuity less affected than that of albino strains), addiction - especially to alcohol - studies. 151356985 LE-Tg(cFos-eGFP)Bhope NIDA IRP (Hope lab) transgenic Unknown RRID:RGD_151356985 This LE transgenic rats were created by injecting the cfos-eGFP construct to pronuclei of fertilized eggs obtained from Long Evans females. The 5 prime end of the transgenic DNA construct contained mouse genomic cFos (indluding the promoter and all exon and intron sequences) was fused with eGFP (including poly(A) tail derived from the IRES (phosphorylated-internal ribosomal entry site) of the EGFP Clontech (Cambridge, UK) vector. A single founder animal was identified. All subsequent breeding used hemizygous cfos-GFP male rats paired with wild-type Long Evans female rats obtained from Charles River Laboratories. Rats were bred on Long-Evans background for 13 generations at NIDA IRP (Hope lab). 151356988 LE-Tg(cFos-eGFP)BhopeRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown RRID:RRRC_00954 This transgenic was created by Dr. Bruce Hope at at NIDA IRP and donated to RRRC in 2022. The transgenic rats were created by injecting the cfos-eGFP construct to pronuclei of fertilized eggs obtained from Long Evans females. The 5 prime end of the transgenic DNA construct contained mouse genomic cFos (indluding the promoter and all exon and intron sequences) was fused with eGFP (including poly(A) tail derived from the IRES (phosphorylated-internal ribosomal entry site) of the EGFP Clontech (Cambridge, UK) vector. A single founder animal was identified. All subsequent breeding used hemizygous cfos-GFP male rats paired with wild-type Long Evans female rats obtained from Charles River Laboratories. Rats were bred on Long-Evans background for 13 generations 151664748 SD-Slc9a6 em1Moro Organization: Dr. Eric Morrow at Brown University 70 Ship Street, Box G-E4 Providence RI 02912 USA mutant Unknown Slc9a6 em1Moro 151664749 X 141146237 141201234 7 X 153620082 153675717 7 X 158979081 159045019 7 X 134443830 134443831 8 RRID:RRRC_01017 CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon. 151665324 SS-Ucp2em1Mcwi Medical College of Wisconsin contact MCW Rat Distribution at mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2022-03-18) RRID:RGD_151665324 Generated by CRISPR/Cas9 mutagenesis of SS/JrHsdMcwi rats by Aron Geurts. The resulting mutation is a 23-bp deletion (rn7: chr1:154,842,967-154,842,989) 151665772 WI-Tfap2cem1(tdTomato)Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan. mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2022-04-01) RRID:RGD_151665772 The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells. 151667414 LE-Ckmtm1(cre)/Rrrc Rat Resource and Research Center mutant Unknown RRID:RGD_151667414 This model expresses cre-recombinase under the control of the endogenous Ckm (creatine kinase, M-type) promoter. Cre was targeted to the rat Ckm gene of LE embryos through CRISP/Cas9 system genome editing system. 151893484 SS-Tg(CAG-Fh)A1Mcwi Medical College of Wisconsin contact MCW Rat Distribution at mcwcustomrats@mcw.edu transgenic Live Animals; Cryopreserved Sperm (as of 2022-04-21) RRID:RGD_151893484 This is a transgenic model created using Sleeping Beauty system. The transgenic animals are overexpressing fumarate hydratase (Fh) under the control of the ubiquitous CAG promoter in the Dahl salt-sensitive strain background. 152975964 SS-F8em2Mcwi Blood Research Institute 8733 W Watertown Plank Road Milwaukee, WI 53226 Contact MCW Rat Distribution at mcwcustomrats@mcw.edu mutant Unknown RRID:RGD_152975964 Full gene inversion of the rat F8 gene introduced by CRISPR/Cas9, to DahlSS background rats. This inversion causes a premature stop codon 3 amino acids into the protein. F8 activity in rats, homozygous for the mutation, is undetectable. 152975965 SS-F8em2Mcwi-Tg(ITGA2B-F8*)Mcwi Blood Research Institute 8733 W Watertown Plank Road Milwaukee, WI 53226 contact MCW Rat Distribution at mcwcustomrats@mcw.edu transgenic Unknown RRID:RGD_152975965 This transgenic was produced by crossing the SS transgenic rat carrying Lentivirus constructs containing the 2bF8 vector [B-domain deleted human FVIII under control of ITGA2B (IIb) promoter] with an F8 knockout rat SS-F8em2Mcwi (RGD:152975964). This transgenic rat strain expressed B-domain deleted human F8 under the control of ITGA2B promoter in the absence of rat F8 product. 152977766 LE-Tg(Drd2-IL2RA/YFP*)1Koba National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2022-07-06) RRID:RGD_152977766 Background strain: Iar:LE (Institute for Animal Reproduction) ( RGD:18337282). This strain was generated by injecting a modified BAC, in which a fusion protein created from the human IL2R alpha-subunit gene (IL2RA) and YFP* (enhanced yellow fluorescent protein,Venus) was inserted into the second exon of the rat Drd2 gene, into fertilized eggs of Long-Evans rats. 152977768 WIC-Tg(Oprk1-YFP*)1Utthe National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Unknown RRID:RGD_152977768 The KOR-Venus construct consisting of promoter of rat Oprk1 (opioid receptor, kappa 1) fused with Venus fluorescent protein, was introduced into fertilized eggs of Wistar rats (Crlj:WI, Charles River Japan). They were then crossed with Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction) to maintain the strain. Transgenic rats expressing the fluorescent protein Venus under the control of the Oprk1 promoter. This strain is heterozygous. 152985526 WIC-Cdkn2aem1Kyhs National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown RRID:RGD_152985526 A 7-bp deletion in exon 1 of the Cdkn2a (p16) gene was introduced by the CRISPR/Cas9. Genetic background is Iar:Wistar-Imamichi (Institute for Animal Reproduction) (RGD:125097496). Introducing the deletion mutation in the Cdkn2a (p16) gene into the background of DMD rats (muscular dystrophy model rats) improves muscle pathology. 152995284 W/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown RRID:RGD_152995284 Substrain of Wistar, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) 152999000 LE-Fxn em2Fara-/+ This strain has been deposited with RRRC mutant Unknown Fxn em2Fara 152999006 1 227647092 227671081 7 1 249400435 249426597 7 1 242123975 242152834 7 1 221874007 221897543 7 RRID:RGD_152999000 Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system 152999001 LE-Fxn em1Fara-/+ This strain has been deposited with RRRC. mutant Unknown Fxn em1Fara 152999004 1 227647092 227671081 7 1 249400435 249426597 7 1 242123975 242152834 7 1 221874007 221897543 7 RRID:RGD_152999001 Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 152999002 LE-Fxn em2Fara-/+/Rrrc Rat Resource and Research Center mutant Unknown Fxn em2Fara 152999006 1 227647092 227671081 7 1 249400435 249426597 7 1 242123975 242152834 7 1 221874007 221897543 7 RRID:RRRC_00961 Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system 152999003 LE-Fxn em1Fara-/+/Rrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Fxn em1Fara 152999004 1 227647092 227671081 7 1 249400435 249426597 7 1 242123975 242152834 7 1 221874007 221897543 7 RRID:RRRC_00960 Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 152999023 SD-Aif1tm(EGFP)Apps/Mmmc Department of Pharmacology, University of Maryland School of Medicine, Baltimore, Maryland 21201 Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-05-21) Study of effects of disease, injury, and aging on microglia Aif1tm(EGFP)Apps 152999024 20 3714428 3716327 7 20 7234609 7240454 7 20 5161350 5167176 7 20 3646784 3652670 7 RRID:RRRC_00965 Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used. 153298963 Taiep/JosvRrrc Rat Resource and Research Center Rat Resource and Research Center mutant Unknown RRID:RRRC_00963 These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 and donated by John Svaren to RRRC now are maintained at RRRC 153323320 MR/NRrrc Maudsely reactive Rat Resource and Research Center, RGD HRDP, contact HRDP Rat Resource and Research Center, RGD HRDP, contact HRDP inbred Live Animals; Cryopreserved Embryo; Cryorecovery (as of 2023-10-25) RRID:RRRC_00173 Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). Now is available at Rat Resource & Research Center 153323324 FXLE12/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) Diabetes Obesity; Cancer RRID:RGD_153323324 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. This substrain was maintained at Medical College of Wisconsin 153344518 FXLE15/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_153344518 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. This substrain was maintained at Medical College of Wisconsin 153344519 LEXF1C/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) Diabetes Obesity; Cancer RRID:RGD_153344519 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 153344520 LEXF6B/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) Diabetes Obesity; Cancer RRID:RGD_153344520 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin. 155260360 COP/HsdUwmRrrc Copenhagen Rat Resource and Research Center, RGD HRDP, contact HRDP Rat Resource and Research Center, RGD HRDP, contact HRDP inbred Live Animals; Cryopreserved Embryo (as of 2023-10-25) RRID:RRRC_00966 Donated from Michael Gould/Jim Shull at University of Wisconsin Madison to Rat Resource & Research Center, 155260361 SD-Tg(Sycp1-Cas9-eGFP)SynblRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2022-10-06) Genetics, Reproductive Biology, Gene Conversion, Active Genetics RRID:RRRC_00968 This project entailed generation of a novel rat strain in which a P2A-Cas9-T2A-EGFP coding sequence was inserted at the stop codon of the rat Sycp1 gene for co-expression of Cas9 and EGFP under the control of the Sycp1 regulatory elements. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 155260362 SD-Tg(Ddx4-Cas9)SynblRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Unknown Genetics, Reproductive Biology, Gene Conversion, Active Genetics RRID:RRRC_00969 rat strain designed to express Cas9 under the control of the rat Ddx4 (Vasa) regulatory elements while also retaining expression of Ddx4. The strategy entailed insertion of a P2A sequence followed by human-codon-optimized Cas9 coding sequences with nuclear localization signals near the C-terminus of the rat Ddx4 (Vasa) gene. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951 155260363 SD-Tg(Cyp2e1-CYP2E1*-Cas9)SynblRrrc RRRC transgenic Cryopreserved Sperm (as of 2022-10-06) Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450 RRID:RGD_155260363 rat strain in which the rat Cyp2e1 gene is humanized by insertion of a human CYP2E1 minigene (CYP2E1*) insert at the native start codon. The insert also included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance of the modified allele when crossed to a rat expressing Cas9 in the germline. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951 URL: URL: Doi:10.1101/2022.08.30.505951 155260364 SD-Tg(Cyp3a23-3a1-Cyp3A4*-Cas9)SynblRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2022-10-06) Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450 RRID:RRRC_00970 rat strain in which the rat Cyp3a1 gene (Cyp3a23-3a1, RGD:628626) was inactivated by insertion of a human CYP3A4 minigene (Cyp3A4*) and the linked rat Cyp3a2 locus was simultaneously mutated by CRISPR-mediated indel introduction. Strain contains Indel 8 at the Rat 3A2 locus (55 kb away), The CYP3A4 minigene included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance. Strain contains and Active Genetic cassette which encodes a gRNA targeting the Rat 3A1 and 3A2 translation initiation site. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951 URL: URL: Doi:10.1101/2022.08.30.505951 155260365 SD-Tg(Sycp1-Cas9-eGFP)Synbl Created by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USA Donated to Rat Resource & Research Center transgenic Cryopreserved Sperm (as of 2022-10-06) Genetics, Reproductive Biology, Gene Conversion, Active Genetics RRID:RGD_155260365 This project entailed generation of a novel rat strain in which a P2A-Cas9-T2A-EGFP coding sequence was inserted at the stop codon of the rat Sycp1 gene for co-expression of Cas9 and EGFP under the control of the Sycp1 regulatory elements. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 155260366 SD-Tg(Ddx4-Cas9)Synbl Created by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USA Donated to Rat Resource & Research Center transgenic Unknown Genetics, Reproductive Biology, Gene Conversion, Active Genetics RRID:RGD_155260366 rat strain designed to express Cas9 under the control of the rat Ddx4 (Vasa) regulatory elements while also retaining expression of Ddx4. The strategy entailed insertion of a P2A sequence followed by human-codon-optimized Cas9 coding sequences with nuclear localization signals near the C-terminus of the rat Ddx4 (Vasa) gene. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951 155260367 SD-Tg(Cyp2e1-CYP2E1*-Cas9)Synbl Created by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USA Donated to Rat Resource & Research Center transgenic Cryopreserved Sperm (as of 2022-10-06) Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450 RRID:RGD_155260367 rat strain in which the rat Cyp2e1 gene is humanized by insertion of a human CYP2E1 minigene (CYP2E1*) insert at the native start codon. The insert also included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance of the modified allele when crossed to a rat expressing Cas9 in the germline. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951 URL: URL: Doi:10.1101/2022.08.30.505951 155260368 SD-Tg(Cyp3a23-3a1-Cyp3A4*-Cas9)Synb Created by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USA Donated to Rat Resource & Research Center transgenic Cryopreserved Sperm (as of 2022-10-06) Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450 RRID:RGD_155260368 rat strain in which the rat Cyp3a1 gene (Cyp3a23-3a1, RGD:628626) was inactivated by insertion of a human CYP3A4 minigene (Cyp3A4*) and the linked rat Cyp3a2 locus was simultaneously mutated by CRISPR-mediated indel introduction. Strain contains Indel 8 at the Rat 3A2 locus (55 kb away), The CYP3A4 minigene included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance. Strain contains and Active Genetic cassette which encodes a gRNA targeting the Rat 3A1 and 3A2 translation initiation site. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951 URL: URL: Doi:10.1101/2022.08.30.505951 155269039 WI;WDB-ROSA26tm1(H2B-tdTomato)/Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Cryopreserved Embryo (as of 2022-10-11) RRID:RGD_155269039 PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 155269040 F344-Tg(CAG-ACE2)057Bryd Deposited at Rat Resource and Research Center transgenic Live Animals (as of 2022-10-11) RRID:RRRC_00946 The human ACE2 gene was placed under control of the synthetic CAG promoter which allows ubiquitous expression of the gene. Based on droplet digital PCR analysis, the strain carries only 1 copy of the transgene. The integration site is unknown. These rats express the human ACE2 gene. The encoded protein is a functional receptor for the spike glycoprotein of several human coronaviruses including SARS-CoV-2, the causative agent of coronavirus disease-2019 (COVID-19). 155269102 McwiWfsmAap:HS Heterogeneous stock Dr. Abraham Palmer laboratory at UCSD outbred Unknown RRID:RGD_155269102 This HS is maintained and distributed from Dr. Palmer's laboratory at UCSD. The origin of HS was from 25 breeding pairs obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy. The Wake Forest HS rats were derived from NMcwi:HS at the Medical College of Wisconsin and maintained at Wake Forest Baptist Medical Center starting in 2017. The colony from Wake Forest was sent to Dr. Palmer's laboratory at University of California San Diego Department of Psychiatry. 155598601 SD-Bmal1em1Mcwi MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Bmal1em1Mcwi 155598603 1 171062181 171162426 7 1 185007527 185105413 7 1 178039002 178137469 7 1 167331756 167430235 7 RRID:RGD_155598601 CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein. 155630631 CD-Ctnsem2Vjupk Vernon Jansen Unit, Faculty of Medical and Health Sciences, The University of Auckland, Auckland, New Zealand mutant Unknown Ctnsem2Vjupk 155630632 10 60060254 60075352 7 10 59488895 59503993 7 10 59749250 59772475 7 10 57801551 57817213 7 RRID:RGD_155630631 The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 2-bp insertion which results in frameshift and pre-mature stop truncated protein. 