10000ACI/NA X C 9935, IrishCurtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR)inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecoveryspontaneous tumors; chronic renal disease; congenital malformationsTnfrsf1a62123710001AVN/OrlinbredUnknown10002BBDP/RhwS. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle.inbredUnknown10003BBDR/RhwS. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 +/- 53 days of age after the first and 67 +/- 10 days of age after the 9th cycle.inbredUnknown10004BC/CpbUObtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands.inbredUnknown10005BDIX/HanunknowninbredUnknown10006BDVII/CubDruckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype.inbredUnknown10008BN/SsNHsdObtained by HSD from nucleus colony at NIHinbredUnknown10009BP/CubinbredUnknown10010BUF/PitBuffaloinbredUnknown10011COP/OlaHsdThese are derived from the original colony which was developed by Dr. W.F. Dunning.inbredUnknown10012DA/PitNUnknowninbredExtinct10013DON/MelbinbredUnknown10014F344/PitinbredUnknown10015FHH/EurAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbredUnknown10016GH/OmrGenetically HypertensiveThis colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations.inbredUnknown10017GK/KyoSweGoto KakizakiDeveloped from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975).inbredUnknown10018IS/Kyoishibashi ratIshibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermOsteosis10019LE/MolLong EvansinbredUnknown10020LEW/PitLewisinbredUnknown10021LH/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbredUnknown10022LN/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbredUnknown10023LOU/CHanLouvainunknowninbredUnknown10024M520/NTo N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49.inbredCryopreserved Embryo10025MHS/GibMilan Hypertensive StrainOutbred Wistar rats with brother x sister mating and selection for high systolic blood pressureinbredUnknown10026MNR/NMaudsely non-reactiveTo N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.inbredExtinct10027MNRA/NTo Harrington in 1965 at F25 (Harrington 1981).inbredUnknown10028MNS/GibMilan Normotensive StrainOutbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.inbredUnknown10029MR/PitAs for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).inbredUnknown10030NEDH/KInbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.inbredUnknown10031NP9From WistarinbredUnknown10032ODU/NOsaka Dental UniversityFrom outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982).inbredExtinct10033OKA/WslinbredUnknown10034OM/ZtmOsborne-MendelunknowninbredUnknown10035P5CinbredUnknown10036PVG/PitinbredUnknown10037SD/RijFrom Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984).inbredUnknown10038SHR/OlaHsdSpontaneously Hypertensive RatinbredUnknown10039SHRSP/RivSpontaneously Hypertensive Rat, Stroke ProneinbredUnknown10040SR/JrSalt ResistantOriginated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b).inbredCryopreserved Embryo; Cryopreserved Sperm10041SS/JrSalt SensitiveStrain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982)inbredCryopreserved Embryo; Cryopreserved SpermHmox1280610042WAG/RijKyoRij > Kyo (1979, F?, GF)inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology10043WF/PitWistar FurthinbredUnknown10044WIST/NhgWistarFrom outbred Wistar stock in 1967.inbredUnknownUgt1a1|Abcd23935|6924410045WN/NInbred Wistar; W/NHeston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15.inbredUnknown10046WKY/OlaHsdinbredUnknown10047WTC/KyoWTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. A missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene (Ohno et al. 2015).inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03)60984GHUniversity of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973).inbredUnknown60985BNBNBillingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b).inbredUnknownCd36|Tnfrsf1a2301|62123760986BUF/NHeston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.inbredExtinct60987MHS/NMilan Hypertensive StrainMilan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).inbredExtinctAdd1|Add22041|204260988LOU/MBazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible. Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978).inbredUnknown60989BPStrain selected for resistance to Walker 256 tumour.inbredUnknown60990LH/MavRrrcLyon HypertensiveLyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed, unrestrained, conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2020-02-13)60991LELong EvansDr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984).inbredUnknown60992MNSMilan normotensive strainOutbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974).inbredUnknown60993FHHFawn Hooded HypertensiveAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbredUnknown60994F344FischerCurtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.inbredUnknown60995DRYRecombinant inbred strain used as normotensive control in studies of hypertension.inbredUnknown60996DONDonryu ratR. Sato 1950 by inbreeding Japanese albino rats.inbredUnknown60997DADADeveloped from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case.inbredUnknownEdnrb|Tnfrsf1a2536|62123760998COPThis Copenhagen (COP) rat was an inbred strain from Curtiss 1921 at Columbia University Institute for Cancer Research.inbredUnknown60999LEWLewisDr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992)inbredUnknownFgf2|Tnfrsf1a2609|62123761000SHRSpontaneously Hypertensive RatOkamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648).inbredUnknownAgtr1b|Cd36|Ephx22071|2301|62073261001NEDHInbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.inbredUnknown61002BDIXDruckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown61003BCHagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973.inbredUnknown61004WIST/ZihkFrom Wistar outbred stock in 1978.inbredUnknown61005OM/NOsborne-MendelHeston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).inbredExtinct61006PVGPVGKings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994).inbredUnknown61007WFWistar FurthJ Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995).inbredUnknown61008WAGWistar Albino GlaxoAL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984).inbredUnknown61009AVN Unknown. Keil University from O Stark, Charles University, Prague.inbredUnknown61010SHRSPSpontaneously Hypertensive Rat, Stroke ProneThe A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994).inbredUnknown61011BB/NBioBreeding ratMutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).inbredExtinct61013E3Kroning, Gottingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968.inbredUnknown61014OLETFOtsuka Long-Evans Tokushima fattyDeveloped by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence'inbredUnknown61015LN/MavRrrclyon normotensive(taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).inbredCryopreserved Embryo; Cryopreserved Sperm61096SHR/NCrukSpontaneously Hypertensive RatNIH derived strain maintained at the Charles River, United Kingdom.inbredUnknown61097WKY/NCrukNIH derived strain maintained at the Charles River, United Kingdom.inbredUnknown61098BXH/IpcvThese recombinant inbred strains are derived from the (BN-<i>Lx</i>/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknown61099HXB/IpcvDerived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published.recombinant_inbredUnknown61100SHR/OlaStrain originated from an inbred SHR strain from Harlan UK Ltd.inbredUnknown61103WKYThis strain was maintained at Medical College of Ohio, Toledo, OhioinbredUnknownCd36|Nos32301|318661104LEW/NCrlSubstrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34.inbredUnknown61105WKY/NHsdThese animals were bought from Harlan Indianapolis, Indiana U.S.A.inbredUnknown61106SHR.BN-(<i>D8Mit5-D8Mgh6</i>)/IpcvA segment of chr. 8 is transferred from the normotensive BN-<i>Lx</i>/Cub rat to the SHR/Ola.congenicUnknown61107BB/OKBioBreeding ratThis colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada.inbredCryopreserved SpermDiabetes Obesity; ImmunologyAsns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk52162|2280|2332|2481|2794|3082|3726|3807|69430|7051461109F344/NHsdF344/NHsdStrain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.inbredUnknown61110SHR/MolSpontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes.inbredUnknown61111DA/Slcdark agoutiThese were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983.inbredLive Animals6111213MThis is a Leprfa/Leprfa substrain derived from the Zucker rat.inbredUnknown61113BN-<I>Lx</I>These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.mutantUnknown61114DA/BklCommercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls.inbredUnknown61115BN/SsNTo N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony.inbredExtinct61116SHRSP/A3Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness.inbredUnknown61117BN-<i>Lx</i>/CubBrown Norway with polydactyly-luxateThese were derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background.inbredUnknown61118BUF/MnaStrain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermCancer; UrologyBsis222161119WKY/NCrlCrljOutbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974.inbredLive Animals; Cryopreserved Embryo61498BN/NHsdMcwiInbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115)inbredLive Animals; Cryorecovery61499SS/JrHsdMcwiInbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115).inbredLive Animals; Cryorecovery61517FHL/EurFawn Hooded Low blood pressureAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damageinbredUnknown67934WOKAOutbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.inbredUnknown67935WOKWOutbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designated WOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.inbredUnknown67936WR Sykora, Rosice (Stark et al 1968b). No further infromation.inbredUnknown67937WST Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986).inbredUnknown67938Y59 Strain developed in Zagreb, Jugoslavia.inbredUnknown67939YA/NNo further information.inbredExtinct67940YO Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992)inbredUnknown67941Z61Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours.inbredUnknown67942ZI A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989).inbredUnknown67943SHE/N-cpReference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94.inbredUnknown67945ISfrom a cross between a wild male and a Wistar female, with sib mating since 1968.inbredUnknown67948JC LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984).inbredUnknown67957APRDeveloped as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).inbredUnknown67958ASAlbino SurgeryUniversity of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973).inbredUnknown67959AS2Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968).inbredUnknown67960AUGDerived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England.inbredUnknown67962ANOutbred Wistar Imamichi strain.inbredUnknown67965AXC A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976.recombinant_inbredUnknown67966B Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85.inbredUnknown67967B/1NNo further information.inbredExtinct67971BBZStrain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3inbredUnknown67974BDEZentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring.inbredUnknown67975BDIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown67976BDIIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown67977BDIIIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown67978BDIVDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown67981BDVDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown67983BDVIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown67984BDVIIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976)inbredUnknown67986BDVIIIDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknown67987BDXDruckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.inbredUnknownLypd36905367988BEGfrom a cross between SC and TE.inbredUnknown67989BH D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973.inbredUnknown67990BI Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992)inbredUnknown67991BIL/1University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.inbredUnknown67993BIL/2University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.inbredUnknown68000BIRMBsame as BIRMA.inbredUnknown68001BLK/NThis strain has an agouti mutationinbredExtinctAsip200368007BROFO Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions.inbredUnknown68008BS University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966).inbredUnknown68011CNo further information.inbredUnknown68012CAP Polish Academy of Sciences, Krakow (Stark et al 1968a).inbredUnknown68013CAR/NHunt-Hoppert caries resistant; CA/RHunt 1937, developed for resistance to dental caries (Hunt et al 1955).inbredUnknown68014CASHunt 1937, developed for high incidence of dental caries.inbredUnknown68015CBHWoodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded).inbredUnknown68018CPB-WEWistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands.inbredUnknown68019CRDHCohen Rosenthal Diabetic Hypertensive As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995).inbredUnknown68020CWSR Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open.inbredUnknown68022DBNo further information.inbredUnknown68023DEBRDundee experimental bald ratThe DEBR rats have been bred at the University of Dundee since March 1984. The original crosses involved the inbred stock BDIX rats showing lesion and Wistar rat. The descendants of this cross resulted from full sib-matings.Two strains of DEBR rats are geing developed: the black-hooded and brown-hooded strains.inbredUnknown68026DSS/1NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N).inbredExtinct68027DSS/2NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).inbredExtinct68028DSS/3NThree inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).inbredExtinct68029DXE-1Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover)recombinant_inbredUnknown68031ET WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).inbredUnknown68032EXBHHannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990)inbredUnknown68034F6RMutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985).inbredUnknown68035FCHFice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol.inbredUnknown68036FH Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see strains FHH and FHL), which may have different characteristics.inbredUnknownRab38<sup>ru</sup>160031168038FHLsee FHH.inbredUnknown68040FNLFice Normolipidemic strain. Developed as a control strain for FCH (see FCH).inbredUnknown68041G Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977)inbredUnknown68042GEPRJobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a).inbredUnknown68044GHA The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973).inbredUnknown68046HCSHarvard to Liverpool, UK in 1960.inbredUnknown68047HMTOutbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor".inbredUnknown68048HS Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus.inbredUnknown68049HXB-1-43/IpcvSet of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs.recombinant_inbredUnknown68050IIMSet of nine strains bred as parallel strains from a single outbred colony maintained by B. Houssay in 1948. All strains were selected for large body weight and high fertility. One strain designated Beta IIM (RGD:40924649) derived from line 'b' became obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). Alpha IIM (RGD:40924650) was used as a control strain in study.inbredUnknown68051INR/NHarrington 1962 from a stock selected by CS Hall for low open field defaecation.inbredExtinct68052IRHarrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981).inbredUnknown68057K Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973).inbredUnknown68058KGH/PitNKunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).inbredExtinct68059KIRBY-B From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980).inbredUnknown68060KX developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977)inbredUnknown68061KYN/HokMakino, Hokkaido University 1960 from stock the carrying theinbredCryopreserved Embryo; Cryopreserved Sperm68062LA/Nfrom a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).inbredExtinct68063LA/N-<i>cp</i>The corpulent (LA/N-cp) ratdeveloped at the National Institutes of Health (NIH) is a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. The obese homozygous (cp/cp) littermates developspontaneous insulin resistance, obesity, impaired glucose tolerance, hypertriglyceridemia and atherosclerosis.congenicUnknown68065LEA Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993)inbredUnknown68066LECIn 1975, at the Center for Experimental Plants and Animals, Hokkaido University, Long Evans Cinnamon was derived originally from a closed colony of Long-Evans rats obtained from Kobe University in 1975.inbredUnknown68067LEJ/HokHok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication).inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm68068LEM Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980).inbredUnknownCkb235768069LEO from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980).inbredUnknown68070LEP Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984)inbredUnknown68071LER/NOriginally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology.inbredExtinct68072LET from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1inbredUnknown68073LETL A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., JapaninbredUnknown68074LETOTHe LETO was obtained by mating of Long-Evan rats in Otsuka Pharmaceutical Co.The LETO has not shown the diabetic syndrome.inbredUnknown68077LL/MavRrrcLyon hypotensiveLyon Low-Tensive. See LHinbredCryopreserved Embryo; Cryopreserved Sperm68079LOU Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978).inbredUnknown68082LUDWLudwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU.inbredUnknown68083LXB Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover)recombinant_inbredUnknown68084M14 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum.inbredUnknown68085M17AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum.inbredUnknown68086M520Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992).inbredUnknown68087MAXXFrom a cross of BNxLEW with subsequent inbreeding.inbredUnknown68088MFDeveloped as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).inbredUnknown68091MLCSMilan low-calpastatin strainFrom a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity.recombinant_inbredUnknown68097MSUBL Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977).inbredUnknown68098MWMunich WistarMunich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS.inbredUnknown68099MWFFrom outbred Wistar rats selected for large numbers of superficial glomeruli.inbredUnknown68100NBL Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990).inbredUnknown68103NERnoda epileptic ratFrom Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has.inbredUnknown68104NIG-III/HokFrom a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987).inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm68106NSD/NNIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock.inbredExtinct68107NZRSubline of AS2 separated at F32.inbredUnknown68109ODUSAs for ODU, but maintained at Osaka Dental University.inbredUnknown68113OXYR/NovDeveloped in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain.inbredUnknown68114OXYS/NovDeveloped in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats.inbredUnknown68115P77PMCWistar rats from Beijing Medical College in 1977.inbredUnknown68116PA King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction.inbredUnknown68117PETH/NRoyal College of Surgeons, RCS Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS.inbredUnknown68118PKDPKDOutbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991.inbredUnknown68119PSDO/NReserved symbol for strain in development now at F6 (NIH 1989).inbredExtinct68121RMuhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R.inbredUnknown68122RCS/NDeveloped before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline.inbredExtinct68123RHA/NRoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated.inbredExtinct68124RII/1 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991).inbredUnknown68125RII/2 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991).inbredUnknown68126RLA/NBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains.inbredUnknown68127RP/AEurRijMuhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991).inbredUnknown68128S5B Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating.inbredUnknown68129SBHSabra hypertensiveSabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics).inbredUnknown68130SBN As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984).inbredUnknown68131SC Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360)inbredUnknown68133SDJ/HokTakeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966.inbredCryopreserved Embryo; Cryopreserved SpermSlc2a2370568134SDNKSprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan.inbredUnknown68136SELDunning 1948. Probably extinct.inbredUnknown68137SHHF JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile.inbredUnknownGrk2|Grk32062|206368140SPRD/HsdOriginated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony.outbredUnknown68143TAOutbred Wistar Imamichi.inbredUnknown68144TEOutbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987).inbredUnknown68145TFFrom outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988).inbredUnknown68146THA Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990).inbredUnknown68147THE/UtpTsukuba high-emotional ratWistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE).inbredCryopreserved Embryo; Cryopreserved SpermBehavior68148TLE/UtpTsukuba low-emotional ratWistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE).inbredCryopreserved EmbryoBehavior68149TMTester Moriyama rat Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication).inbredUnknown68150TMB PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbredUnknown68151TMD PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbredUnknown68152TO/HokTokyo ratA breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994).inbredCryopreserved Embryo; Cryopreserved Sperm68154TOM Toma Institute, Japan (Ikadai, personal communication, 1991)inbredUnknown68155TS WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).inbredUnknown68156TS1 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbredUnknown68157TS3/NHarrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).inbredExtinct68158TT outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991).inbredUnknown68160TU From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991)inbredUnknown68161TW Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985).inbredUnknown68162TX From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991)inbredUnknown68163U Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990).inbredUnknown68164UChA Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.inbredUnknown68165UChB Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.inbredUnknown68166W/Hok Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977).inbredUnknown68167W/Nhg Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany.inbredUnknown68168WA St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983.inbredUnknown68169WAB Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977).inbredUnknown68171WBB/1NNo further informationinbredExtinct68172WBB/2NNo further information.inbredExtinct68173WBN Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived.inbredUnknown68174WCF R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot.inbredUnknown68175WDFIkeda et al (1981) by backcrossing the fatty gene to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus.inbredUnknown68176WEC Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).inbredUnknown68177WEK Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).inbredUnknown68178WELSOutbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984)inbredUnknown68180WINWI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986).inbredUnknown68183WKA King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992)inbredUnknown68184WKAH/HokWistar-King Aptekman HokkaidoKing 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA.inbredCryopreserved Embryo68185WKAM King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA.inbredUnknown68186WKHA/NFrom a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure.inbredExtinct68187WKHT/NFrom a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992).inbredExtinct68188WKS National Institute of Genetics, Mishima, Japan.inbredUnknown68189HTX/HcjD. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30.inbredUnknown69369SSFrom a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension.inbredUnknown69638BN/KaBrown Norway Katholiek (kininogen or kinin deficient)Kitasato University, Kanagawa, Japan.inbredUnknown69643F344/DuCrlCrljThis strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976.inbredLive AnimalsNeurobiology; Cardio Hypertension70410AAAlko, AlcoholWistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as drink for 10 days, after which they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. Fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight, so alcohol intake was used as a phenotypic measure.inbredUnknown70411ANAAlko, Non-AlcoholWistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure.inbredUnknown70413WBBinbredUnknown70416ACHCurtiss and Dunning 1926 at Columbia University Institute for Cancer Research.inbredUnknown70417A28807/NCurtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982).inbredExtinct70418A35322Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990.inbredUnknown70419A7322Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus.inbredUnknown70420A990Curtiss 1921 at Columbia University Institute for Cancer Research.inbredUnknown70421AAWAtomic Energy Commission, Melbourne (Adams et al 1984).inbredUnknown70422ABHYamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan.inbredUnknown70423ACPDunning to National Cancer Institute 1967 at F54.inbredUnknown70424AGANakic, Zagreb (Stark et al 1968b). Used for immunological studies.inbredUnknown70425AGUSGerm-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26.inbredUnknown70426ALB/NAlbanyWolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer.inbredUnknown70427AMTorres, Rio de Janeiro, from outbred stock.inbredUnknown70428AMDILTorres, Rio de Janeiro, from outbred stockinbredUnknown70429AOFrom ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995).inbredUnknown70440BIRMAAM Mandl 1952 from Albino rats purchased from Birmingham market.inbredUnknown70446LIH/LacLiverpool Hooded"Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981).inbredUnknown70447MNRMaudsely non-reactivePL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982).inbredUnknown70448MNRASubstrain of MNR. To Harrington in 1965 at F25 (Harrington 1981).inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)70449MR/NMaudsely reactiveOrigin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).inbredUnknown70450NBRPoiley 1966 from heterogeneous stockinbredUnknown70451OKAFrom faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days.inbredUnknown70452OMOsborne-MendelHeston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).outbredUnknown70453SRRapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen.inbredUnknown70454WKY/NNational Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain.inbredCryopreserved Embryo (as of 2019-02-01)70455WKYO/KyoInbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991).inbredCryopreserved Embryo; Cryopreserved Sperm70456WMWistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Mishima in 1951.inbredUnknown70457WMSMunich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWFinbredUnknown70459ZDFVancouver diabetic fatty Zucker"Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b).inbredUnknown70508SDSprague-DawleyThis strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain, probably Wistar) and subsequently to his white female offspring for 7 generations. All the current colonies are from this original stock.outbredUnknownAqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f12141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|72889270509F344/NRrrcCurtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.inbredCryopreserved SpermCdkn2a|Gfap|Tnfrsf1a2323|2679|621237625624LE<i>Tsc2<sup>Eker</sup></i>/HinEker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo.mutantUnknownTsc2|Tsc2<sup>Eker</sup>3908|12791989625659DRH/SeacEstablished by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermCancer628372ACI.FHH-(<i>D1Mit34-D1Rat156</i>)/EurThe Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI.congenicUnknown628486NER/KyoNoda epileptic rat, GMSOriginated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology628525Ni/HinFound in the Sprague-Dawley (Jci:SD) in Japan. In these the Tsc2 gene is not mutated. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstreaminbredUnknown628907SHR.BN-RT1<sup>n</sup>This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR.congenicUnknown628908SHR.BN-(<i>D1Mit3-Igf2</i>)/IpcvSegment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating.congenicUnknownIgf2|Sa|Scnn1b|Scnn1g2870|3616|3640|3641628909SHR.BN-(<i>D13Arb5-Ren1</i>)/IpcvSegment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity.congenicUnknown629459ZUC-<i>Lepr<sup>faSteJrpz-/-</sup></i>Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology.mutantUnknown629462ZUC-<I>Lepr</I><sup>faSte-/-</sup>This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size.mutantUnknownLepr<sup>fa</sup>13432153629463ZUC-<I>Lepr</I><sup>+Ste</sup>This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype.mutantUnknownLepr3001629464ZUC-<I>Lepr</I><sup>fa</sup>This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions.mutantUnknownLepr<sup>fa</sup>13432153629465SHR/NCrlCrljNIH derived strain maintained at the Charles River, Japan.inbredLive Animals; Cryopreserved EmbryoCardio Hypertension629481SHR.WKY-(<i>D1Wox33-D1Got194</i>)This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background.congenicUnknown629482WKY.SHR-(<i>D1Wox19-D1Mit2</i>)/NjsFragment of the chromosome 1 derived from SHR and repeated backcross to WKYcongenicUnknown629484LEW-<i>tl</i>The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N.congenicUnknownCsf1|Csf1<sup>tl</sup>621063|12910954629485LE/StmThe LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50.inbredLive Animals; Cryopreserved SpermDiabetes Obesity; Cancer629486PVG/OlaHsdblack hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992inbredCryorecovery629487SHR.WKY-(<i>D1Wox19-D1Wox34</i>)/NjsFragment of the chromosome 1 derived from WKY and repeated backcross to SHRcongenicUnknown629488SI-Tg(Ednrb)Ywatransgenic spotting lethalA 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals.transgenicUnknownEdnrb|Ednrb<sup>sl</sup>2536|10755424629489Eker-Tg(Tsc2)5HinWild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.transgenicUnknownTsc23908629490DA.F344-Aia1/1genomic segments with region of interest from chr 20 were inserted to DA straincongenicUnknown629491DA.F344-Aia1/2genomic segments with region of interest from chr 4 were inserted to DA straincongenicUnknown629492SlNatural mutation in the progeny of a Wistar-Imamichi female and a wild rat.mutantUnknownEdnrb|Ednrb<sup>sl</sup>2536|10755424629493DA.F344-Aia1/3genomic segments with region of interest from chr 4 were inserted to DA straincongenicUnknown629494DA.F344-Aia1/4genomic segments with region of interest from chr 10 were inserted to DA straincongenicUnknown629495WKY.SHRSP-(<i>Mt1pa-D1Rat57</i>)/BbbFragment of the chromosome 1 derived from SHRSP and repeated backcross to WKYcongenicUnknownMt1-ps13118629499BXS/IpcvThese recombinant inbred strains are obtained by crossing normotensive BN-<i>Lx</i>/Cub with hypertensive SHR/Ola progenitor strains.recombinant_inbredUnknown629500LEXF/StmRecombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating.recombinant_inbredUnknown629501SD-Tg(Ren2)27This is a hypertensive rat strain in which the mouse Ren2 renin gene along with its 5' and 3' flanking sequences were microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background.transgenicUnknownAgtr1b|Ace2071|2493629502SHR.BN-(<i>Il6-Npy</i>)This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotescongenicUnknownIl6|Npy2901|3197629503SHR.BN-(<i>D19Rat57-D19Mit7</i>)/IpcvThe segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating.congenicUnknownAgt2069629504WKY.SHR-(<i>D1Mit3-D1Rat57</i>)/IwaiFragment of the chromosome 1 derived from SHR and repeated backcross to WKYcongenicUnknown629505SS.MNS-(<i>D10Mit11-D10M11Mit119</i>)/Mcofragment of the chromosome 10 derived from MNS and repeated backcross to SS/JrcongenicUnknown629506LEW-<i>tl</i>.BN-(<i>D2Arb16-D2Wox8</i>)LEW.<i>tl</i> carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2.congenicUnknownCsf1621063629509FHH/EurMcwiAn outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.inbredLive Animals; Cryorecovery629510SS.BN-(<i>D12Arb13-D12Rat79</i>)/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedcongenicLive Animals629511SS-Chr 2<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629512FHH-Chr 12<sup>BN</sup>/McwiA cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629513SS-Chr 4<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629514SS-Chr 6<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Cryopreserved Sperm629515SS-Chr 7<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629516SS-Chr 8<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629517SS-Chr Y<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629518SS-Chr 9<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629519SS.BN-(<i>D13Mgh13-D13Mit4</i>)/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedcongenicUnknown629520FHH-Chr 1<sup>BN</sup>/McwiA cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressedconsomicLive Animals; Cryopreserved Sperm629521SS-Chr 11<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629522SS-Chr 20<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629523SS-Chr 13<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm629524SS-Chr 16<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Cryopreserved Sperm629525SS-Chr 18<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm629548SHR.BN-(<i>D1Mit3-Igf2</i>)/1lpcvSHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv.congenicUnknown629578SS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generationscongenicUnknown631158DXE1/ZtmDXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.recombinant_inbredUnknown631160DXE2/ZtmIs a recombinant inbred strain produced from a cross between DA/Han and E3/Han ratsrecombinant_inbredUnknown631161DXE3/ZtmIs a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.recombinant_inbredUnknown631163LE/BluGillThis inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock.inbredUnknown631182DA/BklArbNThis is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding.inbredExtinct631219SDT/JclEstablished from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating.inbredLive Animals (as of 2021-04-23)631220SS.LEW-(<i>D10Mco1-D10Mco31</i>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenicUnknown631275WKY/CfdWKY/CfdSubstrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA)inbredUnknown631276WKHA/CfdWKHA/CfdOriginated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM)inbredUnknown631278SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/GcrcCongenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background.congenicUnknownFst|Gstm1|Vcam1|S1pr12633|2755|3952|61958631279SHRSP.WKY-(<I>D2Rat13-D2Mit5</I>)/GcrcCongenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.congenicUnknownFst2633631280WKY.SHRSP-(<I>D2Mit5-D2Mgh12</I>)/GcrcCongenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.congenicUnknownPklr3336631281WKY.SHRSP-(<I>Fst-Pklr</I>)/GcrcCongenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.congenicUnknownFst|Pklr2633|3336631282DA.F344-(<I>D10Arb20-D10Arb22</I>)/ArbThis speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background.congenicExtinct631283DA.F344-(<I>D10Arb21-D10Arb22</I>)/ArbThis congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.congenicExtinct631285IER/IhrA mutant rat strain which is a useful model for human cataract.inbredLive AnimalsNeurobiology; Ophthalmology631286WKY/IzmWistar-KyotoWKY strain from the Izumo colonyinbredLive Animals631294F344.GK-(<I>D1Arb42a-D1Rat90</I>)/SweThis congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 backgroundcongenicUnknownCyp2c122470631571SS.LEW-(<i>D1Uia8-D1Mco38</i>)/JrSegment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.congenicUnknown631572SBH/YglSabra hypertension proneBred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.inbredUnknown631573SBN/YglSabra hypertension resistantBred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.inbredUnknown631574Wild/KWild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany.wildUnknown631576LEW/CrlCrljDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34.inbredLive Animals; Cryopreserved EmbryoImmunology; Osteosis631577SHR/IzmStrain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).inbredLive AnimalsCardio Hypertension631578SHR.BN-(<I>D2Rat171-D2Arb24</I>)/IpcvThis congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv backgroundcongenicUnknown631579LEW/OlaHsdObtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands.inbredUnknown631581LEW.1FOriginally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1<sup>f</sup> haplotype into the LEW stockinbredUnknown631582SS.WKY-(<i>Mme-D2Wox18</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/JrcongenicUnknownMme3098631583SS.WKY-(<i>D2Mgh8-D2Mgh9</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/JrcongenicUnknown631585SS.LEW-(<I>D16Mit2-D16Rat12</I>)/AydThis congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr backgroundcongenicUnknown631586SS.MNS-(<I>D10Mco14-D10Mit11</I>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenicUnknown631587SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenicUnknownAce2493631588SS.MNS-(<i>D10Mit11-Vamp2</i>)/McoFragment of the chromosome 10 derived from MNS and repeated backcross to SS/JrcongenicUnknownVamp23949631589SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/NjsCongenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHRcongenicUnknown631590SHR.WKY-(<i>D1Wox34-Sah</i>)/NjsCongenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHRcongenicUnknownAcsm362086631591WKY.SHR-(<i>D1Rat56-D1M7Mit206</i>)/NjsCongenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>DWox19-D1Mit2</i>) to WKYcongenicUnknown631592WKY.SHR-(<i>D1Rat236-D1M7Mit206</i>)/NjsCongenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>D1Wox19-D1Mit2</i>) to WKYcongenicUnknown631593LEW/RjStrain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).inbredUnknown631594BN/RjStrain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).inbredUnknown631595LEW.1AV1.DA-(<i>D10Rat92-D10Rat135</i>)/UbcLEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain.congenicUnknown631596LEW.1AV1.DA-(<i>D10Rat92-D10Wox17</i>)/UbcCongenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2.congenicUnknown631597LEW.1AV1.DA-(<i>D10Wox17-D10Rat135</i>)/UbcCongenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2congenicUnknown631598LEW.1AV1.DA-(<i>D10Got154-D10Rat135</i>)/UbcCongenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2congenicUnknown631599SHRSP/IzmStrain has been maintained at Kyoto University.inbredLive AnimalsCardio Hypertension; Neurobiology631600WKY.SHRSP-(<i>Mt1pa-D1Rat200</i>)/BbbFragment of the chromosome 1 derived from SHRSP and repeated backcross to WKYcongenicUnknownMt1-ps13118631601WKY.SHRSP-(<i>Asgr1-Vamp2</i>)/BbbBoth the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and AokicongenicUnknownAsgr1|Vamp22160|3949631602BN/ElhThese rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony.inbredUnknown631603WKY/SnkThe original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.inbredUnknown631604SHR/SnkThe original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.inbredUnknown631605SS.LEW-(<i>D10Arb9-D10Got101</i>)/JrCongenic strain originated from an inbred SS/Jr strain.congenicUnknown631606SS.MNS-(<i>D10Rat13-D10Mit11</i>)/JrCongenic strain originated from an inbred SS/Jr strain.congenicUnknown631607SS.WKY-(<i>D2N35-Mme</i>)/McoFragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/JrcongenicUnknownMme3098631610SS.LEW-(<i>D1Rat39-D1Rat131</i>)/JrSegment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.congenicUnknown631691SHRSP/A3IzmSubstrain originates from the SHRSP/Izm strain.inbredUnknown631693WKY.SHRSP-(<i>Shbg-Atp1b2</i>)/BbbThis strain has the blood pressure locus from chr 10congenicUnknownAtp1b2|Shbg2171|3671631694WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)/BbbThis single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)congenicUnknown631695SS/JrRkbThis inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat BerlininbredUnknown631696SHR/FubRkbStrain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin.inbredUnknown631697BBDP/HriThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977.inbredUnknown631698BN/MolThis strain is maintained at the Mollegaard breeding center.inbredUnknown631699BB.SHR-(<i>D6Rat184-D6Rat101</i>)/KCongenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females.congenicUnknown631700BB.SHR-(<i>Gnal-D18Mit9</i>)/KDiabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long.congenicUnknownGnal2715631703SS.LEW-(<i>D10Rat207-D10Mgh1</i>)/AydCongenic strain originated from an inbred SS straincongenicUnknown631844HAD1high-alcohol-drinkingThese high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption.inbredUnknown631845LAD1low-alcohol-drinkingThese low-alcohol-drinking were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption.inbredUnknown631846F344.GK-(<i>D1Mgh10-D1Rat90</i>)/SweCongenic strain originated from an inbred F344/Mcwi straincongenicUnknown631847F344.GK-(<i>D1Mit7-D1Mgh25</i>)/SweCongenic strain originated from an inbred F344 straincongenicUnknown631848SHR/OlaIpcvThese are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf1 was identified in this strain.inbredUnknownSbf1<i><sup>m1Ipcv</sup></i>10002755634359WF.WKY-(<i>D5Pas1-D5Uwm37</i>)/UwmWKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region.congenicUnknown634363LEW/NIcoCrlfA substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.inbredUnknown634364SHR/NIcoCrlfA substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.inbredUnknown634365SS/HsdThis strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.inbredUnknown634366SR/HsdThis strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.inbredUnknown634367BN/CrlCrlj1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced.inbredLive Animals; Cryopreserved EmbryoOphthalmology; Immunology634369WBN/KobSlcwistar bonn/koboriThis strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1.inbredLive AnimalsDiabetes Obesity; Ophthalmology634370F344.GK-(<i>D1Mgh10-D1Rat119</i>)/SweGK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain.congenicUnknown634372GHSSD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain.inbredUnknown634373DA/ZtmRhdDA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.inbredUnknown634374E3/ZtmRhdE3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.inbredUnknown634376LEA/NcuThese rats were established from a closed colony of Long-Evans.inbredUnknown634377BN/SeaBN/SeaThis inbred strain was obtained from Sea life SupplyinbredUnknown634380Palcohol-preferringThese were developed at Indiana University for high-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats.inbredUnknownNpy3197634381NPalcohol-nonpreferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats.inbredUnknownNpy3197634382SHR.BN-(<i>D5Wox12-D5Wox20</i>)/IpcvThis congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv backgroundcongenicUnknown634743BILUniversity of Pittsburgh from a mutation in a colony of unknown background held by the NIH.inbredUnknown724569MWF/FubRkbMunich Wistar FromterThe MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm).inbredUnknown724570LEW/RkbThe LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany.inbredUnknown724571MITE/MnaThis strain was established from captured Japanese wild rats.inbredUnknown724572SS.LEW-(<i>D10Wox51-D10Rat27</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown724573SS/JrTolDahl salt-sensitive (SS/Jr) ratsIn the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet.inbredLive Animals (as of 2021-06-08)724574SHR/NHsdSHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN)inbredUnknown724575SS.LEW-(<i>D10Rat17-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown724576KDP/TkyKomeda diabetes-prone ratThis is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross.inbredLive Animals; Cryopreserved EmbryoDiabetes Obesity; ImmunologyCblb620535724577SS.LEW-(<i>D10Rat27-Igfbp4</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknownIgfbp42875728133BN-<I>RT1<SUP>n</SUP></I>/RjThis coisogenic strain was produced by selecting BN rats with the <I>RT1<SUP>n</SUP></I> allele.coisogenicUnknown728134SS.LEW-(<I>D1Rat35-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenicUnknown728135SS.LEW-(<I>D5Uwm14-D5Uwm31</I>)/JrS.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S straincongenicUnknown728137SS.LEW-(<I>D10Rat141-D10Mgh1</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenicUnknown728138SS.MNS-(<I>Mme-Gca</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitivecongenicUnknownAtp1a1|Mme|Npr12167|3098|3195728139WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>)/BbbThis double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(<I>Shbg-Atp1b2</I>) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(<I>Shbg-Atp1b2</I>) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLscongenicUnknown728140SS.LEW-(<I>D10Rat11-D10Mgh1</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenicUnknown728142BN.SHR-(<i>Il6-Cd36</i>)/CubThis congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR.congenicUnknownCd36|Il62301|2901728143SS.LEW-(<I>D1Mco38-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenicUnknown728144BN.PD-(<I>D8Rat39-D8Rat35</I>)/CubThis congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM.congenicUnknown728145SS.LEW-(<I>D5Rat130-D5Rat108</I>)/JrS.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S straincongenicUnknown728146F344.BN-(<I>D3Mgh13-D3Mgh7</I>)/DlwThis congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USAcongenicUnknown728147BN.PD-(<I>D8Rat39-D8Rat35</I>),SHR-(<I>D4Mgh2-Cd36</I>),SHR-(<I>D20Wox3-D20Mgh5</I>)/CubThis is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM.congenicUnknown728148SS.LEW-(<I>D16Uia2-D16Rat12</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenicUnknown728151UPL/NccThe UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony.inbredUnknown728152SS.LEW-(<I>D1Rat196-D1Mgh7</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenicUnknown728153SS.LEW-(<I>D1Rat196-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenicUnknown728155BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/1RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.congenicUnknown728156SS.LEW-(<I>D5Mco34-D5Mco10</I>)/JrSS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S straincongenicUnknown728157SS.LEW-(<I>D5Rat130-D5Mit19</I>)/JrSS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS straincongenicUnknown728158SS.LEW-(<I>D5Uia4-D5Mco10</I>)/JrSS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS straincongenicUnknown728159SS.LEW-(<I>D1Mco36-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.congenicUnknown728161PD/CubpolydactylousStrain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the dolydactyly-luxate syndrome.inbredUnknown728162SS.LEW-(<I>D1Mco87-D1Rat71</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.congenicUnknown728163SS.LEW-(<I>D1Uia2-D1Rat49</I>)/JrInbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.congenicUnknown728165SS.LEW-(<I>D1Rat196-D1Mco36</I>)/JrSegment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.congenicUnknown728166WKY.SHRSP-(<I>D1Rat112-D1Wox29</I>)/IzmA segment from SHRSP/Izm was transferred on a WKY/Izm backgroundcongenicUnknown728167SS.LEW-(<I>Nos2-D10M11Mit119</I>)/AydStrains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segmentcongenicUnknownNos23185728168WOKThe inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, GermanyinbredUnknown728170SS.MNS-(<I>Mme-D2Mit14</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S straincongenicUnknownAtp1a1|Mme2167|3098728171LEW-<I>RT1<SUP>1</SUP></I>/RjThis coisogenic strain was produced by selecting LEW rats with the <I>RT1<SUP>1</SUP></I> allele.coisogenicUnknown728172SS.MNS-(<I>D2Mit6-Adh1</I>)/AydSegments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNScongenicUnknownAdh1|Agtr1b|Atp1a12044|2071|2167728183WF/NTo N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia.inbredUnknown728184SHRSP/A3NTo NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517)inbredExtinct (as of 2020-04-21)728185N:NIHDeveloped in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony.outbredExtinct728186LEW/SsNTo N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31.inbredExtinct728187ACI/N-jStrain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH.congenicExtinct728188LOU/MNTo NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence.inbredExtinct (as of 2020-09-04)728189SHR/N-<I>di</I>Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.congenicUnknown728190RCS-<I>rdy-c</I>Albino retinal dystrophyThis congenic strain is obtained from pink-eyed, tan-hooded RCS ratscongenicUnknown728191LOU/CNTo N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045)inbredExtinct728192RCS-rdy-pThis congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks.congenicUnknown728193N:SDSprague-DawleyTo N 1945 from Sprague Dawley, Inc. Colony closed since then.outbredExtinct728194SHR/NTo N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.inbredExtinct728195SHR/N-<i>cp</i>The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolerance. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis.congenicCryopreserved Embryo (as of 2021-01-20)728196RHA/N-<i>j</i>Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.congenicExtinct728197RCS-rdy-+This congenic strain is obtained from pink-eyed, tan-hooded RCS ratscongenicUnknown728198BHE/NBureau of Home EconomicsTo N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University.inbredExtinct728199RHARoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965).congenicUnknown728200ACI/N-<I>di</I>Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41.congenicUnknown728358SBThis outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear.outbredUnknown728383UPL/CasUpjohn Pharmaceuticals LimitedIn 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating.inbredUnknownGja8<sup>m1Cas</sup>13524999728384SS.LEW-(<i>D10Rat24-Igfbp4</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknownIgfbp42875728385WF.COP-(<i>D2Rat2-D2M13Mit286</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenicUnknown728386SS.LEW-(<i>D10Rat119-D10Rat133</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown728387WF.COP-(<i>D2Mit29-D2Uwm13</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenicUnknown728388SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown728389WF.COP-(<i>D2Mit29-D2Rat201</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenicUnknown728391WF.COP-(<i>D2Rat253-D2Uwm17</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.congenicUnknown728392RHA/N-<I>di</I>Roman high avoidance-<i>di</i> mutationBrattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.congenicUnknown728393SS.LEW-(<i>D10Got125-D10Rat120</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown728394SS.LEW-(<i>D10Rat55-D10Rat13</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown728395SS.LEW-(<i>D10Rat55-D10Rat120</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown728396SS.LEW-(<i>D10Mco15-D10Mgh1</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown731185MWF/FubMunich Wistar FromterMunich Wistar Fromter rats were obtained from colonies at the Freie Universitat, Benjamin Franklin Campus Berlin, GermanyinbredUnknown731186SHR/FubSpontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, GermanyinbredUnknown731187HAD2high-alcohol-drinkingThese were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings.inbredUnknown731188LAD2low-alcohol-drinkingThese were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings.inbredUnknown731189SHRSP.WKY-(<i>Klk1-D1Rat116</i>)/IzmA segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method.congenicUnknown731190SS.LEW-(<i>D1Rat211-D1Rat18</i>)/McoA segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.congenicUnknown731191SHRSP.WKY-(<i>D2Rat14-D2Mgh12</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.congenicUnknown731192SS.LEW-(<i>D3Rat52-D3Rat130</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydcongenicUnknown731193DA.PVG-(<i>D4Rat141-D4Mgh11</i>)PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies.congenicUnknown731194SS.LEW-(<i>D3Chm64-D3Rat17</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydcongenicUnknown731195DA.E3-(<i>D14Wox8-D14Rat64</i>)/RhdThe fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain.congenicUnknown734471SS.LEW-(<i>D1Mgh7-D1Mco41</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background.congenicUnknown734472SS.LEW-(<i>D1Mco2-D1Wox6</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background.congenicUnknown734473SS.LEW-(<i>D17Mco3-D17Mco10</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.congenicUnknown734474SS.LEW-(<i>D5Mit9-D5Mco10</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.congenicUnknown734475DA/OlaHsdOdell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965.inbredUnknown734476Crl:CD(SD)Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system.outbredUnknown734478F344/DuCrlThis colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960.inbredUnknown734479SS.LEW-(<i>D1Mco2-D1Rat49</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background.congenicUnknown734480SS.LEW-(<i>D10Mit10-D10Mgh1</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.congenicUnknown734481SS.LEW-(<i>D1Mco2-D1Mco35</i>)/JrSS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background.congenicUnknownSa3616734482SS.LEW-(<i>D1Rat45-D1Mco41</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.congenicUnknownSa3616734483SS.LEW-(<i>D1Rat42-D1Wox10</i>)/JrThis is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.congenicUnknown734526OLETF/GotOtsuka Long Evans TokushimaLong Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating.inbredUnknown734527OLETF.F344-(<i>D1Rat169-D1Rat459</i>)/GotFemale OLETF/Got rats were crossed with F344/DuCrlCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.congenicUnknown734528OLETF.BN-(<i>D1Rat76-D1Rat459</i>)/GotFemale OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.congenicUnknown734531OLETF.F344-(<i>D1Rat306-D1Rat461</i>)/GotFemale OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation.congenicUnknown734758DA/HamDark-agoutiOriginal DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).inbredUnknown734759SHRSP/GcrcSpontaneously hypertensive rat, stroke proneSHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIHinbredUnknown734760WKY/GcrcWistar-KyotoWKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIHinbredUnknown734761WF/KgaWistar-FurthObtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan).inbredUnknown737657LEW.1AV1Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1<sup>av1</sup> haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region.congenicExtinct737658PVG.1AV1Piebald-Virol-GlaxoOriginally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, GermanycongenicUnknown737690F344/CrliThese animals were from Charles River Italia, Calco, LC, ItalyinbredUnknown737691BN/CrliThese animals were from Charles River Italia, Calco, LC, ItalyinbredUnknown737703LEW-Tg(HLA-B*0702,B2M)120-4Trg<sup>Tg/Tg</sup>Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2020-07-08)737857DA.PVG.1AV1-(<i>D4Rat155-D4Rat84</i>)Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenicUnknown737858DA.PVG.1AV1-(<i>D4Rat155-Spr</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenicUnknownSpr3753737859DA.PVG.1AV1-(<i>D4Mgh17-D4Rat56</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenicUnknown737861DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenicUnknown737862SHRSP.WKY-(<i>D2Rat14-D2Mit5</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.congenicUnknown737863SHRSP.WKY-(<i>D2Wox9-D2Mgh12</i>)/GcrcA segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSPcongenicUnknownGstm12755737864SS.SR-(<i>D13Mit9-D13Mit1</i>)/JrCongenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain.congenicUnknown737865WKY.SHRSP-(<i>D2Rat14-D2Mgh12</i>)A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY.congenicUnknown737866WKY.SHRSP-(<I>D2Rat14-D2Mit5</I>)A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKYcongenicUnknown737867SS.SR-(<I>D13N1-D13Mit1</I>)/JrCongenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient straincongenicUnknown737868SS.SR-(<I>Syt2-D13Mit1</I>)/JrCongenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient straincongenicUnknownSyt23804737869OLETF.BN-(<I>D1Rat461-D1Rat459</I>)/GotFemale OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study.congenicUnknown737870DA.E3-(<i>D20Wox3-D20Mgh4</i>)/RhdA fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA.congenicUnknown737871DA.E3-(<i>D12Got46-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenicUnknown737872DA.E3-(<i>D4Mit16-D4Mgh11</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenicUnknown737873DA.E3-(<i>D6Wox5-D6Rat90</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenicUnknown737885RHA/KunRoman high avoidanceRoman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The NetherlandsinbredUnknown737886BDX/CubRecombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The NetherlandsinbredUnknown737887AO/OlaHsdThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The NetherlandsinbredCryorecovery737888LEW/NHsdCpbThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The NetherlandsinbredUnknown737889LEW/IpcvThese rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The NetherlandsinbredUnknown737891Crl:SDSprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory.outbredUnknown737892ACI/SegHsdThis substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc.inbredUnknownCarcinogenesis; Estrogen-induced pituitary growth; Transplant immunology737893F344/ZtmSubstrain of Fischer rats maintained by Dr. H.J. Hedrich, HannoverinbredUnknown737894LEW/OrlSubstrain of Lewis rats, maintained in Orleans, FranceinbredUnknown737895WKY/ZtmSubstrain of WKY rats maintained by Dr. H.J. Hedrich, HannoverinbredUnknown737896BN/MaasSubstrain of BN rats, maintained by Dr. Alex Maas, The NetherlandsinbredUnknown737897ACI/KunSubstrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The NetherlandsinbredUnknown737898WOKA/KSubstrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, GermanyinbredUnknown737899BN/CubRecombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The NetherlandsinbredUnknown737900WF/ZtmRecombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, GermanyinbredUnknown737901LH/ZtuA substrain of LHinbredUnknown737902BDIX/OrlSubstrain of BDIX, now maintained in Orleans, FranceinbredUnknown737903Hsd:SDSprague DawleyOriginated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratories' colonies are direct descendants of this original colony.outbredUnknown737904U/ASubstrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer InstituteinbredUnknown737905LEW/MaasStrain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers.inbredUnknown737906MWF/HsdMunich Wistar FromterSubstrain of Munich Wistar stock, inbred by Harlan Sprague DawleyinbredUnknown (as of 2020-04-03)737907SS.SR-<i>Inha</i>/JrA chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient straincongenicUnknown737908WF/NHsdSubstrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley.inbredUnknown737909R/ASubstrain of R, from Wistar stock in 1947, to The Netherlands Cancer InstituteinbredUnknown737910ARISTORAT/WslSubstrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, BelgiuminbredUnknown737911BUF/ZtmSubstrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, GermanyinbredUnknown737912SS/JrIpcvstrain originated from Dr. John P. Rapp, Medical College of Ohio, USAinbredUnknown737913E3/ZtmSubstrain of E3, from Dr. H.J. Hedrich, Hannover, GermanyinbredUnknown737914SDL/IpcvSubstrain of SDLinbredUnknown737915R/AWaSubstrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986inbredUnknown737916DZB/GroSubstrain of DZB, to Dr. G.A. van Oortmerssen at University of GroningeninbredUnknown737917WF/MolSubstrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, DenmarkinbredUnknown737918BN/OrlSubstrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, FranceinbredUnknown737919LEW/HanSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, GermanyinbredUnknown737920BH/ZtmSubstrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973inbredUnknown737921BDIV/lfzSubstrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971)inbredUnknown737922LEW/SsNHsdInbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNHsd rats were descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland USA. Harlan became Envigo in 2015.inbredUnknown737923SHR/MaasSubstrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The NetherlandsinbredUnknown737924WAG/RijSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979inbredUnknown737925BN/GroSubstrain of BN, from Billingham and Silvers 1958, to U of GroningeninbredUnknown737926F344/NCrlDerived from NIH stock in 1992 by SASCO. To Charles River in 1996.inbredUnknown737927ALC/ColleSubstrain of ALCinbredUnknown737928BN/NHsdCpbSubstrain of BN, from Billingham and Silvers 1958inbredUnknown737929Crl:WIWistar ratsTo Scientific Products Farm, Ltd. [predecessor of Charles River United Kingdom (CRUK)] in 1947 from Wistar Institute. To Charles River in 1975 from CRUK. This particular colony was selected because of a low incidence of hydronephrosis.outbredUnknown737930LEW/ZtmLEW/ZtmThis inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, GermanyinbredUnknownNcf161307737931GC/KuninbredUnknown737932LEW/CrlLewisDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34.inbredUnknown737933SD/ASprague-Dawley stock initiated by R. Dawley in 1925inbredUnknown737934BN/RijKunSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic UniversityinbredUnknown737935LEW/NhgSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, GermanyinbredUnknown737936SR/JrIpcvSubstrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962)inbredUnknown737937SDH/ZtuunknowninbredUnknown737938AUG/OlaHsdSubstrain of AUG, derived from US August substrains in 1951inbredCryorecovery737939BBWB/MolunknowninbredUnknown737940PAR/WslunknowninbredUnknown737941LEP/CubSubstrain of LEP, from Charles University cross of outbred animalsinbredUnknown737942LE/ZtmSubstrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973inbredUnknown737943R/AEurRijSubstrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986inbredUnknown737944BN/RijNSubstrain of BN, from Billingham and Silvers 1958, from Harlan RijnswijkinbredExtinct737945BN/HanSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973.inbredUnknown737946WAG/OlaHsdSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague DawleyinbredUnknown737947BDII/ZtmSubstrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971)inbredUnknown737948BDE/ZtmSubstrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color.inbredUnknown737949A2/ColleunknowninbredUnknown737950DA/ZtmSubstrain of DA/OlaHsd, to Hannover after 1965inbredUnknown737951CAP/KuvunknowninbredUnknown737952ACI/ZtmunknowninbredUnknown737953LEW/GutSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, GermanyinbredUnknown737954AS/ZtmunknowninbredUnknown737955Hooded/ColleunknowninbredUnknown737956WF/Gutsubstrain of Wistar Furth stock, from J Furth in 1945inbredUnknown737957WOKW/KSubstrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991inbredUnknownDiabetes Obesity; Metabolism737958CHOC/CubunknowninbredUnknown737959RNU/MolunknowninbredUnknown737960Hsd:WIWistarThese are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan.outbredUnknown737961SR/JrMolSubstrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to MollegaardinbredUnknown737962SPRD/ZtmSubstrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976inbredUnknown737963LEW/CubSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in PragueinbredUnknown737964BN/OlaHsdSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to IndianapolisinbredUnknown737965AGUS/OlaHsdSubstrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968inbredUnknown737966LEW/KuvSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in GermanyinbredUnknown737967BS/ZtmSubstrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988inbredUnknown737968BN/GutSubstrain of BN, from Billingham and Silvers 1958inbredUnknown737969NAR/SaUnon-albumin ratSubstrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to UtrechtinbredUnknown737970AMORAT/WslunknowninbredUnknown737971SHRSP/RivmunknowninbredUnknown737972BN/CrlSilvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976.inbredUnknown738038HEPhigh ethanol preferringHigh ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USAinbredUnknown738120LEW-Tg(HLA-B*2705m1,B2M)133-1Trg<sup>Tg/Tg</sup>This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-20)738122SD-Tg(UBC-EGFP)1BalRrrcThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10)1298093LEW/NHsdObtained from Harlan-Sprague Dawley (Indianapolis, Indiana) at 35-45 days of age.inbredUnknown1299868SS.SR-(<I>D7Uia1-D7Mco7</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenicUnknown1299869SS.SR-(<I>Cyp11b1</I>)/JrCongenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient straincongenicUnknown1299870SS.LEW-(<I>D5Uia8-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenicUnknown1299871DA.F344-(<I>D20Arb2-D20Arb8</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenicUnknown1299872DA.F344-(<I>D8Arb15-D8Arb22</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenicUnknown1299873SS.LEW-(<I>D5Mco34-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenicUnknown1299874OLETF.F344-(<i>D1Rat166-D1Rat90</i>)/TjFemale OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol.congenicCryopreserved EmbryoDiabetes Obesity1299875DA.F344-(<i>D7Rat22-D7Mit2</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studies1299876SS.LEW-(<I>D5Rat54-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenicUnknown1299877DA.F344-(<I>D10Rat204-D10Arb22</I>)/ArbRegion of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenicUnknown1299878DA.F344-(<I>D4Arb30-D4Arb4</I>)/ArbThe DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague DawleycongenicUnknown1299879SS.SR-(<I>D7Mco7-D7Wox19</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenicUnknown1299880F344.DA-(<I>D20Arb2-D20Arb8</I>)/ArbRegion of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses.congenicUnknown1299881SS.LEW-(<I>D5Wox3-D5Rat108</I>)/JrSS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS straincongenicUnknown1300432HAA/FDSCHatano High AvoidanceIn 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation.inbredCryopreserved Embryo; Cryopreserved SpermBehavior1300433LAA/FDSCHatano Low AvoidanceIn 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation.inbredCryopreserved Embryo; Cryopreserved SpermBehavior1300439SD-Tg(UBC-EGFP)2BalRrrcThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21.transgenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10)1302359HsdFcen:SDThese animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.outbredUnknown1302360W/HsdFcenThese animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.outbredUnknown1302372SDDIO/RrrcThis strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet.inbredCryopreserved Embryo; Cryopreserved Sperm1302373SDDR/RrrcThis strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet.inbredCryopreserved Embryo; Cryopreserved Sperm1302377SPRD-<i>Anks6<sup>PKD</sup></i>/RrrcFrom outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 (Anks6) mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-07)Anks6<sup>PKD</sup>115349961302416ACI.DA-(<i>D10Rat2-D10Rat19</i>)/ArbA fragment from DA/OlaHsd rats is transferred to ACI/SegHsd.congenicUnknown1302597LEXF7C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302598FXLE26/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredLive Animals; Cryopreserved EmbryoDiabetes Obesity; Cancer1302599WKY/TaThis strain originated from Takeda Chemical Industries, Ltd., JapaninbredCryopreserved Embryo; Cryopreserved Sperm1302600HTX/Kyohydrocephalus texas1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992.mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology1302601FXLE23/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302602FXLE12/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302603FXLE25/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302604LEXF4/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302605LEXF2A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredLive AnimalsDiabetes Obesity; Cancer1302606SHRSP/TaThis strain originated from Takeda Chemical Industries, Ltd., JapanmutantCryopreserved Embryo; Cryopreserved SpermCardio Hypertension1302607FXLE21/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302608CXH6/TjStrain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japanrecombinant_inbredCryopreserved EmbryoMetabolism; Immunology1302610KMI/Tkyminiature rat ishikawaMiniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College.segregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermOsteosisPrkg234011302611FXLE24/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302612LEXF10C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302613BN/fMaiHokKyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21inbredLive Animals; Cryopreserved Embryo1302614WKY/NMnaInbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain.inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1302615FXLE14/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302616LEXF10B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302617LEXF6B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302618LEXF9/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredLive Animals; Cryopreserved EmbryoDiabetes Obesity; Cancer1302619FXLE16/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredLive AnimalsDiabetes Obesity; Cancer1302620SHR/Kyospontaneously hypertension ratOkamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermCardio Hypertension1302621LEXF10A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302622WF/KopInbred originated from Kagoshima University, Japan.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermCancer1302623TM/Kyotester moriyama ratTester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 .mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermHematologyRab38<sup>ru</sup>16003111302624RICO/NgsStrain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan.inbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension; Ophthalmology1302625F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302626BN.UPL-(<I>D2Rat134-D2Rat2</I>)/CasStrain originated from Hiroshima University, JapancongenicCryopreserved SpermOphthalmology1302627F344/NSlcStrain originated from Japan SLC, Inc, Shizuoka, Japan.inbredLive Animals1302628ACIS/HokSpontaneous mutation from ACI/Hok in 1981.coisogenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1302629WKY.SHRSP-(<I>D1Rat49-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302630F344.OLETF-(<I>D10Wox7-D10Wox6</I>)/TjMicrosatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.congenicCryopreserved EmbryoDiabetes Obesity1302631BN/SsNSlcStrain originated from Japan SLC, Inc, Shizuoka, Japan.inbredCryopreserved SpermImmunology1302632WKY.SHRSP-(<I>D1Smu11-D1Arb21</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302633FXLE20/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302634BB/WorTkyBioBreeding ratMutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983.inbredCryopreserved EmbryoDiabetes Obesity; Immunology1302635F344.OLETF-(<i>D12Rat8-D12Rat16</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302636WKY.SHRSP-(<I>D1Wox29-D1Arb21</I>)/IzmThis congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm backgroundcongenicCryopreserved EmbryoCardio Hypertension1302637LAAHatano Low AvoidanceStrain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, JapaninbredUnknown1302638LEXF11/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302639KHR/Kyokaken hairless ratKaken hairless rat were detected by Kimura from GunnmutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermDermatologyOca223184121302640ACI/TjStrain originated from The University of Tokushima, Tokushima, Japan.inbredCryopreserved Embryo1302641LEXF1A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302642LEA/HkmStrain originated at the University of Tokushima, Japan.inbredLive Animals; Cryopreserved Embryo1302643ACI/NKyoaugust copenhagen irishNIH (1988, F143) > Kyo (F43)inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermReproduction1302644CXA5/TjStrain originated at the University of Tokushima, Japan.recombinant_inbredCryopreserved EmbryoMetabolism; Immunology1302645DMY/Kyodemyelination ratFrom a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996).mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyMrs2<sup>dmyKyo</sup>127930711302646LEXF2C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302647F344.OLETF-(<i>D5Rat166-D5Rat90</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302648LEC/HokLong Evans CinnamonAt the Center for Experimental Plants and Animals, Hokkaido University, LEC, along with LEA, was established from a closed colony of Long-Evans rats obtained from Kobe University in 1975. In 1984, within the LEC rats of their F24 generation, a rat exhibiting spontaneous hepatitis with severe jaundice was found (Yoshida, 1987). The LEC was available from Charles River Japan, Inc., Kanagawa, as of spring, 1991.mutantUnknown (as of 2016-12-01)Cancer; ImmunologyAtp7b<sup>hts</sup>115327421302649LEXF7B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302650F344.OLETF-(<i>D9Mgh8-D9Rat15</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302651CXA1/TjStrain originated from the The University of Tokushima, Japan.recombinant_inbredCryopreserved EmbryoMetabolism; Immunology1302652LEXF7A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302653LEXF8A/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302654F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred.congenicCryopreserved EmbryoDiabetes Obesity1302655TO/HkmStrain originated from the Graduate School of Medicine, Hokkaido University, Japan.inbredCryopreserved Embryo1302656LEA/HokLong Evans AgoutiLong Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour . It is used as the control strain of the LEC rat, which is reported to exhibit several mutant phenotypes such as hepatic disorder (hts), blockage of the T cell differentiation (thid) and X-ray hypersensitivity (xhs1 and xhs2).inbredUnknown (as of 2016-12-01)1302657DOP/Nemdilute-opisthotonus (dop)Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established.segregating_inbredCryopreserved Embryo; Cryopreserved SpermNeurobiologyMyo5a31431302658LEJ/HkmStrain originated at the Graduate School of Medicine, Hokkaido University, Japan.inbredLive Animals1302659CXH5/TjStrain originated at the University of Tokushima, Japan.recombinant_inbredCryopreserved EmbryoMetabolism; Immunology1302660RCS/Kyoroyal college of surgeons ratFrom Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998.mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermOphthalmologyMertk<sup><i>rdy</i></sup>409028391302661F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred.congenicCryopreserved EmbryoDiabetes Obesity1302662CXH2/TjStrain originated at the University of Tokushima, Japan.recombinant_inbredCryopreserved EmbryoMetabolism; Immunology1302663F344.OLETF-(<i>D11Rat4-D11Rat1</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302664WNA/NshmNagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal ResearchinbredCryopreserved Embryo; Cryopreserved Sperm1302665FXLE13/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302666LEXF1C/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302667F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302668IS-<I>Tlk</I>/Kyotail anomaly lethal kyotoSpontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto)coisogenicCryopreserved Embryo; Cryopreserved SpermOsteosis1302669HAAHatano High AvoidanceStrain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan.inbredUnknown1302670ACI/NSlcStrain is from Japan SLC, Inc., Shizuoka, Japan.inbredLive Animals1302671WM/TjStrain is from the University of Tokushima, Japan.inbredCryopreserved Embryo; Cryopreserved Sperm1302672W/KyoHok>Hkm>KyoinbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1302673FXLE15/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302674VF/Kyovacuole formation ratThe vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS). A nonsense mutation in the dopey family member 1 (Dopey1) was identified as the likely causative gene for the neurological disease phenotype of the VF rat.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-10)Neurobiology1302675WKY.SHRSP-(<I>D1Smu13-D1Smu11</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302676NER/Slcnoda epileptic ratStrain is from Japan SLC, Inc. Shizuoka, Japan.mutantLive AnimalsNeurobiology1302677NIG-III/TjStrain is from the University of Tokushima, Japan.inbredCryopreserved Embryo1302678NAR/Slcnon albumin ratStrain originated from Japan SLC, Inc, Shizuoka, Japan.mutantLive AnimalsHematology1302679TRMR/Kyotremor resistantTremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. This strain is a substrain of TRM/Kyo and does not show tremor behavior. This strain carrying wild type Hcn1, is considered as segregating inbred strain of TRM.segregating_inbredUnknownAspa6216931302680SHR/TaStrain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan.mutantCryopreserved Embryo; Cryopreserved SpermCardio Hypertension1302681WKY.SHRSP-(<I>D1Smu11-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302682FXLE18/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302683FXLE22/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredLive AnimalsDiabetes Obesity; Cancer1302684F344/NHokDwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & AnimalsinbredUnknown1302685F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/TjMicrosatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment.congenicCryopreserved EmbryoDiabetes Obesity1302686F344/StmDerived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302687WKAH/HkmSlcWistar King A, HokkaidoStrain originated from Japan SLC, Inc., Shizuoka, Japan.inbredLive Animals1302688ACI/NMnaThis strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan.inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1302689WKY.SHRSP-(<I>Ntrk3-D1Smu13</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302690FXLE19/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302691ALB/HokAlbanyAlbany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok)inbredLive Animals; Cryopreserved EmbryoDentistry1302692WKY.SHRSP-(<I>D1Wox18-D1Rat44</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302693KZ-<I>Lepr</I><sup>faTky</sup>A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980.segregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; MetabolismLepr30011302694WKA/SeacWistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermImmunology1302695SER/Kyospontaneously epileptic ratSpontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Acsegregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn|Aspa69063|6216931302696FH/HamSlcfawn hooded ratStrain originated at Japan SLC, Inc., Shizuoka , Japan.mutantLive AnimalsCardio Hypertension1302697KND/Tkykomeda non-diabetic ratKomeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls.inbredLive Animals; Cryopreserved EmbryoDiabetes Obesity1302698SDR/SlcSpontaneous dwarf ratThe G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype. This spontaneous mutation affected the 3' splice/acceptor site. Strain is from Japan SLC, Inc., Shizuoka, Japan.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-05-04)MetabolismGh1<sup>sdr</sup>128803801302699LEXF8D/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302700HOB/Snkhobble ratHOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13.mutantCryopreserved Embryo; Cryopreserved SpermNeurobiologyUnc5c|Unc5c<sup>hob</sup>735109|128023531302701LEW/SsNSlcInbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNSlc rats were descended from a colony obtained from the National Institutes of Health, Bethesda, Maryland USA in 1994 to Japan SLC, Inc.,Shizuoka, Japan.inbredLive Animals (as of 2020-08-26)Immunology1302702TRM/Kyotremor ratIn 1980, a spontaneous tremor mutant rat was found in the colony of Kyo:Wistar (Yamada, 1985). This disorder was found to be caused by an autosomal recessive gene and was designated tremor (tm). Deletion of Aspa gene was identified in the animal with no aspartoacylase activity in the brain and measurable level of activity in the kidney. TRM was established as a segregating inbred strain. In F18 progeny, a rat which did not have tm mutation was separated and established as a control strain of WTC (NBRP No.0020). (Dec 8, 2010)segregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03)NeurobiologyAspa|Hcn1<sup>A354V</sup>621693|134643191302703WKY.SHRSP-(<I>D1Wox29-D1Rat112</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302704WKY.SHRSP-(<I>D1Wox29-D1Rat199</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302705WKY.SHRSP-(<I>D1Wox29-D1Smu13</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302706F344.OLETF-(<i>D5Rat32-D5Rat26</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302707LEXF3/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302708FXLE17/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredCryopreserved EmbryoDiabetes Obesity; Cancer1302709WKY/HcmStrain is from the Hyogo College of Medicine, Japan.inbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension1302710LEXF2B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302711ExHC/SeacIsolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993inbredUnknown1302712ZIMY/KyoZitter Masao YamadaZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada). This strain is homozygous for zi and wild-type for tm. ZIMY (Zitter Masao Yamada)mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-17)NeurobiologyAtrn690631302713F344.OLETF-(<i>D8Rat58-D8Mgh17</i>)/TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicUnknown1302714KZC/TkyKomeda Zucker Creeping ratKomeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983.segregating_inbredCryopreserved Embryo; Cryopreserved SpermNeurobiologyReln35531302715WKY.SHRSP-(<I>D1Wox18-D1Wox29</I>)/IzmThe desired fragment is transferred from SHRSP to WKY.congenicCryopreserved EmbryoCardio Hypertension1302716OM/NSlcOsborne-Mendel ratThe Instutite of Medical Science, The University of Tokyo to Slc (1985)inbredLive Animals1302717ACI/NHokNIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135inbredCryopreserved EmbryoCardio Hypertension1302718HWY/Slchairless wistar yagiStrain is from Japan SLC, Inc., Shizuoka, Japan.mutantLive AnimalsDermatology1302719DON/KyoDonryu ratJapanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1302720CXH10/TjStrain is from the University of Tokushima, Japan.recombinant_inbredCryopreserved EmbryoMetabolism; Immunology1302721LEC/TjFound in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989mutantCryopreserved EmbryoCancerAtp7b<sup>hts</sup>115327421302722PVG/SeacPiebald Virol GlaxoStrain is from Seac Yoshitomi, LTD., Fukuoka, Japan.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermImmunology1302723LEXF5/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer1302724SHR/HcmStrain is from the Hyogo College of Medicine, Japan.mutantCryopreserved EmbryoCardio Hypertension1302726ZI/KyoZitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo.mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn<sup><i>zi</i></sup>409028321302727SHRSR/TaStrain is from Takeda Chemical Industries, Ltd., Osaka, Japan.mutantCryopreserved Embryo; Cryopreserved SpermCardio Hypertension1302728MES/SlcMatsumoto Eosinophilia ShinshuDerived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999)mutantLive AnimalsHematologyCyba<sup>m1Sdi</sup>132090001302729LEA/TjFound in Long Evans strain at Kobe University; Inbreeding at Hokkaido University; Otsuka Pharmaceutical Co.; The University of Tokushima 1989inbredLive Animals; Cryopreserved EmbryoCancer1302795HTGPrague hypertriglyceridemicThese were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding.inbredUnknown1302921F344-Tg(NPHS2-HBEGF)WighDTR (HBEGF) cDNA was inserted at the 3' of the 2.5 kb human podocin (NPHS2) promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs.transgenicUnknown1303393LEC/NcuThese rats were established from a closed colony of Long-Evans.inbredUnknown1304487BBDR/WorDiabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies.inbredUnknown1331811LEW.BN-(<i>D10Rat32-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331812LEW.BN-(<i>D10Rat83-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331813BN.GK-(<i>D8Rat29-D8Got130</i>)/OxThis congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenicUnknown1331814BN.GK-(<i>D8Got302-D8Got130</i>)/OxThis congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenicUnknown1331815LEW/MolLEW/MolThis substrain can be traced originally to Scripps Clinic, La Jolla, to University of Pennsylvania to Simonsen Laboratories in 1966, to Institute of Pathological Anatomy, University of Copenhagen, Denmark 1973. From University of Copenhagen to M&B A/S (Mollegaard Breeding Center Ltd., Denmark ) from 1977 to 2002. (now Taconic Europe)inbredUnknownNcf1613071331816DA.ACI-(<i>D10Rat2-D10Rat29</i>)/Kini(DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA.congenicCryopreserved SpermNeurobiology; Immunology1331817BN.LEW-(<i>D10Rat32-D10Mgh4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenicUnknown1331818LEW.BN-(<i>D10Rat43-D10Mco4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331819F344/EerF344/EerInbred strain originated from animals purchased from Harlan Industries, Indianapolis, IndianainbredUnknown1331820LEW.BN-(<i>D10Got9-D10Rat2</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331821LEW.BN-(<i>D10Wox26-D10Arb4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331822DA.ACI-(<i>D10Rat2-D10Rat6</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenicUnknown1331823LEW.BN-(<i>D10Rat43-D10Rat27</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331824DA.ACI-(<i>D10Rat219-D10Rat29</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenicUnknown1331826LEW.BN-(<i>D10Mgh7-D10Rat27</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331827DA.ACI-(<i>D10Rat10-D10Rat142</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenicUnknown1331828DA.ACI-(<i>D10Rat12-D10Rat144</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenicUnknown1331829BN.LEW-(<i>D9Got8-D9Got200</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenicUnknown1331830F344.BN-(<i>D5Rat1-D5Mit5</i>)/DlwThis congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USAcongenicUnknown1331831LEW.BN-(<i>D10Rat173-D10Rat133</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.congenicUnknown1331832BN.LEW-(<i>D10Rat72-D10Arb4</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenicUnknown1331833DA.ACI-(<i>D10Rat15-D10Rat29</i>)DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.congenicUnknown1331834BN.LEW-(<i>D10Rat100-D10Rat126</i>)/RjThis congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.congenicUnknown1331836WKY/EerWKY/EerInbred strain originated from animals purchased from Harlan Industries, Indianapolis, IndianainbredUnknown1354669BN/OrlIcoCrlfStrain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991.inbredUnknown1354670F344/IcoCrlfThese are inbred rats that were bought from Charles River, Les Oncins near Lyon, France.inbredUnknown1357172WF.BBDR-(<i>D4Arb29-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1357173SS.MNS-(<i>Vamp2-D10M11Mit84</i>)/McoThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenicUnknownVamp239491357174BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>)/RhwS. Bieg and coworkers (1998) generated this congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ñ 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. Lacks one C nucleotide at 478 position which causes a frameshift mutation in the ORF of exon 3 forming a significantly truncated protein.congenicUnknown1357175F344.DR-(<i>D4Mit6-D4Mit24</i>)-Tg(Gimap5)McwiWild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(<i>D4Mit6-D4Mit24</i>)transgenicUnknown1357176WF.BBDR-(<i>D4Arb29-D4Rat96</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1357177F344.DR(DP)-(<i>D4Mit6-D4Mit24</i>)/RhwThe lymphopenia locus from BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding.congenicCryopreserved Embryo1357178CDCohen diabetic ratOriginally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism.inbredUnknown1357179SS.WKY-(<i>D2N35-Mme</i>),MNS-(<i>D10Mit11-D10M11Mit119</i>)/McoSS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F<sub>1</sub> were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister matingcongenicUnknown1357180SS.LEW-(<I>D8Chm14-D8Rat16</I>)/AydCongenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, CanadacongenicUnknownGrik427341357181CDR/YglCohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.inbredUnknown1357182Eker-Tg(Tsc2)28HinWild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.transgenicUnknownTsc239081357183SS.MNS-(<i>D10Mco10-Aldoc</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenicUnknownNos231851357184Crl:ZUC-<I>Lepr</I><sup>fa</sup>Zucker ratsThe obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company.outbredUnknownLepr<sup>fa</sup>134321531357185RHA.Gunn-<i>Ugt1a1</i><sup>j</sup>/NRHA/N rats were crossed with Gunn rats. F<sub>1</sub> hybrids were intercrossed for 12 cycles while selecting for jaundice loci.congenicUnknown1357186Gunn-<i>Ugt1a1</i><sup>j</sup>/BluHsdGunn ratThis mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.mutantUnknownUgt1a1<sup>j</sup>134320641357187WF.BBDR-(<i>D4Rat16-D4Got39</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1357189SS.LEW-(<I>D8Rat56-D8Rat51</I>)/AydCongenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, CanadacongenicUnknown1357190SS.MNS-(<I>Adh1-D2Mit5</I>)/McoThis congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr backgroundcongenicUnknownAdh120441357191CDS/YglCohen diabetic-sensitive ratCohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.inbredUnknown1357192WF.BBDR-(<i>D4Got39-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1357193WF.BBDR-(<i>D4Got51-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1357194WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1357195SS.MNS-(<i>Aldoc-D10Mco1</i>)/JrThis congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.congenicUnknownNos231851357196WF.BBDR-(<i>D4Arb29-D4Rat265</i>)/WorThis congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1357345DA/KDark Agouti/KarlsburgDark agouti rats which were bred and housed in Dept. of Laboratory Animal Science, Karlsburg, GermanyinbredUnknown1357346BB.SHR-(<i>D4Mit6-Spr</i>)/KBB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected.congenicUnknownNpy|Spr3197|37531357417SD-Tg(Npy)400Mcwi14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene.transgenicUnknown1357953WAG/RijHfrSubstrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Envigo (Harlan France)inbredUnknown1357954F344/NHfrStrain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France.inbredUnknown1357955WF/NHfrWistar-FurthSubstrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France.inbredUnknown1357957LEW/HanHfrInbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. To Central Institute for Laboratory Animal Breeding, Hannover, in 1973 at F58. In 1994, to Harlan Netherlands through acquisition of Central Institute for Laboratory Animal Breeding. Harlan became Envigo in 2015inbredUnknownThe LEW/HanHsd is very susceptible to the induction of EAE, while the LEW/SsNHsd is not susceptible to the induction of EAE1357958BN/RijHfrSubstrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France.inbredUnknown1357959FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/McwiThe Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH.congenicLive AnimalsCtsc|Grm5|Nox4|Rab38|Tyr2445|2746|620600|628752|15897551357960LE/CpbHfrSubstrain of LE which was bred at Harlan CPB now at Harlan France.inbredUnknown1357974BB.SHR-(<i>D4Got41-Gimap5</i>)/KOriginated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.congenicUnknownGimap56288711357975SS.LEW-(<i>D1Mco4-D1Rat18</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenicUnknown1357976BB.SHR-(<i>D4Got41-D4Rat171</i>)/KOriginated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.congenicUnknown1357977SS.LEW-(<i>D1Mco8-D1Rat213</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenicUnknown1357978SS.MNS-(<i>D2Mit6-D2Rat303</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) straincongenicUnknown1357979SS.MNS-(<i>Mme-D2Rat131</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) straincongenicUnknownMme30981357980BB.SHR-(<i>D4Got41-Tacr1</i>)/KCongenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997.congenicCryopreserved SpermDiabetes Obesity; MetabolismTacr138111357981SS.LEW-(<i>D3Mco21-D3Rat17</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydcongenicUnknown1357982SS.LEW-(<i>D3Rat52-D3Chm63</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydcongenicUnknown1357983SS.LEW-(<i>D1Mco75-D1Rat18</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenicUnknown1357984SS.MNS-(<i>D2Mit6-D2Rat166</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) straincongenicUnknown1357985LOU/Insoriginated from Universite Catholique de Louvain.inbredUnknown1357986SS.LEW-(<i>D1Uia8-D1Rat211</i>)/McoThis strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.congenicUnknown1357987SS.LEW-(<i>D1Uia8-D1Rat18</i>)/McoA 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.congenicUnknown1357988SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydA segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown1357994SHR/NCrlTo Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneous hypertension.inbredLive Animals (as of 2020-01-23)1358112WKY/NCrlOutbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11inbredUnknown1358114SS-Chr 5<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Cryopreserved Sperm1358150SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenicUnknown1358151FHH-Chr 8<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 8 introgressed.consomicCryopreserved Sperm1358152SS-Chr 14<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 14 introgressed.consomicCryopreserved Sperm1358153COP/CrCrlInbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998.inbredUnknown1358154SS-Chr 3<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 3 introgressed.consomicLive Animals; Cryopreserved Sperm1358155SS.LEW-(<i>D10Rat119-D10Mgh1</i>)(<i>D16Rat21-D16Rat112</i>)/AydThis double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (<i>D10Rat119-D10Mgh1</i>)and (<i>D16Rat21-D16Rat112</i>) from the LEW straincongenicUnknown1358156SS.MNS-(<i>D2Rat183-D2Chm113</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenicUnknown1358157FHH-Chr 7<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 7 introgressed.consomicCryopreserved Sperm1358158FHH-Chr 16<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 16 introgressed.consomicCryopreserved Sperm1358159FHH-Chr 6<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 6 introgressed.consomicCryopreserved Sperm1358160SS.BN-(<i>D8Rat163-D8Rat81</i>)/McwiA SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81.congenicUnknown1358161SS.LEW-(<i>D16Rat38-D16Chm66</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenicUnknown1358162SS-Chr 12<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 12 introgressed.consomicLive Animals1358163SS-Chr 15<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 15 introgressed.consomicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1358164FHH-Chr 17<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 17 introgressed.consomicCryopreserved Sperm1358165SS.MNS-(<i>D2Chm51-D2Rat341</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain.congenicUnknown1358166SS.LEW-(<i>D16Mit3-D16Rat112</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenicUnknown1358167SS.MNS-(<i>D2Wox27-Adh1</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenicUnknownAdh120441358168SS.LEW-(<i>D16Mit2-D16Chm23</i>)/AydThis congenic strain originated from a SS/Jr parental strain.congenicUnknown1358169SS.MNS-(<i>D2Chm25-D2Rat131</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Chm90-D2Wox37</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenicUnknown1358170FHH-Chr 5<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 5 introgressed.consomicCryopreserved Sperm1358171SS-Chr 17<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 17 introgressed.consomicCryopreserved Sperm1358172SS.MNS-(<i>D2Chm25-Fgg</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenicUnknownFgg26131358173FHH-Chr 11<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 11 introgressed.consomicCryopreserved Sperm1358174SS-Chr 19<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 19 introgressed.consomicCryopreserved Sperm (as of 2021-05-07)1358175FHH-Chr 20<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 20 introgressed.consomicCryopreserved Sperm1358176FHH-Chr 18<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 18 introgressed.consomicCryopreserved Sperm1358177SS.MNS-(<i>D2Chm25-D2Mit14</i>)/AydCongenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.congenicUnknown1358178SS-Chr 10<sup>BN</sup>/McwiA SS genomic background with a BN chromosome 10 introgressed.consomicCryopreserved Sperm1358179FHH-Chr 13<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 13 introgressed.consomicCryopreserved Sperm1358180FHH-Chr 19<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 19 introgressed.consomicCryopreserved Sperm (as of 2021-05-07)1358258RCS/LavRrrcroyal college of surgeons ratDeveloped before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London.inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30)1358259RCS-<i>p</i><sup>+</sup>/LavRrrcThis strain has homozygous wild type at the pink eye (p+) locus and homozygous for a deletion in the Mertk gene. Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain.congenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30)1358277RCS-<I>rdy</I><sup>+</sup>/LavRrrcDeveloped by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated.congenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-07-16)1358278RCS-<i>rdy</I><sup>+</sup><I>p</I><sup>+</sup>/LavRrrcDeveloped by crossing a pink-eyed control(RCS-rdy<sup>+</sup>/Lav x black-eyed dystrophic(RCS-p<sup>+</sup>/Lav) The F12 progeny was backcrossed to RCS-rdy<sup>+</sup>/Lav. The strain is pigmented (p+) congenic control strain (rdy+, wild-type at the retinal dystrophy locus) for the pigmented RCS-p+ dystrophic (rdy-) straincongenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12)1358298SD-Tg(Rho*P23H)1LavThis transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).transgenicLive Animals (as of 2021-05-07)Rho112391358299SD-Tg(Rho*P23H)2LavThis transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).transgenicUnknown1358300SD-Tg(Rho*P23H)3LavThis transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).transgenicUnknown1358302SD-Tg(Rho*S334X)3LavThis transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenicUnknown1358303SD-Tg(Rho*S334X)4LavThis transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenicUnknown1358304SD-Tg(Rho*S334X)5LavThis transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenicUnknown1358305SD-Tg(Rho*S334X)7LavThis transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenicUnknown1358306SD-Tg(Rho*S334X)9LavThis transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.transgenicUnknown1358632MR/HarMaudsely reactiveThis strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.inbredCryopreserved Embryo (as of 2019-02-20)1358633MNRA/HarOriginally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.inbredUnknown1358918W-<i>Plp1<sup>md</sup></i>/NyaW-<i>Plp1</i><sup>md</sup>Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders.mutantUnknownPlp1|Plp1<i><sup>md</sup></i>3354|128023461358919F344/SeacInbred strain originated from F344 ratsinbredUnknown1358921WF.DA-(<i>D19Mit1-D19Mit6</i>)/KopCongenic strain originated from a parental DA/Slc strain.congenicCryopreserved EmbryoCancerNqo125031358922BB.WOKW-(<i>D4Got41-Fabp1</i>)/KCongenic strain originated from a BB/OK parental strain.congenicUnknownFabp125901358923LE-<i>Mbp<sup>md</sup></i>A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks.mutantUnknownMbp|Mbp<sup>md</sup>3054|128023511358989WKY.SHR-(<I>D2Rat174-D2Rat28</I>)(<I>D2Rat161-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlcongenicUnknown1358990DA.F344-(<i>D10Mit9-D10Rat24</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/HsdcongenicUnknown1358991F344.HTX-(<i>D11Rat4-D11Arb4</i>)/HcjCongenic strain originated from F344/NHsd parental strain bred to HTX/HcjcongenicUnknown1358992SHR.WKY-(<I>D2Rat40-D2Rat50</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markerscongenicUnknown1358993WKY.SHR-(<I>D2Rat161-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlcongenicUnknown1358994SHR.WKY-(<I>D2Rat161-D2Rat241</I>)This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) congenic strain to the parental strain SHR/NCrlcongenicUnknown1358995F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/TjCongenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.congenicCryopreserved EmbryoDiabetes Obesity1358996SHR.WKY-(<I>D2Rat10-D2Mgh13</I>)This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl backgroundcongenicUnknown1358997WKY.SHR-(<I>D2Rat241-D2Rat185</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlcongenicUnknown1358998BUF/NHsdHeston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan.inbredUnknown1358999WKY.SHR-(<I>D2Rat174-D2Rat28</i>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrlcongenicUnknown1359000DA.F344-(<i>D10Arb27-D10Rat6</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/HsdcongenicUnknown1359001WKY.SHR-(<I>D2Rat42-D2Rat139</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markerscongenicUnknown1359002NTac:WKYThe Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony.outbredUnknown1359003LEW/JrThis strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA.inbredUnknown1359004DA.F344-(<i>D10Mit9-D10Rat11</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and F344/HsdcongenicUnknown1359005SHR.WKY-(<I>D2Rat15-D2Rat50</I>)This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) to parental strain SHR/NCrlcongenicUnknown1359006WKY.SHR-(<I>D2Rat27-D2Rat243</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlcongenicUnknown1359007WKY.SHR-(<I>D2Rat174-D2Rat62</I>)This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrlcongenicUnknown1359008F344.HTX-(<i>D11Rat4-D11Arb4</i>)(<i>D17Rat23-D17Rat154</i>)/HcjDouble congenic strain originated from a cross between single congenic strains F344.HTX-(<i>D11Rat4-D11Arb4</i>)/Hcj and F344.HTX-(<i>D17Rat23-D17Rat154</i>)/Hcj.congenicUnknown1359009WKY.SHR-(<I>D2Rat174-D2Rat185</I>)Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markerscongenicUnknown1359010WF.BBDR-ART2<SUP>a</SUP>/WorWistar FurthCongenic strain created by backcrossing WF strain to BBDR strain which are RT1 <SUP>u/u</SUP> , ART2<SUP>a</SUP>.congenicUnknown1547865FHH-Chr 3<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 3 introgressed.consomicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1547866F344/JclInbred strain originated from F344inbredLive Animals (as of 2021-04-22)1547867FHH-Chr 4<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 4 introgressed.consomicCryopreserved Sperm1547868FHH-Chr 2<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 2 introgressed.consomicCryopreserved Sperm1547869ACI/EurAugust x Copenhagen IrishCurtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIHinbredUnknown1547870FHH-Chr 14<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 14 introgressed.consomicLive Animals1547871ACI.FHH-(<i>D1Rat324-D1Rat156</i>)/EurCongenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains.congenicUnknown1547872FHH-Chr X<sup>BN</sup>/McwiFHH-Chr X<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome X introgressed.consomicCryopreserved Sperm1547873FHH-Chr 15<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 15 introgressed.consomicCryopreserved Sperm1547874FHH-Chr Y<sup>BN</sup>/McwiFHH-Chr Y<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome Y introgressed.consomicCryopreserved Sperm1547875ACI.FHH-(<i>D17Rat117-D17Arb5</i>)(<i>D17Rat180-D17Rat51</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.congenicUnknown1547876FHH-Chr 10<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 10 introgressed.consomicCryopreserved Sperm1549794SS.LEW-(<i>D2Rat199-D2Mco17</i>)/AydCongenic strain was created from a SS/Jr parental straincongenicUnknown1549795SS.LEW-(<i>D2Rat199-D2Rat143</i>)/AydCongenic strain was created from a SS/Jr parental straincongenicUnknown1549796BN/2HokTransferred from Hokkaido University, Chromosome Research Unit, 1987 F16coisogenicLive Animals; Cryopreserved Embryo1549797BUF.ACI-(<i>D16Rat31-D16Arb1</i>)/NccThis congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method.congenicUnknown1549798BB.PVG-<i>RT1</i><sup>u/a</sup>/TkyA congenic strain with the genetic background of the BB/WorTky strain (RT1.B<sup>u</sup>,D<sup>u</sup> ) onto which the MHC locus of PVG.R23 strain (RT1.B<a>,D<a>) has been transferred.congenicCryopreserved EmbryoDiabetes Obesity; Immunology1549799BB.SHR-<i>(D6Rat184-D6Rat3)</i>/KCongenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000.congenicCryopreserved SpermMetabolism1549800BN/KunKtsSlcKitasato University School of Medicine to Slc (2001)mutantLive AnimalsMetabolism1549801BN/SeacSeac Yoshitomi, LTD, Fukuoka, JapaninbredCryopreserved SpermBehavior; Ophthalmology1549802BN/1HokTransferred from Hokkaido University, Chromosome Research Unit, 1987 F15coisogenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1549803ACI-<i>Lyst</i><sup>bg-Kyo</sup>/KyoSpontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999.coisogenicCryopreserved Embryo; Cryopreserved SpermHematology1549804BUF/NacJclCLEA Japan, Inc., Tokyo JapaninbredUnknown1549805BUF.Cg-<i>Foxn1</i><sup>rnu</sup>/MnaBUF/Mna, NN1H-Rnu/RnucongenicCryopreserved Embryo; Cryopreserved SpermUrology1549806BUF.ACI-(<i>D3Rat56-D3Rat83</i>)/NccThis strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient straincongenicCryopreserved Embryo; Cryopreserved SpermCancer1549808SS.LEW-(<i>Prlr-D2Rat143</i>)/AydCongenic strain was created from a SS/Jr parental straincongenicUnknownPrlr34071549809BN/KtsSlcKitasato University School of Medicine to Slc (2002)inbredLive AnimalsImmunology1549810AI/Msikamelogenesis imperfecta ratThis strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc.mutantCryopreserved Embryo; Cryopreserved SpermDentistry1549811ACI/NJclACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan.inbredUnknown1549813F344.ACI-<i>Lmx1a<sup>qc</sup></i>/KyoCongenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. The short-tail mutation, âqueue courteâ in French (with qc as a symbol), occurred spontaneously in 1994, in the ACI/Pas inbred strain of rat maintained at the Institute Pasteur (Paris, France), and was kept segregating in this stock. Since importation into the Institute of Laboratory Animals at Kyoto University, it has been maintained as a congenic strain F344.ACI-qc using F344/NSlc as an inbred partner.congenicCryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-12)Apoa2|Selp|Lmx1a2131|3656|13047841554301WKHA/BordStrain was originated from WHHA/Edh at the University of Vermont College of MedicineinbredUnknown1554302HOB-<I>Unc5c<sup>hob</sup></I>/Snkhobble ratHomozygous hobble rats that were taken from the inbred hobble rat colony.mutantUnknownUnc5c|Unc5c<sup>hob</sup>735109|128023531554303CVD/OpuCerebellar vermis defect ratOriginated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates.mutantUnknownUnc5c7351091554304GAERS/MaveGenetic Absence Epilepsy Rats from Strasbourg30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding.inbredCryopreserved Embryo; Cryopreserved SpermNeurobiology1554305DA-Tg(CAG-lacZ)30JmsklacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.transgenicCryopreserved EmbryoDevelopment1554306GK/SlcGoto Kakizaki RatSpontaneous mutant GK rat which were obtained from Japan SLC, Inc.mutantLive AnimalsDiabetes Obesity1554307W-Tg(LAC3)YsThese transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase.transgenicUnknown1554308Gunn-<i>Ugt1a1<sup>j</i></sup>/SlcGunnSegregated inbred Gunn rat which were obtained from Japan SLC, Inc.segregating_inbredLive AnimalsNeurobiology; MetabolismUgt1a1<sup>j</sup>134320641554309W-Tg(CAG-GFP)184YsThese transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator.transgenicCryopreserved Embryo; Cryopreserved SpermDevelopment1554310DA-Tg(CAG-lacZ)19JmsklacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.transgenicCryopreserved Embryo; Cryopreserved SpermDevelopment1556748F344/SnkMedicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, JapaninbredUnknown1558660SHRSP/TkyoSubstrain of SHRSP rats maintained at International Medical Center of Japan, TokyoinbredUnknown1558661WKY/TkyoSubstrain of WKY rats maintained at International Medical Center of Japan, TokyoinbredUnknown1558662SHR/TkyoSubstrain of SHR rats maintained at International Medical Center of Japan, TokyoinbredUnknown1559030LEC-Tg(ATP7B)TohmA 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA.transgenicCryopreserved Embryo; Cryopreserved SpermCancer1559031NE/MaveThe control strain of GAERS, free of any spontaneous spike and wave discharges.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology1559032SS.LEW-(<I>D17Rat65-D17Chm2</I>)/AydThis congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentcongenicUnknown1559033SS.LEW-(<I>D17Rat65-Prl</I>)/AydThis congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient straincongenicUnknownPrl34031559034SS.LEW-(<I>D17Chm14-D17Rat97</I>)/AydThis congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentcongenicUnknown1559035SS.LEW-(<I>D17Chm14-D17Rat181</I>)/AydThis congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient straincongenicUnknown1559036LEW/JmsLewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01)1559037SS.LEW-(<I>D17Chm9-D17Rat97</I>)/AydThis congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segmentcongenicUnknown1559039ODS/ShiOsteogenic disorder ShionogiDr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.mutantUnknown1559040MD/Tamamyelin deficient ratX-linked mutant of the Wistar rat.mutantLive AnimalsNeurobiology; Development1559041SHRSP/NgskSubstrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology; Cardio Hypertension; Osteosis1559042SHR/NigOriginated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976.inbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension; Pharmacology1559043MV/Opumyelin vacuolation ratThe myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999.mutantCryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn<sup><i>mv</i></sup>409028351559044SS.SR-(<i>D3Mco19-D3Mco5</i>)/JrA region of chr 3 which contains the Edn3 gene was introgressed into the SS ratscongenicUnknownEdn325341559045LEW/CrlcLEW substrain obtained from Charles River Laboratories, La Salle, Quebec, CanadainbredUnknown1559046SHR-Chr Y<sup>W</sup>/KConsomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996.consomicUnknown1559047SHRSP/EzoSubstrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, JapaninbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology; Cardio Hypertension1559048SHR.ODS-<i>Gulo<sup>od</sup></i>/ShiA congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995.congenicCryopreserved Embryo; Cryopreserved SpermCardio Hypertension; OsteosisGulo6207011566430SimTac:LETaconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock.outbredUnknown1566431BN/MolTacThe BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003.inbredUnknown1566432WKY/NMolTacWistar KyotoThe inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit.inbredUnknown1566433HanTac:WHIn 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000.outbredUnknown1566434NTac:SHRTaconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony.outbredUnknown1566437SS-Chr X<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicCryopreserved Sperm1566438DA/MolTacDeveloped at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004.inbredUnknown1566439F344/NTacAxenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH.inbredUnknown1566440NTac:SDTaconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies.outbredUnknown1566443LEW/MolTacLewisScripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived.inbredUnknown1566444MolTac:SDThe SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993.outbredUnknown1566445ACI.BN-(<I>D5Mgh17-D5Rat205</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicExtinct1566447GK/MolTacGoto-KakizakiOriginating at Tohoku University, Sendai, Japan in 1975, the Goto-Kakizaki rat was obtained by Aarhus University Hospital, Denmark in 1994. Received from Aarhus by M&B A/S in 1997.inbredUnknown1566448FHH-Chr 9<sup>BN</sup>/McwiA FHH genomic background with a BN chromosome 9 introgressed.consomicCryopreserved Sperm1566453SD-Tg(HIV-LacZ)AngRrrcFertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid.transgenicCryopreserved Embryo; Cryopreserved Sperm1566454BDIV/ZteBDIV/Ztederived from Berlin-Druckrey strain BDIVinbredUnknown1566455HTX/HcjRrrcAvailable at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30.inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery1566456BDIX/Ztederived from Berlin-Druckrey strain BDIXinbredUnknown1566457SPRDSprague-DawleyFrom outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990).inbredUnknown1566458F344-Tg(ROSA26-ALPP)EpsRrrcF344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP, ALPP).transgenicCryopreserved Sperm (as of 2019-07-01)ALPP13143951566459F344-Tg(ROSA26-EGFP)EpsF344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP).transgenicUnknown1566460SD-Tg(ICAM2-DAF)AngRrrcEmbryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter.transgenicCryopreserved Embryo; Cryopreserved Sperm1578692BN.LEW-(<i>D10Rat32-D10Rat116</i>)/CimlCongenic strain was bred from BN.LEW-(<i>D10Mco17-D10Mco14</i>)/Ciml backcrossed to BN/Rj.congenicUnknown1578693LEW.BN-(<i>D10Mco17-D10Rat221</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578694ATAlcohol-TolerantThe parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.inbredCryopreserved Embryo; Cryopreserved Sperm1578695SHA/BruRrrcSyracuse High AvoidanceSelective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats.inbredCryopreserved Embryo; Cryopreserved Sperm1578696LAS1Low Alcohol Sensitive strain 1Selectively bred for 24 generations for low sensitivity to ethanol then inbred.inbredCryopreserved Embryo; Cryopreserved Sperm1578697BN.LEW-(<i>D10Rat32-D10Rat31</i>)/CimlCongenic strain was bred from BN.LEW-(<i>D10Rat32-D10Rat221</i>)/Ciml backcrossed to BN/Rj.congenicUnknown1578698LAS2Low Alcohol Sensitive strain 2Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbredinbredCryopreserved Embryo; Cryopreserved Sperm1578699BGanemic BelgradeThese are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY.inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery1578700HAS1High Alcohol Sensitive strain 1Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbredinbredCryopreserved Embryo; Cryopreserved Sperm1578701HAS2High Alcohol Sensitive strain 2Selectively bred for high ethanol sensitivity for 24 generations, then inbred.inbredCryopreserved Embryo; Cryopreserved Sperm1578702LEW.BN-(<i>D10Rat32-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578703SLA/BruRrrcSyracuse Low AvoidanceSelective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats.inbredCryopreserved Embryo; Cryopreserved Sperm1578704WLPWarsaw Low PreferingThese were bred from albino stock of Wistar rats as lines that had low ethanol preference.inbredUnknown1578705LEW.BN-(<i>D10Arb4-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578706LEW.BN-(<i>D10Mco17-D10Mco14</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578708LEW.BN-(<i>D10Mgh7-D10Rat221</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578709IAincisor absentThese rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption.inbredCryopreserved Embryo; Cryopreserved Sperm1578710LEW.1AR1-<I>iddm</I>/Ztmarose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup>) in the intra-MHC recombinant inbred strain LEW.1AR1; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain sincecoisogenicUnknownDock8<sup>m1Ztm</sup>138308681578711LEW.BN-(<i>D10Mco17-D10Rat133</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578712BN.LEW-(<i>D10Mco17-D10Mco14</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578713BN/Ztmsubstrain of BNinbredUnknown1578714BN.LEW-(<i>D10Mco17-D10Rat80</i>)/CimlCongenic strain created from parental LEW/Rj and BN/Rj strains.congenicUnknown1578715ANTAlcohol-NontolerantThe parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.inbredCryopreserved Embryo; Cryopreserved SpermGabra6618611578716LEW.1AR1/ZtmLewis strain containing MHC haplotype <i>RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup></i>congenicUnknown1578717WHPWarsaw High PreferingThese were bred from albino stock of Wistar rats as lines that had ethanol preference.inbredUnknown1579677FHH-<i>Madd<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated.mutantExtinct (as of 2017-01-26)Madd<i><sup>m1Mcwi</sup></i>15787961579678ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.congenicLive Animals; Cryopreserved Sperm1579680Wild/TkuWildThese rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed.wildUnknown1579681BN-<i>Birc3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated.mutantExtinct (as of 2016-10-24)Birc3<i><sup>m1Mcwi</sup></i>15787881579682FHH-<i>Tlr4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V489A mutation is generated.mutantCryopreserved Sperm (as of 2017-01-26)Tlr4<i><sup>m1Mcwi</sup></i>15787851579683FHH-<i>Ghsr<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. codon CAG/TAG mutation is generated which changes the AA Q343Stop.mutantCryopreserved Sperm (as of 2017-01-26)Ghsr<i><sup>m1Mcwi</sup></i>15787941579684FHH-<i>Slc8a2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y213Stop mutation is generated from the codon change TAT/TAA.mutantCryopreserved Sperm (as of 2017-01-26)Slc8a2<i><sup>m1Mcwi</sup></i>15787861579685FHH-<i>Tgfbr2<sup>m2Mcwi</sup></i>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG.mutantCryopreserved Sperm (as of 2017-01-26)Tgfbr2<i><sup>m2Mcwi</sup></i>15787821579686GH/OmrMcwiThis colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then.inbredLive Animals; Cryopreserved Embryo1579687FHH-<i>Proc<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L312P mutation is generated.mutantCryopreserved Sperm (as of 2017-01-26)Proc<i><sup>m1Mcwi</sup></i>15787901579688BN-<i>Tgfbr2<sup>m1Mcwi</sup></i>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG.mutantExtinct (as of 2017-01-26)Tgfbr2<i><sup>m1Mcwi</sup></i>15788001579689FHH-<i>F10<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V453G mutation is generated from the codon change GTC/GGC.mutantCryopreserved Sperm (as of 2017-01-26)F10<i><sup>m1Mcwi</sup></i>15787831579690FHH-<i>Slc27a5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated.mutantExtinct (as of 2017-01-26)Slc27a5<i><sup>m1Mcwi</sup></i>15787991579691SS.SHR-(<i>D11Mgh3-D11Rat31</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenicUnknown1579692FHH-<i>Lcat<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H353L mutation is generated from the codon change CAC/CTC.mutantCryopreserved Sperm (as of 2017-01-26)Lcat<i><sup>m1Mcwi</sup></i>15787931579693T2DN/McwiGenerated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained.inbredUnknown1579694FHH-<i>Egln3<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E60G mutation is generated.mutantCryopreserved Sperm (as of 2017-01-26)Egln3<i><sup>m1Mcwi</sup></i>15787811579695ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/EurCongenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.congenicUnknown1579696SS.SHR-(<i>D6Wox13-D6Rat84</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenicUnknown1579697SS.SHR-(<i>D13Rat63-D13Mit1</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenicUnknown1579698FHH-<i>Adra1a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a.mutantCryopreserved Sperm (as of 2017-01-26)Adra1a<i><sup>m1Mcwi</sup></i>15787921579699WKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdWKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdThis congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain backgroundcongenicUnknown1579700ACI.FHH-(<i>D1Rat475-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)/EurDouble congenic strain from backcross of ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eur and ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/Eur.congenicUnknown1579701BN-<i>Nos1<sup>m1</i>Mcwi</sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L72Stop mutation is generated.mutantExtinct (as of 2017-01-26)Nos1<i><sup>m1Mcwi</sup></i>15787951579702SS.SHR-(<i>D9Wox16-D9Rat64</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenicUnknown1579703SS.SHR-(<i>D2Rat61-D2Mco18</i>)/McoCongenic strain from the parental SS/Jr and SHR/NHsd inbred strains.congenicUnknown1579704FHH-<i>Agtr1b<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A 3bp deletion generates a mutation at TTC (del251F)of rat Agtr1b.mutantExtinct (as of 2016-11-29)Agtr1b<i><sup>m1Mcwi</sup></i>15787841579705FHH-<i>Nr0b2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC.mutantCryopreserved Sperm (as of 2017-01-26)Nr0b2<i><sup>m1Mcwi</sup></i>15787981579706FHH-<i>Nr4a1<sup>m1Mcwi</i></sup>Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA.mutantCryopreserved Sperm (as of 2017-01-26)Nr4a1<i><sup>m1Mcwi</sup></i>15787911579707FHH-<i>Adipoq<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq.mutantCryopreserved Sperm (as of 2017-01-13)Adipoq<i><sup>m2Mcwi</sup></i>15787971579708FHH-<i>Des<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated.mutantExtinct (as of 2017-01-26)Des<i><sup>m1Mcwi</sup></i>15788011579709Wild/McwiWildThese rats were caught wild in Milwaukee, used for experiments and then sacrificed.wildUnknown1579710GK/FarGoto-KakizakiGenerated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan.inbredUnknown1579711FHH-<i>Adipoq<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.Y162C mutation is generated on rat Adipoq.mutantCryopreserved Sperm (as of 2017-01-13)Adipoq<i><sup>m1Mcwi</sup></i>15787871579712FHH-<i>Klf6<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated.mutantExtinct (as of 2017-01-26)Klf6<i><sup>m1Mcwi</sup></i>15787891579894SS.LEW-(<i>D10Rat204-D10Rat9</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.congenicUnknown1579895FHH-<i>Bdkrb2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated.mutantExtinct (as of 2016-10-24)Bdkrb2<i><sup>m1Mcwi</sup></i>15798891579896SS.LEW-(<i>D2Rat18-D2Chm277</i>)/AydCongenic strain was created from a SS/Jr parental straincongenicUnknown1579897SS.SR-(<i>D9Rat69-D9Mco14</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenicUnknown1579898SS.LEW-(<i>D10Chm128-D10Chm121</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenicUnknown1579899SS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.congenicUnknown1579900SS.SR-(<i>D9Rat89-Resp18</i>)/McoCongenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) straincongenicUnknownResp1835551579901SS.LEW-(<i>D10Chm224-D10Chm6</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenicUnknown1579902SS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.congenicUnknown1579903SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydA congenic substrain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.congenicUnknown1579904SS.SR-(<i>D9Mgh11-D9Mco33</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenicUnknown1579905SS.SR-(<i>D9Rat89-D9Mco27</i>)/McoCongenic strain derived from parental strains SS and SR.congenicUnknown1579906FHH-<i>Adipoq<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L119P mutation is generated from the codon change CTG/CCG of rat Adipoq.mutantCryopreserved Sperm (as of 2017-01-13)Adipoq<i><sup>m3Mcwi</sup></i>15798871579907SS.LEW-(<i>D10Chm128-D10Chm169</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenicUnknown1579908SS.SR-(<i>D9Mco95-Resp18</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenicUnknownResp1835551579909FHH-<i>Fgl2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA.mutantExtinct (as of 2017-01-26)Fgl2<i><sup>m1Mcwi</sup></i>15798851579910FHH-<i>Ccr2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N117S mutation is generated from the codon change AAT/AGT.mutantCryopreserved Sperm (as of 2017-01-26)Ccr2<i><sup>m1Mcwi</sup></i>15798881579911SS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiSS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiThis congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background.congenicUnknown1579912FHH-<i>F10<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C388 Stop mutation is generated from the codon change TGC/TGAmutantCryopreserved Sperm (as of 2017-01-26)F10<i><sup>m2Mcwi</sup></i>15798861579913SS.LEW-(<i>D10Chm224-D10Chm222</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.congenicUnknown1579914SS.LEW-(<i>D10Mco30-D10Got92</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.congenicUnknown1580542PCK-<i>Pkhd1<sup>pck</i></sup>/CrljCrlThis model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Harris and associates in 2002. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD).coisogenicUnknownPkhd1<sup>pck</sup>115359431581616DA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenicUnknown1581617SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13GarThis transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)transgenicUnknown1581618SHRSP/BbbThis SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany.inbredUnknown1581619BN.PD-(<i>D8Rat39-D8Rat35</i>),SHR-(<i>D2Mit4-D2Rat28</i>),SHR-(<i>D2Rat103-D2Rat107</i>)/CubThis triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-<i>Lx</i>.congenicUnknown1581620SS.SR-(<i>D9Mco61-D9Mco27</i>)/McoA congenic strain derived from the progenitor strains SS and SR.congenicUnknown1581621DA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenicUnknown1581622SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrcThis transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)transgenicCryopreserved Embryo (as of 2017-08-17)1581623LA/Humdlow autotomyLow Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbredUnknown1581624FHH-<i>Lipe<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L347P mutation is generated from the codon change CTA/CCA.mutantExtinct (as of 2017-01-26)Lipe<i><sup>m1Mcwi</sup></i>15814951581625BN-<i>Hand1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC.mutantUnknownHand1<i><sup>m1Mcwi</sup></i>15814931581626FHL/EurMcwiFawn Hooded Low blood pressureThe low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage.inbredUnknown1581627WF.WKY-(<i>D5Uwm66-D5Uwm67</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenicUnknown1581628DA.ACI-(<i>D15Rat6-D15Rat13</i>)/KiniDA.ACI-(<i>D15Rat 6-D15Rat13</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenicUnknown1581629WF.WKY-(<i>D5Wox8-D5Uwm62</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenicUnknown1581630WF.WKY-(<i>D5Uwm63-D5Uwm64</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenicUnknown1581631WF.WKY-(<i>D5Uwm61-D5Uwm37</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenicUnknown1581632WF.WKY-(<i>D5Uwm65-D5Uwm60</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37).congenicUnknown1581633DA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenicUnknown1581634BN-<i>Adora2a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a.mutantExtinct (as of 2016-10-24)Adora2a<i><sup>m1Mcwi</sup></i>15814761581635WKY/BbbThis WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany.inbredUnknown1581636BN-<i>Cebpe<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG.mutantUnknownCebpe<i><sup>m1Mcwi</sup></i>15814941581637FHH-<i>Has1<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG.mutantExtinct (as of 2017-01-26)Has1<i><sup>m1Mcwi</sup></i>15814771581638DA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniThis congenic strain contains an ACI chromosome 15 segment transferred to the DA background straincongenicUnknown1581639HAn/Humdhigh autotomy newMales and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbredUnknown1581640HA/Humdhigh autotomyHigh Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbredUnknown1581641WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenicUnknown1581642FHH-<i>Ccr4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA.mutantExtinct (as of 2017-01-26)Ccr4<i><sup>m1Mcwi</sup></i>15814921581643LAn/Humdlow autotomy newMales and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.segregating_inbredUnknown1581644FHH-<i>Htr1a<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C266Y mutation is generated from the codon change TGT/TAT.mutantCryopreserved Sperm (as of 2017-01-26)Htr1a<i><sup>m1Mcwi</sup></i>15814961581645LL/MavIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain.inbredUnknown1582184SR/JrHsdDahl Salt-ResistantSubstrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.inbredUnknown1582185SS.SR-(<i>D3Mco36-D3Got166</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicUnknown1582186FHH.FHH.1<sup>BN</sup>-(<i>D1Rat183-D1Rat76</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenicUnknown1582187SS.SR-(<i>D3Mco24-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicUnknown1582188SS.SR-(<i>D3Mco36-D3Mco46</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicCryopreserved Sperm (as of 2019-02-18)1582189SS.SR-(<i>D3Mco39-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicUnknown1582190SS/JrHsdDahl Salt-SensitiveSubstrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.inbredUnknown1582191FHH.FHH.1<sup>BN</sup>-(<i>D1Rat287-D1Rat84</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenicUnknown1582192SS.SR-(<i>D3Mco36-D3Got159</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicUnknown1582193FHH.FHH.1<sup>BN</sup>-(<i>D1Mgh13-D1Rat89</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenicUnknown1582194SS.SR-(<i>D3Mco78-D3Got130</i>)/JrSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicUnknown1582195FHH.FHH.1<sup>BN</sup>-(<i>D1Rat173F6B-D1Rat84</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenicUnknown1582196FHH.FHH.1<sup>BN</sup>-(<i>D1Rat234-D1Rat265</i>)/McwiFHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.congenicUnknown1598797WF.WKY-(<i>D10Got124-D10Rat187</i>)/UwmWKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL.congenicUnknown1598798BBDP/WorNDiabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.inbredExtinct (as of 2021-02-22)1598799ACI.FHH-(<i>D1Rat384-D1Rat452</i>)(<i>D17Rat61-D1Arb5</i>)(<i>D17Rat51</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain.congenicUnknown1598800ACI.FHH-(<i>D1Rat384-D1Rat156</i>)/EurCongenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain.congenicUnknown1598801ACI.FHH-(<i>D1Mit18-D1Mit8</i>)(<i>D14Mit11-D14Hmgc14b</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.congenicUnknown1598802BBDR/WorNDiabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generationinbredExtinct (as of 2021-02-22)1598803BBNB/WorNDeveloped from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.inbredUnknown (as of 2020-02-24)1598804WKY.GHS-(<i>D1Rat32-D1Mit32</i>)GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTLcongenicUnknown1599674BBDP.WF-(<i>D8Rat59-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenicUnknown1599675BBDP.WF-(<i>D13Rat124-D13Mgh5</i>)/SunnThe BBDP/WorSunn rats were crossed with inbred WF rats (that share the same MHC haplotype as BBDP/WorSunn rats but differ at the CD45 allele) obtained from Charles River. Introgression of the WF CD45 (RT7.2) allele into BBDP/WorSunn was performed by phenotypic selection of backcross breeders for >10 generations, followed by intercrossing. This led to WF RT7.2 allele introgressed onto the genetic background of BBDP rats and also called BBDP/WorSunn.WF-CD45 inbred line.congenicUnknownPtprc34511599755F344.BN-(<i>D16Mit5-D16Rat75</i>)BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segmentcongenicUnknown1599756BN-<i>Has2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA.mutantUnknownHas2<i><sup>m1Mcwi</sup></i>15995661599757BN-<i>Adora2a<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a.mutantExtinct (as of 2016-10-24)Adora2a<i><sup>m2Mcwi</sup></i>15995611599758SS-<i>Sod3<sup>m1Mcwi</i></sup>Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Sod3<i><sup>m1Mcwi</sup></i>15995671599759GRY/Idrgroggy ratGroggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003.mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12)NeurobiologyCacna1a<sup>gry</sup>128803821599760SPRD.WKY-(<i>D18Wox8-D18Rat44</i>)/IbmmSPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.congenicUnknown1599761BN-<i>Lcat<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG.mutantUnknownLcat<i><sup>m2Mcwi</sup></i>15995701599762SS-<i>Bdkrb2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA.mutantUnknownBdkrb2<i><sup>m2Mcwi</sup></i>15995681599763SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/IbmmSPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.congenicUnknown1599764COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.congenicUnknown1599765SS-<i>Klf4<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC.mutantUnknownKlf4<i><sup>m2Mcwi</sup></i>15995591599766SS-<i>Hps6<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG.mutantUnknownHps6<i><sup>m1Mcwi</sup></i>15995641599767SS-<i>Htr1a<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC.mutantUnknownHtr1a<i><sup>m2Mcwi</sup></i>15995621599768SS-<i>Klf4<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC.mutantUnknownKlf4<i><sup>m1Mcwi</sup></i>15995691599769COP.DA-(<I>D3Rat233-D3Mgh14</I>)/McoMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.congenicUnknown1600337F344.GK-(<i>D1Mgh14-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenicUnknown1600338SHR.F344-(<i>D12Mgh5-D12Mgh6</i>)/SnkSegment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic techniquecongenicUnknown1600339BN.GK-(<i>D1Wox18-D1Got254</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenicUnknown1600340DA/BklArbNsiOriginally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI.inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)1600341LEW-Tg(Ren2)27/JmulThis is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl ratstransgenicUnknown1600342F344.GK-(<i>D1Got250-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenicUnknown1600343SHRSP.WKY-(<I>D1Wox29-D1Arb21</I>)/IzmThis congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategycongenicCryopreserved EmbryoCardio Hypertension1600344F344.GK-(<i>D1Rat175-D1Rat90</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenicUnknown1600345F344.GK-(<i>D1Rat83-D1Rat376</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenicUnknown1600346F344.GK-(<i>D1Swe4-D1Rat85</i>)/SweThis is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.congenicUnknown1600490SS-Chr 1<sup>BN</sup>/McwiA cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressedconsomicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm1625284Wild1/HubrThis rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolationwildUnknown1626207BN-<i>Adora2a<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E207K mutation is generated from the codon change GAG/AAG of rat Adora2a.mutantExtinct (as of 2016-10-24)Adora2a<i><sup>m3Mcwi</sup></i>16420701626210BN-<i>Lipe<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q52L mutation is generated from the codon change CTG/CAG.mutantUnknownLipe<i><sup>m2Mcwi</sup></i>16421691626211SS-<i>Cpf2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.mutantUnknown1626213BN-<i>Oxtr<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F225Y mutation is generated from the codon change TTC/TAC.mutantUnknownOxtr<i><sup>m1Mcwi</sup></i>16421731626214BN-<i>Slc27a5<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K160E mutation is generated from the codon change AAA/GAA.mutantUnknownSlc27a5<i><sup>m2Mcwi</sup></i>16421701641831MWF-Chr 6<sup>SHR</sup>/RkbMWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomicUnknown1641849SS.LEW-(<i>D10Mit1-D10Mgh1</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641850SHR.WKY-(<i>D1Got158-D1Got161</i>)/NjsThis is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant regioncongenicUnknownSpon16199181641851SHR.PD-(<I>D8Rat42-D8Arb23</I>)/CubA differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-<i>Lx</i> straincongenicUnknownZbtb16|Zbtb16<sup>Lx</sup>727921|129108341641852WF.BBDR-(<i>D4Got48-D4Got43</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.congenicUnknown1641853SS.LEW-(<i>D10Mco38-D10Mgh1</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641854HAS.LAS-(<i>D5Rat70-D5Rat37</i>)/RarHAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped,congenicUnknown1641855BBDP.WF-(<i>D8Rat73-D8Rat20</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenicUnknown1641856P.NP-(<i>D4Rat119-D4Rat55</i>)/IusmP and NP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenicUnknown1641857BBDP.WF-(<i>D8Rat16-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenicUnknown1641858SHR.WKY-(<i>D1Rat420-D1Rat278</i>)/NjsThis is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant regioncongenicUnknown1641859SS.MNS-(<i>D10Bra1-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641860SS.MNS-(<i>D10Mco62-D10Mit1</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641861HAS.LAS-(<i>D2Rat53-D2Rat138</i>)/RarHAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped,congenicCryopreserved Sperm (as of 2019-02-26)1641862F344-<i>Apc<sup>Pirc</i></sup>/UwmMale F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam)mutantLive Animals; Cryopreserved Sperm (as of 2018-07-16)Apc<sup>Pirc</sup>15543221641863SHR.PD-(<I>D8Mgh9-D8Rat149</I>)/CubA differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv.congenicUnknownZbtb16|Zbtb16<sup>Lx</sup>727921|129108341641864WF/CrCrliJ. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute.inbredUnknown1641865SD-<i>Brca2<sup>m1Uwm</i></sup>9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. Nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon).mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01)Brca2<i><sup>m1Uwm</sup></i>7283261641866SS.LEW-(<i>D10Mit10-D10Rat24</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641867P/Iusmalcohol-preferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains.inbredUnknownSnca37291641868WF.BBDR-(<i>D4Rat93-D4Rat228</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.congenicUnknownTcrb38341641869SS.MNS-(<i>D10Mco31-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641870BBDP.WF-(<i>D8Rat73-D8Rat121</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenicUnknown1641871SS.MNS-(<i>D10Mco62-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641872SS.LEW-(<i>D10Mco38-D10Mco41</i>)/JrThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1641873NP/Iusmalcohol-nonpreferringThese were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains.inbredUnknownSnca37291641874BBDP.WF-(<i>D8Rat73-D8Rat90</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenicUnknown1641875SHR-Chr Y<sup>BN</sup>/CubBN-<i>Lx</i>/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generationsconsomicUnknown1641876BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)/SunnWF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDPcongenicUnknown1641877NP.P-(<i>D4Rat119-D4Rat55</i>)/IusmMale P and female NP rats were backcrossed to get F1 animals which were further backcrossed to NP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenicUnknownAkr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap12092|3197|3729|68368|735049|1307836|1308501|1310949|13114181641878WF.BBDR-(<i>Clcn1-D4Rat228</i>)/WorThis congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.congenicUnknownClcn123601641879SS-Chr 19<sup>SHR</sup>/RkbSS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomicUnknown1641880SD-<i>Brca1<sup>m1Uwm</i></sup>9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01)Brca1|Brca1<i><sup>m1Uwm</sup></i>2218|7282981642017BBDR/WorBrmDiabetes resistant BB rats maintained in BRM. This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at Biomedical Research Models, Inc.inbredUnknown1642018BBDP/WorBrmThis strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester.inbredUnknown1642036SHR/OlaIpcv-mt<sup>BN/Crl</sup>Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic backgroundconplasticUnknown1642269SS-<i>Birc3<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K170E mutation is generated from the codon change AAG/GAG.mutantExtinct (as of 2017-01-26)Birc3<i><sup>m2Mcwi</sup></i>16421781642270BN-Lcat<i><sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC.mutantCryopreserved Sperm; CryorecoveryLcat<i><sup>m3Mcwi</sup></i>16421751642271SS-<i>Klf4<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H344L mutation is generated from the codon change CAT/CTT.mutantCryopreserved Sperm (as of 2017-01-26)Klf4<i><sup>m3Mcwi</sup></i>16421791642272SS.LEW-(<i>D10Mco84-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642273SS-<i>Thbd<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N256K mutation is generated from the codon change AAC/AAA.mutantExtinct (as of 2017-01-26)Thbd<i><sup>m1Mcwi</sup></i>16421821642274SS-<i>Has1<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V155L mutation is generated from the codon change GTC/CTC.mutantExtinct (as of 2017-01-26)Has1<i><sup>m2Mcwi</sup></i>16421711642275SS.LEW-(<i>D10Rat29-D10Mco88</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642276SS-<i>Kcna5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N152K mutation is generated from the codon change AAT/AAA.mutantCryopreserved Sperm (as of 2017-01-26)Kcna5<i><sup>m1Mcwi</sup></i>16421771642277SS-<i>Cpt2<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F475L mutation is generated from the codon change TTC/CTC.mutantCryopreserved Sperm (as of 2017-01-26)Cpt2<i><sup>m1Mcwi</sup></i>16421741642278SS-<i>Ghsr<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S342P mutation is generated from the codon change TCC/CCC.mutantExtinct (as of 2017-01-26)Ghsr<i><sup>m2Mcwi</sup></i>16421801642279SS.LEW-(<i>D10Arb9-D10Rat161</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642281SS-<i>Podxl<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA.mutantExtinct (as of 2017-01-26)Podxl<i><sup>m1Mcwi</sup></i>16421761642282SS-<i>Cacna1g<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S490T mutation is generated from the codon change TCT/ACT.mutantUnknownCacna1g<i><sup>m1Mcwi</sup></i>16421681642283SS.LEW-(<i>D10Rat29-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642284SS-<i>Fgl2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K129N mutation is generated from the codon change AAG/AAT.mutantUnknownFgl2<i><sup>m2Mcwi</sup></i>16421811642285SS.LEW-(<i>D10Arb9-D10Rat57</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642287SS.LEW-(<i>D10Arb9-D10Mco84</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642288SS.LEW-(<i>D10Mco89-D10Got101</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642289SS-<i>Serpina5<sup>m1Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H24R mutation is generated from the codon change CAT/CGT.mutantUnknownSerpina5<i><sup>m1Mcwi</sup></i>16421671642362SS-<i>Has1<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D167D mutation is generated from the codon change GAT/GAC.mutantUnknownHas1<i><sup>m3Mcwi</sup></i>16423591642363BN-<i>Fgl2<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N353H mutation is generated from the codon change AAT/CAT.mutantUnknownFgl2<i><sup>m3Mcwi</sup></i>16423551642364SS-<i>Ghsr<sup>m3Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N26K mutation is generated from the codon change AAC/AAA.mutantCryopreserved Sperm (as of 2017-01-26)Ghsr<i><sup>m3Mcwi</sup></i>16423571642365SS-<i>Fgl2<sup>m4Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H338P mutation is generated from the codon change CAT/CCT.mutantCryopreserved Sperm (as of 2017-01-26)Fgl2<i><sup>m4Mcwi</sup></i>16423541642366SS-<i>Lcat<sup>m4Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT.mutantExtinct (as of 2017-01-26)Lcat<i><sup>m4Mcwi</sup></i>16423581642367BN-<i>Ccr2<sup>m2Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I99T mutation is generated from the codon change ATC/ACC.mutantExtinct (as of 2017-01-26)Ccr2<i><sup>m2Mcwi</sup></i>16423561642439SS-<i>Lcat<sup>m5Mcwi</i></sup>Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y297Stop mutation is generated from the codon change TAC/TAA.mutantCryopreserved Sperm (as of 2017-01-26)Lcat<i><sup>m5Mcwi</sup></i>16424381642689BN.OLETF-(<i>D1Rat169-D1Rat90</i>)/GotOLETF/Got females were crossed with BN/Crlj to produce F<sub>1</sub> which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotypedcongenicUnknownPrlhr710371642690LA-<i>cp</i>/NJcrOriginated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta.congenicUnknown1642968SS.LEW-(<i>D10Mco84-D10Rat58</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642969SS.LEW-(<i>D10Mco84-D10Mco134</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642970SS.LEW-(<i>D10Mco113-D10Got93</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642971SS.LEW-(<i>D10Mco84-D10Mco129</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642972SS.LEW-(<i>D10Mco84-D10Mco143</i>)/McoThis is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown1642989SS-Tg(CAG-EGFP)1McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicCryopreserved Sperm (as of 2019-04-04)1642990SD-Tg(CAG-EGFP)63McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.transgenicUnknown1642991SS-Tg(CAG-eGFP)18McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicUnknown1642992SS-Tg(CAG-EGFP)28McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicUnknown1642993SD-Tg(CAG-EGFP)97McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.transgenicUnknown1642994SS-Tg(CAG-EGFP)43McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicUnknown1642995SS-Tg(CAG-eGFP)10McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicUnknown1642996SS-Tg(CAG-EGFP)2McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicUnknown1642997SS-Tg(CAG-EGFP)23McwiThis transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.transgenicUnknown1643001FH/UncFawn-hoodedA substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel HillinbredUnknown1643002SHR.WKY-(<i>D1Rat420-D1Got161</i>)/NjsFragment of the chromosome 1 derived from WKY and repeated backcross to SHRcongenicUnknownSpon16199181643007DA.ACI-(<i>D12Wox12-D12Rat53</i>)/ArbACI/SegHsd and DA/OlaHsd were crossed to get F<sub>2</sub> animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsdcongenicUnknown1643010F344.OLETF-(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/Tjdouble congenic strain generated by intercrossing F344.OLETF-(<i>D7Rat18-D7Mit2</i>)/Tj and F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj and F<sub>2</sub> rats screened for homozygositycongenicUnknown2289819SS.MNS-(<i>D10Mco62-D10Got99</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289820SS.MNS-(<i>D10Mco30-D10Got91</i>)/1McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289821SS.MNS-(<i>D10Mco30-D10Got91</i>)/3McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289822SS.MNS-(<i>D10Mco30-D10Got112</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289823SS.MNS-(<i>D10Mco62-D10Mco30</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289824SS.MNS-(<i>D10Mco30-D10Got101</i>)/McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289825SS.MNS-(<i>D10Rat24-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289826SS.MNS-(<i>D10Mco30-D10Got91</i>)/2McoThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289827SS.MNS-(<i>D10Mco30-D10Mco31</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289913SS.MNS-(<i>D10Rat13-D10Rat12</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289916SS.MNS-(<i>D10Mco15-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2289917SS.MNS-(<i>D10Mco70-D10Mit11</i>)/JrThis is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2290056F344-<i>Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4<sup>th</sup> intron of the Rbed1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup>22900552290057F344-TgTn(T2/Bart3)1CebThe Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.transgenicCryopreserved Sperm2290064F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup>22900602290065F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD: 2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).mutantUnknownCA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup>22900592290066F344-<i>Nell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the second intron of the Nell1.mutantUnknownNell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup>22900612290067F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).mutantUnknownBI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup>22900622290078F344-<i>Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene.mutantCryopreserved Sperm (as of 2017-01-26)Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup>22900682290079F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownBI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup>22900692290080F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownBI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup>22900742290081F344-<i>BI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCryopreserved SpermBI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup>22900722290082F344-<i>Brinp3<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Brinp3<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup>22900712290083F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene.mutantUnknownSlc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup>22900732290100F344-<i>Entpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Entpd6 gene.mutantUnknownEntpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup>22900862290101F344-<i>CB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownCB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup>22900922290102F344-<i>Klhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene.mutantUnknownKlhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup>22900852290103F344-<i>Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb and F344-Tg(PGK2-sb11)Ceb. This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup>22900902290104F344-<i>Cadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene.mutantUnknownCadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup>22900882290105F344-<i>Sptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene.mutantUnknownSptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup>22900972290106F344-<i>BQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownBQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup>22900702290107F344-<i>Cyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Cyss gene.mutantUnknownCyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup>22900952290108F344-<i>LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene.mutantCryopreserved Sperm (as of 2017-01-26)LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup>22900892290109F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownCA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup>22900872290110F344-<i>Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup>22900962290111F344-<i>Cst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Cst3 gene.mutantUnknownCst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup>22900932290112F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownCA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup>22900942290113F344-<i>Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene.mutantCryopreserved Sperm (as of 2017-01-26)Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup>22900982290114F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene.mutantUnknownSlc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup>22900912290135F344-<i>Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2<sup>nd</sup> intron of the Chsy1.mutantCryopreserved Sperm (as of 2017-01-26)Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup>22901232290136F344-<i>Slc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2<sup>nd</sup> intron of the Slc24a4 gene.mutantUnknownSlc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup>22901272290137F344-<i>BF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCryopreserved SpermBF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup>22901262290138F344-<i>Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene.mutantExtinct (as of 2016-12-12)Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup>22901282290139F344-<i>AW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownAW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup>22901222290140F344-<i>BI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownBI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup>22901152290141F344-<i>Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene.mutantCryopreserved Sperm (as of 2016-11-11)Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup>22901212290142F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene.mutantUnknownLOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup>22901182290143F344-<i>Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene.mutantCryopreserved Sperm (as of 2017-01-26)Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup>22901162290144F344-<i>Adgrl3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 gene.mutantCryopreserved Sperm (as of 2017-01-13)Adgrl3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup>22901292290145F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownBI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup>22901202290146F344-<i>Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup>22901252290147F344-<i>Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6<sup>th</sup> intron of the Sptlc3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup>22901242290148F344-<i>Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene.mutantExtinct (as of 2016-12-21)Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup>22901172290159F344-<i>Spetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Spetex-2H gene.mutantUnknownSpetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup>22901502290160F344-<i>Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene.mutantCryopreserved Sperm (as of 2017-01-26)Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup>22901542290161F344-<i>Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene.mutantExtinct (as of 2017-01-30)Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup>22901562290162F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene.mutantCryopreserved Sperm (as of 2017-01-26)Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup>22901492290163F344-TgTn(T2/Bart3)2Cebtransposon sleeping beautyThe Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.transgenicExtinct (as of 2016-11-14)2290164F344-<i>Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109<sup>th</sup> intron of the Syne1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup>22901532290165F344-<i>Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene.mutantExtinct (as of 2017-01-24)Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup>22901572290166F344-<i>Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup>22901552290167F344-<i>Dlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6<sup>th</sup> intron of the Dlg1 gene.mutantUnknownDlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup>22901522290168F344-<i>Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). The trap construct targeted to the 4th intron of the Pde5a gene.mutantExtinct (as of 2017-01-24)Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup>22901512290169F344-Tg(PGK2-sb11)CebSleeping beauty transposase transgenicsb11 cDNA linked to human PGK2 promoter was used.transgenicExtinct (as of 2016-11-14)2290170F344-<i>Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3<sup>rd</sup> intron of the Cd226 gene.mutantCryopreserved Sperm (as of 2017-01-26)Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup>22901582290171F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene.mutantUnknownLOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup>22901192290186SD-Tg(SOD1*G93A)39SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutationtransgenicUnknownSOD17308552290187SD-Tg(SOD1*H46R)4SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutationtransgenicUnknownSOD17308552290272SS/JrNgsstrain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki JapaninbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension2290273SHRSP.WKY-<i>(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)</i>/IzmTkyoThe desired fragment is transferred from WKY to SHRSPcongenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cardio Hypertension2290274SHRSP.WKY-<i>(D15Rat2-D15Rat94)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2290275SHRSP.WKY-<i>(D3Tkyo7-D3Rat1)</i>/TkyoThe desired fragment is transferred from WKY to SHRSPcongenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2290276SHRSP.WKY-<i>(D3Mgh16-D3Mgh15)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2290277SHRSP.WKY-<i>(D3Rat227-D3Rat166)</i>/TkyoThe desired fragment is transferred from WKY to SHRSPcongenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2290278SR/JrNgsstrain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki JapaninbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension2290279SHRSP.WKY-<i>(D15Rat68-D15Rat106)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2290280SHRSP.WKY-<i>(D3Mgh16-D3Rat110)</i>/TkyoThe desired fragment is transferred from WKY to SHRSPcongenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2290281SHRSP.WKY-<i>(D3Rat227-D3Rat1)</i>/TkyoThis congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2290282SHRSP.WKY-<i>(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)</i>/IzmTkyoThe desired fragment is transferred from WKY to SHRSPcongenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cardio Hypertension2290298SHR-Tg(Thy1-MAPT)318SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391transgenicUnknownMAPT7364962290299SHR-Tg(Thy1-MAPT)72SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391transgenicUnknownMAPT7364962290311SD-Tg(SOD1*G93A)26DwcSD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutationtransgenicUnknownSOD17308552290386SD-Tg(Wld<sup>s</sup>)23ColeSD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changestransgenicUnknown2290387SD-Tg(UbC-APPswe)6590SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutationtransgenicUnknownAPP7360212290391SD-Tg(Wld<sup>s</sup>)79ColeSD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changestransgenicUnknown2290429SS-Tg(ApoC3-CETP)53OpazSS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promotertransgenicCryopreserved Embryo; Cryopreserved Sperm2291840F344-<i>Dzank1<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene.mutantExtinct (as of 2016-10-17)Dzank1<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup>22918392292168ISIAHInherited stress-induced arterial hypertensionSelected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stressinbredUnknown2292384SS.LEW-(<i>D10Chm167-D10Chm257</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.congenicUnknown2292385SS.LEW-(<i>D10Mco30-D10Got107</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.congenicUnknown2292386SS.LEW-(<i>D10Chm155-D10Rat127</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.congenicUnknown2292387SS.LEW-(<i>D10Chm224-D10Chm259</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.congenicUnknown2292388SS.LEW-(<i>D10Chm246-D10Chm257</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.congenicUnknown2292389SS.LEW-(<i>D10Chm10-D10Chm14</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat13-D10Rat11</i>)/Ayd.congenicUnknown2292390SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.congenicUnknown2292451F344-<i>Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene.mutantCryopreserved Sperm (as of 2017-01-26)Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup>22924502292452F344-<i>Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup>22924492292453F344-<i>BE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCryopreserved SpermBE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup>22924482292454F344-<i>RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene.mutantExtinct (as of 2017-01-26)RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup>22924472292459WF.LEW-<i>RVFV</i>This rat strain was developed by classical breeding technique inserting the gene for resistance to lethal RVFV infection from the LEW rat strain into the genetic background of the WF rat strain.congenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-11-15)2292526SS-Tg(Atp1a1)48OpazSS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPasetransgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24)2292527SS-Tg(RA1V9)64OpazDahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal.transgenicCryopreserved Embryo; Cryopreserved Sperm2292528F344-Tg(APPswe)OpazF344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promotertransgenicCryopreserved Embryo; Cryopreserved Sperm2292529LEW-Tg((ROSA)26Sor-luc)11JmskLEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI sitetransgenicCryopreserved Sperm (as of 2017-08-08)Development2292530SD-Tg(Pou5f1-Dsred)This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells.transgenicCryopreserved Embryo; Cryopreserved Sperm2292531SD-Tg(Pou5f1-EGFP)This transgenic strain carries a random insertion of a construct containing mouse promoter Pou5f1 to drive the expression of EGFP.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2018-04-23)2292532F344-Tg(betaCTF-l45F)F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid proteintransgenicCryopreserved Embryo; Cryopreserved Sperm2292564ACI.COP-(<i>D6Rat80-D6Rat146</i>)/ShulFemale COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenicUnknown2292565ACI.COP-(<i>D3Mgh16-D3Rat119</i>)/ShulFemale COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenicUnknown2292566ACI.COP-(<i>D3Rat130-D3Rat114</i>)/ShulFemale COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenicUnknown2292567ACI.COP-(<i>D10Mgh20-D10Rat4</i>)/ShulFemale COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotypedcongenicUnknown2292647SS.LEW-(<I>D1Mco36-D1Rat106</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2292648SS.LEW-(<I>D1Mco36-D1Mco77</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2292649SS.LEW-(<I>D1Mco36-D1Rat131</I>)/1McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2292650SS.LEW-(<I>D1Mco36-D1Rat131</I>)/2McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2292651SS.LEW-(<I>D1Mco99-D1Rat49</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2292652SS.LEW-(<I>D1Mco85-D1Rat49</I>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2292653SS.LEW-(<i>D1Mco36-D1Mco101</i>)/McoThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2293012ACI.BBDP-(<i>RT1<sup>u</sup></i>)(<i>Gimap5</i>)/Sunn2 BBDP regions (Iddm1 and Iddm2) were introgressed into the ACI/SegHsd backgroundcongenicUnknown2293120LOU.BN-(<i>D10Mgh1-D10Mgh14</i>)/Inssegment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOUcongenicUnknownAce24932293143SS.BN-(<i>D13Rat20-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknownRen35542293144SS.BN-(<i>D13Rat91-D13Rat179</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2293145SS.BN-(<i>D13Hmgc64-RN34_13048990782</i>)/McwiSS/JrHsdMcwi were crossed with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknownRen35542293146SS.BN-(<i>D13Rat20-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2293354LEW.WKY-(<i>D16Rat88-D16Rat40</i>)/Tjasegment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsdcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)2293355WKY.LEW-(<i>D16Rat88-D16Rat40</i>)/Tja22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrlcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)2293729SHR-<i>Gja8</i><sup>m1Cub</sup>This strain is derived from SHR/OlaIpcv where a mutation is observed in the NH<sub>2</sub>-terminal cytosolic domain of Cx50, L7QcoisogenicUnknownGja8|Gja8<sup>m1Cub</sup>628890|127919922293761LH-Chr 17<sup>BN</sup>/MavChr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomicUnknown2293770SHHF/BbbInitial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breedinginbredUnknown2293832LOU.BN-(<i>D6Rat128-D6Rat115</i>)/Inssegment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercrosscongenicUnknown2298494Kini:DA,PVG-G10Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG.1AV1 females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couplesadvanced_intercross_lineUnknown2298498W/GaoxGenerated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine UniversityinbredUnknown2298772WF<sup>fzHsd</sup>Fuzzy ratSparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987)mutantCryopreserved Embryo; Cryopreserved Sperm2299122F344-<i>Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene.mutantExtinct (as of 2017-01-26)Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup>22991012299123F344-<i>AW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantUnknownAW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup>22991082299124F344-<i>Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup>22991092299125F344-<i>Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene.mutantCryopreserved Sperm (as of 2017-01-26)Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup>22991132299126F344-<i>Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup>22991002299127F344-<i>Eva1a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene.mutantExtinct (as of 2017-01-26)Eva1a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup>22990942299128F344-<i>Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene.mutantCryopreserved Sperm (as of 2017-01-26)Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup>22991032299129F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene.mutantExtinct (as of 2017-01-26)Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup>22991072299130F344-<i>Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene.mutantCryopreserved Sperm (as of 2017-01-13)Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup>22990932299131F344-<i>Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup>22991152299132F344-<i>Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene.mutantExtinct (as of 2017-01-26)Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup>22991162299133F344-<i>Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup>22990982299134F344-<i>Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene.mutantCryopreserved Sperm (as of 2017-01-26)Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup>22991052299135F344-<i>Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene.mutantCryopreserved Sperm (as of 2017-01-26)Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup>22991062299136F344-<i>Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene.mutantExtinct (as of 2017-01-26)Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup>22991172299137F344-<i>Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup>22991102299138F344-<i>Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene.mutantCryopreserved Sperm (as of 2017-01-26)Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup>22991182299139F344-<i>Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene.mutantExtinct (as of 2017-01-26)Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup>22991142299140F344-<i>Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene.mutantCryopreserved Sperm (as of 2017-01-26)Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup>22989382299141F344-<i>Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene.mutantExtinct (as of 2017-01-26)Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup>22991042299142F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene.mutantExtinct (as of 2017-01-26)Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup>22990952299143F344-<i>Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene.mutantCryopreserved Sperm (as of 2017-01-26)Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup>22991112299144F344-<i>Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene.mutantCryopreserved Sperm (as of 2017-01-26)Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup>22990992299145F344-<i>Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene.mutantExtinct (as of 2017-01-26)Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup>22990962299146F344-<i>Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene.mutantExtinct (as of 2017-01-26)Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup>22990972299147F344-<i>Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene.mutantCryopreserved Sperm (as of 2017-01-26)Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup>22991122299148F344-<i>Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene.mutantCryopreserved Sperm (as of 2017-01-26)Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup>22991022300018SHRSP.ZUC-(<i>D5Rat4-D5Rat36</i>)/IzmDmcrSelective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/IzmcongenicLive AnimalsDiabetes Obesity; Cardio Hypertension2300195EHC.BN-(<i>D14Rat43-D14Rat132</i>)/KyuEHC/Seac and BN/Seac were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenicscongenicUnknown2300215SHR.BN-(<i>D10Mgh3-D10Rat85</i>)/IpcvCongenic substrain derived from SHR.BN-(<i>D10Mgh3-Srebf1</i>)/IpcvcongenicUnknown2300216SHR-Tg(PEPCK-SREBF1)1IpcvSHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signaltransgenicUnknownSREBF1694732300217SHR.BN-(<i>D10Mgh3-Srebf1</i>)/Ipcv53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv backgroundcongenicUnknownSrebf1694232301079F344-<i>Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7.mutantCryopreserved Sperm (as of 2017-01-26)Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup>23010782301080F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene.mutantCryopreserved Sperm (as of 2017-01-26)Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup>23010762301081F344-<i>Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1.mutantCryopreserved Sperm (as of 2017-01-26)Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup>23010772301246SS.LEW-(<i>D3Rat61-D3Wox1</i>)/AydA segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown2301247SS.LEW-(<i>D16Got3-D16Rat112</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Mit2-D16Chm23</i>)/AydcongenicUnknown2301248SS.LEW-(<i>D3Got33-D3Chm68</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydcongenicUnknown2301249SS.LEW-(<i>D18Rat30-D18Chm29</i>)/AydA segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown2301315LE/OrlLong-Evans/CryptorchidObtained from Centre Nationale de la Researche Scientifique, Orleans, FranceinbredUnknown2301330KHDevelped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, OklahomainbredUnknown2301367SHRSP.WKY-(<I>D2Mit5-D2Rat133</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenicUnknown2301368SHRSP.WKY-(<I>D2Wox15-D2Rat133</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenicUnknown2301369SHRSP.WKY-(<I>D2Rat132-D2Rat53</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenicUnknown2301370SHRSP.WKY-(<I>D2Wox9-D2Rat231</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenicUnknown2301371SHRSP.WKY-(<I>D2Mit21-D2Rat157</I>)/GcrcCongenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragmentcongenicUnknownGstm1|Vcam1|S1pr12755|3952|619582301381SS.LEW-(<I>D18Chm41-D18Rat92</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301382SS.LEW-(<I>D18Chm91-D18Rat67</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301383SS.LEW-(<I>D18Chm31-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301384SS.LEW-(<I>D18Chm41-D18Rat45</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301385SS.LEW-(<I>D18Rat29-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301386SS.LEW-(<I>D18Rat61-D18Rat45</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301387SS.LEW-(<I>D18Rat67-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301388SS.LEW-(<I>D18Chm56-D18Rat55</I>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown2301700F344-<i>Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene.mutantCryopreserved Sperm (as of 2017-01-26)Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup>23016972301701F344-<i>Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene.mutantCryopreserved Sperm (as of 2017-01-26)Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup>23016982301702F344-<i>Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup>23016962301937BN.GH-(<i>D18Rat41-D18Mgh4</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationscongenicUnknown2301938BN.GH-(<i>D6Mit12-D6Rat15</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationscongenicUnknown2301939BN.GH-(<i>D2Rat22-D2Mgh11</i>)/McwiMale GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generationscongenicUnknown2301986BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh backgroundcongenicUnknown2301987BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)/Mcwidesired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh backgroundcongenicUnknown2301988BN.GH-(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh backgroundcongenicUnknown2301989BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/Mcwidesired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh backgroundcongenicUnknown2302067F344/DuCrlSweSubstrain of Fischer rats maintained at Malmo, SwedeninbredUnknown2302080Rhd:F344,GK-G21GK/Swe and F344/Swe were bred to create F<sub>1</sub> generation, couples of F<sub>1</sub> with GK/Swe and F344/Swe females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding random couples which were intercrossed to get further generationsadvanced_intercross_lineUnknown2302081DA.E3-(<i>D11Got79-D11Wox5</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers. The region corresponding with he production of RF-Igl ambda antibodies was mapped to a narrower region 'D11Got79-D11Rat50.'congenicUnknown2302106SHRSP.WKY-(<I>D1Rat44-D1Arb21</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicCryopreserved EmbryoCardio Hypertension2302108SHRSP.WKY-(<I>D1Mgh5-D1Wox29</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicCryopreserved EmbryoCardio Hypertension2302109SHRSP.WKY-(<I>D1Mgh5-D1Rat44</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicCryopreserved EmbryoCardio Hypertension2302110SHRSP.WKY-(<I>Apbb1-D1Arb21</I>)/IzmSHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selectioncongenicCryopreserved EmbryoCardio HypertensionApbb121222302132SHRSP-Tg(Tagln-ACE2)6918BdrTrangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryostransgenicUnknownTagln|ACE23723|13471742302141F344-Tg(Cyp1a1-Ren2)10JmulGenerated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression. The integration site was on Y chromosome as suggested by Southern blot analysis.transgenicUnknownCyp1a1|Ren22458|16223752302148SHR-Tg(Ef1a-Cd36)10IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicUnknownCd3623012302149SHR-Tg(Ef1a-Cd36)19IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicUnknownCd3623012302150SHR-Tg(Ef1a-Cd36)93IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicUnknownCd3623012302151SHR-Tg(Ef1a-Cd36)106IpcvGenerated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vectortransgenicUnknownCd3623012302279F344.SDT-(<i>D3Wox9-D3Arb20</i>)/KbeFemale F344/NSlc were crossed with male SDT/CrljJcl, then female F<sub>1</sub> were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markerscongenicUnknown2302387DA.ACI-(<i>D2Mit12-D2Mgh29</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsicongenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studies2302649F344-<i>Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup>23026452302650F344-<i>Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup>23026412302651F344-<i>Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup>23026382302652F344-<i>Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene.mutantCryopreserved Sperm (as of 2017-01-26)Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup>23026442302653F344-<i>Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene.mutantCryopreserved Sperm (as of 2017-01-26)Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup>23026472302654F344-<i>Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup>23026372302655F344-<i>Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene.mutantCryopreserved Sperm (as of 2017-01-26)Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup>23026462302656F344-<i>Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene.mutantExtinct (as of 2017-01-26)Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup>23026422302657F344-<i>Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup>23026482302658F344-<i>Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene.mutantCryopreserved Sperm (as of 2017-01-26)Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup>23026402302659F344-<i>Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene.mutantCryopreserved Sperm (as of 2017-01-26)Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup>23026362302660F344-<i>Nectin1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1.mutantCryopreserved Sperm (as of 2017-01-26)Nectin1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup>23026392302661F344-<i>Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene.mutantCryopreserved Sperm (as of 2017-01-26)Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup>23026352302662F344-<i>Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene.mutantCryopreserved Sperm (as of 2017-01-26)Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup>23026432302666Scr:sPSardinian alcohol-preferring ratssP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding.outbredUnknown2302984SS.BN-(<i>D13Rat151-D13Rat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302985SS.BN-(<i>D13Rat111-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302986SS.BN-(<i>D13Rat88-D13Rat91</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302987SS.BN-(<i>D13Rat7-D13Rat60</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302989SS.BN-(<i>D13Rat57-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302994SS.BN-(<i>D13Rat127-D13Rat61</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302995SS.BN-(<i>D13Rat115-D13Rat101</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302996SS.BN-(<i>D13Rat7-D13Rat88</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302997SS.BN-(<i>D13Rat91-D13Got45</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2302999SS.BN-(<i>D13Rat178-D13Got45</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303000SS.BN-(<i>D13Rat123-D13Rat150</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303001SS.BN-(<i>D13Rat111-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303002SS.BN-(<i>D13Rat123-D13Rat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303003SS.BN-(<i>D13Rat7-D13Rat127</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303004SS.BN-(<i>D13Rat115-D13Rat61</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303005SS.BN-(<i>D13Rat127-D13Rat77</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303006SS.BN-(<i>D13Rat101-D13Rat46</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303007SS.BN-(<i>D13Rat127-D13Rat46</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303008SS.BN-(<i>D13Rat61-D13GRat197</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303009SS.BN-(<i>D13Rat183-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303010SS.BN-(<i>D13Got51-D13Rat192</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303011SS.BN-(<i>D13Got51-D13Rat57</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown2303099F344-<i>Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene.mutantCryopreserved Sperm (as of 2017-01-26)Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup>23030952303100F344-<i>Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene.mutantCryopreserved Sperm (as of 2017-01-26)Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup>23030972303101F344-<i>Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup>23030942303102F344-<i>Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene.mutantCryopreserved Sperm (as of 2017-01-26)Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup>23030982303103F344-<i>Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup>23030962303116SPRD.WKY-(<i>D10Rat91-D10Rat135</i>)/IbmmSPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.congenicUnknown2303117SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)(<i>D18Rat102-D18Rat44</i>)/IbmmDouble congenic strain generated by intercrossing SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/Ibmm and SPRD.WKY-(<i>D18Rat102-D18Rat44</i>)/Ibmm; F<sub>1</sub> animals were intercrossed and F<sub>2</sub> screened for heterozygousity by markerscongenicUnknown2303148SS.SHR-(<i>D9Wox16-D9Rat76</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2303149SS.SHR-(<i>D9Wox16-D9Mco73</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region.congenicUnknown2303150SS.SHR-(<i>D9Mco74-D9Rat64</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2303151SS.SHR-(<i>D9Wox16-D9Mco77</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2303152SS.SHR-(<i>D9Mco72-D9Mco93</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2303153SS.SHR-(<i>D9Rat7-D9Mco93</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2303154SS.SHR-(<i>D9Wox16-D9Mco85</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2303504LEW/JmsNgscongenital hydrocephalus ratLewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology; Ophthalmology2303610SD/HsdCwrderived from SD/Hsd by cousin-cousin mating for more than 20 generationsinbredUnknown2303611BN/HsdMcwiCwrderived from BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister matinginbredUnknown2303640WAG/RijCmcrSubstrain of WAG/Rij, separated from the Rijswijk colony in about 1975, now maintained at Medical College of WisconsininbredUnknown2303739RDW/UmeSlcFrom Tohoku University to Slc (1999)mutantLive AnimalsMetabolism2303759WT/Jttwhitish teeth ratIn 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating.mutantCryopreserved Embryo; Cryopreserved SpermDentistry2303761SD-Tg(CAG-EGFP)4OsbGreen ratThis transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc.transgenicLive Animals2303779OLETF-Chr 14<sup>F344</sup>/TjChromosome 14 from F344 is introgressed in OLETF backgroundconsomicCryopreserved EmbryoDiabetes Obesity2303784SHR-Chr 4<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHRconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2303785SHRSP-Chr 3<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHRSPconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2303792WTC.ZI-<i>Atrn<sup>zi</sup></i>/KyoZitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto UniversitycongenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn<sup><i>zi</i></sup>409028322303793WTC.DMY-<i>dmy</i>/KyoCongenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto UniversitycongenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology2303971OLETF.F344-(<i>D7Mgh16-D7Mgh20</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303972BN-Chr 13<sup>SS</sup>/McwiA cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressedconsomicUnknown2303973OLETF.F344-(<i>D10Wox7-D10Wox6</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303976F344-<i>Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup>23039742303977F344-<i>Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene.mutantCryopreserved Sperm (as of 2017-01-26)Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup>23039752303978F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303979F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303986WKAH.LEC-<i>Atp7b<sup>hts</sup></i>/TjA congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-11)CancerAtp7b<sup>hts</sup>115327422303987F344.OLETF-(<i>D17Mgh4-Edn1</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes ObesityEdn125322303988F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D8Rat54-D8Mgh17</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303989F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303990F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303991F344.OLETF-(<i>D7Rat31-D7Rat35</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303992F344.OLETF-(<i>D5Mgh29-D5Mgh22</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303993OLETF.F344-(<i>D9Mgh8-D9Mit2</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303994F344.OLETF-(<i>D5Mgh4-D5Rat21</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303995F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303996F344.Cg-<i>Foxn1<sup>rnu</sup></i>/KyoThis congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University.congenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermImmunology; CancerFoxn139702303997F344.OLETF-(<i>D7Mgh8-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2303998WKAH.LEC-<i>Ptprk<sup>thid</sup></i>/TjA congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.congenicCryopreserved EmbryoCancerPtprk6197062303999F344.OLETF-(<i>D14Rat8-D14Rat26</i>)(<i>D14Rat18-D14Rat22</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304000F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304001F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304002F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304003F344.OLETF-(<i>D16Rat19-D16Rat13</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304004F344.OLETF-(<i>D7Mit2-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304016BUF.ACI-(<i>D4Rat192-D4Rat66</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.congenicCryopreserved Embryo; Cryopreserved SpermCancer2304017F344.CVD-<i>Unc5c<sup>cvd</sup></i>/KyoCVD ( Cerebellar vermis defect) rat originated from spontanious mutation of LEW inbred at Osaka Prefecture University in 1992. A mutation in Unc5c has been identified in CVD rats. A congenic strain was produced by backcrossing CVD to F344/NSlc strain at Kyoto University.