155630633 CD-Ctnsem3Vjupk Vernon Jansen Unit, Faculty of Medical and Health Sciences, The University of Auckland, Auckland, New Zealand mutant Unknown Ctnsem3Vjupk 155630634 10 60060254 60075352 7 10 59488895 59503993 7 10 59749250 59772475 7 10 57801551 57817213 7 RRID:RGD_155630633 The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 8-bp insertion which results in frameshift and pre-mature stop truncated protein. 155630635 CD-Ctnsem4Vjupk Vernon Jansen Unit, Faculty of Medical and Health Sciences, The University of Auckland, Auckland, New Zealand mutant Unknown Ctnsem4Vjupk 155630636 10 60060254 60075352 7 10 59488895 59503993 7 10 59749250 59772475 7 10 57801551 57817213 7 RRID:RGD_155630635 The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein. 155631259 Taiep Departamento de Ciencias Fisiologicas, Universidad Autonoma de Puebla, Mexico. mutant Unknown RRID:RGD_155631259 These mutants were found in Sprague-Dawley rats at University of Puebla in 1989. A spontaneous neurological mutation was detected in a colony of Sprague Dawley rats. The animals developed a progressive neurological syndrome characterized by tremor (which appeared at the age of 1 month), ataxia (at 4 months), immobility episodes (after 5-6 months), audiogenic seizures and hindlimb paralysis (after 10 months). Cross breeding experiments indicate that this is an autosomal recessive mutation, The rat line was named taiep (tremor, ataxia, tonic immobility episodes, epilepsy and paralysis) rats. 155631261 SD-Brca1em1Kyo Kyoto University Institute of Laboratory Animals Graduate School of Medicine Yoshida Konoe-cho, Skyo-ku, Kyoto 606-8501 JAPAN mutant Unknown Brca1em1Kyo 155631262 10 90513630 90572676 7 10 89192653 89252760 7 10 89394821 89455093 7 10 86417441 86477762 7 RRID:RGD_155631261 CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9 targeting exon 4 of rat Brca1was injected to fertilized eggs of Jcl:SD rats (Clea Japan). The founder animal carried c.188T>A (p.L63X) was mated to closed-colony Jcl:SD rats. 155631278 SD-Flnaem1Ang The Transgenic Rats and ImmunoPhenomic (TRIP) facility in Nantes (France). mutant Unknown Flnaem1Ang 155631280 X 160362334 160385626 7 1 152200936 152227391 7 X 156460785 156487245 7 X 152007758 152034266 7 RRID:RGD_155631278 This mutant strain was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene. 155631285 SD-Tg(MECP2 )Chnsr transgenic Unknown RRID:RGD_155631285 PAC671D9 (AF031078) DNA containing all the exons of human MECP2 was injected to SD embryos to generate MECP2 duplication rat. 155631289 SD-Pde6bem1Cgen Cyagen Biosciences Inc, Santa Clara, CA, USA mutant Unknown Pde6bem1Cgen 155631290 14 1871037 1914170 7 14 2327104 2370811 7 14 2328690 2371913 7 14 1323310 1366450 7 RRID:RGD_155631289 This mutant strain was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. Pde6b knock out rat was successfully created. 155631293 SD-Pde3aem1Bdr Max-Delbr'ck-Center for Molecular Medicine (MDC) in the Helmholtz Association, Berlin, Germany mutant Unknown Pde3aem1Bdr 155631294 4 178658896 178930417 7 4 239659270 239921900 7 4 175431904 175703844 7 4 174172804 174443944 7 RRID:RGD_155631293 The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446). 155631295 SD-Pde3aem2Bdr Max-Delbr'ck-Center for Molecular Medicine (MDC) in the Helmholtz Association, Berlin, Germany mutant Unknown Pde3aem2Bdr 155631296 4 178658896 178930417 7 4 239659270 239921900 7 4 175431904 175703844 7 4 174172804 174443944 7 RRID:RGD_155631295 The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein (functional DEL). 155631298 SD-Pde3aem3Bdr Max-Delbr'ck-Center for Molecular Medicine (MDC) in the Helmholtz Association, Berlin, Germany mutant Unknown Pde3aem3Bdr 155631299 4 178658896 178930417 7 4 239659270 239921900 7 4 175431904 175703844 7 4 174172804 174443944 7 RRID:RGD_155631298 The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGD missense mutation and results in R862C substitutions in the protein 155641233 SD-Tg(Rho*P23H)1Lav Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown RRID:RGD_155641233 This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). 155641235 WMI/Eer WKY most immobile Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois Rat Resource and Research Center inbred Unknown RRID:RRRC_00973 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. 155641237 WLI/Eer WKY least immobile Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois Rat Resource and Research Center inbred Unknown RRID:RRRC_00967 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. 155641239 SS.SR-(rs65785750-rs13452155)/OpazRrrc Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm; Cryorecovery (as of 2022-11-03) RRID:RRRC_00612 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains 155641240 SS.SR-(rs65785750-rs106808193)/OpazRrrc Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2022-11-03) 5 105452223 140120264 1 - by flanking markers 5 101612333 134724733 1 - by flanking markers RRID:RRRC_00613 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains 155641241 SS.SR-(rs105019230-D17Rat44)/OpazRrrc Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center. congenic Cryopreserved Sperm (as of 2022-11-03) 17 81612361 81612488 1 - by flanking markers 17 75653544 75653670 1 - by flanking markers 17 57343133 73981731 1 - by flanking markers 17 54542464 70156904 1 - by flanking markers RRID:RRRC_00616 Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. 155641245 SD-Tg(Oprm1-icre)1Ottc This rat was produced by Optogenetics and Transgenic Technology Core. Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-13) RRID:RRRC_00975 Targeted knock-in adding a T2A-iCre to the Oprm1 (mu opioid receptor) in this cre recombinase reporter SD rat 155641246 F344-Tg(Cx3cr1-cre/ERT2)3OttcRrrc Rat Resource and Research Center transgenic Unknown RRID:RGD_155641246 The transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. 155641247 F344.LE-ROSA26 em1(LTR-nLuc)Ottc/Rrrc now deposited at Rat Resource and Research Center mutant Unknown RRID:RRRC_00926 The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 155641248 SD-ROSA26em1(LTR-nLuc)Ottc/Rrrc This strain was created by Optogenetics and Transgenic Technology Core. Rat Resource and Research Center mutant Unknown RRID:RRRC_00925 The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 155641251 F344-Tg(CAG-ACE2)057BrydRrrc Rat Resource and Research Center Rat Resource and Research Center transgenic Live Animals (as of 2022-11-04) RRID:RRRC_00946 The human ACE2 gene was placed under control of the synthetic CAG promoter which allows ubiquitous expression of the gene. Based on droplet digital PCR analysis, the strain carries only 1 copy of the transgene. The integration site is unknown. These rats express the human ACE2 gene. The encoded protein is a functional receptor for the spike glycoprotein of several human coronaviruses including SARS-CoV-2, the causative agent of coronavirus disease-2019 (COVID-19). 155663364 SD-Del(Yp)1Mcwi Medical College of Wisconsin mutant Live Animals (as of 2022-11-11) RRID:RGD_155663364 CRISPR guide RNAs flanking Sry4a and Sry1 (Sry) on the Y-chromosome were injected into Crl:SD strain embryos. Chromosomal deletions have not been explicitly defined. 155663365 CD-Tg(RNECO-180E22)208Arno Art Arnold laboratory, University of California Los Angeles transgenic Unknown RRID:RGD_155663365 This transgenic model line 208 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. 155663366 CD-Tg(RNECO-180E22)424Arno Art Arnold laboratory, University of California Los Angeles transgenic Unknown RRID:RGD_155663366 This transgenic model line 424 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. 155663367 CD-Tg(RNECO-180E22)733Arno Art Arnold laboratory, University of California Los Angeles transgenic Unknown RRID:RGD_155663367 This transgenic model line 733 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. 155663368 CD-Tg(RNECO-180E22)737Arno Art Arnold laboratory, University of California Los Angeles transgenic Unknown RRID:RGD_155663368 This transgenic model line 737 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y. 155663559 SD-Gcgtm1(iCre)Lrina This strain was created by Dr. Linda Rinaman PhD at Florida State University Strain has been deposited to RRRC(RRRC:00983, RGD:155663560) mutant Live Animals (as of 2022-11-28) Neuroscience, diabetes, metabolic syndrome, obesity, anxiety RRID:RGD_155663559 CRISPR/Cas9 technology was used to insert an IRES for iCre expression after the final coding sequence of exon 6 of the rat Gcg gene, before the 3' UTR. 155663560 SD-Gcgtm1(iCre)Lrina/Rrrc This strain was created by Dr. Linda Rinaman PhD at Florida State University, and now deposited at Rat Resource and Research Center Rat Resource and Research Center mutant Unknown Neuroscience, diabetes, metabolic syndrome, obesity, anxiety RRID:RRRC_00983 CRISPR/Cas9 technology was used to insert an IRES for iCre expression after the final coding sequence of exon 6 of the rat Gcg gene, before the 3' UTR. 155663675 LE-Tg(ChAT-cre)5.1Deis Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm (as of 2022-12-05) RRID:RGD_155663675 Cre gene was introduced immediately before the ATG of the mouse choline acetyltransferase (Chat) gene in BAC RP23-246B12. This strain is estimated to carry 6 copies of the transgene at the integration site. 155782877 SHRSP/NgskMeltw Department of Life Sciences in Molecular Embryological & DNA Methylation Lab at National Chung Hsing University, Taiwan inbred Live Animals (as of 2022-12-07) Chronic kidney disease; Hypertension; Proteinuria; Stroke RRID:RGD_155782877 Imported from Kyoto University in 2010, now maintained at Molecular Embryological & DNA Methylation Lab at National Chung Hsing University, Taiwan. 155782879 SS-Chr3BN.SS-(D3Rat26-D3Mgh30)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 90573349 153262477 1 - by flanking markers 3 101798743 164637442 1 - by flanking markers 3 95176716 158417703 1 - by flanking markers 3 91609794 151080115 1 - by flanking markers RRID:RGD_155782879 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782880 SS-Chr 3BN.SS-(D3Arb3-D3Rat93)( D3Rat78-D3Rat1)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3;3 7547341;146830639 75411665;170016653 1 - by flanking markers;1 - by flanking markers 3;3 12491255;159184511 86583789;180128021 1 - by flanking markers;1 - by flanking markers 3;3 7140238;152506537 79875036;176418101 1 - by flanking markers;1 - by flanking markers 3;3 77029705;144938577 77029923;168026850 1 - by flanking markers;1 - by flanking markers RRID:RGD_155782880 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782881 SS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 77727907 126079458 1 - by flanking markers 3 88924451 137527624 1 - by flanking markers 3 82222060 131051652 1 - by flanking markers 3 79285268 125293758 1 - by flanking markers RRID:RGD_155782881 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782883 SS-Chr3BN.SS-(D3Rat222-D3Got42)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 78808731 90197018 1 - by flanking markers 3 89999731 101431576 1 - by flanking markers 3 83300114 94807225 1 - by flanking markers 3 80367329 91241711 1 - by flanking markers RRID:RGD_155782883 SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain) , rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. 155782884 SS-Chr3BN.SS-(D3Rat222-D3Mco33)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 78808731 96185250 1 - by flanking markers 3 89999731 108500874 1 - by flanking markers 3 83300114 101902734 1 - by flanking markers 3 80367329 97298391 1 - by flanking markers RRID:RGD_155782884 SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3.. 155782885 SS-Chr3BN.SS-(D3Rat36-D3Rat156)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 78808731 124269028 1 - by flanking markers 3 89999731 135651688 1 - by flanking markers 3 83300114 129166212 1 - by flanking markers 3 80367329 123513386 1 - by flanking markers RRID:RGD_155782885 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782907 LE-Synpoem1Kmh This strain was submitted by Masaaki (Masa) Kuwajima, PhD  (masa@mail.clm.utexas.edu). Strains were produced at Kristen Harris Laboratory, Department of Neuroscience, Center for Learning and Memory, University of Texas at Austin This strain is deposited at Rat Resource and Research Center, mutant Cryopreserved Sperm; Cryorecovery (as of 2025-05-13) RRID:RRRC_00964 Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in rat by CRISPR/Cas9 system in the outbred LE embryos. It is similar to RRRC strain #1025 (LE-Synpoem2Kmh) (RGD:616335891), has a different mutation. 155782909 SS-Chr3BN.SS-(D3Arb22 - D3Mgh30)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 136541408 153262477 1 - by flanking markers 3 148587087 164637442 1 - by flanking markers 3 142174160 158417703 1 - by flanking markers 3 135287266 151080115 1 - by flanking markers RRID:RGD_155782909 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782910 SS-Chr3BN.SS-(D3Rat154 - D3Mgh30)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 125060606 153262477 1 - by flanking markers 3 136438243 164637442 1 - by flanking markers 3 129958906 158417703 1 - by flanking markers 3 124286544 151080115 1 - by flanking markers RRID:RGD_155782910 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782911 SS-Chr3BN.SS-(D3Rat26 - D3Rat14)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 90573349 127698688 1 - by flanking markers 3 101798743 139030095 1 - by flanking markers 3 95176716 132567457 1 - by flanking markers 3 91609794 126854898 1 - by flanking markers RRID:RGD_155782911 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782912 SS-Chr3BN.SS-(D3Rat26 - D3Rat5)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 90573349 148643323 1 - by flanking markers 3 101798743 161185522 1 - by flanking markers 3 95176716 154416795 1 - by flanking markers 3 91609794 146592883 1 - by flanking markers RRID:RGD_155782912 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782913 SS-Chr3BN.SS-(D3Rat12 - D3Mgh30)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 127988419 153262477 1 - by flanking markers 3 139333901 164637442 1 - by flanking markers 3 132875075 158417703 1 - by flanking markers 3 127162703 151080115 1 - by flanking markers RRID:RGD_155782913 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782914 SS-Chr3BN.SS-(D3Rat217- D3Mgh30)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 134491977 153262477 1 - by flanking markers 3 146499815 164637442 1 - by flanking markers 3 140077066 158417703 1 - by flanking markers 3 133293002 151080115 1 - by flanking markers RRID:RGD_155782914 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155782915 SS-Chr3BN.SS-(D3Rat26 - D3Rat217)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown 3 90573349 134492553 1 - by flanking markers 3 101798743 146499996 1 - by flanking markers 3 95176716 140077247 1 - by flanking markers 3 91609794 133293184 1 - by flanking markers RRID:RGD_155782915 SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN. 155791425 SS-Chr 3BN.Il2rgem1Mcwi/Mcwi Medical College of Wisconsin mutant Unknown Il2rgem1Mcwi 12790633 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66398567 66398585 8 RRID:RGD_155791425 The IL2Rg gene was targeted in the SS/JrHsdMcwi rat by TALEN injection into single-cell rat embryos. Once established, a homozygous (RGD:12790632) female rat from the SSIL2Rg line was intercrossed with a homozygous SS.BN3 (RGD:1358154) male to yield heterozygous SS.BN3IL2Rg offspring (F1), followed by brother-sister mating to yield homozygous SS. BN3IL2Rg offspring by the F3 generation. This strain is Immunodeficient Ilrg (X-SCID) mutant consomic line. 155791426 SS-Chr3BN.SS-(D3Rat26-D3Rat218)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown RRID:RGD_155791426 SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. 155791427 SS-Chr3BN.SS-(D3Rat160-D3Rat218)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown RRID:RGD_155791427 SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. 155791428 SS-Chr3BN.SS-(D3Rat164-D3Rat218)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown RRID:RGD_155791428 SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. 