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-05)NeurobiologyUnc5c|Unc5c<sup>cvd</sup>735109|128023552304018BUF.ACI-(<i>D4Rat226-D4Rat109</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.congenicCryopreserved Embryo; Cryopreserved SpermCancer2304019BUF.ACI-(<i>D15Rat68-D15Rat29</i>)/NccThis congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method.congenicCryopreserved Embryo; Cryopreserved SpermCancer2304020ACI.BUF-(<i>D15Rat97-D15Rat29</i>)/NccThis congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method.congenicCryopreserved Embryo; Cryopreserved SpermCancer2304037DDI/Ddiadokkyo diabetes insipidus ratStrain developed at Dokkyo University, School of Medicine, Tochigi, JapaninbredCryopreserved Embryo; Cryopreserved SpermMetabolism; Urology2304038OP/JttOpacitasMaintained in sib mating between opacitas rats (heterozygoutes) and normal rats.mutantCryopreserved Embryo; Cryopreserved SpermOphthalmology2304039WIC-<i>Tg<sup>rdw</sup></i>/KtsEstablished from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. This strain has a spontaneous missense mutation, G2320R, in the thyroglobul gene.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21)MetabolismTg<sup>rdw</sup>128798602304040F344.OP-<i>Op</i>/JttOpacitas rats (heterozygtes) are backcorssed with F344/DuCrj.congenicCryopreserved SpermOphthalmology2304041SD-Tg(CAG-Rgn)SlcTransgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and the rat Rgn genetransgenicLive AnimalsOsteosisRgn35602304045F344.ZUC-<i>Lepr<sup>fa</sup></i>(<i>D14Rat23-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304046F344.ZUC-(<i>Lepr<sup>fa</sup></i>)(<i>D7Rat16-D7Mgh20</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304047F344.ZUC-<i>Lepr<sup>fa</sup></i>/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating.congenicCryopreserved Embryo; Cryopreserved SpermDiabetes ObesityLepr|Lepr<sup>fa</sup>3001|134321532304050F344.OLETF-(<i>D14Rat23-D14Rat55</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304051F344.OLETF-(<i>D14Rat8-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304052F344.OLETF-(<i>D14Rat55-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304053F344.OLETF-(<i>D14Rat23-D14Rat5</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304054F344.OLETF-(<i>D14Rat23-D14Rat10</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304055F344.OLETF-(<i>D14Wox1-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304056F344.OLETF-(<i>D14Rat23-D14Wox14</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304057F344.OLETF-(<i>D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304058F344.OLETF-(<i>D14Rat143-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304059F344.OLETF-(<i>D14Rat5-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304060F344.OLETF-(<i>D14Wox14-D14Rat12</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304061F344.OLETF-(<i>D14Rat23</i>)/TjEstablished as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.congenicCryopreserved EmbryoDiabetes Obesity2304063KDP-Tg(H2Kd-Cblb)2NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb6205352304064KDP-Tg(H2Kd-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb6205352304065KDP-Tg(INS-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb6205352304066KDP-Tg(CAG-Cblb)1NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).transgenicUnknownCblb6205352304074WKY.BUF-<i>Tsr1d</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred.congenicCryopreserved EmbryoCancer2304075ACI.BUF-<i>Pur1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred.congenicCryopreserved EmbryoUrology2304076WKY.BUF-<i>Thym1, Thym2</i>/MnaThis double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (Thym1) (on chr.1) and Ten2 (Thym2)(on chr. 13) has been transferred.congenicCryopreserved Embryo (as of 2018-03-14)Cancer2304077WKY.BUF-<i>Pur1s</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.congenicCryopreserved EmbryoUrology2304078ACI.BUF-<i>Ten1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.congenicCryopreserved Embryo2304079WKY.BUF-<i>Ten1</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.congenicCryopreserved Embryo2304080ACI.BUF-<i>Aftm1</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.congenicCryopreserved Embryo; Cryopreserved Sperm2304081WKY.BUF-<i>Pur1w</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.congenicCryopreserved EmbryoUrology2304082WKY.BUF-<i>Ten2</i>/MnaThis congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.congenicCryopreserved EmbryoUrology2304083ACI.BUF-<i>Ten2</i>/MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.congenicCryopreserved Embryo2304093SHRSP.WKY-(<i>D1Rat106-D1Arb21</i>)/IzmDeveloped by the depositorcongenicCryopreserved EmbryoCardio Hypertension2304094SHRSP.WKY-(<i>D1Smu12-D1Rat44</i>)/IzmThis is a congenic strain developed by the depositor.congenicUnknownCardio Hypertension2304095W-Tg(Plcb2-WGA-EGFP)F1AbekThis is a transgenic strain developed by the depositor.transgenicCryopreserved Embryo2304096SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/1IzmDeveloped by the depositorcongenicCryopreserved EmbryoCardio Hypertension2304097SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/2IzmThis is a congenic strain developed by the depositor.congenicCryopreserved EmbryoCardio Hypertension2304098SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/IzmDeveloped by the depositorcongenicCryopreserved EmbryoCardio Hypertension2304099SHRSP.WKY-(<i>D1Smu12-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.congenicCryopreserved EmbryoCardio Hypertension2304100SHRSP.WKY-(<i>D1Rat39-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.congenicCryopreserved EmbryoCardio Hypertension2304101SHRSP.WKY-(<i>D1Rat43-D1Arb21</i>)/IzmThis is a congenic strain developed by the depositor.congenicCryopreserved EmbryoCardio Hypertension2304102SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmThis is a congenic strain developed by the depositor.congenicCryopreserved EmbryoCardio Hypertension2304104W-Tg(Plcb2-WGA-EGFP)M1AbekThis is a transgenic strain developed by the depositor.transgenicCryopreserved Embryo2304120SHRSP/2TaKyo > Ta (1972)inbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension2304121DA.WF-(<i>D1Mit1-D1Mit3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicCryopreserved EmbryoCancer2304122DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicCryopreserved EmbryoCancer2304123DA.WF-(<i>D4Mit11-Nos3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicCryopreserved EmbryoCancerNos331862304124DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)(<i>D1Mit1-D1Mit3</i>)/KopThis congenic strain in the DA background by introgressing a segment from WFcongenicCryopreserved EmbryoCancer2304125DRH.F344-(<i>D1Mgh8-D1Mgh12</i>)/Shigmdesired fragment from F344 was introgressed into DRH backgroundcongenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer2304200W-Tg(CAG-ABO*A)32JmskThis transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.transgenicCryopreserved EmbryoHematologyAbo36286092304201F344-<i>Galntl6<sup>Tn(sb-T2/Bart3)2.311McwiRrrc</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene.mutantCryopreserved Sperm (as of 2017-01-26)Galntl6<sup>Tn(sb-T2/Bart3)2.311Mcwi</sup>23041942304202F344-<i>RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323.mutantCryopreserved Sperm (as of 2017-01-26)RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup>23041932304203W-Tg(CAG-DsRed2/GFP)1JmskDsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.transgenicCryopreserved EmbryoDevelopment2304204W-Tg(CAG-ABO*B)13JmskThis transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.transgenicCryopreserved EmbryoHematologyAbo36286092304205W-Tg(Alb-DsRed2)34JmskThis transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.transgenicCryopreserved Embryo; Cryopreserved SpermDevelopment2304206W-Tg(CAG-DsRed2/GFP)15JmskDsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.transgenicCryopreserved Embryo; Cryopreserved SpermDevelopment2304207F344-<i>Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene.mutantCryopreserved Sperm (as of 2017-01-26)Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup>23041962304208F344-<i>Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup>23041972304209F344-<i>Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene.mutantExtinct (as of 2017-01-26)Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup>23041992304210W-Tg(Alb-DsRed2)42JmskThis transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.transgenicCryopreserved Embryo; Cryopreserved SpermDevelopment2304211W-Tg(CAG-cre)81JmskThis strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School.transgenicLive Animals; Cryopreserved Embryo (as of 2018-07-16)Development2304212F344-<i>RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503.mutantCryopreserved Sperm (as of 2017-01-26)RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup>23041982304213F344-<i>P3h3<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene.mutantCryopreserved Sperm (as of 2017-01-26)P3h3<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup>23041952304214W-Tg(CAG-ABO*B)2JmskThis transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.transgenicCryopreserved EmbryoHematologyAbo36286092304215F344-Tg(XPO1)1HikF344/DuCrj Tg rat inoculated with human crm1 genome (BAC)transgenicCryopreserved Embryo; Cryopreserved SpermCancer; Infectious2304221WTC-<i>swh</i>/KyoThe rat showed abnormal hair texture and mammary gland hypoplasia which occurred in the WTC.ZI-<i>Atrn<sup>zi</sup></i> colony at the National Cancer Center Research Institute in 1998. After elimination of <i>zi</i> allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. In 2011, Kuramoto et al. (RGD:14398762) identified a missense mutation in the Edaradd gene.mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-11)DermatologyEdaradd<sup><i>swhKyo</i></sup>143987652304222WIST/IarInbred Wistar-ImamichiStrain developed by the depositorinbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21)Metabolism; Development2304241F344-Tg(CXCR4)1HikTransgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj.transgenicCryopreserved Embryo; Cryopreserved SpermInfectiousCXCR47321762304242WTC-<i>Kcnq1<sup>dfk</sup></i>KyoRats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-<i>Kcnq1<sup>dfk</sup></i>/Kyo rat is a mutant for circling behavior. although the Atrn<sup>zi</sup> allele of WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic rats was eliminated, the circling behavior remained.mutantCryopreserved Sperm (as of 2017-04-05)Otorhinology; Internal OrganKcnq1|Kcnq1<sup>dfk</sup>621503|128023442304277SHRSP.WKY-(<i>D1Rat36-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304278DA-Tg(Alb-HSVtk)5JmskThis strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in these transgenic rats causes hepatitis.transgenicCryopreserved EmbryoDevelopment2304279W-Tg(MT2A-Myc)1YsThis transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).transgenicCryopreserved EmbryoReproduction; DevelopmentMyc31302304280SHR/ShiDeveloped by the DEPOSITORinbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension2304281SERC/KyoDeveloped by the DEPOSITORmutantCryopreserved SpermNeurobiology2304282IEW/Ihrmutant of Ihara epileptic rat.inbredLive Animals; Cryopreserved EmbryoNeurobiology; Ophthalmology2304283SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304284SHRSP.WKY-(<i>D1Mgh5-D1Rat116</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304285BDIX/NemOdaThis strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992.inbredUnknownCancer2304286DMYC/KyoDeveloped by the DEPOSITORcoisogenicCryopreserved Sperm2304287ACI.F344-(<i>D16Rat17-D16Rat15</i>)/NkgF344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain.congenicCryopreserved EmbryoCancer2304288ACI.BUF-(<i>D20Img2-D20Rat5</i>)/NccDeveloped by the DEPOSITORcongenicUnknownCancer2304289SHRSP.WKY-(<i>D1Mgh5-D1Rat349</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304290BUF.ACI-(<i>D20Img2-D20Rat5</i>)/NccDeveloped by the DEPOSITORcongenicUnknownCancer2304291LEW-Tg(CAG-EGFP)1YsThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.transgenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermDevelopment2304292LEW-Tg((ROSA)26Sor-luc)21JmskThis strain expresses luciferase ubiquitously driven by the gene trap ROSA 26 promoter established at Jichi Medical School.transgenicCryopreserved Embryo (as of 2017-08-08)Development2304293F344.LEC-<i>xhs1</i>/1NrsLEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assaycongenicCryopreserved Sperm2304294MPOD/KyoMyeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait.mutantCryopreserved Embryo; Cryopreserved SpermCancer; Immunology2304295SHRSP.WKY-(<i>Igf1r-D1Rat36</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionIgf1r28692304296KB/OdaMaintained by crossing heterozygotes of the albino locus (segregating inbred strain).segregating_inbredCryopreserved Embryo2304297TM.KDP-<i>Cblb</i>/NyoHomozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).congenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb6205352304298SD-Tg(Tuba1a-EYFP)OknThis strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter.transgenicUnknown2304299LEW-Tg(Alb-GFP)6JmskThis strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School.transgenicCryopreserved EmbryoDevelopment2304300W-Tg(S100b-EGFP)ScellDeveloped by microinjecting the transgene into Wistar ratstransgenicCryopreserved Embryo; Cryopreserved SpermNeurobiology; Metabolism2304301SHRSP.WKY-(<i>Slco3a1-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionSlco3a16202272304302SHRSP.WKY-(<i>D1Rat44-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304303W-Tg(MT2A-Myc)2YsThis transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).transgenicCryopreserved EmbryoReproduction; DevelopmentMyc31302304304SHRSP.WKY-(<i>D1Rat209-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304305DOB/OdaThis strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000.inbredLive Animals; Cryopreserved Embryo2304306BUF.ACI-(<i>D20Img2-Cdkn1a</i>)/NccDeveloped by the DEPOSITORcongenicUnknownCancerCdkn1a693282304307ACI.BUF-(<i>D20Img2-Cdkn1a</i>)/NccDeveloped by the DEPOSITORcongenicUnknownCancerCdkn1a693282304308ICR/IhrA new rat strain has been developed, in which a spontaneous cataract occurs without exception at 3-4 months after birth and matures completely at 4-6 months of age, indicating that this strain possesses a maturity-onset cataract.inbredLive Animals (as of 2019-08-05)Neurobiology; Ophthalmology2304309SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304310SD-Tg(Nes/Hspa1b-EGFP)OknThis strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter.transgenicCryopreserved Embryo; Cryopreserved SpermNeurobiology2304311LEW-Tg((ROSA26)Sor-lacZ)44JmskRrrcThis strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.transgenicCryopreserved Embryo (as of 2017-08-08)Development2304312SHRSP.WKY-(<i>D1Mgh5-D1Rat36</i>)(<i>D1Rat44-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304313SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2304314BDIX.Cg-<i>Tal</i>/NemOdaMating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain).congenicCryopreserved SpermOsteosis2304315SHRSP.WKY-(<i>Calca-D1Arb21</i>)/IzmTkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionCalca22542304316F344.LEC-<i>xhs1</i>/2NrsLEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assaycongenicCryopreserved Sperm2304329WKY/EzoDeposited by the DEPOSITORinbredCryopreserved EmbryoCardio Hypertension2304330SD-Tg(HRAS)128NccThis strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2021-04-30)Cancer2304331F344-Tg(CCR5)1HikDeposited by the DEPOSITORtransgenicCryopreserved Embryo; Cryopreserved SpermInfectious2304332HER/WkmtDeveloped by the DEPOSITORinbredLive AnimalsNeurobiology2305934F344-<i>Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup>23059322305935F344-<i>Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup>23059332305939SHRSP.WKY-(<i>D9Mit6-D9Rat83</i>)/TkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305940SHRSP-Chr 7<sup>WKY</sup>/TkyoChromosome 7 from WKY is introgressed into the genomic background of SHRSPconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305941SHR-Chr 15<sup>WKY</sup>/TkyoChromosome 15 from WKY is introgressed into the genomic background of SHRconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305942SHR-Chr 3<sup>WKY</sup>/TkyoChromosome 3 from WKY is introgressed into the genomic background of SHRconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305943SHRSP-Chr 15<sup>WKY</sup>/TkyoChromosome 15 from WKY is introgressed into the genomic background of SHRSPconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305944SHRSP-Chr 4<sup>WKY</sup>/TkyoChromosome 4 from WKY is introgressed into the genomic background of SHRSPconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305945SHRSP-Chr 13<sup>WKY</sup>/TkyoChromosome 13 from WKY is introgressed into the genomic background of SHRSPconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305946SHR-Chr 1<sup>WKY</sup>/TkyoChromosome 1 from WKY is introgressed into the genomic background of SHRconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305947SHR-Chr 19<sup>WKY</sup>/TkyoChromosome 19 from WKY is introgressed into the genomic background of SHRconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305948SHRSP.WKY-(<i>D8Rat77-D8Rat16</i>)(<i>D8Tkyo10</i>)/TkyoDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305949SHRSP-Chr 1<sup>WKY</sup>/TkyoChromosome 1 from WKY is introgressed into the genomic background of SHRSPconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2305966SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity2305967SHR.SHRSP-(<i>D18Rat73-D18Rat11</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity2305968SHRSP.WKY-(<i>D1Wox18-D1Rat39</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity2305969SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity2305970DA-Tg(Alb-TTR*V30M)7JmskThis is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.transgenicCryopreserved EmbryoDevelopment2305971SHRSP.SHR-(<i>D18Rat73-D18Rat11</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity2305972WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)(<i>Bcl2-D13Mgh7</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305973SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity2305974WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305975SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity2305976DA-Tg(Alb-TTR*V30M)9JmskThis is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.transgenicCryopreserved EmbryoDevelopment2305977ACI.F344-(<i>D16Rat12-D16Mco2</i>)/NkgF344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals.congenicCryopreserved Embryo; Cryopreserved SpermCancer2305978LEW-Tg((ROSA)26Sor-DsRed*)7JmskThis strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School.transgenicCryopreserved Embryo (as of 2017-08-08)Development2305979WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>Bcl2-D13Mgh7</i>)/IzmDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305987F344.OLETF-(<i>D7Mgh16-D7Wox46</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305988(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1Developed by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305989(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Z-Lepr<sup><i>fa</i></sup>/Tj</i>)F1Developed by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305990F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305991(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/Tj X F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1Developed by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305992F344.OLETF-(<i>D7Mit16-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305993F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305994F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/1TjDeveloped by the DEPOSITORcongenicUnknownDiabetes Obesity2305995F344.OLETF-(<i>D7Got130-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305996F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305997(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/2Tj x F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1Developed by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305998F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D8Rat54-D8Mgh17</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2305999F344.OLETF-(<i>D7Mgh16-D7Rat70</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306000F344.OLETF-(<i>D7Rat70-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306001F344.OLETF-(<i>D7Rat176-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306002F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/1TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306003F344.OLETF-(<i>D7Wox46-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306004F344.OLETF-(<i>D7Mgh16-D7Mit16</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306013F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306014F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306015F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306016F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306017(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D14Rat23-D14Rat12</i>))F1Developed by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306018F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306019F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306020(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>))F1Developed by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306021SHR-Chr 2<sup>WKY</sup>/TkyoDeveloped by the DEPOSITORconsomicCryopreserved EmbryoDiabetes Obesity; Cardio Hypertension2306022KCI/KyoRats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003.mutantCryopreserved SpermNeurobiologyPcdh1515909692306023F344-Tg(CCNT1)1HikDeveloped by the DEPOSITORtransgenicCryopreserved SpermInfectiousCCNT113224572306024FOK/NcuFuruyama ratThese are resistant to hot environment.inbredCryopreserved Embryo; Cryopreserved Sperm2306025WMN/NrsDeveloped by the DEPOSITORinbredLive Animals; Cryopreserved EmbryoCancer; Metabolism2306026F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306027WM/NrsDeveloped by the DEPOSITORinbredLive Animals; Cryopreserved EmbryoCancer; Metabolism2306028F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306029(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1Developed by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306030F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/2TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2306033SHR.Cg-<i>Lepr<sup>cp</sup></i>/NDmcrNonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999.congenicLive AnimalsDiabetes Obesity; Cardio HypertensionLepr<sup>cp</sup>115705652306034NER.F344-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Rat100-D5Rat234</i>)/KyoDeveloped by the DEPOSITORcongenicCryopreserved SpermNeurobiology2306035F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)/KyoThis double congenic strain was established by crossing F344.NER-(<i>D1Mgh6-D1Rat73</i>)/Kyo and F344.NER-(<i>D5Mgh4-D5Rat36</i>)/KyocongenicLive AnimalsNeurobiology2306036F344-<i>Apc<sup>m1</i>Kyo</sup>F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven).mutantLive Animals; Cryopreserved Sperm (as of 2017-03-14)CancerApc|Apc<sup>m1Kyo</sup>2123|127922522306037F344-Tg(CD4)1HikDeveloped by the DEPOSITORtransgenicCryopreserved SpermInfectious2306041F344-<i>Scn1a<sup>m2Kyo</sup></i>Established by ENU mutagenesis. A point mutation in Scn1a gene.mutantCryopreserved SpermNeurobiologyScn1a<sup>m2Kyo</sup>127922842306042F344-<i>Scn1a<sup>m1Kyo</sup></i>Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model.mutantLive Animals; Cryopreserved Sperm (as of 2017-05-04)NeurobiologyScn1a<sup>m1Kyo</sup>127922832306043SHR/4DmcrDeveloped by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressureinbredLive AnimalsCardio HypertensionCd3623012306044SHRSP/3DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, A4 lineinbredLive AnimalsCardio HypertensionCd3623012306045SHR/2DmcrDeveloped by the DEPOSITOR, one of the SHR substrains from B2 lineinbredLive AnimalsCardio HypertensionCd3623012306046W-Tg(CAG-EGFP)3YsThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.transgenicLive Animals; Cryopreserved Embryo2306047W-Tg(Gnrh1-EGFP)NphyThis transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence.transgenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermGnrh127202306048SHR/3DmcrDeveloped by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressureinbredLive AnimalsCardio HypertensionCd3623012306049SHRSP/4DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosisinbredLive AnimalsCardio HypertensionCd3623012306050SHRSP/5DmcrDeveloped by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosisinbredLive AnimalsCardio HypertensionCd3623012306051SHRSP/2DmcrDeveloped by the DEPOSITOR, this is one of the SHRSP substrains, A1sb lineinbredLive AnimalsCardio HypertensionCd3623012306058LEC.W-Tg(CAG-Zfml)30Ncms/NcmsDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306059DA.Cg-<i>Foxn1<sup>rnu</sup> Lyst<sup>bg</sup></i>/SlcDeveloped by the DEPOSITORcongenicCryopreserved Embryo; Cryopreserved SpermImmunology; HematologyFoxn1|Lyst3970|6218372306060LEC.W-Tg(CAG-Zfml)26Ncms/NcmsDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306061ACI.BUF-<i>Pur1, Thym2</i>/MnaThe proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (Thym2) (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002.congenicUnknownMetabolism2306062W-Tg(Per1-luc)1OaDeveloped by the DEPOSITORtransgenicCryopreserved Embryo; Cryopreserved Sperm2306063LEC.W-Tg(CAG-Zfml)21Ncms/NcmsDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306064MPR/IarDeveloped by the DEPOSITORmutantCryopreserved Embryo; Cryopreserved SpermMetabolism; OsteosisArsb|Arsb<sup>MPR</sup>2158|127929672306070WIC-Tg(Wap-GH1)1MniIkeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491).transgenicCryopreserved Sperm (as of 2017-04-21)Diabetes Obesity; Metabolism2306071F344-Tg(CAG-EGFP)NccoTransgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection methodtransgenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer; Metabolism2306072ACI.F344-(<i>D16Nkg74</i>)/NkgA sub congenic strain of ACI/N.F344-(<i>D16Rat12-D16Mco2</i>)/NkgcongenicCryopreserved Embryo; Cryopreserved SpermCancer2306073WIC-Tg(Wap-GH1)2MniIkeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491).transgenicCryopreserved Sperm (as of 2017-04-21)Diabetes Obesity; Metabolism2306076ACI.F344-(<i>D16Nkg9-D16Nkg38</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals.congenicCryopreserved Embryo; Cryopreserved SpermCancer2306077ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating.congenicCryopreserved Embryo; Cryopreserved SpermCancer2306078KFRS4A/KyoDeveloped by the DEPOSITORmutantCryopreserved SpermNeurobiology; Behavior2306079ACI.F344-(<i>D16Nkg87-D16Nkg105</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals.congenicCryopreserved Embryo; Cryopreserved SpermCancer2306085TCR/IbuToyoda Circling RatA male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007.mutantCryopreserved SpermNeurobiology; Behavior2306089ACI.BUF-(<i>D7Wox16-D7Rat69</i>)/MnaThe thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing.congenicCryopreserved SpermCancer2306090ExHC/TaExogenously hypercholesterolemic ratDeveloped by the DEPOSITORinbredLive Animals (as of 2017-04-19)Metabolism2306098ACI.F344-(<i>D16Nkg30-D16Mgh6</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.congenicCryopreserved Sperm2306099SHR.WKY-(<i>D15Tkyo3-D15Rat68</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306100SHR.WKY-(<i>D3Tkyo7-D3Rat1</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306101LEC.BN-(<i>D4Mgh16-D4Rat233</i>)/HkvDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306102BN.LEC-(<i>D4Rat128-D4Rat106</i>)/HkvDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306103SHRSP/SumsDeveloped by the DEPOSITORinbredCryopreserved Embryo2306104BN.LEC-(<i>D4Rat184-D4Rat238</i>)/HkvDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306105BN.LEC-(<i>D4Rat128-D4Rat238</i>)/HkvDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306106CLX/TaCircling behavior linked to the X-chromosome (CLX)Developed by the DEPOSITORmutantCryopreserved EmbryoBehavior2306107SD-Tg(Sp6)58TjThe transgenic construct carrying rat Sp6 coding region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.transgenicCryopreserved Sperm (as of 2017-08-22)Dentistry; DevelopmentSp613067682306108SHR.WKY-(<i>D3Mit9-D3Wox16</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306109SHR.WKY-(<i>D3Mgh6-D3Rat1</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306110IER/SumsDeveloped by the DEPOSITORinbredCryopreserved EmbryoNeurobiology2306111LEC.BN-(<i>D4Mgh16-D4Rat233</i>)(<i>D4Rat271-D4Rat238</i>)/HkvDeveloped by the DEPOSITORcongenicCryopreserved Sperm2306112ZDF-<i>Lepr<sup>fa</i>CrlCrlj</sup>Developed by the DEPOSITORmutantLive Animals; Cryopreserved EmbryoDiabetes ObesityLepr30012306113SD-Tg(Sp6)6TjDeveloped by the DEPOSITORtransgenicCryopreserved SpermDentistry; DevelopmentSp613067682306114SHR.WKY-(<i>D3Mgh16-D3Rat110</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306115SHR.WKY-(<i>D3Mgh16-D3Rat166</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306116SD-Tg(Sp6)5TjThe transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.transgenicCryopreserved SpermDentistry; DevelopmentSp613067682306117ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.congenicCryopreserved Sperm2306118SHR.WKY-(<i>D15Rat95-D15Rat106</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306119F344-Tg(CD4,CCNT1)1HikDeveloped by the DEPOSITORtransgenicCryopreserved SpermInfectious2306120SHR.WKY-(<i>D4Wox27-D4Rat15</i>)/TkyoThis congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.congenicCryopreserved SpermDiabetes Obesity; Cardio Hypertension2306276F344-<i>Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup>23062732306277F344-<i>Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene.mutantCryopreserved Sperm (as of 2017-01-26)Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup>23062742306278F344-AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325.mutantCryopreserved Sperm (as of 2017-01-31)AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>23062722306279F344-<i>Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup>23062752306529BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwParental strain BBDR.BBDP-(<I>D4Rhw17-ss99306861</i>)(<I>D4Rhw11-D4Rhw10</I>)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congeniccongenicUnknown2306532BBDR.F344-(<i>D4Rat27-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenicUnknown2306533BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/2RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwcongenicUnknown2306534BBDR.F344-(<i>D4Rat102-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwcongenicUnknown2306535BBDR.F344-(<i>D4Rat253-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwcongenicUnknown2306536BBDR.F344-(<i>D4Arb11-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains generated by intercrossing male BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw and female BBDR/RhwcongenicUnknown2306537BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/1RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwcongenicUnknown2306538BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwCongenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutationcongenicUnknown2306539BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/3RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenicUnknown2306540BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenicUnknown2306541BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwBBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressedcongenicUnknown2306542BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenicUnknown2306543BBDR.F344-(<i>D4Got59-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwBBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressedcongenicUnknown2306544BBDR.F344-(<i>D4Rat26-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwCongenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNAcongenicUnknown2306709BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/3RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.congenicUnknown2306710F344-<i>Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene.mutantCryopreserved Sperm (as of 2017-01-26)Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup>23067012306711F344-<i>FM117003<sup>Tn(sb-T2/Bart3)2.321McwiRrrc</sup></i>this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)CebmutantCryopreserved SpermFM117003<sup>Tn(sb-T2/Bart3)2.321Mcwi</sup>23067032306712BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/2RhwThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.congenicUnknown2306717BBDP/WorSunnThese originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada.inbredCryopreserved Sperm; Cryorecovery (as of 2018-11-12)2306784Kini:DA,PVG-G12Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1<sup>a</sup> MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG/OlaHsd females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couplesadvanced_intercross_lineUnknown2306815SS.SR-(<I>D7Rat67-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenicUnknown2306816SS.SR-(<I>D7Mco19-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenicUnknown2306817SS.SR-(<I>D7Uia1-D7Mco19</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenicUnknown2306818SS.SR-(<I>D7Rat131-D7Mco7</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenicUnknown2306819SS.SR-(<I>D7Uia1-D7Rat131</I>)/JrCongenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotypedcongenicUnknown2306820SS.SR-(<i>D3Arb14-D3Mco36</i>)/McoSS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosomecongenicUnknown2306823SS.SR-(<i>D3Arb14-D3Mco36</i>)(<i>D7Mco19-D7Mco7</i>)/McoSS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco were crossed with SS.SR-(<i>D7Mco19-D7Mco7</i>)/Jr and then F<sub>1</sub> rats were backcrossed with SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bredcongenicUnknown2306840E3.DA-(<i>D4Wox22-D4Got132</i>)(<i>D12Wox5-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markerscongenicUnknown2306841E3.DA-(<i>D12Wox5-D12Rat26</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markerscongenicUnknown2306842E3.DA-(<i>D20Rat45-D20Rat47</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markerscongenicUnknown2306874F344-<i>Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene.mutantCryopreserved Sperm (as of 2017-01-26)Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup>23068732306875F344-<i>Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene.mutantExtinct (as of 2017-01-26)Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup>23068722306892SHR.BN-(<i>D2Rat114-D2Rat123</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenicUnknown2306893SHR.BN-(<i>D16Rat87-D16Mgh1</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenicUnknown2306894SHR.BN-(<i>D4Rat33-D4Rat54</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenicUnknown2306895SHR.BN-(<i>D2Rat226-D2Rat294</i>)/JkBackcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animalscongenicUnknown2306961RLA/VerhRoman low avoidanceBignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, BelgiuminbredUnknown2306962RHA/VerhRoman high avoidanceBignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, BelgiuminbredUnknown2307077HXB4/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307078HXB27/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307079HXB3/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307080HXB20/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307081HXB31/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307082HXB18/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307083HXB10/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307084HXB24/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307085HXB17/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307086HXB7/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307087SHR.BN-(<i>D18Rat32-D18Rat12</i>)/IpcvA segment of chr 18 from BN was introgressed into the SHR backgroundcongenicUnknown2307088HXB22/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307089HXB29/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307090SHR.BN10/IpcvA segment of chr 10 from BN was introgressed into the SHR backgroundcongenicUnknown2307091HXB13/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307092HXB14/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307093HXB23/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307094HXB1/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307095HXB15/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307096HXB2/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307097HXB21/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307098HXB25/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307099HXB5/IpcvDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown2307115BXH5/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307116PXO3-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307117PXO5-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307118PXO9/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307119PXO7-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307120PXO7-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307121BXH2/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307122PXO8-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307123BXH13/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307124BXH10/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307125PXO6-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307126BXH8/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307127BXH11/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307128PXO5-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307129BXH9/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307130PXO6-3/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307131PXO8-2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307132PXO10/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307133BXH12-2/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307134BXH3/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307135PXO4/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307136BXH6/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307137PXO6-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307138PXO1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307139BXH12-1/CubDerived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown2307155SHR/1NCrlTo Charles River from NIH in 1973 at F32.inbredUnknown2307156DA/ZtmKiniSubstrain of DA, to Hannover after 1965, now at Stockholm, Sweden.inbredUnknown2307157PVG.1AV1/KiniOriginally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden.congenicUnknown2307159SHRSR.SHRSP-(<i>Klk1-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenicUnknownMt1-ps1|Klk1c123118|13031922307160SHRSR.SHRSP-(<i>Klk1-D1Mit3</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenicUnknownKlk1c1213031922307161SHRSR.SHRSP-(<i>D1Rat134-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenicUnknownMt1-ps131182307166SHRSP.SHRSR-(<i>Klk1-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenicUnknownMt1-ps1|Klk1c123118|13031922307167SHRSP.SHRSR-(<i>Klk1-D1Mit3</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenicUnknownKlk1c1213031922307168SHRSR/BbbSpontaneously Hypertensive Rat, Stroke ResistantThis SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany.inbredUnknown2307169SHRSP.SHRSR-(<i>D1Rat134-Mt1-ps1</i>)/BbbSHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interestcongenicUnknownMt1-ps131182307298BN/HanKiniSubstrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany)inbredUnknown2307299ACI/ZtmKinisubstrain of ACI derived from ACI/ZtminbredUnknown2307300LEW.1AV1/KiniSubstrain of LEW.1AV1congenicUnknown2307301DA.LEW.RT1f-(<i>D20Wox15-D20Wox13</i>)/RhdRT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markerscongenicUnknown2307317MHSMilan Hypertensive StrainOutbred Wistar rats with brother x sister mating and selection for high systolic blood pressureoutbredUnknown2307318BDIX/Ifzderived from Berlin-Druckrey strain BDIXinbredUnknown2307319MNS/NMilan normotensive strainWistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.inbredCryopreserved Embryo2307355PXO3-1/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307356PXO2/CubDerived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.recombinant_inbredUnknown2307357BDV/ZtmDeveloped from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles.inbredUnknown2307358LUDW/OlaHsdLudwigWistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979.inbredCryorecovery2307359BUF/SimRijHsdDeveloped by Heston in 1946 from a BuffaloinbredUnknown2307360DA.BI.RT1i-(<i>D20Rat42-D20Rat31</i>)/RhdRT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han.congenicUnknown2307441F344-<i>Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup>23074402307442F344-<i>Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup>23074392308816Crl:WI(Han)Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL (under structural changed to RCC). Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system.outbredUnknown2308851Crl:OP(CD)Obese Prone RatsDeveloped from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD).outbredUnknown2308852Crl:LELong-Evans RatsOriginated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978.outbredUnknown2308853Crl:OR(CD)Obese Resistant RatsDeveloped from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets.outbredUnknown2308885GK/CskCrljCrlThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006.inbredUnknown2308886SS/HsdMcwiCrlInbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001.inbredUnknown2311049SHROB/KolGmiCrl-<i>Lepr<sup>cp</i></sup>/CrlThis mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001.coisogenicUnknownLepr<sup>cp</sup>115705652311051SHRSP/A3NCrlStroke Prone RatsThe Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002.inbredUnknown2311070BUF/CrCrlBuffalo RatHeston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).inbredUnknown2311071ZDF-<i>Lepr<sup>fa</sup></i>/CrlA mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001.coisogenicUnknownLepr30012311072FHH/EurMcwiCrlAn outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001.inbredUnknown2311073NBL/CrCrlBogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998.inbredUnknown2311074BDIX/CrCrlDruckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).inbredUnknown2311078Crl:CD-<i>Hr<sup>hr</i></sup>CD hairless ratsThis spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic.outbredUnknown2311079WF/CrCrlJ. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).inbredUnknown2311082SS-Chr 13<sup>BN</sup>/McwiCrlDeveloped at the Medical College of Wisconsin. To Charles River in 2003.consomicUnknown2311692F344-<i>Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene.mutantCryopreserved Sperm (as of 2017-01-26)Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup>23116912311693F344-<i>Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene.mutantExtinct (as of 2017-01-26)Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup>23116892311694F344-<i>Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene.mutantCryopreserved Sperm (as of 2017-01-26)Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup>23116872312352LEW.1NThese congenic rats carry the RTl<sup>n</sup> haplotype on the LEW strain genetic background.congenicUnknown2312447SD-Tg(Pmp22)KanThis transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid librarytransgenicUnknownPmp22111252312466Crl:LISLister Hooded RatThese rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance.outbredUnknown2312471Crl:ZUC(Orl)-<i>Lepr</i><sup>fa</sup>The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991.outbredUnknownLepr<sup>fa</sup>134321532312472Crl:WI(WU)Wistar Wu RatSelection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987.outbredUnknown2312473BDIX/OrlCrlBDIX RatsRats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991.inbredUnknown2312474Crl:OFA(SD)The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968.outbredUnknown2312498WAG/RijCrlWAG RatsA.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993.inbredUnknown2312499Crl:NIH-<i>Foxn1</i><sup>rnu</sup>Nude RatsThe NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs.outbredUnknown2312504Crlj:WIWistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981)outbredUnknown2312511WF/IcoCrlWistar RatsFurth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970.inbredUnknown2312512ZSF1-<i>Lepr<sup>fa</sup></i> <i>Lepr<sup>cp</sup></i>/CrlThis hybrid rat is a cross between a ZDF female and a SHHF male rat. This model was developed at Genetic Models International, Indianapolis. To Charles River in 2001.hybridUnknown2312513Crlj:DONDr. Sato(1952) to Nippon Rat to CRLJ(1990)outbredUnknown2312514Crlj:LECHokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991).outbredUnknown2312518Crlj:ZUC-<i>Lepr</i><sup>fa</sup>Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000)outbredUnknownLepr<sup>fa</sup>134321532312577SHR.BN-(<i>D18Rat99-D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygositycongenicUnknown2312578SHR.BN-(<i>D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygositycongenicUnknown2312579SHR.BN-(<i>D18Rat40-D18Rat82</i>)/IpcvF<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygositycongenicUnknown2312580SHR.BN-(<i>D18Rat113-D18Rat82</i>)/IpcvSHR/OlaIpcv were crossed with BN/Crl, F<sub>1</sub> animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotescongenicUnknown2312609MWF-Chr 8<sup>SHR</sup>/RkbMWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossingconsomicUnknown2312644DA.WOKW-(<i>D3Mit10-D3Rat189</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K backgroundcongenicUnknown2312645DA.WOKW-(<i>D16Rat88-D16Wox7</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K backgroundcongenicUnknown2312646DA.WOKW-(<i>D5Mgh6-D5Mit5</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K backgroundcongenicUnknown2312647DA.WOKW-(<i>D3Mgh5-D3Rat1</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K backgroundcongenicUnknown2312648DA.WOKW-(<i>D10Mgh2-D10Rat4</i>)/KA cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K backgroundcongenicUnknown2312733BN-Chr 13<sup>SS</sup> Chr 18<sup>SS</sup>/McwiA cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressedconsomicCryopreserved Sperm2313181LEW.1WR1/WorBrmObtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc.congenicUnknown2313209WF.ART2/Wordeveloped at the Universtiy of Massachusetts, Medical SchoolcongenicUnknown2313221SHHF-<i>Lepr<sup>cp</i></sup>/CrlDeveloped by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001.congenicUnknownLepr<sup>cp</sup>115705652313222BN/HsdMcwiCrlBN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles RiverinbredUnknown2313231LEWBNF1/CrlThis hybrid rat is a cross between a LEW female and a BN male rat.hybridUnknown2313232WFF344F1/CrlThis hybrid rat is a cross between a WF female and a F344 male rat.hybridUnknown2313342BN-Chr 17<sup>LH</sup>/MavChr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedconsomicUnknown2313343LH-Chr 13<sup>BN</sup>/MavChr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomicUnknown2313384Wild/NovThese are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, RussiawildUnknown2313463F344-<i>Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene.mutantCryopreserved Sperm (as of 2017-01-26)Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup>23134592313464F344-<i>Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene.mutantExtinct (as of 2017-01-26)Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup>23134602313465F344-<i>Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene.mutantCryopreserved Sperm (as of 2017-01-26)Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup>23134622313466F344-<i>Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup>23134612313588SD-Tg(Ins2-IAPP)SoelCrl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promotertransgenicUnknown2313693SHR-Tg(PEPCK-SREBF1)2IpcvSHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signaltransgenicUnknownSREBF1694732313734SD-Tg(H1/tetO-RNAi:Insr)29BdrFertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promotertransgenicUnknown2313735SD-Tg(H1/tetO-RNAi:Insr)14BdrFertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promotertransgenicUnknown2313922F344-Tg(Cyp1a1-Ren2)10.LEW-(<i>D10Rat142-D10Rat15</i>)/JmulF344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to F344 females to produce BC-F344. After 12 backcross nerations, males and females heterozygous for F344/Lew in the reduced MOD QTLregion were brother-sister mated to generate aimals that were homozygous Lew/Lew for the MOD QTL region but homozygous F344/F344 for the rest of the genome.congenicUnknown2313923LEW-Chr YF344-Tg(Cyp1a1-Ren2)10.F344-(<i>D10Rat99-D10Rat11</i>)/JmulF344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to Lew females to produce BC-Lew. After 12 backcross generations, males and females heterozygous for F344/Lew in the MOD QTLregion were brother-sister mated to generate aimals that were homozygous F344/F344 for the MOD QTL region but homozygous LEW/LEW for the rest of the genome.congenicUnknown2313924LEW-Chr YF344-Tg(Cyp1a1-Ren2)10/JmulF344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markersconsomicUnknown2314001N:HSHeterogeneous stockOriginated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of WisconsinoutbredUnknown2314009NMcwi:HSHeterogeneous stock25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. A rotational delay of 1 is used, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc.outbredUnknown2314027SDT.Cg-<i>Lepr<sup>fa</sup></i>/JttSDT fatty<i>Lepr<sup>fa</sup></i> allele from ZDF was introgressed into SDT rats using the speed congenic methodcongenicUnknown2314161F344-<i>Kuru1</i>/KyoKuru1A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantCryopreserved Sperm2314162F344-<i>Oune</i>/KyoOuneA mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantLive Animals; Cryopreserved SpermTbx613077162314163F344-<i>Kcna1<sup>Adms</sup></i>/KyoADMS (autosomal dominant myokymia and seizures) ratThis strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model.mutantLive Animals; Cryopreserved Sperm (as of 2017-05-04)Kcna1<sup>Adms</sup>128803832314164F344-<i>Kuru2</i>/KyoKuru2A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantCryopreserved Sperm2314165ACI-<i>Chib</i>/KyoChibiThis strain was established by phenotype-driven ENU mutagenesis.mutantCryopreserved SpermDermatology2314166F344-<i>Tbr2</i>/KyoTsubura2A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantCryopreserved Sperm2314167F344-<i>Kmch</i>/KyoKomachiThis strain was established by phenotype-driven ENU mutagenesis.mutantLive Animals; Cryopreserved Sperm2314168F344-<i>Tbr1</i>/KyoTsubura1A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantCryopreserved Sperm2314169WTC.F344-<i>Scn1a<sup>m1Kyo</sup></i>/KyoThis congenic strain was established by backcrossing F344-<i>Scn1a<sup>m1Kyo</sup></i> onto WTC/Kyo.congenicLive Animals; Cryopreserved Sperm2314170F344-<i>Egr<sup>m1Kyo</i></sup>EGR (Excessive Grooming Rat), Kaikai, Kyo1897This strain was established by phenotype-driven ENU mutagenesis.mutantCryopreserved Sperm2314224F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/2TjCongenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.congenicCryopreserved EmbryoDiabetes Obesity2314225F344-Chr 15<sup>OLETF</sup>/TjDeveloped by the depositorconsomicCryopreserved EmbryoDiabetes Obesity2314226WI-Tg(WSCD2)3TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicCryopreserved SpermWSCD216057102314227WI-Tg(WSCD2)4TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicCryopreserved SpermWSCD216057102314228WI-Tg(WSCD2)5TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicCryopreserved SpermWSCD216057102314229F344.OLETF-(<i>D7Uwm22-D7Mgh20</i>)/TjDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes Obesity2314230F344-<i>Hr<sup>krh</i></sup>/KyoHairless Kyoto, HanakoA mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).mutantCryopreserved SpermDermatology; Urology2314231F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/2TjMale OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.congenicCryopreserved EmbryoDiabetes Obesity2314232WI-Tg(WSCD2)1TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicCryopreserved SpermWSCD216057102314243SHR.WKY-(<i>D1Mgh2-D1Wox10</i>)/IzmTkyoDeveloped by the depositorcongenicCryopreserved Embryo; Cryopreserved SpermCardio Hypertension2314244BCR/NnIn the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene).mutantCryopreserved SpermNeurobiology2314245WI-Tg(WSCD2)6TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicCryopreserved SpermWSCD216057102314246SHRSP.WKY-(<i>D1Rat117-D1Rat90</i>)/IzmTkyoDeveloped by the DepositorcongenicCryopreserved EmbryoCardio Hypertension2314247WI-Tg(Prl-EGFP)YampA transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) ratstransgenicCryopreserved SpermMetabolism; Development2314313NER.F344-(<i>D5Rat100-D5Rat234</i>)/KyoThe Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.congenicUnknownNeurobiology2314314NER.F344-(<i>D1Mgh6-D1Rat132</i>)/KyoThe Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.congenicUnknownNeurobiology2314315F344.NER-(<i>D5Mgh4-D5Rat36</i>)/KyoThe Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.congenicCryopreserved SpermNeurobiology2314316F344.NER-(<i>D1Mgh6-D1Rat73</i>)/KyoThe Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.congenicCryopreserved SpermNeurobiology2314317WTC.GRY-<i>Cacna1a<sup>gry</sup></i>/KyoDeveloped by the depositorcongenicCryopreserved Sperm (as of 2017-05-04)NeurobiologyCacna1a|Cacna1a<sup>gry</sup>2244|128803822314339F344-<i>Patj<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene.mutantCryopreserved Sperm (as of 2017-01-26)Patj<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup>23143352314340F344-<i>Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene.mutantExtinct (as of 2016-10-24)Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup>23143372314341F344-<i>Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene.mutantExtinct (as of 2016-10-24)Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup>23143382314342F344-<i>Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene.mutantExtinct (as of 2017-01-26)Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup>23143362314360ACI.F344-(<i>D16Mit5-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals.congenicCryopreserved SpermCancer2314361W-Tg(Slc32a1-YFP*)1YyanThis transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.transgenicLive Animals; Cryopreserved SpermNeurobiology; Development2314362F344-<i>Hrdk</i>/KyoHairless dominant KyotoHairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven).mutantCryopreserved Sperm2314363W-Tg(Slc32a1-YFP*)2YyanThis transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.transgenicLive Animals; Cryopreserved SpermNeurobiology; Development2314364ACI.F344-(<i>D16Nkg112-D16Nkg27</i>)/NkgThis congenic strain was established by backcrossing ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals.congenicCryopreserved SpermCancer2314365KFRS2/KyoA male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.mutantCryopreserved SpermOphthalmology; DermatologyTyr|Tyr<sup>siaKyo</sup>1589755|132073452314368F344-<i>Trdk</i>/KyoTremor dominant KyotoTremor dominant Kyoto (Trdk) mutation is an autosomal dominant mutation that appeared in 2008 in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU) (Mashimo et al., 2008). Rats heterozygous for Trdk (Trdk/+) exhibited tremor behavior that was evident around weaning. To remove latent ENU-induced mutations, the laboratory established an F344-Trdk/+ congenic strain by nine rounds of backcrossing. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2,.mutantCryopreserved Sperm (as of 2021-07-15)NeurobiologyKcnn2<sup>Trdk</sup>1497353302314375LE.AR-<i>Ednrb<sup>sl</i></sup>/OkkmAR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008).mutantCryopreserved Embryo (as of 2017-03-28)Internal OrganEdnrb|Ednrb<sup>sl</sup>2536|107554242314376KFRS4/KyoA male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14.mutantLive Animals; Cryopreserved Embryo (as of 2021-10-05)Ophthalmology; Dermatology2314377KFRS3B/KyoA male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding.mutantCryopreserved SpermOphthalmology; Dermatology2314378AR-<i>Ednrb<sup>sl</i></sup>/OkkmAganglionosis ratCongenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR)mutantCryopreserved Embryo (as of 2016-10-31)Internal OrganEdnrb|Ednrb<sup>sl</sup>2536|107554242314379KFRS6/KyoA male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo.mutantLive AnimalsDermatology2314380SD-Tg(CAG-lacZ)541HtsuDeveloped by the depositortransgenicCryopreserved Sperm2314381KFRS5A/KyoA male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo.mutantCryopreserved SpermDermatologyKrt71<sup>Rex</sup>115704162314382SD-Tg(CAG-HRAS*G12V)250HtsuThis transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promotertransgenicCryopreserved SpermCancerHRAS7308812314383KFRS3A/KyoA male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.mutantCryopreserved SpermOphthalmology; Dermatology2314396LCR/McoLow-capacity runnersArtificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill.inbredUnknown2314397HCR/McoHigh-capacity runnersArtificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill.inbredUnknown2314414LEW-Tg(H1/tetO-RNAi:Insr)87HrjbLEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promotertransgenicUnknownInsr29172314415LEW-Tg(H1/tetO-RNAi:Insr)4HrjbLEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promotertransgenicUnknownInsr29172314477LEW-<i>RT1<sup>DA</i></sup>/RrrcSprague-Dawley RT1<sup>u</sup> haplotype backcrossed onto Lewis inbred strain.congenicCryopreserved Embryo; Cryopreserved Sperm2314478LEW-<i>RT1.B<sup>m1Trg</i></sup>/RrrcRT1.BENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain.mutantCryopreserved Embryo; Cryopreserved Sperm2314492SBN.SBH-(<i>D1Rat148-D1Rat89</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314493SBH.SBN-(<i>D1Mgh2-D1Rat74</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314494SBH.SBN-(<i>D1Rat137-D1Rat123</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314495SBN.SBH-(<i>D1Rat27-D1Mit7</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/YglcongenicUnknown2314496SBH.SBN-(<i>D1Mgh2-D1Mgh11</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314497SBN.SBH-(<i>D1Rat101-D1Rat74</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314498SBH.SBN-(<i>D1Rat137-D1Rat83</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314499SBN.SBH-(<i>D1Mgh17-D1Mgh14</i>)/YglSegment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/YglcongenicUnknown2314500SBH.SBN-(<i>D1Mgh2-D1Rat101</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314501SBH.SBN-(<i>D1Wox11-D1Rat137</i>)/YglSegment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/YglcongenicUnknown2314530SS.SHR-(<i>D8Uia1-D8Rat90</i>)/McoSS/Jr females were bred with SHR/NHsd males and their female F<sub>1</sub> were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markerscongenicUnknown2314531SHR.SS-(<i>D13Rat1-D13Mgh6</i>)/McoSS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markerscongenicUnknown2314532SHR.SS-(<i>D8Uia1-D8Rat90</i>)/McoSS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markerscongenicUnknown2314655BRAT-<i>Avp<sup>di</i></sup>/BluHsdBrattleboroHereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21)Avp<sup>di</sup>136272612314861WAG/RijYcbSubstrain of WAG/Rij; from Netherlands to Yale University.inbredUnknown2314904WAG-<i>F8<sup>m1Ycb</sup></i>This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline.mutantUnknownF8<i><sup>m1Ycb</sup></i>23149032314928Slc:WSlc: WistarInstitute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain.outbredUnknown2314934WST.F344-<i>Ker</i>/KyoWistar/ST-BooThis congenic strain was established by backcrossing F344-<i>Ker</i>/Kyo (NBRP No.0458) onto Slc:WSTcongenicCryopreserved Sperm2314935WST.F344-<i>Kmch</i>/KyoWistar/ST-KomachiThis congenic strain was established by backcrossing F344-<i>Kmch</i>/Kyo (NBRP No.0458) onto Slc:WST.congenicCryopreserved Sperm2314936WI-Tg(WSCD2)TkyoA transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.transgenicCryopreserved Sperm (as of 2017-08-24)2314937F344.OLETF-(<i>D5Mgh20-D5Mgh22</i>)/TjDeveloped by the depositorcongenicCryopreserved EmbryoDiabetes Obesity2316631F344.GK-(<i>D1Swe8-D1Gpam-1</i>)/SweThis sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/SwecongenicUnknownAdra2a|Pdcd4|Shoc22056|620816|13081462316632NEDH/KSimNew England Deaconess HospitalInbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. HoffmaninbredUnknown2316633F344.GK-(<i>D1Got251-D1Gpam-1</i>)/SweThis sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/SwecongenicUnknown2316653SS.LEW-(<i>D1Mco102-D1Got46</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Uia8-D1Rat18<i>)/Mco contributing to the introgressed LEW allelecongenicUnknown2316654SS.LEW-(<i>D1Mco102-D1Mco129</i>)/1McoA sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2316655SS.LEW-(<i>D1Mco102-D1Mco129</i>)/2McoA sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown2316925SHR.BN-(<i>D3Rat159-D3Rat1</i>)/Mco50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsdcongenicUnknown2316927SHR.BN-(<i>D6Rat40-D6Rat170</i>)/Mco45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsdcongenicUnknown2316928SHR.BN-(<i>D3Rat159-D3Rat1</i>)(<i>D6Rat40-D6Rat170</i>)/Mcothis double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allelecongenicUnknown2317196DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>)Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interestcongenicUnknown2317197DA.PVG.1AV1-(<i>D8Rat41-D8Rat24</i>)Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interestcongenicUnknown2317201DA.PVG.1AV1-(<i>D8Rat24-D8Got145</i>)DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locuscongenicUnknown2317278Taiep/DunThese mutants were found in Sprague-Dawley rats at University of Puebla in 1989mutantUnknown2317590DA.PVG.1AV1-(<i>D4Rat23-D4Rat108</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KinicongenicUnknown2317595DA.PVG.1AV1-(<i>D4Rat23-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KinicongenicUnknown2317596DA.PVG.1AV1-(<i>D4Rat103-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KinicongenicUnknown2317598DA.PVG.1AV1-(<i>D4Rat231-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KinicongenicUnknown2317599DA.PVG.1AV1-(<i>D4Got211-D4Mit12</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KinicongenicUnknown2317791DA.PVG.1AV1-(<i>D4Got60-D4Kini1</i>)/KiniCongenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/KinicongenicUnknown2317812AT.ANT-(<i>D1Uia12-D1Rat288</i>)/RarF<sub>2</sub> males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were testedcongenicCryopreserved Sperm (as of 2019-02-26)2317813AT.ANT-(<i>D1Rat234-D1Rat47</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenicUnknown2317814AT.ANT-(<i>D1Rat273-D1Rat158</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenicUnknown2317815AT.ANT-(<i>D1Rat35-D1Rat47</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenicUnknown2317816AT.ANT-(<i>D1Rat234-D1Rat158</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenicUnknown2317817AT.ANT-(<i>D1Rat183-D1Rat288</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with ATcongenicUnknown2317818AT.ANT-(<i>D1Rat273-D1Rat288</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with ATcongenicUnknown2317819AT.ANT-(<i>D1Rat35-D1Rat288</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with ATcongenicUnknown2317820AT.ANT-(<i>D1Rat158-D1Rat288</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with ATcongenicUnknown2317822AT.ANT-(<i>D1Rat35-D1Rat38</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenicUnknown2317825AT.ANT-(<i>D1Rat234-D1Rat35</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenicUnknown2317827AT.ANT-(<i>D1Rat234-D1Rat38</i>)/RarThis sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with ATcongenicUnknown2317891SHR-Chr 6<sup>MWF</sup>/RkbSHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomicUnknown2324631DA.E3-(<i>D4Wox49-D4Got136</i>)/RhdThis congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.congenicUnknownClec4a313595282325143SHR/NHsdMcoSpontaneously Hypertensive RatSHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbredUnknown2325145LEW/CrlMcoLewisThese were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbredUnknown2325146MNS/NMcoMilan normotensive strainThese were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbredUnknown2325202SS/JrSeacDahl Salt-SensitiveSubstrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRPinbredCryopreserved Embryo; Cryopreserved SpermCardio- Hypertension2325206LEW/SeacSubstrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD JapaninbredUnknown2325209SHRSP/HosSubstrain of SHRSP purchased from Sankyo Lab Service, Japan.inbredUnknown2325724PVG.LEW-(<i>D1Rat270-D1Rat68</i>)/Kini63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1congenicUnknown2325754SD-<i>Pax6<sup>Sey</sup></i>/MceAutosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA.mutantUnknownPax6|Pax6<sup>Sey</sup>3258|7376882325773WKY.LEW-(<i>D13Arb15-D13Rat58</i>)/TjaSegment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrlcongenicUnknown2325774WKY.LEW-(<i>D13Arb10-D13Arb15</i>)(<i>D16Rat88-D16Rat40</i>)/TjaWKY.LEW-(<i>D13Arb10-D13Arb15</i>) were crossed with WKY.LEW-(<i>D16Rat88-D16Rat40</i>), the F<sub>1</sub> were backcrossed to WKY.LEW-(<i>D13Arb10-D13Arb15</i>) and then the offsprings were intercrossedcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)2325796SS.LEW-(<i>D3Rat52-D3Chm57</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat130</i>)/AydcongenicUnknown2325798SS.LEW-(<i>D10Got112-Igfbp4</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/AydcongenicUnknownIgfbp428752325801SS.LEW-(<i>D16Chm36-D16Mit2</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydcongenicUnknown2325803SS.LEW-(<i>D16Rat112-D16Chm60</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydcongenicUnknown4107048SS.SR-(<I>D7Rat16-D7Rat189</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenicUnknown4107052SS.SR-(<I>D7Rat16-D7Mgh5</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenicUnknown4107055SS.SR-(<I>D7Rat16-D7Rat176</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenicUnknown4107057SS.SR-(<I>D7Mco7-D7Rat81</I>)/JrCongenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segmentcongenicUnknown4107063SS.LEW-(<i>D1Uia8-D1Rat124</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allelecongenicUnknown4107065SS.LEW-(<i>D1Uia8-D1Rat213</i>)/McoA sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allelecongenicUnknown4139872SS-<i>Nckap5<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6.mutantExtinct (as of 2017-01-26)Nckap5<sup>em2Mcwi</sup>41398624139873SS-<i>Rag1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Rag1<sup>em2Mcwi</sup>41398664139874SS-<i>Ets1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Ets1<sup>em1Mcwi</sup>41398564139875FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.mutantCryopreserved Sperm (as of 2017-01-26)Sorcs1<sup>em1Mcwi</sup>41398644139877FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Rab38<sup>em1Mcwi</sup>41398674139878SS-<i>Mmp2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.mutantUnknown (as of 2017-07-18)Mmp2<sup>em2Mcwi</sup>41398694139879SS-<i>Nckap5<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.mutantExtinctNckap5<sup>em1Mcwi</sup>41398594139880SS-<i>Ren<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Ren<sup>em1Mcwi</sup>41398634139881SS-<i>Nckap5<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.mutantExtinct (as of 2017-01-26)Nckap5<sup>em3Mcwi</sup>41398614139882SS-<i>Nppa<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Nppa<sup>em4Mcwi</sup>41398574139883SS-<i>Nox4<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Nox4<sup>em2Mcwi</sup>41398684139884SS-<i>Rag1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Rag1<sup>em1Mcwi</sup>41398654139885SS-<i>Sh2b3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Sh2b3<sup>em1Mcwi</sup>41398584139889BHD/DspeBirt-Hogg-Dube ratA rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd.inbredCryopreserved Embryo (as of 2018-06-06)Flcn7350884139890TT/SgnRats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats.mutantCryopreserved SpermFkbp613089264139891F344-Chr 3<sup>SDT</sup>/NyoThis consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background.consomicCryopreserved EmbryoDiabetes Obesity4139892ALD/Hyoacid lipase deficiency ratIn a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far.inbredCryopreserved EmbryoMetabolismLipa30084140402W-Tg(Gh1as)NibsThe construct which contains of rat growth hormone (<i>Gh1</i>) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat <i>Gh1</i> cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science.transgenicCryopreserved Sperm4140403SD-Tg(Eno2-ATXN3*64Q)29KakizBackground strain is Slc:SD.transgenicCryopreserved SpermNeurobiology4140404ODS-<i>Gulo<sup>od/od</sup>/ShiJclOsteogenic disorder Shionagi ratDr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.inbredLive Animals (as of 2021-04-29)Gulo<sup>od</sup>1268487614140405LEXF6A/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredCryopreserved Embryo4140406SHRSP.WKY-(<i>D1Wox29-D1Arb21</i>)/IzmDmcrTo establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.congenicCryopreserved Embryo4140407SDT.BN-<i>Gluco13</i>/NyoThe <i>Gluco13</i> (<i>Gisdt1</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-<i>Gluco14</i>/Nyo (NBRP No. 0602).congenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity4140408LEXF8C/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredCryopreserved Embryo4140409COP-Chr 16<sup>DA</sup>/McoRrrcTransfer of the DA-rat chromosome 16 (RNO16) into the COP-rat backgroundconsomicUnknown4140410SD-Tg(Eno2-ATXN3*64Q)16KakizBackground strain is Slc:SD.transgenicCryopreserved SpermNeurobiology4140411SDT.BN-<i>Gluco14</i>/NyoThe <i>Gluco14</i> (<i>Gisdt2</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN-<i> Gluco13</i>/Nyo (NBRP No. 0601).congenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity4140412LEXF1D/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredCryopreserved Embryo4140413LEXF1B/StmThe LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.recombinant_inbredCryopreserved Embryo4140414WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)/IzmDmcrTo establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.congenicUnknown4140415TRMRC/KyoThe coisogenic control strain for the TRMR strain (NBRP No.0016).coisogenicLive Animals; Cryopreserved Sperm4140416SD-Tg(Eno2-Vcp)16KakizThis transgenic strain was generated by microinjection into Slc:SD fertilized eggs.transgenicCryopreserved SpermNeurobiology4140469F344-<i>Kmch</i>/NSlcKomachifrom NBRPmutantUnknown4142540SHR.WKY-(<i>D4Rat10-D4Rat15</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicCryopreserved SpermCardio Hypertension4142541W-Tg(Tek-GFP)1SohThis transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion.transgenicCryopreserved Embryo; Cryopreserved Sperm4142542BN.SDT-<i>Gluco14</i>/NyoThe Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo.congenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity4142543BN.SDT-<i>Gluco13</i>/NyoThe Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo.congenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity4142544WKY/KihaA WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University.mutantCryopreserved Embryo4142545SHR.WKY-(<i>D3Rat108-D3Rat166</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicCryopreserved SpermCardio Hypertension4142546AMI/TjRats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003.mutantCryopreserved EmbryoDentistry4142547SHR.WKY-(<i>D4Wox27-D4Rat11</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicCryopreserved SpermCardio Hypertension4142548SHR.WKY-(<i>D4Wox27-D4Rat10</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicCryopreserved SpermCardio Hypertension4142549SHR.WKY-(<i>D4Wox27-D4Rat4</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicCryopreserved SpermCardio Hypertension4142550SHR.WKY-(<i>D4Rat101-D4Rat15</i>)/IzmTkyoThis congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.congenicCryopreserved SpermCardio Hypertension4142799LEW.SS-(<i>D2Uia5-D2Rat143</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic straincongenicUnknown4142800LEW.SS-(<i>D18Chm31-D18Mit8</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic straincongenicUnknown4143165SD-Tg(Aqp5-GFP)ZboroRrrcAqp5EGFPThis rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained.transgenicCryopreserved Embryo; Cryopreserved SpermAqp521444143456BN.GK-(<i>D2Wox30-D2Wox68</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenicUnknown4143457BN.GK-(<i>D2Rat40-D2Wox35</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenicUnknown4143458BN.GK-(<i>D2Wox49-D2Rat70</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenicUnknown4143459BN.GK-(<i>D2Rat40-D2Got149</i>)/OxThis congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.congenicUnknown4145088SS.BN-(<i>D6Rat119-D6Arb3</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown4145089SS.BN-(<i>D6Rat149-D6Rat18</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown4145090SS.BN-(<i>D6Rat149-D6Got171</i>)/McwiSS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown4145091SS.BN-(<i>D6Rat149-D6Arb3</i>)/McwiSS/JrHsdMcwi were crossed with SS-6<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown4145374ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Rat98-D14Hmgc18</i>)/McwiCongenic strain developed by crossing ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/Eur (Rf-1a) males to ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi (Rf-1a+4) double congenic femalescongenicUnknown4889411SHRSP.WKY-(<i>D1Smu13-D1Wox33</i>)/IzmAbout 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic straincongenicCryopreserved SpermCardio- Hypertension4889414WKY.SHRSP-(<i>D1Rat171-D1Wox33</i>)/IzmAbout 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(<i>D1Smu13-D1Smu11</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic straincongenicCryopreserved SpermCardio-Hypertension4889450DA.PVG.1AV1-(<i>D1Rat248-D1Rat10</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb)congenicUnknown4889464GK/OxOriginal breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UKinbredUnknown4889499CDS-Chr 4<sup>CDR</sup>/YglHomozygous male CDS/Ygl were bred with CDR/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889817SBN-Chr 1<sup>SBH</sup>/YglHomozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889820SBH-Chr 1<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889822SBN-Chr 17<sup>SBH</sup>/YglHomozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889875SBH-Chr 2<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889877SBH-Chr 20<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889879SBH-Chr X<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889882SBH-Chr 17<sup>SBN</sup>/YglHomozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixedconsomicUnknown4889890DA.PVG.1AV1-(<i>D17Rat8-D17Rat37</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37congenicCryopreserved SpermImmunology4891048SS.LEW-(<i>D7Rat73-D7Rat128</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknownAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|7278864891051LEW.SS-(<i>D7Rat73-D7Rat128</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknownAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|7278864891103WMI/EerWKY most immobile3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated.inbredUnknown4891107WLI/EerWKY least immobile3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated.inbredUnknown4891165Wig/YmaswigglingThese are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) straincongenicUnknown4891380SS.SR-(<i>D9Mco95-D9Mco98</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknown4891383SS.SR-(<i>D9Mco98-Resp18</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknownResp1835554891386SS.SR-(<i>D9Mco98-Resp18</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknownResp1835554891388SS.SR-(<i>D9Mco95-D9Mco100</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknown4891390SS.SR-(<i>D9Mco95-D9Mco100</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknown4891392SS.SR-(<i>D9Mco95-D9Mco102</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknown4891394SS.SR-(<i>D9Mco101-Resp18</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknownResp1835554891396SS.SR-(<i>D9Mco72-Resp18</i>)/McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknownResp1835554891400SS.SR-(<i>D9Mco14-Resp18</i>)/1McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknownResp1835554891402SS.SR-(<i>D9Mco14-Resp18</i>)/2McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknownResp1835554891404SS.SR-(<i>D9Mco14-Resp18</i>)/3McoSS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 regioncongenicUnknownResp1835554892563WF.WKY-(<i>D5Rat26-D5Uwm42</i>)/UwmWKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region.congenicUnknown5130721HXB1/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131094BN-<i>Lx</i>/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.mutantUnknown5131095BXH13/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131097BXH12/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131099BXH11/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131101BXH10/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131104BXH9/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131106BXH8/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131108BXH6/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131110BXH5/CubPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131113HXB31/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131115HXB29/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131118HXB27/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131120HXB26/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131122HXB25/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131124HXB23/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131126HXB20/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131128HXB17/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131130HXB15/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131132HXB13/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131134HXB10/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained by Printz laboratory for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131136HXB7/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131138HXB4/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131140HXB3/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131142HXB2/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131144HXB18/IpcvPrinEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.recombinant_inbredUnknown5131910SS-<i>Acad10<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2.mutantCryorecovery (as of 2017-07-18)Acad10<sup>em2Mcwi</sup>51319055131911SS-<i>Alms1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Alms1<sup>em1Mcwi</sup>51319065131912SS-<i>Aldh2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4.mutantCryopreserved Sperm (as of 2017-01-26)Aldh2<sup>em2Mcwi</sup>51319075131920SS-<i>Apoe<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2.mutantExtinctApoe<sup>em8Mcwi</sup>51319155131921SS-<i>Apoe<sup>em7Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.mutantExtinctApoe<sup>em7Mcwi</sup>51319185131922SS-<i>Cdh13<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.mutantCryorecovery (as of 2017-01-26)Cdh13<sup>em1Mcwi</sup>51319195131932SS-<i>Cyp1a1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.mutantCryopreserved Sperm (as of 2017-01-26)Cyp1a1<sup>em1Mcwi</sup>51319285131933SS-<i>Cyba<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Cyba<sup>em1Mcwi</sup>51319305131934SS-<i>Cyp1a1<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 4.mutantExtinct (as of 2017-01-26)Cyp1a1<sup>em5Mcwi</sup>51319295131950SS-<i>Msra<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Msra<sup>em3Mcwi</sup>51319455131951SS-<i>Prokr1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 126-bp frameshift deletion in exon 2.mutantExtinct (as of 2017-01-26)Prokr1<sup>em2Mcwi</sup>51319475131952SS-<i>Mas1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.mutantCryorecovery (as of 2018-09-05)Mas1<sup>em1Mcwi</sup>51319465131953SS-<i>Prokr1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2.mutantExtinct (as of 2017-01-26)Prokr1<sup>em1Mcwi</sup>51319485131954SS-<i>Mstn<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2.mutantExtinct (as of 2017-01-26)Mstn<sup>em2Mcwi</sup>51319495131963SS-<i>Nox4<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.mutantCryopreserved Sperm (as of 2017-01-26)Nox4<sup>em1Mcwi</sup>51314285131964SS-<i>Mstn<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Mstn<sup>em3Mcwi</sup>51319625131965SS-<i>Mthfr<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Mthfr<sup>em1Mcwi</sup>51319615131966SS-<i>Plod1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.mutantCryorecovery (as of 2017-01-26)Plod1<sup>em1Mcwi</sup>51319605131974SS-<i>Rasgrp3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12.mutantCryopreserved Sperm (as of 2017-01-26)Rasgrp3<sup>em1Mcwi</sup>51319685131975SS-<i>Ptpn11<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4.mutantCryopreserved Sperm (as of 2017-01-26)Ptpn11<sup>em1Mcwi</sup>51319705131976SS-<i>Ptpn11<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp frameshift deletion in exon 4.mutantExtinct (as of 2017-01-26)Ptpn11<sup>em4Mcwi</sup>51319695131987SS-<i>Tgfb1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 3.mutantExtinct (as of 2017-01-26)Tgfb1<sup>em1Mcwi</sup>51319865131988SS-<i>Wdr72<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 5-bp frameshift deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Wdr72<sup>em2Mcwi</sup>51319785131989SS-<i>Tgfb1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Tgfb1<sup>em3Mcwi</sup>51319805131990SS-<i>Slc30a8<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Slc30a8<sup>em2Mcwi</sup>51319815131991SS-<i>Slc30a8<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Slc30a8<sup>em1Mcwi</sup>51319795134683WF.WKY-(<i>D7Rat171-D7Rat128</i>)/1UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenicUnknown5134685WF.WKY-(<i>D7Rat171-D7Rat128</i>)/2UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenicUnknown5134687WF.WKY-(<i>D7Rat51-D7Rat128</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenicUnknown5134689WF.WKY-(<i>D7Uwm25-D7Rat128</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenicUnknown5134692WF.WKY-(<i>D7Rat171-D7Rat45</i>)/UwmChromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic backgroundcongenicUnknown5134951WF.COP-(<i>D7Rat39-D7Uwm12</i>)/1UwmChromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic backgroundcongenicUnknown5134953WF.COP-(<i>D7Rat39-D7Uwm12</i>)/2UwmChromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic backgroundcongenicUnknown5135031BN.MES-<i>Cyba</i>/Snamutant Cyba gene from the MES/Slc strain is introduced into the background of BN/SsNSlc by standard procedures with seven backcrosses to BN/SsNSlccongenicUnknown5135472ACI.BN-(<I>D5Uwm70-D5Rat32</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5135473ACI.BN-(<I>D5Uwm70-D5Got42</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5135475ACI.BN-(<I>D5Rat60-D5Rat115</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5135477ACI.BN-(<I>D5Uwm70-D5Mgh15</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5135479ACI.BN-(<I>D5Rat113-D5Rat36</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5135481ACI.BN-(<I>D5Mgh17-D5Rat98</I>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5143940ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/EurCongenic substrain that originated from ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/EurcongenicUnknown5143941ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwiTriple congenic ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur from Erasmus Medical Center, Rotterdam, Netherlands now bred and housed at Medical College of WisconsincongenicUnknown5143942ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.congenicUnknown5143943ACI.FHH-(<i>D14Mit11-D14Rat82</i>)/EurCongenic strain generated by using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf4 QTL region of chr 14 is introgressed in this strain.congenicCryopreserved Sperm5143984SS-<i>Plekha7<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.mutantCryopreserved Sperm (as of 2017-01-26)Plekha7<sup>em1Mcwi</sup>51439785143985SS-<i>Mstn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation deletes part of exon 2 and its splice acceptor.mutantCryopreserved Sperm (as of 2017-01-26)Mstn<sup>em1Mcwi</sup>51439645143986SS-<i>Ulk3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.mutantCryopreserved Sperm (as of 2017-01-26)Ulk3<sup>em1Mcwi</sup>51439685143987SS-<i>Gpr183<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Gpr183<sup>em3Mcwi</sup>51439615143988SS-<i>Gpr183<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Gpr183<sup>em2Mcwi</sup>51439555143989SS-<i>Agtrap<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor.mutantCryopreserved Sperm (as of 2017-01-26)Agtrap<sup>em4Mcwi</sup>51439635143990SS-<i>Ulk3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 88-bp frameshift deletion in exon 5.mutantCryopreserved Sperm (as of 2017-01-26)Ulk3<sup>em4Mcwi</sup>51439715143991SS-<i>Gpr183<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Gpr183<sup>em1Mcwi</sup>51439575143992SS-<i>Rasgrp3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 20-bp frameshift deletion in exon 12.mutantCryopreserved Sperm (as of 2017-01-26)Rasgrp3<sup>em3Mcwi</sup>51439465143993SS-<i>Plcd3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 161-bp deletion in exon 1 including the splice donormutantCryopreserved Sperm (as of 2017-01-26)Plcd3<sup>em4Mcwi</sup>51439545143994SS-<i>Plcd3<sup>em7Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codonmutantCryopreserved Sperm (as of 2017-01-26)Plcd3<sup>em7Mcwi</sup>51439765143995SS-<i>Plekha7<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 8.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Plekha7<sup>em4Mcwi</sup>51439795143996SS-<i>Agtrap<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor.mutantCryopreserved Sperm (as of 2017-01-26)Agtrap<sup>em8Mcwi</sup>51439705144101SS-<i>Kcnq1<sup>em14Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3.mutantCryorecovery (as of 2017-01-26)Kcnq1<sup>em14Mcwi</sup>51440835144102ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi-<i>Asip<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Asip<sup>em1Mcwi</sup>51440995144103SS-<i>Ldlr<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.mutantCryopreserved Sperm (as of 2017-01-26)Ldlr<sup>em1Mcwi</sup>51440905144104SS-<i>Ncf2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 2.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Ncf2<sup>em1Mcwi</sup>51440895144105SS-<i>Hexim2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Hexim2<sup>em4Mcwi</sup>51440955144106SS-<i>Kcnq1<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Kcnq1<sup>em9Mcwi</sup>51440765144107SS-<i>Itga9<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCGGAGCCTTCCTGTCCgacagcGTGGTTCTCCTCAGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor.mutantCryopreserved Sperm (as of 2017-01-26)Itga9<sup>em1Mcwi</sup>51440775144108SS-<i>Ldlr<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.mutantCryopreserved Sperm (as of 2017-01-26)Ldlr<sup>em4Mcwi</sup>51440755144110ACI.BN-(<i>D5Mgh17-D5Mgh15</i>)/ShulThis congenic strain is developed by further genotyping ACI.BN-(<i>D5Mgh17-D5Rat205</i>)/Shul.congenicUnknown5147594FHH.PCK-(<i>D9Rat35-D9Rat70</i>)/McwiA FHH/EurMcwi male was crossed with a PCK/CrljCrl-<i>Pkhd1<sup>pck</i></sup>/Crl female, and the male progeny were backcrossed to FHH/EurMcwi females for five generations by marker assisted breeding. In each generation, males were genotyped by fluorescent genotyping for three markers within the Pkhd1 gene, and 98 markers evenly spaced throughout the genome.congenicUnknownPkhd1<sup>pck</sup>115359435490515FHH.BN(<i>D1Rat265-D1Rat76</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundcongenicExtinct5490516FHH.BN(<i>D14Rat80-D14Hmgc4</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundcongenicLive Animals; Cryopreserved Sperm5490517FHH.BN(<i>D14Rat78-D14Hmgc4</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundcongenicLive Animals; Cryopreserved Sperm5508304WUN-<i>Abcc2<sup>TR-</i></sup>/HsdRrrcSpontaneous 1-bp deletion mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC). This mutation at amino acid 393 resulting a frameshift and premature stop at position 401.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2019-08-02)Abcc2|Abcc2<sup>TR-</sup>2366|127929415508305F344-<i>Dpp4<sup>DPPIV-</i></sup>/DchcHsdRrrcThe DPP4 mutant rat was a spontaneous mutation in Fischer 344 rats, which caused a deficiency in DPPIV, was identified by Dr. Douglas C. Hixson at Rhode Island Hospital.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-16)Dpp4<sup>DPPIV</sup>127929425508356SS-<i>Gucy1a3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5.mutantExtinctGucy1a3<sup>em1Mcwi</sup>55083515508357SS-<i>Tfdp2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6.mutantCryopreserved Sperm (as of 2017-01-26)Tfdp2<sup>em2Mcwi</sup>55083325508358SS-<i>Wdr72<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 3 and intron 3mutantCryopreserved Sperm (as of 2017-01-26)Wdr72<sup>em1Mcwi</sup>55083275508359SS-<i>Prune<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Prune<sup>em3Mcwi</sup>55083485508360SS-<i>Dguok<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCGGTTCCTTCTGCgtagacTCCGAGCGTCTTTCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp frameshift deletion in exon 1.mutantExtinct (as of 2017-01-26)Dguok<sup>em4Mcwi</sup>55083235508361SS-<i>Bcas3<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCTGTACTCACttcgtACGGGGGAGATGGTCAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 9.mutantCryopreserved Sperm (as of 2017-01-26)Bcas3<sup>em4Mcwi</sup>55083295508362SS-<i>Ncf2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Ncf2<sup>em4Mcwi</sup>55083425508363SS-<i>Sorcs2<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACATCAGCTTCCGCTCTgactggGAGCTGGTCAAGGTGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 15.mutantCryopreserved Sperm (as of 2017-01-26)Sorcs2<sup>em4Mcwi</sup>55083265508364SS-<i>Prune<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Prune<sup>em1Mcwi</sup>55083415508365SS-<i>Agtr1a<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Agtr1a<sup>em5Mcwi</sup>55083185508366SS-<i>Tfdp2<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.mutantExtinctTfdp2<sup>em5Mcwi</sup>55083345508367SS-<i>Ulk4<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACCTTGTAGCTACccaggtGAGGCTGTCTGATGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 15 and intron 15mutantCryopreserved Sperm (as of 2017-01-26)Ulk4<sup>em3Mcwi</sup>55083405508368SS-<i>Trafd1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTGGTGCCCGGACagagcTGTGTGGCAGCTGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 5.mutantCryopreserved Sperm (as of 2017-01-26)Trafd1<sup>em1Mcwi</sup>55083525508369SS-<i>Myadml2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.mutantExtinct (as of 2017-01-26)Myadml2<sup>em1Mcwi</sup>55083175508370SS-<i>Nppb<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Nppb<sup>em2Mcwi</sup>55083245508371SS-<i>Mylip<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.mutantExtinctMylip<sup>em3Mcwi</sup>55083365508380SS-TgTn(T2ONC)2McwiThese rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.transgenicCryopreserved Sperm5508381SS-TgTn(T2ONC)1McwiThese rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.transgenicCryopreserved Sperm5508392HsdHlr:ZUC-<i>Lepr</i><sup>fa</sup>Derived from a colony obtained in 1992outbredUnknown5508393BN/RijHsdThese were derived from a nucleus colony obtained directly from the TNO Institute, the Netherlands now available at Envigo.inbredUnknown5508394FBNF1/HsdOffspring of a cross between the F344/NHsd inbred female and a BN male rat.hybridUnknown5508395Hsd:RH-<i>Foxn1</i><sup>rnu</sup>Athymic NudeDerived from animals obtained from the Rowett Research Institute, Aberdeen, Scotland.outbredUnknown5508396HsdRccHan:WISTDerived at Biological Research Laboratories Limited (BRL), formerly RCC, now Harlan Laboratories Ltd., Fullinsdorf, Switzerland from original colony at Zentralinstitute fur Versuchstierzucht, Hannover in 1989. Transferred to Harlan Sprague-Dawley, Inc. in 1993 (nomenclature HsdHan:WIST). Harlan became Envigo in 2015.