155791429 SS-Chr3BN.SS-(D3Mgh13-D3Rat218)/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown RRID:RGD_155791429 SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. 155791430 SS-Chr3BN.SS-(D3Rat 86 to D3Rat218 )/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown RRID:RGD_155791430 SS/JrHsdMcwi were crossed withSS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi (jq strain), rats from F1 were backcrossed to SS/JrHsdMcwi to select the congenic strains carrying subregion of jq to BN chromosome 3. 155791431 SS-Chr 3BN.SS-(D3Arb3-D3Rat93)( D3Rat78-D3Rat1).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown Il2rgem1Mcwi 12790633 3;3 7547341;146830639 75411665;170016653 1 - by flanking markers;1 - by flanking markers 3;3 12491255;159184511 86583789;180128021 1 - by flanking markers;1 - by flanking markers 3;3 7140238;152506537 79875036;176418101 1 - by flanking markers;1 - by flanking markers 3;3 77029705;144938577 77029923;168026850 1 - by flanking markers;1 - by flanking markers RRID:RGD_155791431 Immunodeficient congenic line developed by intercross of SS-Chr 3BN.SS-(D3Arb3-D3Rat93)( D3Rat78-D3Rat1)/Mcwi (RGD:155782880) withSS-Il2rgem1Mcwi (RGD:12790632) to breed the Il2rg (X-SCID) mutation into this background. 155791432 SS-Chr 3BN.SS-(D3Rat26-D3Mgh30).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown Il2rgem1Mcwi 12790633 3 90573349 153262477 1 - by flanking markers 3 101798743 164637442 1 - by flanking markers 3 95176716 158417703 1 - by flanking markers 3 91609794 151080115 1 - by flanking markers RRID:RGD_155791432 Immunodeficient congenic line developed by intercross of SS-Chr3BN.SS-(D3Rat26-D3Mgh30)/Mcwi(RGD:155782879) withSS-Il2rgem1Mcwi (RGD:12790632) to breed the Il2rg (X-SCID) mutation into this background. 155791433 SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown Il2rgem1Mcwi 12790633 3 77727907 126079458 1 - by flanking markers 3 88924451 137527624 1 - by flanking markers 3 82222060 131051652 1 - by flanking markers 3 79285268 125293758 1 - by flanking markers RRID:RGD_155791433 Immunodeficient congenic line developed by intercross of SS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi(RGD:155782881) withSS-Il2rgem1Mcwi (RGD:12790632) to breed the Il2rg (X-SCID) mutation into this background. 155791434 SS-Chr 3BN.SS-(D3Rat222-D3Got42).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown Il2rgem1Mcwi 12790633 3 77727907 90197018 1 - by flanking markers 3 88924451 101431576 1 - by flanking markers 3 82222060 94807225 1 - by flanking markers 3 79285268 91241711 1 - by flanking markers RRID:RGD_155791434 Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. . 155791435 SS-Chr 3BN.SS-(D3Rat222-D3Mco33).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown Il2rgem1Mcwi 12790633 3 77727907 96185250 1 - by flanking markers 3 88924451 108500874 1 - by flanking markers 3 82222060 101902734 1 - by flanking markers 3 79285268 97298391 1 - by flanking markers RRID:RGD_155791435 Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. 155791436 SS-Chr 3BN.SS-(D3Rat26-D3Rat218).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown Il2rgem1Mcwi 12790633 3 90573349 126079458 1 - by flanking markers 3 101798743 137527624 1 - by flanking markers 3 95176716 131051652 1 - by flanking markers 3 91609794 125293758 1 - by flanking markers RRID:RGD_155791436 Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. 155791437 SS-Chr 3BN.SS-(D3Rat160-D3Rat218).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. congenic Unknown Il2rgem1Mcwi 12790633 3 118692155 126079458 1 - by flanking markers 3 130058246 137527624 1 - by flanking markers 3 123558901 131051652 1 - by flanking markers 3 118235304 125293758 1 - by flanking markers RRID:RGD_155791437 Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. 155791438 SS-Chr 3BN.SS-(D3Rat164-D3Rat218).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. mutant Unknown Il2rgem1Mcwi 12790633 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66398567 66398585 8 RRID:RGD_155791438 Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. 155791439 SS-Chr 3BN.SS-(D3Mgh13-D3Rat218).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. mutant Unknown Il2rgem1Mcwi 12790633 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66398567 66398585 8 RRID:RGD_155791439 Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. 155791440 SS-Chr 3BN.SS-(D3Rat 86-D3Rat218).Il2rgem1/Mcwi This strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability. mutant Unknown Il2rgem1Mcwi 12790633 X 89342055 89345715 7 X 72017856 72021516 7 X 71165378 71169078 7 X 66398567 66398585 8 RRID:RGD_155791440 Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. 155791645 BN/NOlaHsd Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown RRID:RGD_155791645 In 1980, from National Institutes of Health, Bethesda, USA (BN/SsN, RGD:61115) to OLAC (now Envigo). 155804258 BN/Rij inbred Unknown RRID:RGD_155804258 inbred Brown Norway (BN) rat strain produced in the Rijswijk colony. 155888488 MWF/SimwMcwi Medical College of Wisconsin, RGD HRDP, contact HRDP RGD HRDP, contact HRDP inbred Live Animals (as of 2023-02-07) RRID:RGD_155888488 A colony of inbred Munich Wistar Fromter (MWF) rats maintained at the Medical College of Wisconsin since 2014, more than 20 breeding generations. Imported from a colony at Indiana University maintained more than 20 years; originally obtained from Roland Blatz at the University of California, San Diego 155888489 MWF/Simw Indiana University inbred Live Animals (as of 2023-02-07) RRID:RGD_155888489 A colony of Munich Wistar Fromter (MWF) rats maintained at Indiana University over 20 years, originally obtained from Roland Blatz at the University of California, San Diego 155900755 SD-Chrna6em1Slot The laboratory has deposited these strains with the Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09) Drug Addiction, Nicotine/Tobacco Addiction Chrna6em1Slot 155900756 16 69012201 69018901 7 16 68486608 68493308 7 16 68860018 68866718 7 16 64697741 64704441 7 RRID:RRRC_00984 Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 155900757 SD-Chrna6em2Slot The laboratory has deposited these strains with the Rat Resource and Research Center mutant Unknown (as of 2023-12-19) Drug Addiction, Nicotine/Tobacco Addiction Chrna6em2Slot 155900759 16 69012201 69018901 7 16 68486608 68493308 7 16 68860018 68866718 7 16 64697741 64704441 7 RRID:RRRC_00985 Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR. 156212871 HSRA/Ummc heterogeneous stock-derived renal agenesis rat Michael Garrett, University of Mississippi Medical Center inbred Live Animals (as of 2023-02-14) Renal agenesis, CAKUT, altered neprhogenesis RRID:RGD_156212871 An inbred strain derived from the Heterogeneous Stock by selective inbreeding more than 20 generations for spontaneous renal agenesis. 156340304 MWF/HsdMcwi Munich Wistar Fromter RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156340304 These are re-derived rats of from substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley and now maintained at Medical College of Wisconsin 156354230 PVG/SeacMcwi Piebald Virol Glaxo RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) Immunology RRID:RGD_156354230 These are re-derived rats of from Seac Yoshitomi, LTD., Fukuoka, Japan. and maintained at Medical College of Wisconsin. 156362762 RCS/LavRrrcMcwi royal college of surgeons rat RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) RRID:RGD_156362762 These are re-derived rats of from RCS/LavRrrc and maintained at Medical College of Wisconsin. Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Then to University of California- San Francisco, School of Medicine, deposited to Rat Resource & Research Center. 156368567 BDIX/NemOdaMcwi RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) Cancer RRID:RGD_156368567 These are re-derived rats of from BDIX/NemOda and maintained at Medical college of Wisconsin. This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992. 156403001 BUF/MnaMcwi RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) Cancer; Urology RRID:RGD_156403001 These are re-derived rats of from BUF/Mna and maintained at Medical College of Wisconsin. BUF strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. 156406412 HTX/KyoMcwi hydrocephalus texas RGD HRDP, contact Hybrid Rat Diversity program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) Neurobiology RRID:RGD_156406412 These are re-derived rats of from HTX/Kyo and maintained at Medical College of Wisconsin.1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992. 156420138 MR/HarMcwi Maudsely reactive RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420138 These are re-derived rats of MR/Har now maintained at Medical College of Wisconsin. This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. 156420139 MNS/NMcwi Milan normotensive strain RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Program at HRDP@mcw.edu inbred Live Animals; Cryopreserved Embryo (as of 2024-08-06) RRID:RGD_156420139 These are re-derived rats of MNS/N now maintained at Medical College of Wisconsin. Origin: Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. 156420144 HXB1/IpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420144 Embryo-rederived from breeder stock HXB1/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. 156420145 HXB7/IpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420145 Embryo-rederived from breeder stock HXB7/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. 156420146 HXB13/IpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420146 Embryo-rederived from breeder stock HXB13/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. 156420147 HXB17/IpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420147 Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. 156420148 HXB18/IpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420148 Embryo-rederived from breeder stock HXB18/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. 156420149 HXB23/IpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420149 Embryo-rederived from breeder stock HXB23/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. 156420150 BXH6/CubMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156420150 Embryo-rederived from breeder stock BXH6/Cub provided by Dr. Kren from Charles University, Department of Biology, Prague, Czech Republic, maintained at Medical College of Wisconsin 156420151 ZDF-Leprfa/+/Crl Charles River Laboratories Charles River Laboratories coisogenic Unknown RRID:RGD_156420151 This is the control model for the ZDF-Leprfa/Crl. 156420152 Mlac:WR Wistar rats National Laboratory Animal Center, Mahidol University Thailand National Laboratory Animal Center, Mahidol University Thailand outbred Unknown RRID:RGD_156420152 This outbred Wistar was maintained at National Laboratory Animal Center (NLAC), Thailand. All animals were housed at the Chulalongkorn University Laboratory Animal Center (CULAC) . 156420153 Mlac:SD Sprague Dawley rats National Laboratory Animal Center, Mahidol University Thailand National Laboratory Animal Center, Mahidol University Thailand outbred Unknown RRID:RGD_156420153 This outbred Sprague Dawley was maintained at National Laboratory Animal Center (NLAC), Thailand. All animals were housed at the Chulalongkorn University Laboratory Animal Center (CULAC) . 156430076 LEXF1A/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430076 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430077 LEXF2A/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430077 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430078 LEXF2B/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430078 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430079 LEXF2C/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430079 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430080 LEXF3/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) Diabetes Obesity; Cancer RRID:RGD_156430080 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430081 LEXF4/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430081 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430082 LEXF5/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430082 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430083 LEXF7A/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430083 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430085 LEXF7B/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430085 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430086 LEXF7C/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430086 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430087 LEXF8A/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430087 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430089 LEXF8D/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430089 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430090 LEXF9/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430090 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430091 LEXF10B/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430091 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430092 LEXF10C/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430092 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430093 LEXF11/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430093 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430094 FXLE13/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430094 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430095 FXLE14/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430095 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430099 FXLE16/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430099 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430100 FXLE17/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430100 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430101 FXLE18/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430101 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430102 FXLE19/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430102 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430103 FXLE21/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430103 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430104 FXLE22/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430104 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430105 FXLE23/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430105 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430106 FXLE24/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430106 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430107 FXLE25/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430107 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430108 FXLE26/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430108 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. 156430109 FXLE20/StmMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430109 This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin 156430110 BXH12/CubMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_156430110 Embryo-rederived from breeder stock BXH12-1/Cub provided by Dr. Kren from Charles University, Department of Biology, Prague, Czech Republic, maintained at Medical College of Wisconsin 156430169 SD-Mecp2em1Sage/Hsd ENVIGO ENVIGO mutant Cryopreserved Embryo (as of 2023-02-22) Autism, Rett syndrome, Cognition RRID:RGD_156430169 The MeCP2 KO rat model was originally created at SAGE Labs, Inc. in St. Louis, MO and distributed out of the Boyertown, PA facility. The line continues to be maintained through the original SAGE Labs animal inventory acquired by Envigo. The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). 156430327 FSL Flinders Sensitive Line Rat Karolinska Institutet, Stockholm Sweden inbred Unknown RRID:RGD_156430327 Flinders Sensitive Line Rat (FSL) was selectively bred from outbred Sprague Dawley for increased response an anticholinesterase agent. The FSL rat partially resembles depressed individuals with phenotypes of reduced appetite and psychomotor function but exhibits normal hedonic responses and cognitive function. 