In 2004 Envigo acquired RCC Ltd. and new breeding stock was transferred in 2008 (nomenclature RccHan:WIST). Unlike competitive models, the RccHan:WIST rat has been maintained from the original nucleus of 156 breeding pairs in Hannover, Germany.outbredUnknown5508397HotHsd:SDSprague DawleyOriginally developed by the Holtzman Company in Madison, Wisconsin, from Sprague Dawley stock in 1947; to Harlan through acquisition in 1986.outbredUnknown5508398BluHsd:LELong Evans (Blue Spruce)From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988. Harlan became Envigo in 2015.outbredUnknown5509086ACI.BN-(<i>D5Rat72-D5Rat36</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5509087ACI.BN-(<i>D5Rat113-D5Rat159</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain backgroundcongenicUnknown5509988SS-<i>Nppb<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2.mutantCryorecovery (as of 2017-01-26)Nppb<sup>em4Mcwi</sup>55099795509989SS-<i>Msra<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 1-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Msra<sup>em4Mcwi</sup>55099775509990SS-<i>Cyp1a1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 188-bp deletion encompassing exon 4mutantCryopreserved Sperm (as of 2017-01-26)Cyp1a1<sup>em2Mcwi</sup>55099765509991SS-<i>Mylip<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Mylip<sup>em2Mcwi</sup>55083335509992SS-<i>Ube2q2<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7.mutantCryopreserved Sperm (as of 2017-01-26)Ube2q2<sup>em3Mcwi</sup>55099875509993SS-<i>Tcf7l2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGAAGCCTCCAGAGCagacaaGCCCTCAAGGATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 169-bp deletion of exon5 and intron 5.mutantCryopreserved Sperm (as of 2017-01-26)Tcf7l2<sup>em1Mcwi</sup>55099815509994SS-<i>Sh2b3<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Sh2b3<sup>em2Mcwi</sup>55099825509995SS-<i>Adra2a<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Adra2a<sup>em1Mcwi</sup>55099865509996SS-<i>Stk39<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7.mutantExtinctStk39<sup>em2Mcwi</sup>55099785509997SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.mutantExtinctNckap5<sup>em4Mcwi</sup>55099755529230ACI.FHH-(<i>D1Hmgc16-D1Rat225</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundcongenicCryopreserved Sperm5529529ACI.FHH-(<i>D1Hmgc1-D1Hmgc19</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundcongenicCryopreserved Sperm5529731ACI.FHH-(<i>D1Hmgc20-D1Hmgc21</i>)/Mcwidesired segments from FHH/EurMcwi were introgressed in ACI/Eur backgroundcongenicCryopreserved Sperm5683886SS-Chr 12<sup>BN</sup>.SS-(<i>D12Arb13-D12Mit2</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenicUnknown5683888SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Rat79</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenicUnknown5683890SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenicUnknown5685369SS-<i>Agtr1a<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Agtr1a<sup>em1Mcwi</sup>55083315686300SS-<i>Adra2a<sup>em1Mcwi-/-</sup></i>SS-<i>Adra2a<sup>em1Mcwi-</sup>/Adra2a<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2019-07-26)Adra2a<sup>em1Mcwi</sup>55099865686302SS-<i>Adra2a<sup>em1Mcwi+/+</sup></i>SS-<i>Adra2a<sup>em1Mcwi+</sup>/Adra2a<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686304SS-<i>Agtrap<sup>em4Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em4Mcwi-</sup>/Agtrap<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Embryo (as of 2018-09-05)5686306SS-<i>Agtrap<sup>em4Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em4Mcwi+</sup>/Agtrap<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686308SS-<i>Hexim2<sup>em4Mcwi-/-</sup></i>SS-<i>Hexim2<sup>em4Mcwi-</sup>/Hexim2<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686311SS-<i>Hexim2<sup>em4Mcwi+/+</sup></i>SS-<i>Hexim2<sup>em4Mcwi+</sup>/Hexim2<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686314SS-<i>Rasgrp3<sup>em1Mcwi-/-</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi-</sup>/Rasgrp3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686316SS-<i>Rasgrp3<sup>em1Mcwi+/+</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi+</sup>/Rasgrp3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686318SS-<i>Sh2b3<sup>em1Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 .mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Sh2b3<sup>em1Mcwi</sup>41398585686320SS-<i>Sh2b3<sup>em1Mcwi+/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi+</sup>/Sh2b3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686322SS-<i>Sh2b3<sup>em1Mcwi-/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2019-07-26)Sh2b3<sup>em1Mcwi</sup>41398585686326SS-<i>Ulk3<sup>em4Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686328SS-<i>Ulk3<sup>em4Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi+</sup>/Ulk3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686330SS-<i>Ulk3<sup>em4Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686332SS-<i>Wdr72<sup>em2Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em2Mcwi-</sup>/Wdr72<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686335SS-<i>Wdr72<sup>em2Mcwi+/+</sup></i>SS-<i>Wdr72<sup>em2Mcwi+</sup>/Wdr72<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686652SS-<i>Agtr1a<sup>em1Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em1Mcwi-</sup>/Agtr1a<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)5686654SS-<i>Agtr1a<sup>em1Mcwi+/+</sup></i>SS-<i>Agtr1a<sup>em1Mcwi+</sup>/Agtr1a<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686657SS-<i>Agtr1a<sup>em5Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em5Mcwi-</sup>/Agtr1a<sup>em5Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686659SS-<i>Agtrap<sup>em8Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em8Mcwi-</sup>/Agtrap<sup>em8Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686662SS-<i>Agtrap<sup>em8Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em8Mcwi+</sup>/Agtrap<sup>em8Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686664SS-<i>Aldh2<sup>em2Mcwi-/-</sup></i>SS-<i>Aldh2<sup>em2Mcwi-</sup>/Aldh2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686666SS-<i>Aldh2<sup>em2Mcwi+/+</sup></i>SS-<i>Aldh2<sup>em2Mcwi+</sup>/Aldh2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686668SS-<i>Cdh13<sup>em1Mcwi-/-</sup></i>SS-<i>Cdh13<sup>em1Mcwi-</sup>/Cdh13<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryorecovery (as of 2018-09-05)5686670SS-<i>Cdh13<sup>em1Mcwi+/+</sup></i>SS-<i>Cdh13<sup>em1Mcwi+</sup>/Cdh13<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686672SS-<i>Cyp1a1<sup>em1Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi-</sup>/Cyp1a1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2019-11-06)5686676SS-<i>Cyp1a1<sup>em1Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi+</sup>/Cyp1a1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686678SS-<i>Cyp1a1<sup>em2Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi-</sup>/Cyp1a1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686680SS-<i>Cyp1a1<sup>em2Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi+</sup>/Cyp1a1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686684SS-<i>Cyp1a1<sup>em5Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi-</sup>/Cyp1a1<sup>em5Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)5686687SS-<i>Cyp1a1<sup>em5Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi+</sup>/Cyp1a1<sup>em5Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686689SS-<i>Prokr1<sup>em1Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em1Mcwi-</sup>/Prokr1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)5686692SS-<i>Prokr1<sup>em1Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em1Mcwi+</sup>/Prokr1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686695SS-<i>Prokr1<sup>em2Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em2Mcwi-</sup>/Prokr1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)5686697SS-<i>Prokr1<sup>em2Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em2Mcwi+</sup>/Prokr1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686700SS-<i>Kcnq1<sup>em14Mcwi-/-</sup></i>SS-<i>Kcnq1<sup>em14Mcwi-</sup>/Kcnq1<sup>em14Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryorecovery (as of 2018-09-05)5686702SS-<i>Kcnq1<sup>em14Mcwi+/+</sup></i>SS-<i>Kcnq1<sup>em14Mcwi+</sup>/Kcnq1<sup>em14Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686704SS-<i>Msra<sup>em3Mcwi-/-</sup></i>SS-<i>Msra<sup>em3Mcwi-</sup>/Msra<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686706SS-<i>Msra<sup>em3Mcwi+/+</sup></i>SS-<i>Msra<sup>em3Mcwi+</sup>/Msra<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686708SS-<i>Msra<sup>em4Mcwi-/-</sup></i>SS-<i>Msra<sup>em4Mcwi-</sup>/Msra<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686710SS-<i>Msra<sup>em4Mcwi+/+</sup></i>SS-<i>Msra<sup>em4Mcwi+</sup>/Msra<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686713SS-<i>Mstn<sup>em1Mcwi-/-</sup></i>SS-<i>Mstn<sup>em1Mcwi-</sup>/Mstn<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2019-07-26)Mstn<sup>em1Mcwi</sup>51439645686715SS-<i>Mstn<sup>em1Mcwi+/+</sup></i>SS-<i>Mstn<sup>em1Mcwi+</sup>/Mstn<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686718SS-<i>Mstn<sup>em3Mcwi-/-</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2019-07-26)Mstn<sup>em3Mcwi</sup>51319625686721SS-<i>Mstn<sup>em3Mcwi+/+</sup></i>SS-<i>Mstn<sup>em3Mcwi+</sup>/Mstn<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686723SS-<i>Mstn<sup>em3Mcwi-/+</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686725SS-<i>Nppa<sup>em4Mcwi-/-</sup></i>SS-<i>Nppa<sup>em4Mcwi-</sup>/Nppa<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)5686728SS-<i>Nppa<sup>em4Mcwi+/+</sup></i>SS-<i>Nppa<sup>em4Mcwi+</sup></i>/<i>Nppa<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686730SS-<i>Nppb<sup>em2Mcwi-/-</sup></i>SS-<i>Nppb<sup>em2Mcwi-</sup></i>/<i>Nppb<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknownNppb<sup>em2Mcwi</sup>55083245686732SS-<i>Nppb<sup>em2Mcwi+/+</sup></i>SS-<i>Nppb<sup>em2Mcwi+</sup></i>/<i>Nppb<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686734SS-<i>Nppb<sup>em4Mcwi-/-</sup></i>SS-<i>Nppb<sup>em4Mcwi-</sup>/Nppb<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryorecovery (as of 2018-09-05)5686736SS-<i>Nppb<sup>em4Mcwi+/+</sup></i>SS-<i>Nppb<sup>em4Mcwi+</sup>/Nppb<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686738SS-<i>Plcd3<sup>em4Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em4Mcwi-</sup>/Plcd3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686740SS-<i>Plcd3<sup>em4Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em4Mcwi+</sup>/Plcd3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686742SS-<i>Plcd3<sup>em7Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em7Mcwi-</sup>/Plcd3<sup>em7Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686744SS-<i>Plcd3<sup>em7Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em7Mcwi+</sup>/Plcd3<sup>em7Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686747SS-<i>Plekha7<sup>em1Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em1Mcwi-</sup>/Plekha7<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686749SS-<i>Plekha7<sup>em1Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em1Mcwi+</sup>/Plekha7<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686758SS-<i>Plekha7<sup>em4Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em4Mcwi-</sup>/Plekha7<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Plekha7<sup>em4Mcwi</sup>51439795686760SS-<i>Plekha7<sup>em4Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em4Mcwi+</sup>/Plekha7<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686762SS-<i>Plod1<sup>em1Mcwi-/-</sup></i>SS-<i>Plod1<sup>em1Mcwi-</sup>/Plod1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryorecovery (as of 2018-09-05)5686764SS-<i>Plod1<sup>em1Mcwi+/+</sup></i>SS-<i>Plod1<sup>em1Mcwi+</sup>/Plod1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686766SS-<i>Sh2b3<sup>em2Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em2Mcwi-</sup>/Sh2b3<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Sh2b3<sup>em2Mcwi</sup>55099825686768SS-<i>Slc30a8<sup>em1Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em1Mcwi-</sup>/Slc30a8<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686770SS-<i>Slc30a8<sup>em1Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em1Mcwi+</sup>/Slc30a8<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686772SS-<i>Slc30a8<sup>em2Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em2Mcwi-</sup>/Slc30a8<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686776SS-<i>Slc30a8<sup>em2Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em2Mcwi+</sup>/Slc30a8<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686778SS-<i>Stk39<sup>em2Mcwi-/-</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)Stk39<sup>em2Mcwi</sup>55099785686780SS-<i>Stk39<sup>em2Mcwi+/+</sup></i>SS-<i>Stk39<sup>em2Mcwi+</sup>/Stk39<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686782SS-<i>Stk39<sup>em2Mcwi-/+</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)Stk39<sup>em2Mcwi</sup>55099785686784SS-<i>Tcf7l2<sup>em1Mcwi-/-</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686786SS-<i>Tcf7l2<sup>em1Mcwi+/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi+</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686788SS-<i>Tcf7l2<sup>em1Mcwi-/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686790SS-<i>Ulk3<sup>em1Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686792SS-<i>Ulk3<sup>em1Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi+</sup>/Ulk3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686794SS-<i>Ulk3<sup>em1Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686797SS-<i>Wdr72<sup>em1Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em1Mcwi-</sup>/Wdr72<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5686799SS-<i>Wdr72<sup>em1Mcwi+/+</sup></i>SS-<i>Wdr72<sup>em1Mcwi+</sup>/Wdr72<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5686826ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1, Rf-3 QTL region of chr 3, and Rf4 QTL region of chr 14 are introgressed in this strain.congenicUnknown5686829ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat6-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiTriple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.congenicUnknown5686832ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Got102-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiMulticongenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.congenicUnknown5687688FHH-Tg(CAG-Rab38)1McwiA Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion mapped to chromosome 14, roughly 13.2-Mbp, and was more than 100-kbp away from the nearest gene (downstream of Antrx2).transgenicUnknown5687689FHH-Tg(CAG-Rab38)2McwiA Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion in line 2 was found to be within a long interspersed nuclear element (LINE) sequence and could not be unambiguously mapped to a specific chromosome location.transgenicUnknown5687969ACI.BN-(<i>D2Rat251-D2Mgh3</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.congenicUnknown5687971ACI.BN-(<i>D2Rat10-D2Rat202</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.congenicUnknown5687973ACI.BN-(<i>D18Rat30-D18Rat89</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 18 transferred to the ACI/SegHsd strain background.congenicUnknown5687974SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.mutantExtinctCyp4a2<sup>em1Mcwi</sup>56877245687975SS-<i>Prex1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGTACTTCCGCTTCcatgcgGACGAGGAGATGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 16.mutantCryopreserved Sperm (as of 2017-01-26)Prex1<sup>em2Mcwi</sup>56877195687977SS-<i>Acad10<sup>em2Mcwi+/+</sup></i>SS-<i>Acad10<sup>em2Mcwi+</sup>/Acad10<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5687979SS-<i>Acad10<sup>em2Mcwi-/-</sup></i>SS-<i>Acad10<sup>em2Mcwi-</sup>/Acad10<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The homozygous mutant carries a 10-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-07-18)Acad10<sup>em2Mcwi</sup>51319055687981SS-<i>Alms1<sup>em1Mcwi-/-</sup></i>SS-<i>Alms1<sup>em1Mcwi-</sup>/Alms1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5687983SS-<i>Alms1<sup>em1Mcwi+/+</sup></i>SS-<i>Alms1<sup>em1Mcwi+</sup>/Alms1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5687985SS-<i>Apoe<sup>em7Mcwi+/+</sup></i>SS-<i>Apoe<sup>em7Mcwi+</sup>/Apoe<sup>em7Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5687987SS-<i>Apoe<sup>em7Mcwi-/-</sup></i>SS-<i>Apoe<sup>em7Mcwi-</sup>/Apoe<sup>em7Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5687989SS-<i>Apoe<sup>em8Mcwi-/-</sup></i>SS-<i>Apoe<sup>em8Mcwi-</sup>/Apoe<sup>em8Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5687992SS-<i>Apoe<sup>em8Mcwi+/+</sup></i>SS-<i>Apoe<sup>em8Mcwi+</sup>/Apoe<sup>em8Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5687994SS-<i>Bcas3<sup>em4Mcwi+/+</sup></i>SS-<i>Bcas3<sup>em4Mcwi+</sup>/Bcas3<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5687996SS-<i>Bcas3<sup>em4Mcwi-/-</sup></i>SS-<i>Bcas3<sup>em4Mcwi-</sup>/Bcas3<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5687998SS-<i>Cyba<sup>em1Mcwi-/-</sup></i>SS-<i>Cyba<sup>em1Mcwi-</sup>/Cyba<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)5688000SS-<i>Cyba<sup>em1Mcwi+/+</sup></i>SS-<i>Cyba<sup>em1Mcwi+</sup>/Cyba<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688002SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5688004SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/-</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5688006SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct5688008SS-<i>Ets1<sup>em1Mcwi+/+</sup></i>SS-<i>Ets1<sup>em1Mcwi+</sup>/Ets1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688010SS-<i>Ets1<sup>em1Mcwi-/+</sup></i>SS-<i>Ets1<sup>em1Mcwi-</sup>/Ets1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)Ets1<sup>em1Mcwi</sup>41398565688012SS-<i>Gpr183<sup>em1Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em1Mcwi-</sup>/Gpr183<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688014SS-<i>Gpr183<sup>em1Mcwi+/+</sup>SS-<i>Gpr183<sup>em1Mcwi+</sup>/Gpr183<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688016SS-<i>Gpr183<sup>em2Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em2Mcwi-</sup>/Gpr183<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688018SS-<i>Gpr183<sup>em2Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em2Mcwi+</sup>/Gpr183<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688020SS-<i>Gpr183<sup>em3Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em3Mcwi-</sup>/Gpr183<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688022SS-<i>Gpr183<sup>em3Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em3Mcwi+</sup>/Gpr183<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688024SS-<i>Itga9<sup>em1Mcwi+/+</sup></i>SS-<i>Itga9<sup>em1Mcwi+</sup>/Itga9<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688026SS-<i>Mas1<sup>em1Mcwi+/+</sup></i>SS-<i>Mas1<sup>em1Mcwi+</sup>/Mas1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688028SS-<i>Mas1<sup>em1Mcwi-/-</sup></i>SS-<i>Mas1<sup>em1Mcwi-</sup>/Mas1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryorecovery (as of 2017-07-18)5688039SS-<i>Mthfr<sup>em1Mcwi+/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi+</sup>/Mthfr<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688041SS-<i>Mthfr<sup>em1Mcwi-/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi-</sup>/Mthfr<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688043SS-<i>Nckap5<sup>em1Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em1Mcwi-</sup>/Nckap5<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)Nckap5<sup>em1Mcwi</sup>41398595688045SS-<i>Nckap5<sup>em1Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em1Mcwi+</sup>/Nckap5<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688047SS-<i>Nckap5<sup>em2Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em2Mcwi-</sup>/Nckap5<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)Nckap5<sup>em2Mcwi</sup>41398625688049SS-<i>Nckap5<sup>em2Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em2Mcwi+</sup>/Nckap5<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688051SS-<i>Nckap5<sup>em3Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em3Mcwi-</sup>/Nckap5<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantExtinct (as of 2018-09-05)Nckap5<sup>em3Mcwi</sup>41398615688053SS-<i>Nckap5<sup>em3Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em3Mcwi+</sup>/Nckap5<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688059SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/-</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688061SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+</sup>/Nckap5<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688063SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688066SS-<i>Ncf2<sup>em1Mcwi-/-</sup></i>SS-<i>Ncf2<sup>em1Mcwi-</sup>/Ncf2<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Ncf2<sup>em1Mcwi</sup>51440895688069SS-<i>Ncf2<sup>em1Mcwi+/+</sup></i>SS-<i>Ncf2<sup>em1Mcwi+</sup>/Ncf2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688074SS-<i>Nox4<sup>em2Mcwi-/-</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. This homozygous mutant carries an 8-bp frameshift deletion in exon 7 of rat Nox4.mutantLive Animals; Cryopreserved Sperm (as of 2019-01-03)Nox4<sup>em2Mcwi</sup>41398685688077SS-<i>Nox4<sup>em2Mcwi+/+</sup></i>SS-<i>Nox4<sup>em2Mcwi+</sup>/Nox4<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688080SS-<i>Nox4<sup>em2Mcwi-/+</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2019-07-26)Nox4<sup>em2Mcwi</sup>41398685688083SS-<i>Prex1<sup>em2Mcwi-/-</sup></i>SS-<i>Prex1<sup>em2Mcwi-</sup>/Prex1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688087FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-/-</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-</sup>/Rab38<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.mutantUnknownRab38<sup>em1Mcwi</sup>41398675688090FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+/+</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+</sup>/Rab38<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknownRab386287525688092SS-<i>Rag1<sup>em1Mcwi-/-</sup></i>SS-<i>Rag1<sup>em1Mcwi-</sup>/Rag1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)5688094SS-<i>Rag1<sup>em1Mcwi+/+</sup></i>SS-<i>Rag1<sup>em1Mcwi+</sup>/Rag1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688096SS-<i>Rag1<sup>em2Mcwi-/-</sup></i>SS-<i>Rag1<sup>em2Mcwi-</sup>/Rag1<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)5688098SS-<i>Rag1<sup>em2Mcwi+/+</sup></i>SS-<i>Rag1<sup>em2Mcwi+</sup>/Rag1<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688100SS-<i>Ren<sup>em1Mcwi+/+</sup></i>SS-<i>Ren<sup>em1Mcwi+</sup>/Ren<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688102SS-<i>Ren<sup>em1Mcwi-/-</sup></i>SS-<i>Ren<sup>em1Mcwi-</sup>/Ren<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)5688107FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-/-</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-</sup>/Sorcs1<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is a 14-bp frameshift deletion mutation in exon 7.mutantUnknownSorcs1<sup>em1Mcwi</sup>41398645688109FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+/+</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+</sup>/Sorcs1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688111SS-<i>Tfdp2<sup>em2Mcwi-/-</sup></i>SS-<i>Tfdp2<sup>em2Mcwi-</sup>/Tfdp2<sup>em2Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688113SS-<i>Tfdp2<sup>em2Mcwi+/+</sup></i>SS-<i>Tfdp2<sup>em2Mcwi+</sup>/Tfdp2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688116SS-<i>Tgfb1<sup>em1Mcwi+/+</sup></i>SS-<i>Tgfb1<sup>em1Mcwi+</sup>/Tgfb1<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.mutantUnknown5688119SS-<i>Tgfb1<sup>em3Mcwi+/-</sup></i>SS-<i>Tgfb1<sup>em3Mcwi+</sup>/Tgfb1<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained heterozygous breeders.mutantCryopreserved Sperm (as of 2021-08-24)5688121SS-<i>Ube2q2<sup>em3Mcwi-/-</sup></i>SS-<i>Ube2q2<sup>em3Mcwi-</sup>/Ube2q2<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688123SS-<i>Ube2q2<sup>em3Mcwi+/+</sup></i>SS-<i>Ube2q2<sup>em3Mcwi+</sup>/Ube2q2<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown5688125SS-<i>Ulk4<sup>em3Mcwi-/-</sup></i>SS-<i>Ulk4<sup>em3Mcwi-</sup>/Ulk4<sup>em3Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantCryopreserved Sperm (as of 2018-09-05)5688396ACI.BN-(<i>D3Rat80-D3Rat3</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 3 transferred to the ACI/SegHsd strain background.congenicUnknown5688400ACI.BN-(<i>D4Rat5-D4Got131</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 4 transferred to the ACI/SegHsd strain background.congenicUnknown5688402ACI.BN-(<i>D6Rat148-D6Rat109</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 6 transferred to the ACI/SegHsd strain background.congenicUnknown5688405ACI.COP-(<i>D5Rat12-D5Rat205</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.congenicUnknown5688407ACI.COP-(<i>D5Rat28-D5Rat205</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.congenicUnknown5688409ACI.COP-(<i>D5Rat28-D5Rat36</i>)/ShulThis congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.congenicUnknown6218997SHR/NCrlAnraThese were originally from Harvard University, Boston MA, then at UNESP, Botucatu, SP, Brazil, now maintained at Behavior Genetics Laboratory, SC, BrazilinbredUnknown6219002LEW/HsdUnibAnraLEW rats originally from Harlan Sprague Dawley, IN then bred at UNICAMP (Campinas, SP Brazil) now maintained at Behavior Genetics Laboratory, SC, BrazilinbredUnknown6478788STOCK-<i>Tp53<sup>tm1(EGFP-Pac)Qly</sup></i>/Rrrcp53 knockout ratThis strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5 prime and 1.6- kb 3 prime homology arms and a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting F344 blastocysts. Founder animals were mated with SD rats.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01)Tp53|Tp53<sup>tm1(EGFP-Pac)Qly</sup>3889|127929576478789LEW-Tg(CAG-EGFP)YsRrrcTransgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegalovirus enhancer, chicken b-actin enhancer-promoter and rabbit b-globin poly(A) signal.transgenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2018-07-16)6478791F344-Tg(UBC-EGFP)F455RrrcThis transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. Animals that exhibited fluorescence of tails were mated. Offspring were bred with Lewis wild-type mates to map transgene location. Animals were backcrossed 10 generations onto F344.transgenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm6480190NAft:HSHeterogeneous stockFrom Dr. Eva Redei, Center for Comparative Medicine, Northwestern University to Dr. Alberto Fernandez-Teruel, BarcelonaoutbredUnknown6480205MWF-Chr 6<sup>SHR</sup> Chr 8<sup>SHR</sup>/RkbChr 8 and chr 6 were introgressed from albuminuria-resistant SHR/FubRkb into the sensitive isogenic background of MWF/FubRkbconsomicUnknown6480210SHR-Chr 8<sup>MWF</sup>/RkbSHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomicUnknown6480218AR-<i>Ednrb<sup>sl</i></sup>/HkvAganglionosis ratCongenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR), provided to Dr. Takashi Agui by Dr. Ozaki, National Institute for Physiological Sciences, Okazaki, JapanmutantUnknownEdnrb<sup>sl</sup>107554246480220LE/Hkv.AR-<i>Ednrb<sup>sl</sup></i>Aganglionosis ratThis strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. AR-derived Ednrb<sup>sl</sup> was introduced into Long-Evans by Dr. Ozaki (NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm), and this rat was provided to Dr. Agui at Hokkaido University and inbred line was established by sib mating.mutantCryopreserved Embryo (as of 2016-11-15)Internal MedicineEdnrb<sup>sl</sup>107554246480223F344.AR-<i>Ednrb<sup>sl</sup></i>/HkvAganglionosis ratThis strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. This congenic strain was established by backcrossing (over 10 generations) of AR rat to F344/NSlc.mutantCryopreserved Embryo (as of 2016-10-28)Ednrb<sup>sl</sup>107554246480863BBDR/RhwRrrcBBDR/Rhw from R. H. William Laboratory, University of Washington, Seattle, Washington to Rat Resource & Research CenterinbredCryopreserved Embryo; Cryopreserved Sperm6480866BN-Chr 13<sup>LH</sup>/MavRrrcChr 13 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedconsomicCryopreserved Embryo; Cryopreserved Sperm6480868BN-Chr 2<sup>LH</sup>/MavRrrcChr 2 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotypedconsomicCryopreserved Embryo; Cryopreserved Sperm6480874COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoRrrcMale COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. Transferred from Medical College of Toledo to Rat Resource & Research CentercongenicCryopreserved Embryo; Cryopreserved Sperm6482243WI-<i>Cit<sup>fhJjlo</sup></i>/Rrrcflathead ratFlathead rat was discovered at University of Connecticut in an inbred colony of Wistar rats. Spontaneous single G deletion in exon 1 of citron kinase (Cit) confers a premature stop codon and lack of citron kinase protein.mutantCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-07-21)Cit<sup>fhJjlo</sup>132048316482244SS-Tg(APOA1)116OpazRrrcSS/JrHsd embryos were microinjected with human APOA1 C3 promotertransgenicCryopreserved Embryo; Cryopreserved Sperm6482245SS-Tg(Atp1a1)24OpazRrrcSS/JrHsd embryos were microinjected with rat alpha1 Na,K-ATPase promoter (-1288 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPasetransgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24)6482247FDIO/RrrcCross between F344 (lean phenotype) and SDDIO (diet-induced obese phenotype) then inbred for 6 generations with maintenance of obese phenotype.inbredCryopreserved Embryo; Cryopreserved Sperm6482252F344-Tg(Pgk1-EGFP)/RrrcMultiple random integration of EGFP gene under the control of the PGK promoter.transgenicCryopreserved Embryo; Cryopreserved Sperm6482254Gunn-<i>Ugt1a1<sup>j</i></sup>/BluHsdRrrcGunn ratThis mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-09-15)Ugt1a1<sup>j</sup>134320646482256HS/RrrcHigh Self-AdministrationDeveloped from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.inbredCryorecovery (as of 2019-02-01)6482259LS/RrrcLow Self-AdministrationDeveloped from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-01-13)6482268BRAT-<i>Avp<sup>di</i></sup>/BluHsdRrrcBrattleboroHereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Brattleboro rats transferred to the RRRC in 2009.mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21)Avp<sup>di</sup>136272616482271LEW.Cg-<i>Foxn1</i><sup>rnu</sup>/NRrrcThe NIH nude rat was developed in 1979-1980 at the NIH through a series of matings involving the following inbred rat strains: BN/SsN, MR/N, BUF/N, WN/N, ACI/N, WKY/N, M520/N, and F344/N. Received from the National Institute of Health by NCI in 1983. The nude mutation was subsequently backcrossed 17 generations to the Lewis inbred strain.congenicCryopreserved Embryo; Cryopreserved Sperm6482282LEW-Tg(EGFP)463-5RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicCryopreserved Sperm6482284LEW-Tg(EGFP)456-9RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicCryopreserved Sperm6482286LEW-Tg(EGFP)458-7RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicCryopreserved Embryo; Cryopreserved Sperm6482288LEW-Tg(EGFP)463-1RrrcLewis- GFP transgenicinsertion of EGFP transgene with Ubiquitin C promotertransgenicCryopreserved Sperm6482290LEW-Tg(EGFP)455RrrcLewis- GFP transgenicThis transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos.transgenicCryopreserved Embryo; Cryopreserved Sperm6482292LEW-Tg((ROSA26)Sor-lacZ)15JmskThis strain expresses LacZ ubiquitously driven by the ROSA26 promoter established at Jichi Medical School.transgenicCryopreserved Embryo (as of 2017-08-08)6482294LH-Chr 13<sup>BN</sup>/MavRrrcChr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomicCryopreserved Embryo; Cryopreserved Sperm6482296LH-Chr 17<sup>BN</sup>/MavRrrcChr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotypedconsomicCryopreserved Embryo; Cryopreserved Sperm6482298MWF/ZtmRrrcMunich Wistar FromterFrom outbred Wistar rats selected for large numbers of superficial glomeruli.inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01)6482643WIN/RhwRrrcSubmitted to Rat Resource & Research CenterinbredCryopreserved Embryo; Cryopreserved Sperm6482645SD-Tg(Rho-S334X)3LavRrrcThis transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated rhodopsin protein. Submitted to Rat Resource & Research CentertransgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-08-17)6482654ACI.BN-(<i>D7Rat36-D7Rat11</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicUnknown6482674HIS/NdkRrrcHigh-Saccharin-Consuming (HiS) RatThe Occidental HiS (high-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that voluntarily consumed high levels of saccharin.This male was mated to several Holtzman Sprague-Dawley females and offspring displaying high saccharin consumption were selected. Selective breeding was continued in which offspring with high saccharin consumption were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.inbredCryopreserved Embryo; Cryopreserved Sperm6482676LOS/NdkRrrcLow-Saccharin-Consuming (HiS) RatThe Occidental LoS (low-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that did not voluntarily consume saccharin. This male was mated to several Holtzman Sprague-Dawley females and offspring displaying low saccharin consumption were selected. Selective breeding was continued in which offspring with low saccharin consumption (see phenotyping protocol) were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.inbredCryopreserved Embryo; Cryopreserved Sperm6482680SD-Tg(MMTV-Erbb2)1UwmRrrcHsd:SD background carrying a transgene which produces over-expression of the rat Erbb2 proto-oncogene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-12)Erbb225616483453SS-<i>Dguok<sup>em2Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Dguok<sup>em2Mcwi</sup>55083546483454SS-<i>Dguok<sup>em1Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105)mutantCryopreserved Sperm (as of 2017-01-26)Dguok<sup>em1Mcwi</sup>55083456483455SS-<i>Dguok<sup>em3Mcwi</sup></i>This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc)mutantCryopreserved SpermDguok<sup>em3Mcwi</sup>55083256483846HsdFcen:WIWistarDescendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan and now maintained at School of Science, Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, ArgentinaoutbredUnknown6484519SS-<i>ROSA26<sup>em1(SB11)Mcwi</sup></i>This strain was produced by ZFN-stimulated knockin in the rat Rosa26 locus. ZFNs targeting the sequence CCTTCCCCCTTCTTCcctcgtGATCTGCAACTGGAGTCT were injected into SS/JrHsdMcwi rat embryos along with a plasmid template incorporating the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA, and SV40 polyadenylation signal to integrate the transgene by homologous recombination. The resulting animal was confirmed by sequencing both junctions to harbor the SB11 gene knocked into the rat locus and expresses SB11 transposase in every cell by immunohistochemistry.mutantCryorecovery (as of 2017-08-08)Rosa26<sup>em1(SB11)Mcwi</sup>64845186484559SS-<i>Slc34a1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGTGCTCAGCTCTGCCTTccaactGGCCGGAGGTAGGGCCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp deletion in exon 4.mutantExtinct (as of 2017-01-26)Slc34a1<sup>em1Mcwi</sup>56876996484560SS-<i>Pdc<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 5.mutantCryopreserved Sperm (as of 2017-01-26)Pdc<sup>em2Mcwi</sup>56876956484561SS-<i>Comt<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTTCCAGGTCACCATCctcaatGGGGCATCCCAGGATCTT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 4.mutantCryopreserved Sperm (as of 2017-01-26)Comt<sup>em1Mcwi</sup>56877256484562SS-<i>Fgf5<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Fgf5<sup>em1Mcwi</sup>56877206484563SS-<i>Cst3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Cst3<sup>em3Mcwi</sup>56877386484564SS-<i>Cd247<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Cd247<sup>em3Mcwi</sup>56877306484565SS-<i>Ldlr<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 4.mutantExtinct (as of 2017-01-26)Ldlr<sup>em3Mcwi</sup>51440826484566SS-<i>Slc6a12<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTCCCTCTCCAGTatggacAGAAAGGTTACAGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion overlapping exon 2mutantCryopreserved Sperm (as of 2017-01-26)Slc6a12<sup>em1Mcwi</sup>56877366484567FHH-Chr 1<sup>BN</sup>-<i>Sorcs3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCCCGCTCCATTGAcatcagtTCCCTGGTCGTCCAGGAT into FHH-Chr 1BN/Mcwi rat embryos. The resulting mutation is a 33-bp insertion in exon 7mutantCryopreserved Sperm (as of 2017-01-26)Sorcs3<sup>em1Mcwi</sup>56877316484568SS-<i>Cd247<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.mutantExtinctCd247<sup>em5Mcwi</sup>56877136484569SS-<i>Adora2b<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 114-bp deletion in exon 1mutantCryopreserved Sperm (as of 2017-01-26)Adora2b<sup>em1Mcwi</sup>56877296484570SS-<i>Stc1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGCTGCCCAATCACttctccAACAGGTATCCTGAGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Stc1<sup>em2Mcwi</sup>56877226484571SS-<i>Myadml2<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Myadml2<sup>em5Mcwi</sup>56877266484572SS-<i>Fgf5<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Fgf5<sup>em5Mcwi</sup>56877276484573SS-<i>Clcn6<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Clcn6<sup>em2Mcwi</sup>56877406484574SS-<i>Umod<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2.mutantExtinctUmod<sup>em1Mcwi</sup>56876976484575SS-<i>Resp18<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp substitution in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Resp18<sup>em3Mcwi</sup>56877146484576SS-<i>Adipoq<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-13)Adipoq<sup>em1Mcwi</sup>56877096484577SS-<i>Gnb3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGCTCCCTCTCTCCTGGCagtccTTGTGGGACATTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 111-bp deletion overlapping exon 7.mutantCryopreserved Sperm (as of 2017-01-26)Gnb3<sup>em1Mcwi</sup>56876966484578SS-<i>Mylip<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Mylip<sup>em1Mcwi</sup>55083476484579SS-Chr 5<sup>BN</sup>-<i>Cyp4a3<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2.mutantExtinctCyp4a3<sup>em3Mcwi</sup>56877376484580SS-<i>Ldlr<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 123-bp frameshift deletion in exon 4.mutantExtinct (as of 2017-01-26)Ldlr<sup>em2Mcwi</sup>51440946484581SS-<i>Resp18<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Resp18<sup>em2Mcwi</sup>56877056484582SS-<i>Cd247<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Cd247<sup>em1Mcwi</sup>56877036484583SS-<i>Nr2f2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCTTCTTCCCTGACCTGCagatcACGGACCAGGTGGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Nr2f2<sup>em1Mcwi</sup>56877216484584SS-<i>Adipoq<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-13)Adipoq<sup>em2Mcwi</sup>56877166484585SS-<i>Slc7a9<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.mutantCryopreserved Sperm (as of 2017-01-26)Slc7a9<sup>em2Mcwi</sup>56877016484711SS-<i>Atp2b1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TACCTTCTGGGTTCAgaagagGCCGTGGCTTGCTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 117-bp deletion in intron 8 and exon 9.mutantCryopreserved Sperm (as of 2017-01-26)Atp2b1<sup>em2Mcwi</sup>64847076484712SS-<i>Lpin1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Lpin1<sup>em1Mcwi</sup>64847096484713SS-<i>Cubn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CGGGAGTACCTTCAGATTcatgatGGAGACTCCTCAGCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 14.mutantCryopreserved Sperm (as of 2017-01-26)Cubn<sup>em1Mcwi</sup>64847056484714SS-<i>Lss<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 12-bp deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Lss<sup>em2Mcwi</sup>64847066484715SS-<i>Adora2b<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 162-bp deletion in exon 1mutantCryopreserved Sperm (as of 2017-01-26)Adora2b<sup>em2Mcwi</sup>56876986484716SS-<i>Bcat1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGTCTGTACATCCGCCCCacattCATCGGGATTGAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is 15-bp deletion in exon 5mutantCryopreserved Sperm (as of 2017-01-26)Bcat1<sup>em2Mcwi</sup>64847086484717SS-<i>Cacna1h<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CCGACCCACAGTGTCtgggagATCGTGGGGCAGGCAGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 11.mutantCryopreserved Sperm (as of 2017-01-26)Cacna1h<sup>em2Mcwi</sup>64847036484718SS-<i>Ace<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 6.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-13)Ace<sup>em2Mcwi</sup>64847046484719SS-<i>Lepr<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCATCGTACTGCCCacaatgGGACATGGTCACAAG into SS/JrHsdMcwi rat embryos. The resulting mutation was a 16-bp deletion in exon 11, predicted nonsense stop codon 30.mutantCryopreserved Sperm (as of 2017-01-26)Lepr<sup>em2Mcwi</sup>64847016484720SS-<i>Lep<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTGTGCCTATCCacaaaGTCCAGGATGACACC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Lep<sup>em5Mcwi</sup>64847006484721SS-<i>Ace<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 6.mutantLive Animals; Cryopreserved Sperm (as of 2018-11-12)Ace<sup>em1Mcwi</sup>64847026766770BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwiThis congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene; maintained at Medical College of WisconsincongenicUnknown6893382BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwi-<i>Il1r1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 5.mutantCryorecovery (as of 2017-01-26)Il1r1<sup>em3Mcwi</sup>68933786893383SS-<i>Fyn<sup>em6Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp deletion in exon 4.mutantCryopreserved Sperm (as of 2017-01-26)Fyn<sup>em6Mcwi</sup>68933806893384SS-<i>Kcnj11<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Kcnj11<sup>em9Mcwi</sup>68933816893385SS-<i>Kcnj11<sup>em5Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Kcnj11<sup>em5Mcwi</sup>68933796893429SS-<i>Nos3<sup>em8Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 109-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Nos3<sup>em8Mcwi</sup>68934216893430SS-<i>Nat8<sup>em4Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACATCCGCCAGTTCCAGgagaggGACTATGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Nat8<sup>em4Mcwi</sup>68934136893431SS-<i>Nos3<sup>em13Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Nos3<sup>em13Mcwi</sup>68934226893432SS-<i>Hvcn1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.mutantCryopreserved Sperm (as of 2017-01-26)Hvcn1<sup>em1Mcwi</sup>68934106893433SS-<i>Nos3<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Nos3<sup>em2Mcwi</sup>68934186893434SS-<i>Kcnj16<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Kcnj16<sup>em1Mcwi</sup>68934236893435SS-<i>Tfdp2<sup>em6Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 6.mutantCryopreserved Sperm (as of 2017-01-26)Tfdp2<sup>em6Mcwi</sup>68934176893436SS-<i>Kcnmb1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a net 4-bp deletion in exon 2.mutantCryopreserved Sperm (as of 2017-01-26)Kcnmb1<sup>em1Mcwi</sup>68934156893437BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5.mutantExtinctIl1r1<sup>em1Mcwi</sup>68934256893438SS-<i>Fgf1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TTCCAGTTCAGCTGCAGCtcagtGCGGAAAGCGCGGGCGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Fgf1<sup>em2Mcwi</sup>68934126893439SS-<i>Hvcn1<sup>em2Mcwi-/-</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.mutantCryopreserved Sperm (as of 2017-01-26)Hvcn1<sup>em2Mcwi</sup>68934196893440SS-<i>Fyn<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4.mutantExtinctFyn<sup>em1Mcwi</sup>68934116893441SS-<i>Grm7<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2017-01-26)Grm7<sup>em2Mcwi</sup>68934166893442SS-<i>Pparg<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3mutantCryopreserved Sperm (as of 2017-01-26)Pparg<sup>em1Mcwi</sup>68934246893443BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5.mutantExtinctIl1r1<sup>em2Mcwi</sup>68934146893444SS-<i>Kcnmb1<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2.mutantCryopreserved Sperm (as of 2017-01-26)Kcnmb1<sup>em3Mcwi</sup>68934206893530BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/RhwKoletsky rat leptin receptor mutant (lepr) from the LA/N-<i>cp</i> was introgressed into the BBDR/Rhw rats by marker-assisted breeding. This was initiated in 2001 by Dr. Hansen and completed in 2007 at the University of Washington, Seattle.congenicUnknown6893535BBDR.LA-(<i>D5Rat98-D5Rat233</i>), BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwHeterozygous BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/Rhw (DR.<sup><i>lepr</sup></i>) were crossed with homozygous BBDR.BBDP-(-(<i>D4Mit6-D4Mit7</i>)/Rhw (DR.