156430328 FRL Flinders Resistant Line Rat Karolinska Institutet, Stockholm Sweden inbred Unknown RRID:RGD_156430328 Flinders Resistant Line Rat (FRL) was selectively bred from outbred Sprague Dawley for less response to an anticholinesterase agent than FSL. FRL is not more resistant to the anticholinesterase agent compared to other outbred rats. The FSL rat partially resembles depressed individuals with phenotypes of reduced appetite and psychomotor function but exhibits normal hedonic responses and cognitive function. 156451369 HAD high-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_156451369 These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines 156451370 LAD low-alcohol-drinking Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana outbred Unknown RRID:RGD_156451370 These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. 158013766 SD-Akt1em1Soar Institute for Reproductive and Developmental Sciences, Department of Pathology & Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS 66160, USA. mutant Unknown Akt1em1Soar 158013767 6 137640482 137657552 7 6 146225955 146247008 7 6 137218398 137239970 7 6 131717680 131719011 8 RRID:RRRC_00891 This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein. 288084580 F344-Txn1m1Kyo age dependent mitochondrial cytopathy rat Division of Animal Genetics, Laboratory Animal Research Center, Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, Japan mutant Unknown Neurobiology RRID:RGD_288084580 This mutation Phe54Leu is an autosomal dominant mutation that appeared in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU). Rats heterozygous for Txn1 (Txn1 /+) exhibited running seizures only in its juvenile stage. The rat called Adem rat, exhibited age dependent mitochondrial cytopathy (Adem). The rats were backcrossed for more than ten generations on the F344/NSlc inbred background to ensure other mutations induced by ENU was reduced. The causative gene was identified as a missense substitution (c. 160 T > C, p. Phe54Leu) in exon 3 of Txn1. 288084582 F344-Txn1 em1Kyo Division of Animal Genetics, Laboratory Animal Research Center, Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, Japan mutant Unknown Neurobiology RRID:RGD_288084582 This CRISPR/Cas9 induced mutation Phe54Leu is induced in embryos of F344/NSlc. The genome editing system targeting exon 3 of Txn1 gene ( (c. 160 T > C) was delivered into embryos by electroporation. The two-cell stage embryos were transferred into the oviducts of pseudopregnant females. The rat called Txn1-F54L rat, replicates Adem rats (RGD:288084580) which carried Phe54Leu mutation in the same gene.These two strains exhibit similar phenotype. 291492855 SD-Tg(Prp-DISC1)Uhg Center for Behavioral Neuroscience, Institute of Experimental Psychology, Heinrich-Heine University D�sseldorf, D�sseldorf, Germany transgenic Unknown RRID:RGD_291492855 Transgenic Sprague Dawley rats were generated by injecting the linearized fragment of the CosSHa.tet vector containing the full-length, non-mutant human DISC1 as transgene with the polymorphisms F607 and C704, under the control of the Syrian hamster prion protein promoter, into pronuclei of Sprague Dawley rats. 329322880 SD-Mertkem1Cgen Cyagen Biosciences (Guangzhou) Inc.Building D, 3rd Floor, 3 Juquan Road, Science City, Guangzhou, 510663, China mutant Live Animals (as of 2023-04-24) RRID:RGD_329322880 The gRNA to rat Mertk gene, and Cas9 mRNA were co-injected into fertilized rat eggs to generate targeted knockout offspring. F0 founder animals were identified by PCR followed by sequence analysis, which were bred to wildtype rat to test germline transmission and F1 animal generation. This strain was derived from founder 6# carrying a 13934 deletion which included exons 3 to 5. 329333019 SD-Spon2em1Holi Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan 430060, China mutant Unknown Spon2em1Holi 329333021 14 83501025 83510376 7 14 82815158 82824529 7 14 77505695 77518001 7 RRID:RGD_329333019 This Spon2 knockout mutant was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats. 329812004 Ibd:WI Wistar rats outbred Unknown RRID:RGD_329812004 The Wistar rats maintained at The Nencki Institute of Experimental Biology of the Polish Academy of Sciences, Warsaw, Poland 329845586 W;WIAR-Izumo1em1Osb Osaka University National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2023-12-28) Izumo1em1Osb 329845587 1 96090118 96095872 7 1 102682319 102682325 8 1 101603222 101608977 7 1 96090817 96096893 7 RRID:RGD_329845586 Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (RGD:2304222) (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence:TGG. A 7-bp deletion(CTTTGGA)after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR background KO rats, this strain was mated with Slc:Wistar (RGD:2314928), hence this mutant is in mix background.Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed. 329845597 WKY-Col4a5em1Matsu Division of Molecular Genetics, Shigei Medical Research Institute, 2117 Yamada, Minami-ku, Okayama, 701-0202, Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2023-05-30) Col4a5em1Matsu 329969888 X 36918697 37130659 7 X 111226503 111437171 7 X 112769595 112983720 7 X 105118762 105322699 7 RRID:RGD_329845597 Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. Col4a5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. 329845599 WKY-Col4a5em2Matsu Division of Molecular Genetics, Shigei Medical Research Institute, 2117 Yamada, Minami-ku, Okayama, 701-0202, Japan National BioResource Project for the Rat in Japan mutant Unknown Col4a5em2Matsu 329969892 X 36918697 37130659 7 X 111226503 111437171 7 X 112769595 112983720 7 X 105118762 105322699 7 RRID:RGD_329845599 Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. Col4α5 em2 rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. 329845600 WKY-Col4a5em3Matsu Division of Molecular Genetics, Shigei Medical Research Institute, 2117 Yamada, Minami-ku, Okayama, 701-0202, Japan National BioResource Project for the Rat in Japan mutant Unknown Col4a5em3Matsu 329969893 X 36918697 37130659 7 X 111226503 111437171 7 X 112769595 112983720 7 X 105118762 105322699 7 RRID:RGD_329845600 Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em3 mutant carries a deletion of 56 base pairs containing the first methioine. Col4α5 em3 ratshave urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. 329848962 SHRSP.SHR-(D1Got82-D1Rat97)/Izm National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Unknown 1 79624016 80868564 1 - by flanking markers 1 82503596 83715456 1 - by flanking markers 1 81241080 82453948 1 - by flanking markers 1 79969446 81169607 1 - by flanking markers RRID:RGD_329848962 A subcongenic strain generated by backcrossing SHRSP.SHR-(D1Mgh5-D1Got87)/Izm (NBRP Rat No.0709, RGD:7411707) to SHRSP/Izm. A segment of the QTL region of chromosome 1 involved in salt-induced stroke (Niiya et al. Sci Rep. 2018; 8; 9403) has been exchanged. 329848994 WIC.WDB-Kiss1tm1(tdTomato)Nurep National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2023-06-21) RRID:RGD_329848994 Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). The targeting vector (tdTomato/puromycin N-acetyl transferase) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). 329848995 WIC;WDB-Kiss1tm1Nurep National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2023-06-07) RRID:RGD_329848995 The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). 329848998 LE-Tg(Drd2-cre)487-3Koba National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2023-06-07) RRID:RGD_329848998 This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs. Detailed information of BAC: Drd2, CH230-11B15 from the CHORI-230 Female Brown Norway rat BAC Library (BACPAC Resources Center, Children?s Hospital Oakland Research Institute)" 329848999 LE-Tg(Drd2-cre)490-9Koba National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2023-06-07) RRID:RGD_329848999 This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs. " 329849003 LE-Pvalbem2(cre)Koba National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Unknown RRID:RGD_329849003 A complex of Cas9 protein and gRNA was introduced into Iar:LE fertilized rat eggs by electroporation. Combi-CRISPR (Yoshimi K. et al.) was used to induce knock-in. Knock-in rats were selected and crossed with wild-type rats to establish this strain. Sequence features: the intron just before the fourth exon of the Pvalb gene (intron 3) is deleted by NHEJ after double-strand break by one base compared to the wild-type. ---ttggcgggccagaacctcagggg---(wild-type) ---ttggcgggccagaacc-cagggg---(knock-in) 329849006 LE;LEH-Ednrbsl/Kwb National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2023-06-08) Ednrbsl 10755424 RRID:RGD_329849006 LEH/Hkv (NBRP Rat No. 0802 aka. RGD:6480220) was resuscitated from frozen embryos and heterozygous male was obtained. The heterozygous male was mated with female Long-Evans rats (Crlj:LE), and the resulting offspring were deposited to NBRP. 329849009 F344-TyrCKitH/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2023-06-09) Kit|Tyr 620568|1589755 1;14 143641257;34906043 143746315;34984819 7;7 1;14 157322968;34901860 157416594;34979384 7;7 14;1 35072131;151012598 35149638;151106802 7;7 14;1 32547459;141115036 32624694;141210207 7;7 RRID:RGD_329849009 F344-TyrC KitH/Kyo (Black F344, NBRP Rat No. 0768, aka RGD:11040971), carrying 1) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) induced was crossed with F344/NSlc (Japan SLC, Inc.). Then, from the F2 generation, Tyr as a wild-type homozygous (confirmed by sequence) and Kit as a hooded homozygous (confirmed by phenotype) were selected. 329849010 F344-TyrCKitH.LEA-(Tel-D17Got10)/Hkv National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2023-06-09) Kit|Tyr 620568|1589755 14;1 34906043;143641257 34984819;143746315 7;7 14;1 34901860;157322968 34979384;157416594 7;7 14;1 35072131;151012598 35149638;151106802 7;7 14;1 32547459;141115036 32624694;141210207 7;7 RRID:RGD_329849010 A congenic strain in which a chromosome 17 fragment of LEA rats (provided by Dr. Tadashi Okamura) was introduced into the F344-TyrC KitH (NBRP Rat No. 0768). 329849011 SD-Fosem1Yossi National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2023-06-09) RRID:RGD_329849011 SD rats (Slc:SD) in which the c-Fos gene (ENSRNOG00000008015) was disrupted by the CRISPR/Cas9 system. Two guide RNAs and Cas9 protein were injected into the pronucleus of fertilized eggs of SD rats. After injection, they were transferred into the oviducts of the recipient rats and born. The founder rat (line 12) showed abnormal teeth, and PCR and sequencing analysis revealed that 1,067 bases including Exon 1 were deleted. The founder rat were mated with SD rats and bred. 329951704 ACI.BBDP-(RT1u)/Sunn Sunnybrook Research Institute, Toronto, Ontario, Canada. Rat Resource and Research Center congenic Cryopreserved Sperm; Cryorecovery (as of 2023-07-10) RRID:RRRC_00790 1 BBDP regions [Iddm1(RT1u) was introgressed into the ACI/SegHsd background 329951705 SD-Cited2em1Soar Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2023-07-10) hypoxia RRID:RRRC_00807 Deletion of coding sequence (Exon 2) using CRISPR/Cas9 329951706 SD-Adrm1em1Uok Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2023-07-10) RRID:RRRC_00861 CRISPR/Cas9-mediated deletion of ATG start site in Exon 2 of Adrm1 gene 329955364 WKY-Tg(CD68-GFP)Kjw Kevin Woollard at Imperial College London transgenic Unknown glomerulonephritis RRID:RGD_329955364 Transgene insertion (human CD68-GFP) using Sleeping Beauty transposon system on Wistar Kyoto rats. Rat monocyte/macrophage reporter strain on a WKY background which has susceptibility to experimental glomerulonephritis. GFP expression occurs exclusively within blood monocytes and tissue macrophages. 329955365 WKY-Tg(CD68-GFP)KjwRrrc Develop by Kevin Woollard at Imperial College London Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2023-07-11) glomerulonephritis RRID:RRRC_00866 Transgene insertion (human CD68-GFP) using Sleeping Beauty transposon system on Wistar Kyoto rats. Rat monocyte/macrophage reporter strain on a WKY background which has susceptibility to experimental glomerulonephritis. GFP expression occurs exclusively within blood monocytes and tissue macrophages. 329955449 SD-Serpina6em1Glha Rats were originally bred and maintained at the Center for Disease Modeling. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryorecovery (as of 2023-07-12) Serpina6em1Glha 329955453 6 127911618 127921851 7 6 136742720 136752950 7 6 127523948 127534178 7 6 122787486 122787538 8 RRID:RGD_329955449 A CRISPR/cas9 strategy was employed by Sage Labs, to generate Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon. 329955451 SD-Serpina6em1Glha/Rrrc Rats were originally bred and maintained at the Center for Disease Modeling. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryorecovery (as of 2023-07-12) Serpina6em1Glha 329955453 6 127911618 127921851 7 6 136742720 136752950 7 6 127523948 127534178 7 6 122787486 122787538 8 RRID:RRRC_00930 A CRISPR/cas9 strategy was employed by Sage Labs, to generate Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon. 329955459 WKY-P2rx7em1Tja Imperial College London mutant Unknown P2rx7em1Tja 329955460 12 35074025 35117152 7 12 41242368 41808755 7 12 39353613 39396042 7 12 33900615 33900616 8 RRID:RGD_329955459 A global P2RX7KO on a WKYbackground was created at Imperial College London using zinc finger nuclease (ZFN) technology to generate a 2 base pair insertion in exon 10 of P2rx7 329955557 SD-Ace2em1(ACE2)Prem Deposited this strain with the Rat Resource and Research Center: (RRRC), 4011 Discovery Drive, Columbia, MO 65201. Phone: (573) 884-6076 Fax: 573-882-9857 mutant Live Animals (as of 2023-07-17) COVID-19 research. ACE2 1347174 RRID:RGD_329955557 CRISPR/Cas9 knock-in of the human ACE2 transgene into the endogenous locus of the rat Ace2 gene. Single integration of hACE2, with expression driven by the endogenous rat Ace2 promoter. Provides a more natural expression pattern (versus abundant overexpression as seen in prior models). 329969882 SD-Tg(Myh6-cre)Lizh Key Laboratory of Human Disease Comparative Medicine, NHFPC, Institute of Laboratory Animal Science, Peking Union Medicine College, Chinese Academy of Medical Sciences, transgenic Unknown RRID:RGD_329969882 The heart-specific cre expression plasmid (alpha-MHC-Cre) was produced by inserting the cre coding sequence downstream of the a-MHC (Mgh6) promoter in the a-MHC expression vector. The a-MHC-Cre transgenic rat was generated by microinjection of linearized alpha-MHC-Cre plasmid to Sprague Dawley embryos. 329969883 SD-Trim44em1Lizh Key Laboratory of Human Disease Comparative Medicine, NHFPC, Institute of Laboratory Animal Science, Peking Union Medicine College, Chinese Academy of Medical Sciences, mutant Unknown RRID:RGD_329969883 A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4 ng/ul), Cas9 mRNA (25 ng/ul), and sgRNAs (10 ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO). 329969885 SD-Trim44em1Lizh,Tg(Myh6-cre)Lizh Key Laboratory of Human Disease Comparative Medicine, NHFPC, Institute of Laboratory Animal Science, Peking Union Medicine College, Chinese Academy of Medical Sciences, mutant Unknown RRID:RGD_329969885 The conditional Trim44 knockout (Trim44 cKO, SD-Trim44em1Lizh, RGD:329969883) was bred with the α-MHC-Cre tool rat (SD-Tg(Myh6-cre)Lizh, RGD:329969882) to generate cardiac-specific Trim44 knockout which had the Trim44flox/flox/α-MHC-Cre genotype. 401717572 SD-Mpoem1Mcwi Medical College of Wisconsin mutant Live Animals (as of 2023-08-07) Mpoem1Mcwi 401717573 10 76085872 76097012 7 10 75004128 75014496 7 10 75087892 75098260 7 10 72595923 72595933 8 RRID:RGD_401717572 CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats. 401795481 WI-Nanos3em1(tdTomato)Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan. mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-11) Nanos3em1(tdTomato)Nips 401795483 19 25669353 25672779 7 19 36262007 36265766 7 19 25284907 25288680 7 19 23978465 23988933 7 RRID:RGD_401795481 The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Nanos3 expressing cells. 401795484 CD-Slc30a10em1Sommu The strain was submitted by Dr. Somshuvra Mukhopadhyay from the University of Texas at Austin. The strain will be deposited to Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2023-09-11) neuroscience, toxicology, metal homeostasis, physiology, manganese toxicity Slc30a10em1Sommu 401795485 13 101474867 101492180 7 13 108048948 108083821 7 13 103396295 103406759 7 13 96998143 97048076 7 RRID:RGD_401795484 Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. 401799619 SD-Tg(Acr3-EGFP)Nips Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, Japan. or Division of Mammalian Embryology, Center for Stem Cell Biology and Regenerative Medicine, The Institute for Medical Science, The University of Tokyo, Tokyo108-8639, Japan. transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-12) RRID:RGD_401799619 This transgenic strain was created by intracytoplasmic sperm injection (ICSI) mediated DNA transfer. Linearized Acr3-EGFP plasmid DNA (Nakanishi et al., FEBS Lett. 1999; 0.1 micrograms/ml) is mixed with sperm heads of Slc:SD rats for 2 min. The sperm head is microinjected into ovulated oocytes of Slc:SD rat (RGD ID:12910483) and incubated overnight prior to embryo transfer to pseudopregnant females. Resultant pups are examined for correct gene-targeting by genomic PCR, and maintained by crossing the founder with Slc:SD rat. 401824639 SD-Fahem3McwiIl2rgem2McwiRag1em6Mcwi Medical College of Wisconsin, Aron Geurts, ageurts@mcw.edu. Please contact: transgeniccore@mcw.edu for availability. mutant Cryopreserved Sperm (as of 2023-09-18) RRID:RGD_401824639 Produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion. 401824640 SD.SD-Fahem3McwiIl2rgem2McwiRag1em6Mcwi/Mcwi Medical College of Wisconsin, Aron Geurts, ageurts@mcw.edu. Please contact: transgeniccore@mcw.edu for availability. congenic Cryopreserved Sperm (as of 2023-09-18) RRID:RGD_401824640 This model was made by taking RGD:401824639 (Fah, Il2rg, and Rag1 triple knockout model) and backcrossing to Crl:SD, then intercrossing multiple generations again until all three gene alleles were homozygous again. 401827145 LE-Pink1em1Davis The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Center mutant Cryorecovery (as of 2025-01-27) Parkinson's research RRID:RRRC_01007 The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos. 401827899 BXH13/CubMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Live Animals; Cryopreserved Embryo (as of 2023-10-24) RRID:RGD_401827899 This recombinant inbred was originally derived from founder strains BN-Lx/Cub and SHR/OlaIpcv at Charles University, Department of Biology, Prague, Czech Republic. This substrain was maintained at the Medical College of Wisconsin. 401900746 SD-Prl7b1tm1(cre)Soar University of Kansas Medical Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21) Reproductive biology Prl7b1tm1(cre)Soar 401900752 17 43783328 43791541 7 17 41012487 41020700 7 17 39153431 39161644 7 17 37202058 37214739 7 RRID:RRRC_001013 CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. 401900748 SD-Prl7b1tm1(cre)Soar/Rrrc This strain is rederived at Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21) Reproductive biology Prl7b1tm1(cre)Soar 401900752 17 43783328 43791541 7 17 41012487 41020700 7 17 39153431 39161644 7 17 37202058 37214739 7 RRID:RRRC_001013 CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site. 401900749 SD-Prl7b1em1Soar University of Kansas Medical Center Rat Resource and Research Center mutant Cryopreserved Embryo (as of 2023-11-21) Reproductive biology Prl7b1em1Soar 401900751 17 43783328 43791541 7 17 41012487 41020700 7 17 39153431 39161644 7 17 37202058 37214739 7 RRID:RRRC_001014 CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus 401900750 SD-Prl7b1em1Soar/Rrrc This strain is rederived at Rat Resource and Research Center Rat Resource and Research Center mutant Cryopreserved Embryo (as of 2023-11-21) Reproductive biology Prl7b1em1Soar 401900751 17 43783328 43791541 7 17 41012487 41020700 7 17 39153431 39161644 7 17 37202058 37214739 7 RRID:RRRC_001014 CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus 401901198 SHHFcp/cp/MccGmiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_401901198 401901199 SHHFcp/+/MccGmiCrl Charles River Laboratories Charles River Laboratories inbred Unknown RRID:RGD_401901199 401901201 SHHFcp/+/Mcc Dr. McCune laboratory inbred Unknown RRID:RGD_401901201 401901202 SHHFcp/cp/Mcc Dr. McCune laboratory inbred Unknown RRID:RGD_401901202 401901286 test8Dec test8Dec advanced_intercross_line Unknown RRID:RGD_401901286 test8Dec 401938598 SS-Del(2q)1Mcwi Medical College of Wisconsin Please contact: mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2023-12-12) RRID:RGD_401938598 Four single guide RNAs and SpCas9 targeting sequences ATGAAGTGCCTAGCTTCATT, GAAGCTAGGCACTTCATCTA, ATTCATAATGGGACACTCGA, and CCCAGCCTCAGATTCATAAT flanking a chromosome 2 region distal to Npr3 were targeted in SS/JrHsdMcwi embryos. A 29,508 bp deletion in chromosome 2 (rn6: chr2:61,845,176-61,874,684) resulted, along with an insertion of 3 nucleotides (TGG). 401938647 SD-Slc9a6 em1Moro/Rrrc Dr. Eric Morrow at Brown University 70 Ship Street, Box G-E4 Providence RI 02912 USA deposited at RRRC mutant Live Animals (as of 2023-12-18) neurodevelopment/neurodegeneration Slc9a6 em1Moro 151664749 X 141146237 141201234 7 X 153620082 153675717 7 X 158979081 159045019 7 X 134443830 134443831 8 RRID:RGD_401938647 Crispr-Cas was used to introduce a 2bp insertion of TT to create a stop codon in exon 7 of SLC9a6 gene, causing termination of translation. The strain was rederived at RRRC. 401938650 CD-Slc30a10em1Sommu/Rrrc The strain was created by Dr. Somshuvra Mukhopadhyay from the University of Texas at Austin. The strain is rederived at Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2023-12-19) neuroscience, toxicology, metal homeostasis, physiology, manganese toxicity RRID:RGD_401938650 Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line. 401938653 SD-Ctnsem1Odev University of Zurich - Institute of Physiology, Mechanisms of Inherited Kidney Disorders Group Winterthurerstrasse 190 CH-8057 Zürich Contact Olivier Devuyst at Email: olivier.devuyst@uzh.ch, National BioResource Project for the Rat in Japan mutant Live Animals (as of 2025-03-31) Cystinosis Ctnsem1Odev 401938654 10 60060254 60075352 7 10 59488895 59503993 7 10 59749250 59772475 7 10 57810970 57810981 8 RRID:RGD_401938653 The Ctns gen was deleted by oocyte injection of the CRISPER/Cas9 system (PolyGene AG, Zurich,Switzer-land). Two single guideRNAs(sgRNAs) targeting exon3 of Ctns were selected :CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG), CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resultingin a premature stop codon in the exon3 of Ctns. 401940195 SD-Ahrem1Iexas-/- Osaka University, Faculty of Medicine, Institute of Experimental Animal Sciences mutant Unknown Ahrem1Iexas 401940199 6 54205104 54240268 7 6 64589066 64624078 7 6 54963990 55001806 7 6 52263461 52263470 8 RRID:RGD_401940195 The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . 401940197 SD-Ahrem1Iexas+/- Osaka University, Faculty of Medicine, Institute of Experimental Animal Sciences mutant Unknown Ahrem1Iexas 401940199 6 54205104 54240268 7 6 64589066 64624078 7 6 54963990 55001806 7 6 52263461 52263470 8 RRID:RGD_401940197 The Ahr heterozygous rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats . 401940198 SD-Ahrem1Iexas+/+ Osaka University, Faculty of Medicine, Institute of Experimental Animal Sciences mutant Unknown RRID:RGD_401940198 The Ahr wild type littermates from the cross of heterozygous Ahr rats. The Ahr mutants were created using CRISPR/Cas9 gene editing to delete a portion of exon 2 of Ahr in Sprague Dawley rats . 401959229 LE-Tg(Thy1-GCaMP6f)8Rrrc Janelia Research Campus and Princeton University Rat Resource & Research Center transgenic Unknown Neuroscience RRID:RRRC_01010 Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-chain kinase. Reference ID: https://doi.org/10.1101/2023.08.17.553594 401959407 OlaHsd:LE Long Evans Envigo, UK and Netherlands outbred Unknown Behaviour RRID:RGD_401959407 Medical Research Council, Mill Hill obtained LH stock from ICI, Alderley Edge in 1932 and have maintained closed colony since that time. From Medical Research Council, Mill Hill to OLAC (Harlan) in 1969. Harlan became Envigo in 2015, then Envigo was acquired by Inotiv in 2021 401959606 Cnc:SD Sprague-Dawley R. Dawley, Sprague-Dawley Company, http://www.spfbiotech.com/product/ratdetail/10/75 outbred Unknown RRID:RGD_401959606 This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. This strain was maintained by China National Center For Rodent Laboratory Animal. and available from SPF biotech since 2018. 401960080 Yxch:SD Experimental Animal Center of Army Medical University (Chongqing, China). Experimental Animal Center of Army Medical University (Chongqing, China). outbred Unknown RRID:RGD_401960080 Experimental Animal Center of Army Medical University (Chongqing, China). 401960101 ZSF1-Leprfa/cp/Crl Genetic Models International, Indianapolis. Charles River Laboratories hybrid Unknown Leprcp|Leprfa 11570565|13432153 RRID:RGD_401960101 This F1 obese model was developed by crossing rat strains with two separate leptin receptor mutations (fa and facp), In Charles River, they mate a Heterozygous ZDF (fa/+) with a Homozygous SHHF (cp/cp).This mating of ZDF and SHHF parent can produce obese ZSF1 (having fa and cp mutation from both parents) or lean ZSF1 (having just one copy of mutated Lepr, either cp or fa). The obese F1 develop insulin resistance, hyperglycaemia, and mild hypertension 401960104 ZSF1-Leprlean/Crl Genetic Models International, Indianapolis. Charles River Laboratories hybrid Unknown RRID:RGD_401960104 This F1 lean model was developed by crossing rat strains with two separate leptin receptor mutations (fa and cp). In Charles River, they mate a Heterozygous ZDF (fa/+) with a Homozygous SHHF (cp/cp).This mating of ZDF and SHHF parent can produce obese ZSF1 (having fa and cp mutation from both parents) or lean ZSF1 (having just one copy of mutated Lepr, either cp or fa). 401976372 SD-Crhtm1(Cre)Kji This strain was created by Dr. Karl Iremonger at the Centre for Neuroendocrinology, Department of Physiology, University of Otago, Dunedin, New Zealand mutant Unknown RRID:RGD_401976372 CRISPR/Cas9 technology was used to insert an IRES for Cre expression after the corticotropin-releasing hormone (Crh) gene and is expressed in cells that produce CRH. 401976374 NTacSam:SD Taconic outbred Unknown RRID:RGD_401976374 This outbred Sprague Dawley was originally from Taconic and bred at SAMTAKO in Korea. 401976436 Cnc:WI Wistar rats spfbiotech outbred Unknown RRID:RGD_401976436 The Wistar rat is an outbred albino rat. This breed was developed at the Wistar Institute in 1906 for use in biological and medical research. The Wistar was maintained by China National Center For Rodent Laboratory Animal. and available from SPF biotech since 2019. 401976445 HsdOla:LIS Lister Hooded inotiv outbred Unknown RRID:RGD_401976445 Medical Research Council, Mill Hill obtained LH stock from ICI, Alderley Edge in 1932 and have maintained closed colony since that time. From Medical Research Council, Mill Hill to OLAC (Harlan) in 1969. Harlan became Envigo in 2015, then Envigo was acquired by Inotiv in 2021. 401976475 CrlNifdc:CD(SD) Sprague-Dawley National Rodent Laboratory Animal Resources Center outbred Unknown RRID:RGD_401976475 Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system. The Nifdc strain is available from ?National Rodent Laboratory Animal Resources Center? in China. 404976871 DA/MolTacMcwi Medical College of Wisconsin Contact MCW rat distribution at mcwcustomrats@mcw.edu inbred Live Animals (as of 2024-03-18) RRID:RGD_404976871 A closed colony of DA/MolTac (RRID:RGD_1566438) has been maintained at the Medical College of Wisconsin for more than 30 generations. 404976872 DA;CD-Tg(RNECO-180E22)733Arno/Mcwi Medical College of Wisconsin Contact MCW rat distribution at mcwcustomrats@mcw.edu transgenic Cryopreserved Sperm (as of 2024-03-18) RRID:RGD_404976872 CD-Tg(RNECO-180E22)733Arno, RGD:155663367 was backcrossed at the Medical College of Wisconsin to DA/MolTacMcwi for 6-7 generations before cryopreservation of sperm. 404976873 SS-Del(1q)2Mcwi Medical College of Wisconsin Please contact: mcwcustomrats@mcw.edu mutant Cryopreserved Sperm (as of 2024-03-18) RRID:RGD_404976873 Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted. 405100226 LE-Fmr1em1Pwc SAGE (Sigma Advanced Genetic Engineering) Labs Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh EH8 9XD, UK. mutant Unknown RRID:RGD_405100226 Colony founders were produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting founders did not express FMRP or eGFP. 405100723 LE-ROSA26 em1(CAG-Ghsr)Ottc Optogenetics and Transgenic Technology Core mutant Unknown RRID:RGD_405100723 The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. 405100724 LE-Pdynem(iCre)1Ottc Optogenetics and Transgenic Technology Core Optogenetics and Transgenic Technology Core mutant Unknown RRID:RGD_405100724 This mutant rat was produced by targeted knocking adding in IRES-iCre to the 3' end of Pdyn in LE rat using CRISPR/Cas9 method. 405100725 LE-Pdynem(iCre)2Ottc Optogenetics and Transgenic Technology Core Optogenetics and Transgenic Technology Core mutant Unknown RRID:RRRC_01023 This mutant rat was produced by targeted knocking adding in IRES-iCre to the 3' end of Pdyn in LE rat using CRISPR/Cas9 method. 405649860 SD-Esr1em1Bra-/- Genome Editing and Animal Models, University of Wisconin-Madison Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA. mutant Unknown Esr1em1Bra 405649861 1 35523680 35759891 7 1 42534049 42935434 7 1 41192029 41594799 7 1 41106335 41499104 7 RRID:RGD_405649860 Two target sequences (GCCGTGTTCAACTACCCCGAGGG and GCTGCGCAAGTGTTACGAAGTGG) within the second and third exon, respectively, of the coding sequence of Esr1 (the rat gene encoding ERα) were selected. gRNAs targeting these sequences were synthesized via in vitro transcription. gRNAs (25 ng/ul each) were co- microinjected with Cas9 protein (40 ng/ul) into Sprague-Dawley rat embryos, and embryos were transferred into pseudo-pregnant recipients. Animals heterozygous for a 25 base pair deletion in Esr1 exon 3 were used to establish an ER alpha mutant colony and subsequent homozygous mutant offspring were obtained for study. 405650195 SD-Esr1em1Bra+/+ Genome Editing and Animal Models, University of Wisconin-Madison Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA. mutant Unknown RRID:RGD_405650195 This is the wild type littermate from the crossing of heterozygous Esr1 mutant rats. This wild type littermate rat was used as a control for the homozygous mutant SD-Esr1em1-/- (RGD:405649860) in estrogen receptor study. 405847397 Wakil: bHR High Responder The selectively bred High Responder (bHR) rat line was generated at the University of Michigan (Ann Arbor, MI USA). Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109 Please contact hebda@med.umich.edu for availability or contact URL https://medicine.umich.edu/dept/mni/elaine-k-hebda-bauer-phd outbred Live Animals (as of 2024-05-16) Substance Use, Mood Disorder, Hyperactivity, Exploratory Behavior, Locomotor Behavior, Behavioral Disinhibition, Externalizing RRID:RGD_405847397 Dawley rats derived from three distinct breeding colonies. In the first generation, sib-matings were avoided by only breeding pairs of animals that were derived from different colonies. At each generation, we maintain 12 litters for each of our selectively bred lines. Behavior response to a novel environment performed on adults was used as a criterion for selective breeding. Males and females with the highest scores from locomotion testing were bred together to generate the bred high-responder (bHR). 405847400 Wakil: bLR Low Responder The selectively bred Low Responder (bLR) rat line was generated at the University of Michigan (Ann Arbor, MI USA). Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109 Please contact hebda@med.umich.edu for availability or contact URL https://medicine.umich.edu/dept/mni/elaine-k-hebda-bauer-phd outbred Live Animals (as of 2024-05-16) Substance Use, Mood Disorder, Hyperactivity, Exploratory Behavior, Locomotor Behavior, Behavioral Disinhibition, Externalizing RRID:RGD_405847400 Dawley rats derived from three distinct breeding colonies. In the first generation, sib-matings were avoided by only breeding pairs of animals that were derived from different colonies. At each generation, we maintain 12 litters for each of our selectively bred lines. Behavior response to a novel environment performed on adults was used as a criterion for selective breeding. Males and females with the lowest scores from locomotion testing were bred together to generate the bred low-responder (bHR). 405849381 SHR-Tti2em1Ipcv+/- Institute of Physiology of the Czech Academy of Sciences, Prague, Czech Republic mutant Unknown RRID:RGD_405849381 This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls. 405849382 SHR-Tti2em1Ipcv+/+ Institute of Physiology of the Czech Academy of Sciences, Prague, Czech Republic mutant Unknown RRID:RGD_405849382 This is the wild type littermate of the Tti2 knockout rats. The knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and this wild type littermates were used as controls. 405849385 SD-Tg(DNMT3A+) Feis Shanghai Jiao Tong University International Peace Maternity & Child Health Hospital Shanghai Key laboratory for Embryo?Original Adult Disease School of Medicine Shanghai Jiao Tong University Shanghai 200030 transgenic Unknown RRID:RGD_405849385 The hDNMT3A transgenic rats were established using zygote microinjection of a bacterial artificial chromosome (BAC). The RP11-159D24 BAC (NCBI-ID:223335, Homo sapiens, GRCh38.p2: Chr. 2: 25,202,642-25,410,145, total length: 207,504 bp) containing DNMT3A (GRCh38.p2: 25,232,961,25,342,590, total length: 109,630 bp) was injected into rat zygotes (Rattus norvegicus, Sprague-Dawley, SD). The offspring were identified with 8 PCR primer-pairs that were specific for the RP11-159D24 sequence to detect positive transgenic ones. 405849386 SD-Tg(DNMT3A)-/- Feis Shanghai Jiao Tong University International Peace Maternity & Child Health Hospital Shanghai Key laboratory for Embryo?Original Adult Disease School of Medicine Shanghai Jiao Tong University Shanghai 200030 transgenic Unknown RRID:RGD_405849386 This is the wild type littermate of the hDNMT3A transgenic rats which were established using zygote microinjection of a bacterial artificial chromosome (BAC). The RP11-159D24 BAC (NCBI-ID:223335, Homo sapiens, GRCh38.p2: Chr. 2: 25,202,642-25,410,145, total length: 207,504 bp) containing DNMT3A (GRCh38.p2: 25,232,961,25,342,590, total length: 109,630 bp) was injected into rat zygotes (Rattus norvegicus, Sprague-Dawley, SD). The offspring were identified with 8 PCR primer-pairs that were specific for the RP11-159D24 sequence to detect positive transgenic ones and wild type littermates that did not carry the human transgene. 405849408 SS-Xdhem1Mcwi+/- MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown Xdhem1Mcwi 14398480 6 21417685 21590015 7 6 34996983 35059195 7 6 25149570 25211273 7 6 21530463 21592172 7 RRID:RGD_405849408 CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a heterozygous strain which has decreased Xdh protein detected in the kidney cortex tissue as compared to the wild type littermate at 6-week old. 405849409 SS-Xdhem1Mcwi+/+ MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown RRID:RGD_405849409 CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. This is a wild type littermate used as the control for its homozygous or heterozygous littermate. 405849411 WKY-Krtcap3em3Mcwi+/+ MCW Gene Editing Rat Resource Center Contact MCW rat distribution at mcwcustomrats@mcw.edu mutant Unknown RRID:RGD_405849411 CRISPR/Cas9 system was used to introduce a mutation in the Krtcap3 gene of WKY/Ncrlrat embryos. This is the wild type littermate (from heterozygous breeders) carrying wild type Krtcap3. This wild type mutant usually is used as an experimental control. 405850241 SD-Mir500 em1Cgen Cyagen Biosciences 19 South Dongcang Rd Taicang Jiangsu 215499 P. R. China mutant Unknown Mir500 em1Cgen 405850242 X 16906456 16906535 7 X 16121332 16121411 7 X 15258778 15258857 7 RRID:RGD_405850241 Sprague Dawley rats by microinjection of TALENs in fertilized eggs (Cyagen Biosciences). Briefly, the rno-mir-500 gene (Gene ID: 100314112; MirBase accession no. MIMAT0005321), which was located on rat chromosome X, was selected as the TALEN target site. TALENs were constructed using the Golden Gate Assembly and confirmed by sequencing. The founder, which carried 8- bp deletion (GCACCTGG) in the both strands compared with the wild-type (WT) DNA sequence, were genotyped by PCR followed by DNA-sequencing analysis. After that, heterozygous F1 were produced by mating F0 with WT rats. Heterozygous F1 rats were determined and mated to produce homozygote mutant (mir-500−/−) and WT (mir-500+/+). 405850257 Stock Tc(HSA21)1Yakaz National BioResource Project for the Rat in Japan, Rat Resource and Research Center transchromosomal Cryopreserved Sperm (as of 2025-02-03) Neurobiology, Ophthalmology, Cancer, Immunology, Internal Organ, Behavior, Hematology RRID:RRRC_01021 Chimeric rats were generated using rBLK2i-1 (WDB/Nips-ES1/Nips, RGD: 10054010) to which human chromosome 21 was introduced. They were then backcrossed with Wistar rats (Crlj:WI) for more than 10 generations. 405855876 SD-Foxo4em1Soar Institute for Reproductive and Developmental Sciences, Department of Pathology & Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS 66160, USA. Rat Resource and Research Center mutant Unknown Foxo4em1Soar 405855878 X 89332278 89338835 7 X 72007762 72014636 7 X 71155284 71162158 7 X 66385241 66392115 7 RRID:RGD_405855876 This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. 405855877 SD-Foxo4em1Soar+/+ Institute for Reproductive and Developmental Sciences, Department of Pathology & Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS 66160, USA. mutant Unknown RRID:RGD_405855877 This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein. 405878045 ACI August x Copenhagen Irish inbred Unknown RRID:RGD_405878045 Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research, after accidental mating between an August male with an Irish coat and a COP (Copenhagen2331)female. This is the parent to ACI substrains sent to Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. 405878046 BUF inbred Unknown RRID:RGD_405878046 This strain derived by Heston 1946 from Buffalo stock of H. Morris, to. It is the parental strains to several BUF substrains maintained in other institutions. 405878047 HTX inbred Unknown RRID:RGD_405878047 D. F. Kohn, Inst. of Comparative Medicine,Columbia University established this strain from institutional albino rats of unknown origin at University of Texas. This HTX is the parent to HTX substrains maintained in other institutions. 405878048 LH inbred Unknown RRID:RGD_405878048 In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). This LH is the parent to LH substrains maintained in other institutions. 405878049 LL inbred Unknown RRID:RGD_405878049 This the hypotensive strain established from the selective breeding In 1969. Outbred Sprague-Dawley rats were selected for systolic blood pressure trait using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LH as a hypertensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). This LL is the parent to LL substrains maintained in other institutions. 405878050 LN inbred Unknown RRID:RGD_405878050 This is the normotensive control strain established from the selective breeding In 1969. Outbred Sprague-Dawley rats were selected for systolic blood pressure trait using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LH was maintained as a hypertensive strain, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). This LN is the parent to LN substrains maintained in other institutions. 405878051 MR Maudsely reactive inbred Unknown (as of 2024-07-09) RRID:RGD_405878051 This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. This MR is the parent to MR substrains maintained in other institutions. 405878052 RCS royal college of surgeons rat inbred Unknown RRID:RGD_405878052 Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, This RCS is the parent to RCS substrains maintained in other institutions.The RCS/LavRrrc substrain is available from Rat Resource & Research Center. 405878082 PD polydactylous Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic inbred Unknown RRID:RGD_405878082 Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the polydactyly-luxate syndrome. 407420261 SD-Nme7em1Pdra+/- Laboratory of Transgenic Models of Diseases, Institute of Molecular Genetics of the Czech Academy of Sciences, Czech Republic. mutant Unknown RRID:RGD_407420261 The CRISPR/Cas9 nuclease system was used to generate Sprague Dawley (SD) rats with Nme7 gene knock-out. Two sets of guide (g)RNA were designed within the exon 4 of the Nme7 gene. A knock-out founder with a 5-nucleotide deletion (TCGAA within the exon 4 of the Nme7 gene) creating a premature stop codon. 407420262 SD-Nme7em1Pdra-/- Laboratory of Transgenic Models of Diseases, Institute of Molecular Genetics of the Czech Academy of Sciences, Czech Republic. mutant Unknown RRID:RGD_407420262 The CRISPR/Cas9 nuclease system was used to generate Sprague Dawley (SD) rats with Nme7 gene knock-out. Two sets of guide (g)RNA were designed within the exon 4 of the Nme7 gene. A knock-out founder with a 5-nucleotide deletion (TCGAA within the exon 4 of the Nme7 gene) creating a premature stop codon. 407431635 LE-Drd3em2(cre)Davis Created by Daniel Davis at University of Missouri for Section on Behavioral Neuroscience, NIMH. Deposited at RRRC. Contact RRRC@missouri.edu for availability. mutant Live Animals (as of 2024-08-15) RRID:RGD_407431635 CRISPR/Cas9 was used to insert CRE recombinase at DRD3 in rat embryos.This is line2, and line1 is "LE-DRD3em1(cre)Davis" (RGD:407431632). Both are created by Daniel Davis at University of Missouri for the Section on Behavioral Neuroscience at NIMH. 407431636 LE-Drd3em3(cre)Davis Created by Daniel Davis at University of Missouri for Section on Behavioral Neuroscience, NIMH. Deposited at RRRC. Contact RRRC@missouri.edu for availability. mutant Live Animals (as of 2024-08-15) RRID:RGD_407431636 This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Drd3. 407431637 LE-Galem2(cre)Davis Created by Daniel Davis at University of Missouri for Section on Behavioral Neuroscience, NIMH. Deposited at RRRC. Deposited at RRRC. Contact RRRC@missouri.edu for availability. mutant Live Animals (as of 2024-08-15) RRID:RGD_407431637 This rat model was generated using CRISPR-Cas9 technology insert a Cre-P2A cassette into the ATG start site of rat Gal. Created by Daniel Davis at University of Missouri. 407445919 Mmab:W Wistar Department for Breeding of Laboratory and Experimental Animals, Institute for Medical Research, Military Medical Academy, Belgrade outbred Live Animals (as of 2024-08-22) RRID:RGD_407445919 The outbred Wistar rats which bred and housed at the Military Medical Academy in Belgrade, Serbia 407446370 SD-Cyp2dem1Kg Dr. Kristin Grimsrud at University of California, Davis The rat strain is deposited to Rat Research and Resource Contact RRRC@missouri.edu for availability. mutant Unknown (as of 2024-08-29) Pharmacogenetics, drug studies RRID:RRRC_01005 A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. 407446371 SD-Cyp2dem2(CYP2D6)Kg Dr. Kristin Grimsrud at University of California, Davis The rat strain is deposited to Rat Research and Resource Contact RRRC@missouri.edu for availability. mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-08-29) Pharmacogenetics, drug studies RRID:RRRC_01006 A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. Subsequently, the human CYP2D6 gene (~6.2 kb) was inserted in place of the rat Cyp2d gene cluster. 407450403 BN/Slacc Shanghai laboratory animal center of the Chinese Academy of Sciences, Shanghai, China inbred Unknown RRID:RGD_407450403 Substrain of BN maintained at Shanghai laboratory animal center of the Chinese Academy of Sciences, Shanghai, China 407450412 Liuch:WI Wistar rats The Laboratory Animal Center of Zhejiang University outbred Unknown RRID:RGD_407450412 This outbred rat strain was derived from Wistar Institute. Now is maintained at the Laboratory Animal Center of Zhejiang University 407450413 SD-Il6em1Yona-/- Pharma Foods International Co., Ltd. (Kyoto, Japan) National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan mutant Unknown Il6em1Yona 407450416 4 456799 461376 7 4 3095536 3100112 7 4 3043231 3047807 7 4 5214602 5219178 7 RRID:RGD_407450413 The Il6 knockout (KO) rats were generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This strain carried a 118 bp deleted in the second exon of IL-6 407450414 SD-Il6em1Yona+/+ Pharma Foods International Co., Ltd. (Kyoto, Japan) National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan mutant Unknown RRID:RGD_407450414 The wild type rats were littermates of cross of heterozygous Il6 mutant rats. The wild type littermates were used as experimental controls for the homozygous mutant SD-Il6em1Yona-/- (RGD:407450413) generated using the CRISPR/Cas9 technique to induce a 118 bp deletion in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). 407550225 WKYLEWF1/Ebv Department of Physiology, Justus Liebig University, Giessen, Germany Department of Physiology, Justus Liebig University, Giessen, Germany hybrid Unknown RRID:RGD_407550225 This hybrid rat is a cross between a WKY female and a LEW male rat. 407570623 Slacc:SD Sprague-Dawley Laboratory Animal Management Department, Shanghai Institute of Family Planning Science. outbred Unknown RRID:RGD_407570623 SD rats maintained at Laboratory Animal Management Department, Shanghai Institute of Family Planning Science.. 407571697 LE-Nr3c1em1Jhrmn Strain deposited with the RRRC mutant Unknown Nr3c1em1Jhrmn 407571698 18 32371496 32459145 7 18 31408742 32348480 7 18 31728373 32704022 7 18 31271681 31393320 7 RRID:RRRC_01036 CRISPR-mediated knock in of loxP sites flanking Glucocorticoid Receptor exon 3 via Homology Directed Repair (HDR) 408364955 SD-Vdrem1Hfd Hector DeLuca laboratory at UW-Madison This strain is deposited to Rat Resource and Research Center (RRRC) mutant Cryopreserved Embryo (as of 2024-11-05) Vdrem1Hfd 408364972 7 136567614 136617280 7 7 139536241 139585928 7 7 139344452 139394138 7 7 129014788 129014799 8 RRID:RRRC_01033 The CRISPR/Cas9 system was used to introduce a net 12-bp deletion in exon 3 of the VDR gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGcccccggatctgtgGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGt--del--- GAGTGTGTGGAGACCGAGCCAC 408364956 SD-Vdrem2Hfd Hector DeLuca laboratory at UW-Madison Rat Resource and Research Center (RRRC); strain ID 1034 mutant Cryopreserved Embryo (as of 2024-11-05) RRID:RRRC_01034 The CRISPR/Cas9 system was used to introduce deletion and insertion in exon 3 of the VDR gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCccgaccCTGGTGACTTTGACCggaacgtgccccGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCtggt– CTGGTGACTTTGACC------GGATCTGTGGAGTGTGTGGAGACCGAGCCAC 408364957 F344-ApcPirc/UwmVdrem3Hfd Hector DeLuca laboratory at UW-Madison Rat Resource and Research Center (RRRC); strain ID 1033 mutant Cryopreserved Sperm (as of 2024-11-05) Colon cancer ApcPirc|Vdrem3Hfd 1554322|408364962 18;7 26732147;136567614 26790383;136617280 7;7 18;7 26725560;139536241 26820837;139585928 7;7 18;7 27011710;139344452 27106323;139394138 7;7 7 129014788 129014792 8 RRID:RRRC_01033 The F344-ApcPirc rat was generated previously by ENU mutagenesis (RGD ID 1641862). These fertilized rat embryos were used with the CRISPR/Cas9 system to introduce a 5-bp deletion (CCCCG) in exon 3 of the Vdr gene. This mutant was heterozygous for the Apc mutation and homozygous for the VDR deletion. WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGCCCCGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGG ATCTGTGGAGTGTGTGGAGACCGAGCCAC 408364958 SD-Cyp27b1em1Hfd Hector DeLuca laboratory at UW-Madison Rat Resource and Research Center (RRRC); strain ID 1031 mutant Cryopreserved Embryo (as of 2024-11-05) Cyp27b1em1Hfd 408364974 7 70512763 70517707 7 7 70333150 70340006 7 7 62871377 62871458 8 RRID:RRRC_01031 The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCAAAGGGGG KO: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCAAAGGGGG 408364959 SD-Cyp27b1em2Hfd Hector DeLuca laboratory at UW-Madison Rat Resource and Research Center (RRRC); strain ID 1032 mutant Cryopreserved Embryo (as of 2024-11-05) Cyp27b1em2Hfd 408364975 7 70512763 70517707 7 7 70333150 70340006 7 7 62871348 62871376 8 RRID:RRRC_01032 The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG KO: CTCGCCTCCA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG 408364982 WI-C1ql3em1Lian Institute of Laboratory Animal Science, Peking Union Medicine College, National Human Disease Animal Model Resource Center, Beijing, China (https://namr.org.cn/Ldesc/1_1074) mutant Live Animals (as of 2024-11-08) C1ql3em1Lian 408364987 17 87275167 87285484 7 17 81939086 81945581 7 17 80314186 80320681 7 17 76119344 76129170 7 RRID:RGD_408364982 The C1ql3 knout rats were established using CRISPR/cas9 method. The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant female were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame. 529435545 Wakil:bHRbLRF1 Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109 Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109 hybrid Unknown RRID:RGD_529435545 Offspring of a cross between the F37 Wakil: bHR (RGD:405847397) female and Wakil bLR (RGD:405847400) male rat. 596938164 CrlNctr:CD(SD) Charles River Laboratories Charles River Laboratories outbred Unknown RRID:RGD_596938164 A colony of outbred Crl:CD(SD) (RGD:734476) maintained at National Center for Toxicological Research, FDA. 597538479 SD-Eml1tish/Scrb tish rat University of Virginia, Charlottesville, VA, United States University of Virginia, Charlottesville, VA, United States mutant Unknown Eml1tish 597538481 6 132825590 132880169 7 6 141536753 141619726 7 6 132367342 132450488 7 6 127283968 127457246 7 RRID:RGD_597538479 The first tish animals were identified on the basis of postmortem histological analyses during the course of unrelated experiments using a strain of Sprague Dawley rats maintained at the University of Virginia. It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. A breeding colony was established by identifying living relatives of deceased tish individuals, and then these relatives were screened using magnetic resonance imaging (MRI). The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the unannotated exon 1 of Eml1 genome (Rnor_6.0; ENSRNOG00000043143). 597538592 SD-Tg(SNCA)Nuber ARCND, BWH, Harvard Medical School 77 Avenue Louis Pasteur, Boston MA 02115 USA transgenic Unknown RRID:RGD_597538592 For the generation of transgenic rats, the authors used a 190-kb fused AF163864 PAC/AC097478 BAC clone (Yamakado et al., 2012, PMID:22475625). It contained the entire human SNCA sequence (GenBank AF163864), with 30-kb upstream regulatory promoter sequences and a 45-kb flanking downstream region, cloned into pBACe3.6 vector as described previously. Transgenic rats were obtained by injecting the purified BAC fragment into fertilized Sprague–Dawley oocytes at a concentration of 1.5 µg/ml. A founder line displaying the highest integration number of BAC DNA construct was crossedbred to homozygosity. 597830029 Pha:WI Wistar rats Breeding station Dobrá Voda, Institute of Experimental Pharmacology and Toxicology, Slovak Academy of Science, Slovak Republic Breeding station Dobrá Voda, Institute of Experimental Pharmacology and Toxicology, Slovak Academy of Science, Slovak Republic outbred Unknown RRID:RGD_597830029 The outbred Wistar rats are maintained at Breeding station Dobrá Voda, Institute of Experimental Pharmacology and Toxicology, Slovak Academy of Science, Slovak Republic. 597830140 BBDR.BBDP-(Zfp786-Aoc1)/Ulund Celiac Disease and Diabetes Unit, Lund University, Lund, Sweden Celiac Disease and Diabetes Unit, Lund University, Lund, Sweden congenic Unknown RRID:RGD_597830140 This congenic strain was developed by intercross breeding using diabetic prone (DP) and diabetic resistant (DR) BB rats. This diabetes susceptible congenic rat strain carries Zfp786-Aoc1 genome fragment from DP and the other genomes are from DR. Since Gimap4 and Gimap5 are within Zfp786-Aoc1 region, they are of DP origin. 597830141 BBDR.BBDP-(Gimap1-Aoc1)/Ulund Celiac Disease and Diabetes Unit, Lund University, Lund, Sweden Celiac Disease and Diabetes Unit, Lund University, Lund, Sweden congenic Unknown RRID:RGD_597830141 This diabetic resistant congenic strain was developed by sister-brother breeding of heterozygote  sBBM (BBDP.BBDR-(Zfp786-Aoc1)/Ulund, RGD:597830140 ). The congenic rat carries DP genome from Gimap1-Aoc1 where Gimap5 is located. 598092487 SD-Cftrem1Wpick University of Missouri Columbia Rat Resource and Research Center mutant Live Animals (as of 2025-03-18) study of cystic fibrosis Cftrem1Wpick 598092489 4 43874852 44041870 7 4 42281040 42448571 7 4 42693263 42860679 7 4 46561269 46728759 7 RRID:RRRC_01038 A targeted 16 bp deletion was made in Exon 3 of the rat Cftr gene using CRISPR-Cas9 technology. 598092509 SD-Lgals3em1Dfult Availability Contact Email: dfulton@augusta.edu at Augusta University mutant Live Animals; Cryopreserved Sperm (as of 2025-03-21) RRID:RGD_598092509 Gal-3 KO rats were developed using CRISPR technology on the Sprague-Dawley background (Sage). CRISPR guides were selected targeting the fifth exon, and gene disruption was confirmed by genomic sequencing and immunoblot analysis for Gal-3 protein expression in lung tissue. PMCID: PMC6589585 598092510 SD-Pbkem1Dfult Availability Contact Email: dfulton@augusta.edu at Augusta University mutant Live Animals; Cryopreserved Sperm (as of 2025-03-21) RRID:RGD_598092510 we used CRISPR-Cas9 technology to generate a PBK KO rat. Cas9 editing of exon 4 in the rat PBK gene resulted in the insertion of a single “T” resulting in a frame shift and premature termination of the PBK protein. PMCID: PMC11650665 598092522 DA-Lystbg/Slc Lyst gene mutation was identified in 1985 in DA rats maintained at Hamamatsu University School of Medicine since 1980. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2025-03-25) Hematology Lystbg 598099555 RRID:RGD_598092522 Lyst gene mutation was identified in 1985 in DA rats maintained at Hamamatsu University School of Medicine since 1980. In 2000, it was provided to Japan SLC, Inc.The mutant beige protein was frameshift and prematured truncated at the 2594th amino acids due to 578 bp deletion (positions 7742-8319) caused by recombination between LINE1s (Long Interspersed Nuclear Element 1). 598092524 Slc:WSRC-KitWs Yagi Memorial Park in Hiroshima, Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2025-03-25) mast cell deficiency KitWs 12910763 14 34906043 34984819 7 14 34901860 34979384 7 14 35079269 35079280 8 14 32554595 32554606 8 RRID:RGD_598092524 In 1987, a Ws mutant (RGD:12910762) with a light-colored coat and large abdominal white spots was discovered in a colony of BN/fMai inbred rats that had been allocated to Yagi Memorial Park from the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. However, homozygous for the Ws mutation could not be obtained in BN inbred rats due to embryonic lethality. Therefore, they crossed with Donryu outbred rats and obtained homozygous by crossing F1 heterozygous. This strain was designated as WsRC and was supplied to Japan SLC, Inc. in 1993. 598092525 SD-C5ar1em22Taoki National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-25) Cardio Hypertension, Infectious, Pharmacology RRID:RGD_598092525 This strain was established by CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. guide RNA gRNA No1; ATAAGTAACGACAGCAGTGA gRNA No2; GAGTTTCACTCGGTCCACGA 598092526 SD-Rnf213em1Taoki National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-25) Cardio Hypertension RRID:RGD_598092526 This strain was established in 2020 using the CRISPR/Cas9 system at the Institute of Immunology Co., Ltd. In the same year, it was introduced to the Research Institute, National Cerebral and Cardiovascular Center. The genetic background is Slc:SD. 598092574 F344-Hspa8em1Opu National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology RRID:RGD_598092574 The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:xxxxx) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). 598092575 F344-Hspa8m1Kyo National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2025-03-27) Neurobiology RRID:RGD_598092575 This strain, called KK rats, in homozygous rats show gait abnormalities from around 5-6 weeks of age. Thereafter, the neurological symptoms progress rapidly, leading to emaciation and death. The mutant gene was named kk, as Kenta Kumafuji was the discoverer of the gait abnormality. 598092577 F344-Hspa8em2Opu National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology RRID:RGD_598092577 The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). 598092579 LE-Tg(Tac1-cre)3-2Koba National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092579 Background strain: Long-Evans rat (Iar:Long-Evans). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertiled eggs. 598092582 LE-Calcaem4(cre)Daiyi National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092582 Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). Cre and T2A were inserted into the start codon (methionine) of the second exon of the Calca gene using CRISPR/Cas9. 598092583 LE-Sstem1(cre)Bfdi National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092583 Cre was inserted at the start codon (methionine) of the somatostatin (Sst) gene. The Sst precursor is then expressed using the T2A peptide as a linker. Genetic background is Iar:Long-Evans (Institute for Animal Reproduction). 598092585 SD.LIS-Actbtm1(CAG-GCaMP8)Ksak National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092585 The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of G8CaMP-flox stop at the 3'non-coding site of the Actb gene were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. 598092586 SD.LIS-ROSA26tm1(CAG-RCaMP2)Ksak National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092586 The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of RCaMP2-flox stop at the Rosa26 locus were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. RCaMP2 stands for red calcium indicator (PMID: 25419959). 598092588 LE-Them2-2(cre)Koba National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092588 The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). 598092591 LE-Them2-1(cre)Koba National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092591 The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). 598092592 LE-Them1(cre)Koba National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-27) Neurobiology, Behavior RRID:RGD_598092592 The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). 598092593 W-Gpr143em19Gosh National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-28) Neurobiology, Ophthalmology, Cardio Hypertension, Behavior, Pharmacology RRID:RGD_598092593 Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. 598092595 F344.VF-Dop1avf/Omu National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2025-03-28) Neurobiology RRID:RGD_598092595 A congenic strain generated by backcrossing VF/Kyo rats (donor line, NBRP Rat No. 0022, RGD:1305534) to the F344/DuCrlCrlj (RGD:69643). This congenic strain carries the vacuole formation causing mutation (Dop1avf) in Dopey1(Dop1a) from VF/Kyo strain. It was generated at Osaka Metropolitan University. 598092597 SD-Tmem130em1Taoki National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-28) Cancer RRID:RGD_598092597 Generated with CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. Guide RNA gRNA No1: GACCATCAGTAGTAAGACTA gRNA No2: GATTTCCAGGTACTCGGGACG 598092598 F344-Nox1em1Shmo National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-28) RRID:RGD_598092598 A 29-base deletion was introduced into the first exon of the NADPH oxidase 1 (Nox1) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). 598092601 F344-Cybbem1Shmo National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-28) Hematology RRID:RGD_598092601 A 7-base deletion was introduced into the first exon of the NADPH oxidase 2 (Nox2)(official symbol:Cybb) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). 598092602 F344-Nox4em1Shmo National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-28) RRID:RGD_598092602 A one-base insertion was introduced into the first exon of the NADPH oxidase 4 (Nox4) gene of F344/DuCrj rats by CRISPR/Cas9. They were then backcrossed to F344/N (Japan SLC, Inc.). 598092603 F344-Cybbem1ShmoNox1em1ShmoNox4em1Shmo National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-03-28) Hematology RRID:RGD_598092603 A 7-base deletion in the first exon of the NADPH oxidase 2 (Nox2) gene, a 29-base deletion in the first exon of the NADPH oxidase 1 (Nox1) gene, and a one-base insertion in the first exon of the NADPH oxidase 4 (Nox4) gene were introduced by CRISPR/Cas9 in the F344/DuCrj rats. They were then backcrossed to F344/N (Japan SLC, Inc.). This triple Nox knock rats were created by compound crossbreeding of single knockout rats (RGD:598092598, RGD:598092601, RGD:598092602). 598092604 F344.MES-Cybames/Shmo National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2025-03-28) Hematology CybamesSdi 13209000 RRID:RGD_598092604 The Cybames mutant allele (Cybames) carried by MES rats was introduced by backcrossing to F344/N (Japan SLC, Inc.). The Cybames mutant allele is a 4-bp deletion in the splice sequence of the fourth intron of the Cyba gene. 598092605 W-Tg(Dbh-tTA,-cre)2_7Fusa National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2025-03-28) Neurobiology, Behavior, Pharmacology, Development RRID:RGD_598092605 This strain was established by a use of the BAC transgenic method with a technical support from the C.B.S.N resource (Dr. Kazuto Kobayashi, Fukushima Medical University, Dr. Yuchio Yanagawa, Gunma University Graduate School of Medicine). This transgenic rat was transported to The Jikei University School of Medicine, and cre recombinase expression was confirmed by crossing it with a reporter rat (NBRP Rat No: 0734). These rats are maintained in The Jikei University School of Medicine. Background strain: Crlj:WI. Transgene: Dbh (dopamine beta-hydroxylase: rat), TetR (E.coli), VP16 protein minimal“F”-type activation domain (Herpes simplex virus), 2A (Thosea asigna virus), cre recombinase (P1 Phage), bGlobin polyA (rabbit), loxP (P1 phage). Detailed method (BAC transgenic method): a rat BAC clone was used (CH230-211J22). Combined mRNA for tTA and cre recombinase sequences is transcribed under the control of Dbh promoter. In translation step, the transcript is cut at the 2A peptide sequence, resulting in a separate protein production of tTA and Cre. 598092606 W-Tg(Dbh-tTA,-cre)5_4Fusa National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2025-03-28) Neurobiology, Behavior, Pharmacology, Development RRID:RGD_598092606 This strain was established by a use of the BAC transgenic method with a technical support from the C.B.S.N resource (Dr. Kazuto Kobayashi, Fukushima Medical University, Dr. Yuchio Yanagawa, Gunma University Graduate School of Medicine). This transgenic rat was transported to The Jikei University School of Medicine, and cre recombinase expression was confirmed by crossing it with a reporter rat (NBRP Rat No: 0734). These rats are maintained in The Jikei University School of Medicine. Background strain: Crlj:WI. Transgene: Dbh (dopamine beta-hydroxylase: rat), TetR (E.coli), VP16 protein minimal“F”-type activation domain (Herpes simplex virus), 2A (Thosea asigna virus), cre recombinase (P1 Phage), bGlobin polyA (rabbit), loxP (P1 phage). Detailed method (BAC transgenic method): a rat BAC clone was used (CH230-211J22). Combined mRNA for tTA and cre recombinase sequences is transcribed under the control of Dbh promoter. In translation step, the transcript is cut at the 2A peptide sequence, resulting in a separate protein production of tTA and Cre. 598092607 W-Tg(Dbh-tTA,-cre)5_9Fusa National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2025-03-28) Neurobiology, Behavior, Pharmacology, Development RRID:RGD_598092607 This strain was established by a use of the BAC transgenic method with a technical support from the C.B.S.N resource (Dr. Kazuto Kobayashi, Fukushima Medical University, Dr. Yuchio Yanagawa, Gunma University Graduate School of Medicine). This transgenic rat was transported to The Jikei University School of Medicine, and cre recombinase expression was confirmed by crossing it with a reporter rat (NBRP Rat No: 0734). These rats are maintained in The Jikei University School of Medicine. Background strain: Crlj:WI. Transgene: Dbh (dopamine beta-hydroxylase: rat), TetR (E.coli), VP16 protein minimal“F”-type activation domain (Herpes simplex virus), 2A (Thosea asigna virus), cre recombinase (P1 Phage), bGlobin polyA (rabbit), loxP (P1 phage). Detailed method (BAC transgenic method): a rat BAC clone was used (CH230-211J22). Combined mRNA for tTA and cre recombinase sequences is transcribed under the control of Dbh promoter. In translation step, the transcript is cut at the 2A peptide sequence, resulting in a separate protein production of tTA and Cre. 598130079 LEW-Col7a1em1Jtol-/- Division of Blood and Marrow Transplantation Department of Pediatrics University of Minnesota Medical School We have deposited the strain with RRRC (Rat Resource and Research Center) mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2025-04-15) Recessive Dystrophic Epidermolysis Bullosa; pediatric dermatologic disorders; dermatologic cancers. RRID:RGD_598130079 The CRISPR/Cas9 system was used to introduce an 8-bp deletion in exon 1 of the Col7a1 gene of one-cell Lew/Crl rat embryos. 598136401 Wakil:bHRbLRF2 Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109 Laboratory of Dr. Huda Akil and Dr. Stanley Watson, MBNI, University of Michigan, 205 Zina Pitcher Pl. Ann Arbor, MI 48109 hybrid Unknown RRID:RGD_598136401 Selectively breeding rats for high or low locomotor activity in a novel environment (LocoScore) produced the bHR line (Wakil:bHR, RRID:RGD_405847397) and bLR line (Wakil:bLR, RRID:RGD_405847400), respectively (Stead. After 37 generations, 12 bHRs and 12 bLRs (F0) were chosen from 24 distinct families to crossbreed. The F1 offspring with similarly high or low LocoScores were then bred with each other to produce a re-emergence of diverse behavioral phenotypes in the F2 generation. 598154594 SD-C5ar1em1(C5AR1)Idor Michel Steiner, Idorsia Pharmaceuticals Ltd. Hegenheimermattweg 91 4125 Allschwil Switzerland National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-04-30) RRID:RGD_598154594 Zinc fingers were designed and human C5aR1 cDNA was cloned into a pZFN plasmid and sequence verified. Subsequently, co-microinjection of a pair of ZFNs and the donor plasmid into the pronucleus of fertilized, one cell embryos was performed, generating HR-mediated KI animals. The entire process was performed at SAGE Labs, Horizon, (St Louis, USA). Sprague Dawley (Charles River) rat (Rattus norvegicus) C5aR1 (NCBI Gene ID: 113959, updated on 18-Oct-2012 Location : 1q12 Sequence : Chromosome: 1; NC_005100.3 (79452051..79458856, complement) mRNA join (1..>34,5088..6806) /gene="C5ar1" CDS join(32..34,5088..6143) /gene="C5ar1") was replaced using zinc finger technology utilizing with the human C5aR1 cDNA by inserting the human cDNA into the 5’ end of the rat C5ar1 exon 2 locus using the ZFN Binding. Cut Site: CTTGGCCGTGTTCCTGGTaggagtTACCGGAAATGCCCTGGTG 598154597 W-Mkxem2Asah National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-04-30) RRID:RGD_598154597 The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 7- bp deletion causing frameshift mutation in the gene. 598154598 F344.W-np/Shi Shionogi and Company, Ltd. Address: Koka-cho, Shiga. JAPAN National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2025-04-30) RRID:RGD_598154598 In 1983, Wistar rats with pleural and ascites effusions and severe skin oedema were found at the Shionogi Pharmaceutical Co. The rats were named Nephrose Shionogi (NPS) because they showed nephrosis (F12). Breeding revealed that this phenotype was dominated by a autosomal recessive gene, np. NPS rats develop nephrosis at 4 weeks of age and die within 2 weeks. To prolong survival, NPS rats (np/+) were backcrossed with F344/Shi rats to generate the congenic strain (N12-13). 598154599 F344-Il2rgem1Larc Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan National BioResource Project for the Rat in Japan mutant Live Animals (as of 2025-04-30) RRID:RGD_598154599 This strain was generated at the Institute of Medical Science, University of Tokyo, by using CRISPR-Cas3. Microinjected into pronuclear-stage rat embryos of the F344/Jcl strain. The embryos were transferred into the oviducts of pseudopregnant females. A strain with a 1,869 bp deletion in the Il2rg gene was established from the resulting litters. 598154600 F344-Rag2em1Larc Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan National BioResource Project for the Rat in Japan mutant Live Animals (as of 2025-04-30) RRID:RGD_598154600 This strain was generated at the Institute of Medical Science, University of Tokyo, by using CRISPR-Cas3. Microinjected into pronuclear-stage rat embryos of the F344/Jcl strain. The embryos were transferred into the oviducts of pseudopregnant females. A strain with a 410 bp deletion in the Rag2 gene was established from the resulting litters. 598154602 WIC;W-Oprk1em1(cre)Nurep National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-04-30) RRID:RGD_598154602 Oprk1-cre rats were generated by Dr. Hiroko Tsukamura, Dr. Yoshihisa Uenoyama, Dr. Naoko Inoue, Dr. Mayuko Nagae (Nagoya University) and Dr. Masumi Hirabayashi (National Institute for Physiological Sciences). The CRISPR/Cas9 and adeno-associated virus vector (Oprk1 [exon 4], T2A, Cre) were introduced into the pronuclear stage embryos of Wistar rats (Crlj:WI). It was maintained by mating with the Wistar-Imamichi rats (Iar:WIC) (RGD:125097496) or by sibling mating. 598154604 ZFDM-Lcn2em1Nyo National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-04-30) RRID:RGD_598154604 "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA. " 598154608 ZFDM-Lcn2em2Nyo National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-04-30) RRID:RGD_598154608 "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA. " 598154611 SD-Tg(TOR1A)Tot University Clinics Tuebingen, Core Facility Transgenic Animals FORS/HIH Otfried-Mueller-Str. 27 Tuebingen 72076 Germany transgenic Unknown RRID:RGD_598154611 The full length humanTOR1A wild type gene including upstream and downstream flanking regions were inserted into a pUC19 vector. Following linearization and purification the transgenes were used to generate transgenic rats by microinjection of the DNA construct into the pronucleus of rat zygotes. Transgenic rats were kept on Sprague–Dawley background and bred as hemizygotes using standard procedures. Genotypes of offspring were determined by PCR and sequencing of DNA extracted from ear biopsies. Primer pair 5′-TAAAAATGTGTATCCGAGTGGAAAT (forward) and 5′-AAGGACTGAGTGTTGTTTCTTTTC (reverse) amplified a 230 bp segment within the coding sequence of exon 5 under the following conditions: 94 °C for 1 min, 60 °C for 1 min and 72 °C for 1 min, 40 cycles. Only lines that showed stable germline transmission of the transgenes were used for further analyses. 598154612 SD-Tg(TOR1ADYT1)Tot University Clinics Tuebingen, Core Facility Transgenic Animals FORS/HIH Otfried-Mueller-Str. 27 Tuebingen 72076 Germany transgenic Unknown RRID:RGD_598154612 The 16.25 kbps full length human DYT1 allele of TOR1A gene including upstream and downstream flanking regions were inserted into a pUC19 vector. Following linearization and purification the transgenes were used to generate transgenic rats by microinjection of the DNA construct into the pronucleus of rat zygotes. Transgenic rats were kept on Sprague–Dawley background and bred as hemizygotes using standard procedures. Genotypes of offspring were determined by PCR and sequencing of DNA extracted from ear biopsies. Primer pair 5′-TAAAAATGTGTATCCGAGTGGAAAT (forward) and 5′-AAGGACTGAGTGTTGTTTCTTTTC (reverse) amplified a 230 bp segment within the coding sequence of exon 5 under the following conditions: 94 °C for 1 min, 60 °C for 1 min and 72 °C for 1 min, 40 cycles. Only lines that showed stable germline transmission of the transgenes were used for further analyses. 598973841 F344-ApcPirc/UwmRrrc University of Wisconsin-Madison, Madison, Wisconsin Rat Resource and Research Center mutant Live Animals (as of 2025-05-11) ApcPirc 1554322 18 26732147 26790383 7 18 26725560 26820837 7 18 27011710 27106323 7 18 25828558 25925511 7 RRID:RGD_598973841 ThPirc rats were generated by crossing male F344-ApcPirc/Uwm (RGD:1641862) Pirc rats with wild-type female rats obtained commercially from Envigo Laboratories (Indianapolis, IN, USA), i.e., F344/NHsd. 598973845 SD-Gfapem1Mes+/- Waisman Center, University of Wisconsin Madison The strain is now deposited at Rat Resource and Research Center mutant Unknown Gfapem1Mes 150519905 10 92059881 92068555 7 10 90763150 90771823 7 10 90990762 90999435 7 10 87852891 87861631 7 RRID:RGD_598973845 The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human disease. The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The current background srain is Crl:CD (SD). This mutant strain serves as a model for Alexander disease. knockins have post-weaning failure to thrive and ~10% mortality by 12 weeks, but afterwards are viable and can breed . 598973846 SD-Gfapem1Mes+/+ Waisman Center, University of Wisconsin Madison The heterozygous mutant strain is now deposited at Rat Resource and Research Center mutant Unknown RRID:RGD_598973846 These rats are wild type littermates of the mutant where the rat GFAP gene was mutated based on the severity and frequency of the R239H mutation in human disease. The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The current background srain is Crl:CD (SD). This mutant strain serves as a model for Alexander disease. knockins have post-weaning failure to thrive and ~10% mortality by 12 weeks, but afterwards are viable and can breed . 616335891 LE-Synpoem2Kmh This strain was submitted by Masaaki (Masa) Kuwajima, PhD  (masa@mail.clm.utexas.edu). Strains were produced at Kristen Harris Laboratory, Department of Neuroscience, Center for Learning and Memory, University of Texas at Austin This strain is deposited at Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2025-05-13) RRID:RRRC_01025 Exons 2 and 3 were deleted to eliminate all known Synaptopodin isoforms in the outbred Long Evans (Charles River 006). It is similar to RRRC strain #964 (LE-Synpoem1Kmh) (RGD:155782907), has a different mutation location upstream of exon 2. 616335894 SD-ROSA26 em1(CAG-DdCBE-Mt-co3/Ilas Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College Rat Resource Center of China (www.ratresource.com) mutant Unknown RRID:RGD_616335894 The knock in of "CAG-loxP-stop-loxP-DdCBE-Mt-co3" to ROSA26 was induced by CRISPR/Cas9 in SD embryos from Vital River. This ROSA 26 knock in construct carrying DddA-derived cytosine base editor (DdCBE)linked to Mt-co3 was used to introduce premature stop codons in the rat Mt-co3 in mitochondrial genome in the presence of Cre recombinase. 616336063 SD-ROSA26 em1(CAG-DdCBE-Mt-co3, NeuN-Cre/Ilas Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College Rat Resource Center of China (www.ratresource.com) mutant Unknown RRID:RGD_616336063 This rat strain with neuronal specific knock out of Mt-co3 was generated by crossing a rat neuron-specific Cre strain (NeuN-Cre) with SD-ROSA26 em1(CAG-loxP-stop-loxP-DdCBE-Mt-co3/Ilas. Compared with the controls, the neuron-specific Mt-co3 knock out rats were largely normal in the first postnatal month, but progressively developed ALS-like symptoms afterward. 616336064 F344-ROSA26em11(CAG-EGFP,-mCherry)Larc Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan National BioResource Project for the Rat in Japan advanced_intercross_line Cryopreserved Sperm (as of 2025-05-14) RRID:RGD_616336064 F344/Jcl rat fertilized eggs were microinjected and transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the CAG promoter-loxP-EGFP-loxP-polyA-mCherry sequence inserted into the ROSA26 gene were selected and established.EGFP is expressed throughout the body, and when the EGFP sequence is removed in the presence of cre recombinase, mCherry is expressed. 616336065 F344-ROSA26em10(Alb-cre)Larc This strain was created at the Institute of Medical Science, University of Tokyo. Principle investigator is Masayuki Yamamoto Tohoku University National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-05-14) RRID:RGD_616336065 F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the Rosa26 gene were selected and established. Although the Alb promoter is inserted, cre leakage is confirmed throughout the body. 616336066 F344-ROSA26em20(Alb-cre)Larc This strain was created at the Institute of Medical Science, University of Tokyo. Principle investigator is Masayuki Yamamoto Tohoku University National BioResource Project for the Rat in Japan mutant Extinct (as of 2025-05-14) RRID:RGD_616336066 F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the ROSA26 gene were selected and established. The Alb promoter-Cre sequence is inserted in an inverted position. Cre is expressed specifically in the liver. 616336067 F344-Albem4(cre)Larc This strain was created at the Institute of Medical Science, University of Tokyo. Principle investigator is Masayuki Yamamoto Tohoku University National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2025-05-14) RRID:RGD_616336067 Fertilized eggs from F344/Jcl rats were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the 2A-Cre sequence inserted into the Albumin gene were selected and established. 616336068 LE.W-Tg(Dbh-tTA,-cre)2_7Fusa/Koba National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2025-05-14) RRID:RGD_616336068 This congenic strain was created by back crossing Long-Evans with The W-Tg(Dbh-tTA-2A-cre)2_7Fusa strain(RGD: 598092605) provided by Dr. Fusao Kato and Dr. Yukari Takahashi of the Jikei University School of Medicine. Background strain: Long-Evans (Institute for Animal Reproduction) Transgenes: DBH (rat), TetR (Escherichia coli), VP16 protein minimal "F"-type activation domain (Herpes simplex virus), 2A (Thosea asigna virus), Cre (P1 phage), bGlobin polyA (rabbit), loxP (P1 phage). 616362803 sP Sardinian alcohol-preferring rats University of Cagliari, Italy outbred Unknown RRID:RGD_616362803 The bidirectional breeding program of sP (Sardinian alcohol-preferring rats) and sNP (Sardinian non-alcohol-preferring) was begun in 1981 by Drs Fabio Fadda and Gian Luigi Gessa, at the University of Cagliari, Italy.Selection of sP and sNP rats started from a heterogeneous base population of outbred Wistar rats purchased from Morini, San Polo d’Enza, RE, Italy). The sP rats have alcohol preference in two-bottle chocice between water and 10% alcohol, while the sNP rats prefer water. 616362805 sNP Sardinian alcohol-non-preferring rats University of Cagliari, Italy outbred Unknown RRID:RGD_616362805 The bidirectional breeding program of sP (Sardinian alcohol-preferring rats) and sNP (Sardinian non-alcohol-preferring) was begun in 1981 by Drs Fabio Fadda and Gian Luigi Gessa, at the University of Cagliari, Italy.Selection of sP and sNP rats started from a heterogeneous base population of outbred Wistar rats purchased from Morini, San Polo d’Enza, RE, Italy). The sP rats have alcohol preference in two-bottle chocice between water and 10% alcohol, while the sNP rats prefer water. 616390066 SD-CdCSem1Bcgen+/- Cri du Chat Syndrome rat The animal facility of the Chongqing Medical University. mutant Unknown RRID:RGD_616390066 To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product). 616572761 SD-CdCSem1Bcgen+/+ The animal facility of the Chongqing Medical University. mutant Unknown RRID:RGD_616572761 This is the wild type littermate of SD-CdCSem1Bcgen+/- (RGD:616390066). The mutant CdCS rat has the 5p15.2 deletion in the genome and it a rat model for human Cri du Chat Syndrome . 616572805 HXB5/IpcvMcwi RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu RGD HRDP, contact Hybrid Rat Diversity Panel at HRDP@mcw.edu recombinant_inbred Unknown RRID:RGD_616572805 Embryo-rederived from breeder stock HXB5/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin. 616572806 BXH10/CubMcwi RGD HRDP, contact HRDP RGD HRDP, contact HRDP recombinant_inbred Unknown RRID:RGD_616572806 Embryo-rederived from breeder stock BXH10/Cub provided by Dr. Kren from Charles University, Department of Biology, Prague, Czech Republic, maintained at Medical College of Wisconsin