<sup><i>Gimap5</sup></i>), to geenrate teh double congenic rats that had mutations for Gimap5 and lepr genes.congenicUnknown6893551DA.PVG.1AV1-(<i>D1Rat32-D1Rat51</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.congenicCryopreserved SpermNeurobiology6893554DA.PVG.1AV1-(<i>D1Rat193-D1Rat68</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.congenicCryopreserved SpermNeurobiology6893599SS-<i>Pdc<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 47-bp deletion in exon 5.mutantCryopreserved Sperm (as of 2017-01-26)Pdc<sup>em3Mcwi</sup>56877126893600SS-<i>Abcb1b<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4.mutantCryopreserved Sperm (as of 2017-07-24)Abcb1b<sup>em2Mcwi</sup>68935986902893BB.SHR-(<i>Acsm3-Igf2</i>)/KCongenics extablished as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK ratscongenicUnknownIgf2|Acsm32870|620866903879SS/NEisSlc1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, JapaninbredUnknown6903881SR/NEisSlc1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, JapaninbredUnknown6903902WF.COP-(<i>D2Uwm14-D2Uwm13</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background.congenicUnknown6903904WF.COP-(<i>D2Uwm17-D2Rat16</i>)/UwmA segment of chromosome 2 was transferred from COP into the WF background.congenicUnknown6903912SS.SHR-(<i>D9Mco72-D9Rat89</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903914SS.SHR-(<i>D9Mco72-D9Rat55</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903917SS.SHR-(<i>D9Mco72-D9Mco109</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903920SS.SHR-(<i>D9Mco72-D9Uia4</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903922SS.SHR-(<i>D9Mco72-D9Mco106</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903925SS.SHR-(<i>D9Mco72-D9Mco105</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903928SS.SHR-(<i>D9Rat7-D9Got111</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903932SS.SHR-(<i>D9Rat7-D9Rat52</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903934SS.SHR-(<i>D9Rat7-D9Mco91</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6903936SS.SHR-(<i>D9Rat7-D9Rat84</i>)/McoThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown6907047WF.WKY-(<i>D5Uwm63-D5Uwm60</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).congenicUnknown6907054WF.WKY-(<i>D5Uwm67-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907057WF.WKY-(<i>D5Uwm76-D5Uwm61</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907059WF.WKY-(<i>D5Uwm76-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907061WF.WKY-(<i>D5Uwm67-D5Uwm78</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907063WF.WKY-(<i>D5Uwm76-D5Got18</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907076WF.WKY-(<i>D5Uwm78-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907078WF.WKY-(<i>D5Uwm95-D5Uwm98</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907080WF.WKY-(<i>D5Uwm67-D5Uwm81</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907084WF.WKY-(<i>D5Uwm76-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907087WF.WKY-(<i>D5Uwm78-D5Uwm84</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907090WF.WKY-(<i>D5Uwm78-D5Uwm93</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907092WF.WKY-(<i>D5Uwm88-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907094WF.WKY-(<i>D5Uwm87-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907096WF.WKY-(<i>D5Uwm85-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907098WF.WKY-(<i>D5Uwm82-D5Uwm92</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907100WF.WKY-(<i>D5Uwm82-D5Uwm91</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907104WF.WKY-(<i>D5Uwm77-D5Uwm91</i>)/UwmA sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.congenicUnknown6907436SS.BN-(<i>D13Hmgc41-D13Hmgc23</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenicUnknown6907438SS.BN-(<i>D13Rat77-D13Rat105</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenicUnknown6907445SS.BN-(<i>D13Rat124-D13Rat101</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenicUnknown7204133LEW-<i>Rag1<sup>em1Ztm</sup></i>This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.mutantUnknownRag1<sup>em1Ztm</sup>72041327204136SD-<i>Rag1<sup>em1Ang</sup></i>This strain was produced by injecting ZFNs into Sprague-Dawley rat embryos. The resulting mutation is a 5-bp frameshift deletion in the Rag1 gene that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751.mutantUnknownRag1<sup>em1Ang</sup>72041357207880LEW.WKY-(<i>D13Arb15-D13Rat58</i>)/TjaSegment of interest from chr 13 of WKY/NCrl was introgressed into LEW/SsNHsdcongenicUnknown7240510DA.PVG.1AV1-(<i>D4Rat113-D4Kiru96</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKinicongenicUnknown7240512DA.PVG.1AV1-(<i>D4Rat113-D4Kiru80</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKinicongenicUnknown7240513DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/Kirucongenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKinicongenicUnknown7240514DA.PVG.1AV1-(<i>D4Kiru12-D4Kiru55</i>)/KiruCongenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/Kiru onto the genetic background of DA/ZtmKinicongenicUnknown7240521DA.PVG.1AV1-(<i>D4Kini3-D4Rat177</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic straincongenicUnknown7240522DA.PVG.1AV1-(<i>D4Kini3-D4Mgh14</i>)/KiniDA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic straincongenicCryopreserved SpermViral encephalitis (HSE)7241047LE-<i>Lrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup></i>This strain was produced by crossing LE-Lrrk1<sup>em1Sage</sup> with LE-Lrrk2<sup>em1Sage</sup>mutantCryopreserved Embryo (as of 2017-06-06)Lrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>72410437241048LE-<i>Park7<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5mutantUnknownPark7<sup>em1Sage</sup>72410427241049LE-<i>Pink1<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC).mutantLive Animals (as of 2017-05-08)Pink1<sup>em1Sage</sup>72410467241050LE-<i>Lrrk2<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30.mutantLive Animals (as of 2017-06-06)Lrrk2<sup>em1Sage</sup>72410457241051LE-<i>Lrrk1<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.mutantUnknownLrrk1<sup>em1Sage</sup>72410447241052LE-<i>Prkn<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT).mutantUnknownPrkn<sup>em1Sage</sup>72410417241053LE-<i>Lrrk1<sup>em1Sage-/-</sup>Lrrk2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygousmutantUnknownLrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>72410437241054LE-<i>Pink1<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4.mutantUnknownPink1<sup>em1Sage</sup>72410467241055LE-<i>Park7<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA).mutantLive Animals (as of 2017-05-08)Park7<sup>em1Sage</sup>72410427241056LE-<i>Lrrk2<sup>em1Sage-/-</sup></i>ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offsprings maintained as homozygousmutantLive Animals (as of 2018-08-24)Lrrk2<sup>em1Sage</sup>72410457241057LE-<i>Lrrk1<sup>em1Sage-/-</sup></i>ZFN mutant founders carrying a 19-bp frameshift deletion in exon 4 were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous.mutantUnknownLrrk1<sup>em1Sage</sup>72410447241058LE-<i>Prkn<sup>em1Sage</sup></i>This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4.mutantUnknownPrkn<sup>em1Sage</sup>72410417241239DA.BN-(<i>D9Wox18-D9Rat20</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241240DA.BN-(<i>D9Mit6-D9Rat29</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241241DA.BN-(<i>D9Mit6-D9Got15</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241242DA.BN-(<i>D9Got8-D9Rat139</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241243DA.BN-(<i>D9Wox24-D9Rat20</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicCryopreserved SpermNeurobiology7241244DA.BN-(<i>D9Wox24-D9Wox18</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241245DA.BN-(<i>D9Wox24-D9Rat139</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241246DA.BN-(<i>D9Wox24-D9Rat44</i>)/KiniDA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241247LEW.BN-(<i>D9Got8-D9Got22</i>)/KiniLEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241248LEW.BN-(<i>D9Wox24-D9Got22</i>)/KiniLEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous ratscongenicUnknown7241265SHR-Chr Y<sup>WKY</sup>/AkrWKY/NHsd males were crosssed with SHR/NHsd females to get F1 animals, the hybrid animals were backcrossed with female SHR/NHsd to transfer the Y chromosomeconsomicUnknown7241267WKY-Chr Y<sup>SHR</sup>/AkrSHR/NHsd males were crosssed with WKY/NHsd females to get F1 animals, the hybrid animals were backcrossed with female WKY/NHsd to transfer the Y chromosomeconsomicUnknown7241271SHR.BN-(<i>D10Mit4-D10Wox11</i>)/CubSegment of chromosome 10 from BN.<i>Lx</i>/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congeniccongenicUnknown7241594(SDxF344)F1-<i>Rbm20<sup>m1Mlgw</i></sup>This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.mutantCryopreserved Sperm (as of 2017-01-25)Rbm20<i><sup>m1Mlgw</sup></i>72415937241595(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw+/+</i></sup>Heterozygous offspring were intercrossed and maintained as wild typemutantCryopreserved SpermRbm20<i><sup>m1Mlgw</sup></i>72415937241596(SDxF344)F1-<i>Rbm20<sup>m1Mlgw+/+</i></sup>Heterozygous offsprings were intercrossed and maintained as wild typemutantCryopreserved SpermRbm20<i><sup>m1Mlgw</sup></i>72415937241597(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw</i></sup>This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.mutantCryopreserved Sperm (as of 2017-01-25)Rbm20<i><sup>m1Mlgw</sup></i>72415937241794SHR/BbbThis SHR colony is maintained at Max-Delbruck Center for Molecular Medicine, GermanyinbredUnknown7241811BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)(<i>D13Rat124-D13Mgh5</i>)/Sunna double congenic strain which has more than 38.74 Mb of chr 8 and more than 16.78 Mb of chr 13 of Wistar Furth introgressed into the gentic background of BBDP/WorSunncongenicUnknown7243955DA.F344-(<i>D4Got44-D4Arb21</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenicUnknown7243960DA.F344-(<i>D4Got44-D4Rat128</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenicUnknown7243963DA.F344-(<i>D4Uia2-D4Wox21</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenicUnknown7243965DA.F344-(<i>D4Arb21-D4Arb4</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenicUnknown7243966DA.F344-(<i>D4Arb5-D4Arb4</i>)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenicUnknown7244374FXLE/StmRecombinant inbred strain derived from Le/Stm (from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/DuCrlj (from Charles River Japan) and then maintained by brother-sister mating.advanced_intercross_lineUnknown7244380DA.F344(Cia3c)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenicUnknown7244381DA.F344(Cia3e)/ArbCongenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygositycongenicUnknown7245481SD-Tg(hsMt-LacZ)Rehpresses LacZ under the transcriptional control of the mouse metallothionein regulatory sequences. Transgene expression in germ cells is constitutive; expression of the transgene can be induced in liver by zinc or cadmium.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05)7245482SD-Tg(ROSA26-EGFP)RehRrrcStrain carries a 1.8kb transgene consisting of the mouse ROSA26 regulatory sequences driving EGFP. FISH was used to localize the transgene insertion to Chromosome 11q11-q12, proximal to Grik1 and near Ncam2. The transgene is expressed exclusively in male and female germ cells throughtout development.transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05)7245488SD-Tg(Chat-tTA)Rats express a mouse tetracycline-controlled transactivator (tTA) driven by the mouse choline acetyltransferase (Chat) promotor. When mated to a second transgenic strain (RRRC:00633) that carries a target gene (TDP43) under the regulation of a tetracycline response element (TRE), the expression of TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.transgenicCryopreserved Sperm (as of 2019-02-05)7245494SD-Tg(TRE-TARDBP-M337V)Strain carries a transgene expressing human TDP43 with the M337V mutation under control of a tTA-dependent promoter (TRE). When mated to a second transgenic strain (RRRC:632) that carries a tetracycline-controlled transactivator driven by the mouse choline acetyltransferase (Chat) promoter, the expression of mutant TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.transgenicCryopreserved Sperm (as of 2019-02-05)TARDBP13220817245521SD-Tg(Th-SNCA<sup>*</sup>)3Insthe transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat linestransgenicUnknown7245523SD-Tg(Th-SNCA<sup>*</sup>)4Insthe transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat linestransgenicUnknown7245527WKHA/Edhderived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressureinbredUnknown7245556WKHT/EdhWKHT rats are derived from a cross between SHR and WKY. Brother/sister inbreeding of the hybrids and successive generations was performed, selecting for the hypertension, but not the behavioral hyperactivity, of the SHR.inbredUnknown7246924HanTacFcfiq:WHWistar HannoverReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.outbredUnknown7246927NTacFcfiq:SDSprague DawleyReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.outbredUnknown7246928NTac:NIH-<i>Foxn1</i><sup>rnu</sup>nudeThe NIH nude Spontaneous mutant model was developed by NIH in 1979-1980 by intercrossing eight strains of rats. Taconic received stock from NIH Animal Genetic Resource in 1981. The rats were derived by hysterectomy in 1987 and again in 1998. Animals are randomly bred at Taconic without selection for coat color or pigmentation.outbredUnknown7246929NTacFcfiq:NIH-<i>Foxn1</i><sup>rnu</sup>nudeReceived from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating between homozygous male x heterozygous female.outbredUnknown7247278SD-Tg(Camk2a-tTA)XgxCamk2a-tTA transgenic rats expressing tTA under regulatory control of the forebrain promotor Camk2a. Transgene expression can be blocked by administration of doxycycline to drinking water.transgenicCryopreserved Sperm (as of 2019-02-18)7247279SD-Tg(TRE-FUS-R521C)XgxOverexpression of R521C mutant form of human FUS (Fused in Sarcoma) transgene is under regulatory control of tetracycline-responsive promoter element.transgenicCryopreserved Sperm (as of 2019-02-18)FUS13188827247280SD-Tg(TRE-LacZ)XgxLacZ gene was assembled downstream of the TRE (tetracycline-responsive promoter elements) promoter, allowing inducible gene expression.transgenicCryopreserved Sperm (as of 2019-02-18)7247286F344-Tg(APP)21BeseyF344/NHsd embryos were microinjected with a DNA construct containing human beta amyloid precursor protein (APP), Swedish (Swe) double mutation (K670N-M671L) and Indiana (Ind) single autosomal dominant mutation (V642F). The transgene is driven by an ubiquitin-C promoter. Homozygous transgenic rats exhibit approximately 2.9-fold more expression of APP mRNA than wild-type rats.transgenicCryopreserved Sperm (as of 2019-02-05)APP7360217247289SD-Tg(TETRA-EGFP)BeseySD embryos were microinjected with a DNA construct containing the GFP gene downstream of a miniCMV promoter under the control of tetracycline response element (TRE). The pLV-Tet-GFP was generated by co-transfection of pLV-Tet-GFP, pÎ8.9 and pVSV-G into a 293FT packaging cell linetransgenicCryopreserved Sperm (as of 2019-02-18)7247290SD-Tg(Ubc-P2ry2)BeseySD embryos were microinjected with a lentiviral construct containing the rat P2ry2 gene (G protein-coupled purinergic receptor P2Y2) under control of an ubiquitin-C promoter. Results in over-expression of P2ry2 mRNA.transgenicCryopreserved Sperm (as of 2017-08-22)P2ry2620887247594WKY.SHR-(<i>D1Rat90-D1Mit18</i>)/IwaiFragment of the chromosome 1 derived from SHR and repeated backcross to WKYcongenicUnknown7248453SS.BN-(<i>D12Hmgc3-AU047911</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.congenicUnknown7248454SS.BN-(<i>D12Hmgc7-D12Hmgc6</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.congenicUnknown7248456SS.BN-(<i>D12Hmgc3-D12Got29</i>)/McwiSubcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.congenicUnknown7248725ACI.BN-(<i>D7Rat164-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer7248727ACI.BN-(<i>D7Rat164-D7Uwm30</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer7248729ACI.BN-(<i>D7Rat206-D7Uwm30</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicUnknownmammary cancer7248731ACI.BN-(<i>D7Rat164-D7Uwm31</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicUnknownmammary cancer7248733ACI.BN-(<i>D7Rat164-D7Uwm33</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicUnknownmammary cancer7248736ACI.BN-(<i>D7Uwm32-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer7248738ACI.BN-(<i>D7Uwm36-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer7248740ACI.BN-(<i>D7Uwm38-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer7248742ACI.BN-(<i>D7Uwm33-D7Mit27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicUnknown7248744ACI.BN-(<i>D7Uwm33-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicCryopreserved Sperm (as of 2017-09-07)mammary cancer7248746ACI.BN-(<i>D7Uwm41-D7Mit16</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer7248748ACI.BN-(<i>D7Uwm28-D7Mit16</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicCryopreserved Sperm (as of 2017-09-07)mammary cancer7257663WI-<i>Tlr4<sup>em1Geh</i></sup>This strain was produced by TALEN mediated 13 bp deletion in Exon 1 in the rat Tlr4 gene; background strain is Crl:WImutantUnknownalcohol action, immune system function, septic shockTlr4<sup>em1Geh</sup>72576617257722WKY.SHR-(<i>D1Mgh14-D1Rat77</i>)/IwaiFragment of the chromosome 1 derived from SHR/NCrlj and repeated backcross to WKY/NCrlCrljcongenicUnknown7349321LEXF2D/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredUnknown7349322LEXF8B/StmThis strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.recombinant_inbredUnknown7349357DA.PVG.1AV1-(<i>D4Got128-D4Got136</i>)Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.congenicUnknown7364879SS-<i>Apoe<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3mutantCryopreserved Sperm (as of 2017-01-26)Apoe<sup>em9Mcwi</sup>73648787364880SS-<i>Cst3<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Cst3<sup>em1Mcwi</sup>56877087364881SS-<i>Slc7a9<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6.mutantCryopreserved Sperm (as of 2017-01-26)Slc7a9<sup>em1Mcwi</sup>56877007364882SS-<i>Sorcs2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15.mutantCryopreserved Sperm (as of 2017-01-26)Sorcs2<sup>em1Mcwi</sup>55083437364902SS-Chr 2<sup>BN</sup>/1McwiAekCompared to the current SS-Chr 2<sup>BN</sup>/Mcwi colony at the Medical College of Wisconsin (where this strain originated) it is a more complete consomic strain (a smaller piece of distal Chromosome 2 is of the SS genotype compared to the SS-Chr 2<sup>BN</sup>/Mcwi strain).consomicCryopreserved Embryo (as of 2019-02-19)Studies of ischemia reperfusion injury or hypertension7364919SS.BN-(<i>rs64114288-rs107464428</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from the top to ~227 Mb transferred to the SS/JrHsdMcwi strain background.congenicCryopreserved Sperm (as of 2019-02-19)cardiac ischemia7364923SS.BN-(<i>rs106982173-rs65057186</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.congenicCryopreserved Sperm (as of 2019-02-19)cardiac ischemia7364927SS.BN-(<i>rs13453786-rs66377062</i>)/AekThis congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.congenicCryopreserved Sperm (as of 2019-02-19)cardiac ischemia7364932ACI.BN-(<i>D7Rat42-D7Uwm33</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicCryopreserved Sperm (as of 2017-09-07)mammary cancer7364934ACI.BN-(<i>rs199006987-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer7364936ACI.BN-(<i>D7Arb15-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicCryopreserved Sperm (as of 2017-09-07)mammary cancer7364938(LE x RCS-<i>p</i><sup>+</sup>/LavRrrc)F1RCS-<i>p</i><sup>+</sup>/LavRrrc males were mated to LE females.congenicCryopreserved Sperm (as of 2019-02-18)Retinal ResearchMertk692837364940F344-<i>Tp53<sup>tm1(EGFP-Pac)Qly</sup></i>/RrrcBackcrossed STOCK-<i>Tp53<sup>tm1(EGFP-Pac)Qly</sup></i>Rrrc with F344 using speed congenic approach to move mutation onto F344 genetic background.mutantUnknowntumorigenesis model7364954DA.ACI-(<i>D2Mit12-D2Got121</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 7 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studies7364956DA.ACI-(<i>D2Wox20-D2Mit14</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 10 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studies7364959DA.ACI-(<i>D2Uwm24-D2Rat54</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 8 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studies7364970DA.ACI-(<i>D12Mit2-D12Got49</i>)/NsiCongenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 12 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studies7364974DA.F344-(<i>D10Rat195-D10Rat92</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studies7364976DA.F344-(<i>D10Rat195-D10Arb27</i>)/NsiCongenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studies7364978DA.F344-(<i>D10Arb27-D10Rat92</i>)/NsiCongenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studies7364981DA.F344-(<i>D7Rat22-D7Rat15</i>)/NsiCongenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 11 times then brother-sister mating to maintain in the homozygous statecongenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studies7364991ACI/EurMcwiACI (August × Copenhagen Irish)substrain of ACI derived from ACI/EurinbredCryopreserved Embryo; Cryopreserved SpermRenal disease7365040SS.SR-(<i>rs65785750-rs13452155</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenicCryopreserved Sperm (as of 2021-05-07)7365043SS.SR-(<i>rs65785750-rs106808193</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenicCryopreserved Sperm (as of 2019-02-05)7394698ZUC.BN-(<i>D1Rat42-D1Rat90</i>)/Stehomozygous lean wild-type ZUC-<I>Lepr</I><sup>+Ste</sup> were crossed with BN/Crl to get F<sub>1</sub>; these were backcrossed to lean ZUC males; congenics were selected by genotyping with markerscongenicUnknown7394818P.NP-(<i>D4Mgh16-D4Rat173</i>)/IusmP.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenicUnknown7394821P.NP-(<i>Snca-D4Rat35</i>)/IusmP.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selectioncongenicUnknownSnca37297401201SS.SR-(<i>D17Rat24-rs106534785</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenicCryopreserved Sperm (as of 2019-02-05)7401203SS.SR-(<i>rs105019230-D17Rat44</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. <a href=http://www.rrrc.us/Strain/?x=616>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2021-05-07)7401261LOU/NimrOlaHsdLouvainLOU/C was selected for high immunocytoma incidence; to National Institute of Medical Research, Mill Hill; in 1985 from Nimr to HarlaninbredCryorecovery7411634WDB/NipsCrlj:WI females were bred to DA/Slc males to generate F<sub>1</sub> pups which were bred by brother-sister mating; only black (non-agouti) pups were picked for breeding. (The genotype of the pups was checked by backcrossing to BN (for BB or Bb) and Hooded strains (for HH or Hh) genotype.) When the aaBBCCHH genotype of F2 was confirmed then the strain was maintained by brother-sister mating.inbredUnknown7411676SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/GcrcCongenic strain created by speed congenic strategy where the desired region from Chromosome 3 of WKY/Gcrc was introgressed into the SHRSP/Gcrc background.congenicUnknown7411679SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)(<i>D3Mgh16-D3Rat114</i>)/GcrcF<sub>1</sub> rats generated by crossing SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/Gcrc and SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc were backcrossed to SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc; heterozygous animals for chr 3 fragment were crossed with homozygous animals for chr 2; animals that were homozygous for both fragments were intercrossed to get the desired bicongenic straincongenicUnknown7411703SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/Izmconstructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segmentscongenicCryopreserved SpermCardio-Hypertension7411705SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/Izmconstructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segmentscongenicCryopreserved Embryo; Cryopreserved SpermCardio-Hypertension7411707SHRSP.SHR-(<i>D1Mgh5-D1Got87</i>)/Izmmale SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/IzmcongenicCryopreserved SpermCardio-Hypertension7411709SHRSP.SHR-(<i>D1Mit30-D1Rat269</i>)/Izmmale SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/IzmcongenicCryopreserved SpermCardio-Hypertension7421599SS.LEW-(<i>D1Chm64-D1Rat19</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421603SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421606SS.LEW-(<i>D1Uia4-D1Rat320</i>)/AydA segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421610SS.LEW-(<i>D5Mit5-D5M4Mit14</i>)/AydA segment of chromosome 5 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421612SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydA segment of chromosome 16 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421617SS.LEW-(<i>D17Chm14-D17Rat65</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421619SS.LEW-(<i>D17Chm85-D17Chm71</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421621SS.LEW-(<i>D17Chm131-D17Chm93</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421623SS.LEW-(<i>D17Rat84-D17Chm17</i>)/AydA segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421634SS.MNS-(<i>D2Got93-D2Rat222</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421636SS.MNS-(<i>D2Chm90-D2Rat38</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421638SS.MNS-(<i>D2Chm381-D2Chm225</i>)/AydA segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421640SS.MNS-(<i>D2Rat155-D2Chm161</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421643SS.MNS-(<i>D2Chm254-D2Chm161</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421645SS.MNS-(<i>D2Rat155-D2Chm419</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421647SS.MNS-(<i>D2Chm161-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421649SS.MNS-(<i>D2Chm153-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421651SS.MNS-(<i>D2Chm442-D2Chm410</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7421654SS.MNS-(<i>D2Chm366-D2Rat52</i>)/AydCongenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown7771589SS.SR-(<i>D2Rat352-rs63922710</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenicCryopreserved Sperm (as of 2019-02-05)7771600SS.SR-(<i>rs106870553-rs63922710</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strainscongenicCryopreserved Sperm (as of 2019-02-05)7771610SHRSP-Chr 1<sup>F344</sup>/RkbSHRSP/Bbb male was crossed with female F344/Crl to get F1 animals which in turn were backcrossed with female SHRSP, this was repeated for 7 generations, tested by sequential marker-assisted backcrossingconsomicUnknown7777135SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7777138SS.LEW-(<i>D5Mco41-D5Mco47</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7777140SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco41-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1Mco and SS.LEW-(<i>D5Mco41-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenicUnknown7777143SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7777180SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7794691SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco42-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenicUnknown7794694SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7794696SS.LEW-(<i>D5Mco43-D5Mco47</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7794698SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco43-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3Mco and SS.LEW-(<i>D5Mco413-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenicUnknown7794700SS.LEW-(<i>D5Mco39-D5Mco41</i>)/McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7794704SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2McoSS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr straincongenicUnknown7794706SS.LEW-(<i>D5Mco39-D5Mco41</i>)(<i>D5Mco42-D5Mco47</i>)/Mcomale and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco41</i>)/Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenicscongenicUnknown7800659F344.Cg-<i>Du, Tyr<sup>C</sup></i>/Kyodownunder ratDeveloped by the DEPOSITORcongenicCryopreserved Sperm (as of 2016-11-10)Development7800661F344.Cg-<i>Du, Tyr<sup>CKyo+/+</i></sup>downunder ratDeveloped by the DEPOSITORmutantUnknown7800667F344.Cg-<i>Foxn1<sup>rnuKyo-/+</sup></i>Jic N13 to Kyo (1988)mutantLive Animals; Cryopreserved SpermImmunology; CancerFoxn139707800671F344-<i>Sv2a<sup>m1Kyo</sup></i>Established by ENU mutagenesis. A missense mutation (L174Q) mutation in Sv2a: synaptic vesicle glycoprotein 2a, was identified.mutantUnknownSv2a|Sv2a<sup>m1Kyo</sup>619715|127929627800673KFRS2/Kyo<sup>-/+</sup>KFRS2<sup>-/+</sup>A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.mutantLive Animals; Cryopreserved SpermOphthalmology; DermatologyTyr|Tyr<sup>siaKyo</sup>1589755|132073457800676KFRS3A/Kyo<sup>+/+</sup>A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.mutantUnknown7800692MKO/TamiMinko RatMKO rat is derived from Wistar male rat which exhibited large-size and abnormal lipid metabolism.inbredLive Animals; Cryopreserved Embryo7800694NER.F344-(<i>D1Rat132</i>)(<i>D5Rat100</i>)/KyoDeveloped by the DEPOSITORcongenicUnknown7800702KHR/Kyo<sup>-/-</sup>kaken hairless ratKaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).mutantCryopreserved Embryo; Cryopreserved SpermDermatologyOca223184127800705KHR/Kyo<sup>-/+</sup>kaken hairless ratKaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).mutantCryopreserved Embryo; Cryopreserved SpermDermatologyOca223184128142383SHRSP/BbbUtxAnimals transferred from Harvard University/Brigham (Dr Klaus Lindpaintner) originating from SHRSP colony at University of HeidelberginbredUnknown8142385SHR/UtxAnimals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974inbredUnknown8547938CrljJcl:SDSprague-Dawley from Charles River Laboratory Japan, to CLEA Japan, Inc.outbredLive Animals (as of 2021-04-22)8548794F344-Tg(NC1-269B17)1NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicCryopreserved SpermCasp322758548809F344-Tg(NC1-269B17)2NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicCryopreserved SpermCasp322758548812F344-Tg(NC1-269B17)3NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicCryopreserved SpermCasp322758548815F344-Tg(NC1-269B17)4NkgBAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.transgenicCryopreserved SpermCasp322758548817KDP.PVG-RT1<sup>a/u</sup>/NyoMHC haplotype (RT1.B<i>a</i>D<i>a</i>) of PVG.R23 was transferred onto the genetic background of KDP/Tky strain (RT1.B<i>u</i>D<i>u</i>). This allele has been maintained in heterozygous condition. Backcrossing has started since 2003 and afterwards maintained by sib matingcongenicCryopreserved SpermDiabetes Obesity8549599BN.LEW-(<i>D10Rat32-D10Rat133</i>)/CimlCongenic strain created from parental BN/Rj and LEW/Rj strains.congenicUnknown8549776F344-<i>Lep<sup>m1Kyo</sup></i>F344 OB ratEstablished by ENU mutagenesis in F344/NSlc rats. This strain has Lep missense mutation (Q92X).mutantLive Animals (as of 2017-03-17)Diabetes ObesityLep|Lep<sup>m1Kyo</sup>3000|127929638549778PVG.KDP-<i>Cblb<i>/NyoPVG.KDP-Cblb congenicDeveloped by the DEPOSITORcongenicCryopreserved EmbryoDiabetes ObesityCblb6205358549779DRU/UubcThe mutant rat showing microphthalmia was found in the colony of Donryu rats at Central Institute for Experimental Animals in 1974. A pair of F3 rats was transferred to The Third Department for Anatomy, School of Medicine, Chiba University in 1975 and maintained by sib mating. F50 rats were transferred to Faculty of Agriculture, Utsunomiya University by Dr. S Sugita in 1991inbredCryopreserved Embryo8549782SD.Gunn-<i>Ugt1a1<sup>j</sup></i>/AonDeveloped by the DEPOSITORcongenicCryopreserved Sperm (as of 2017-09-15)Neurobiology; MetabolismUgt1a1|Ugt1a1<sup>j</sup>3935|134320648549785W.Gunn-<i>Ugt1a1<sup>j</i></sup>/AonDeveloped by the DEPOSITORcongenicUnknownNeurobiology; MetabolismUgt1a1|Ugt1a1<sup>j</sup>3935|134320648549798WMS/SimNcpMunich, Germany from Wistar stock selectively bred for superficial glomeruli. To Simonsen Labs, CA via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Transferred at Nigata University from Simonsen Laboratory in 2005. at Niigata UniversityinbredCryopreserved Embryo8551711SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551714SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D10Chm246-D10Chm257</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D10Chm246-D10Chm257</i>)/AydcongenicUnknown8551716SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D16Chm48-D16Chm60</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydcongenicUnknown8551718SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D16Chm48-D16Chm60</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydcongenicUnknown8551721SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551723SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8551725SS.LEW-(<i>D8Chm12-D8Rat15</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Chm12-D8Rat15</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8551727SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8551730SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551732SS.LEW-(<i>D17Chm131-D17Chm93</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551734SS.LEW-(<i>D17Chm131-D17Chm93</i>)(<i>D17Rat84-D17Chm17</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D17Rat84-D17Chm17</i>)/AydcongenicUnknown8551737SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551739SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8551742SS.LEW-(<i>D16Chm48-D16Chm60</i>)(<i>D18Rat101-D18Rat92</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat101-D18Rat92</i>)/AydcongenicUnknown8551748SS.LEW-(<i>D3Rat17-D3Mco80</i>)(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat17-D3Mco80</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8551750SS.LEW-(<i>D1Uia4-D1Rat320</i>)(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.LEW-(<i>D1Uia4-D1Rat320</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551752SS.LEW-(<i>D1Rat320-D1Mgh32</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551755SS.LEW-(<i>D1Chm64-D1Rat19</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Chm64-D1Rat19</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551757SS.LEW-(<i>D7Uia3-D7Mgh1</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D7Uia3-D7Mgh1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551759SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551761SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Got112-Igfbp4</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Got112-Igfbp4</i>)/AydcongenicUnknown8551763SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8551766SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551772SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551774SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydcongenicUnknown8551776SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8551778SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D3Rat2-D3Chm79</i>)/AydA double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D3Rat2-D3Chm79</i>)/AydcongenicUnknown8551782SS.LEW-(<i>D18Chm90-D18Chm4</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown8551785SS.LEW-(<i>D18Wox7-D18Rat67</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown8551787SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown8551789SS.LEW-(<i>D18Chm59-D18Rat1</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown8551864DA.LEW.1AV1-(<i>D4Mgh17-D4Mgh21</i>)/KiruLEW.1AV1/Kini allele is introgressed into the DA/ZtmKini rats.congenicUnknown8551866LEW.1AV1.DA-(<i>D4Mgh17-D4Rat203</i>)/KiruDA/ZtmKini allele is introgressed into the LEW.1AV1/kini rats.congenicUnknown8551868PVG.1AV1.DA-(<i>D4Mgh17-D4Rat84</i>)/KiruDA/ZtmKini allele is introgressed into the PVG.1AV1/Kini rats.congenicUnknown8551872DA.PVG.1AV1-(<i>D4Rat155-D4Rat113</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551874DA.PVG.1AV1-(<i>D4Rat63-D4Rat84</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551876DA.PVG.1AV1-(<i>D4Rat203-D4Got130</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551880DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551882DA.PVG.1AV1-(<i>D4Rat203-D4Mit22</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551885DA.PVG.1AV1-(<i>D4Mit22-D4Rat84</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551887DA.PVG.1AV1-(<i>D4Got126-D4Rat203</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551889DA.PVG.1AV1-(<i>D4Rat62-D4Got136</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8551892DA.PVG.1AV1-(<i>D4Rat113-D4Rat62</i>)/KiruCongenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.congenicUnknown8552235SD-Tg(Pbsn-TAg)1ObsSV40 Large T Antigen along with Rat probasin promotertransgenicCryopreserved Sperm (as of 2017-08-17)Pbsn7085718552237WI-Tg(Nanog-GFP-PuroR)22Kyomouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performancetransgenicLive Animals8552239F344.WI-Tg(Nanog-GFP-PuroR)KyoWI-Tg(Nanog-GFP-puro-R)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic backgroundtransgenicCryopreserved Sperm8552242ETR/EisEisai Turning RatDeveloped by the DEPOSITORinbredCryopreserved EmbryoBehavior8552244SD-Tg(Dsp-mCherry-DTR)JflnThis rat carries a transgene consisting of the Dsp promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. Red fluorescence can be detected from the skin of the animals but not the brain.transgenicCryopreserved Sperm8552247SD-Tg(Neurod6-mCherry-DTR)JflnThis rat carries a transgene consisting of the NeuroD6 promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. This model is yet to be validated.transgenicCryopreserved Sperm (as of 2017-08-17)8552249SD-Tg(Camk2a-FLPo)JflnThis transgene consists of approximately 6kb of the CamK2a promoter followed by a gene encoding FLP, optimised for mamalian exprssion (FLPo). This rat remains unvalidated.transgenicCryopreserved Sperm (as of 2017-08-16)8552252ACI.BUF-<i>Aftm1</i>/2MnaThis congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.congenicCryopreserved Embryo8552255LAP/Hshyolow alcohol preference ratDeveloped by the DEPOSITORinbredCryopreserved Embryo8552257HAP/Hshyohigh alcohol preference ratDeveloped by the DEPOSITORinbredCryopreserved Embryo8552259F344-<i>Ldlr<sup>m1Kyo</i></sup>/TaDeveloped by the DEPOSITORmutantCryopreserved Embryo8552261WIAR.MPR-<i>Arsb<sup>abd</i></sup>/NcchdDeveloped by the DEPOSITORmutantCryopreserved EmbryoOsteology; MetabolismArsb|Arsb<sup>MPR</sup>2158|127929678552267SHRSP.WKY-(<i>D1Rat116-D1Wox10</i>)/TkyoDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity8552269SHRSP.WKY-(<i>D1Tkyo58-D1Rat90</i>)/TkyoDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity8552271SHRSP.WKY-(<i>D1Rat27-D1Wox18</i>)/TkyoDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity8552273SHRSP.WKY-(<i>D1Tkyo57-D1Wox18</i>)/TkyoDeveloped by the DEPOSITORcongenicCryopreserved SpermDiabetes Obesity8552275F344-<i>Lgi1<sup>m1Kyo</sup></i>Developed by gene driven ENU mutagenesis in F344/NSlc rats. Lgi1-mutant rats carrying a missense mutation (c.1154 T > G)(L385R).mutantCryopreserved Sperm (as of 2017-03-17)Lgi1|Lgi1<sup>m1Kyo</sup>628742|127929708552279WI-Tg(Per1-luc)YlabThe original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferasetransgenicCryopreserved Sperm8552285F344.WI-Tg(Per1-luc)YlabThe original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferasetransgenicCryopreserved Sperm8552287F344.WIC-Tg<i><sup>rdw</i>Kts</sup>This is a F344 congenic carrying Tgrdw derived from WIC-Tgrdw/Kts. WIC-Tgrdw/Kts was established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive.congenicCryopreserved Sperm (as of 2017-04-27)Metabolism8552289A5M/KhosDeveloped by the DEPOSITORinbredCryopreserved EmbryoMetabolism8552293SR/JrSeacDahl Salt-ResistantSubstrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRPinbredCryopreserved Embryo; Cryopreserved SpermCardio- Hypertension8552296UPL/CasTakeuSubstrain of UPLinbredCryopreserved EmbryoOphthalmology8552298DA-<i>Tyr<sup>em1Kyo</i></sup>The strain having a Endonuclease-induced 29-bp deletion mutation in Tyr gene was established by TALENs combined with Exonuclease 1.mutantCryopreserved Sperm (as of 2017-03-17)Behavior; DermatologyTyr|Tyr<sup>em1Kyo</sup>1589755|127929728552303DA-<i>Tyr<sup>em2Kyo</i></sup>Developed by the DEPOSITORmutantLive Animals; Cryopreserved SpermBehavior; Dermatology8552309ODUS/OduThe mutant rat showing spontaneous gingivitis was found in the colony of WKY rats in 1972. The inbred strain was established in 1991.inbredCryopreserved Embryo8552311ODUR/OduThis inbred strain was established from WKY rats as a control for ODUS/Odu.inbredCryopreserved Embryo8552313DA.PVG.1AV1-(<i>D10Rat81-D10Rat238</i>)/KiniDA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.congenicCryopreserved SpermNeurobiology8552315W-Tg(Thy1-COP4/YFP*)4JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.transgenicCryopreserved SpermOphthalmology; Otorhinology8552317W-Tg(Thy1-COP4/YFP*)5JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.transgenicCryopreserved SpermOphthalmology; Otorhinology8552319W-Tg(Thy1-COP4/YFP*)6JfhyThe transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.transgenicCryopreserved SpermOphthalmology; Otorhinology8552321SHR-Tg(APOC3-CETP)1TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC3 promoter into SHR/Izm rat fertile eggs.transgenicCryopreserved EmbryoDiabetes Obesity; Neurobiology8552323SHR-Tg(APOC3-CETP)2TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.transgenicCryopreserved SpermDiabetes Obesity; Neurobiology8552325SHR-Tg(APOC3-CETP)3TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC5 promoter into SHR/Izm rat fertile eggs.transgenicCryopreserved SpermDiabetes Obesity; Neurobiology8552327SHR-Tg(APOC3-CETP)4TkyoThe transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.transgenicCryopreserved SpermDiabetes Obesity; Neurobiology8552329W-Tg(Nqo1)KopThe transgenic rats were established by injection of transgene consisting of NAD(P)H quinone oxidoreductase 1 gene derived from a DA/Slc rat strain into Wistar rat fertile eggs.transgenicCryopreserved SpermOncology; Metabolism8552331F344-<i>Il2rg<sup>em7Kyo</sup></i>The strain having a Endonuclease-induced 7 bp deletion mutation in the 2nd exon of the rat Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University.mutantUnknownHematology; ImmunologyIl2rg<sup>em7Kyo</sup>136287328552337DA.PVG.1AV1-(<i>D10Got406-D10Rat93</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Animals for congenic breeding were selected from the 10th generation of an advanced intercross line (AIL) originating from the EAE-susceptible DA and EAE-resistant PVG.1AV1 rat strains. Selected males containing a PVG.1AV1 fragment in the Eae18b region (from OT24.18 to D10Rat93 marker, at 68.36 Mb and 81.9 Mb, respectively) were backcrossed with DA females for 8 generations, and offspring was genotyped using microsatellite markers in each generation. In the 8th generation, heterozygous males and females were crossed to obtain the experimental population of homozygous congenic rats and littermate controls.congenicCryopreserved SpermNeurobiology8552341DA.PVG.1AV1-(<i>D10Got6-D10Rat184</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by transfer of the defined Vra4 segment selected from male donors of G8 generation of a DAxPVG1.AV1 andvanced intercross line. Subsequential backcrossing for 9 generations.congenicCryopreserved SpermNeurobiology8552346DA.PVG.1AV1-(<i>D4Rat107-D4Got132</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by selective transferring of PVG alleles in the interval between D4Rat137 and D4Kiru157 onto DA background in minimum of 13 backcross generations.congenicCryopreserved SpermNeurobiology8552348DA.PVG.1AV1-(<i>D13Rat105-D13Rat131</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). The congenic line was established from DA and MHC-identical PVG.A rats using a speed-congenic approach with marker assisted selection. DA females were mated with male offspring selected from F2 (DAxPVG.A) with heterozygote alleles within chromosome 13 and Eae34 QTL interval and with the lowest PVG.A background contamination using 96 microsatellite markers equally spaced throughout the genome (at 20 centimorgan cM intervals). A breeding pair selected from the N7 generation were crossed for two generations to produce homozygous DA.PVG-Eae34 congenic rats.congenicCryopreserved SpermNeurobiology8552351DA.PVG.1AV1-(<i>D9Wox24-D9Rat44</i>)/KiniInbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Briefly, in each backcross generation, rats for further breeding were selected on the basis of genotyping of 8 microsatellite markers in the congenic region, from marker D9Wox24 to D9Rat20. The genetic background of rats was also screened with 100 markers. After the complete removal of the donor genome outside the congenic fragment, two heterozygous rats were intercrossed to produce the homozygous strains DA.BN-Eae4(N7F1). Subsequently, interval-specific recombinants were bred from an F2 breeding. R25 recombinant was established in 2003.congenicCryopreserved SpermNeurobiology8552364WI-Tg(L2-Venus)NipsThe construct contains CAG--lox P--Neo-pA--lox P--Venus--pA (4.3 kb) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotestransgenicUnknown8552366WI-Tg(CAG-cre)NipsThe construct contains CAG--NLS-Cre--pA (3.3 kb)which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotestransgenicUnknown8552368WI-Tg(CAG-Venus)NipsThe construct contains L2-Venus ÿ CAG-Cre (CAG--lox P--Venus--pA (3.1 kb)) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotestransgenicUnknown8552371WDB-<i>ROSA26<sup>em1(RT2)Nips</sup></i>This strain was produced by knock-in in the rat Rosa26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain.mutantUnknown8552996F344/Arcsubstrain of F344 bred at Animal Resources Centre AustraliainbredUnknown8553001ArcCrl:CD(SD)substrain derived from Crl:CD(SD); IGS refers to animals bred using the CRL International Genetic Standard system.outbredUnknown8553003ArcCrl:WIWistar ratsFrom Charles River to Animal Resources Centre, AustraliaoutbredUnknown8553005BN/RijHsdArcTo Animal Resources Centre, Australia from Harlan.inbredUnknown8553006DA/Arcsubstrain of DA bred at Animal Resources Centre, AustraliainbredUnknown8553008LEW/CrlArcLewisDeveloped by Dr. Lewis from Wistar stock in the early 1950s. To Animal Resources Centre, Australia from Charles RiverinbredUnknown8553010PVG/Arcsubstrain of PVG maintained at Animal Resources CentreinbredUnknown8553013SHR/NCrlArcTo Animal Resources Centre from Charles RiverinbredUnknown8553015WKY/NCrlArcTo Animal Resources Centre from Charles RiverinbredUnknown8553187FHH.BN(<i>D14Rat98-D14Hmgc4</i>)/Mcwidesired segments from BN were introgressed in FHH backgroundcongenicUnknown8655639WAG/NovSubstrain of WAG, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk)inbredUnknown8655660WAG.OXYS-(<i>D1Rat30-D1Rat219</i>)/Novdesired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/NovcongenicUnknownCic|Arhgap331310706|23183748655663WAG.OXYS-(<i>D1Rat219-D1Rat81</i>)/Novdesired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/NovcongenicUnknownSnurf|Ifit1|Zp2|Gtf3c1|Col17a169269|620599|620605|621048|13111308655977W-<i>Lepr</i><sup>+/+</sup>/NinWistar NIN leanThe lean litter mates of WNIN-Ob (W-LeprfaNin, RGD:8655992). Both are derived from the inbred stock of Wistar rats (W/NIN) dating back to 1920 at National Institute of Nutrition (NIN), Hyderabad, India.inbredUnknown8655992W-<i>Lepr</i><sup>faNin</sup>The spontaneously developed obese rat was derived from the colony of inbred W/Nin by selective breeding. Its lean litter mate ( W-Lepr+/+/Nin, RGD:8655977) was used as a control strain in obesity related study.mutantUnknown8657051F344/NinSubstrain of F344 maintained at National Institute of Nutrition (NIN), Hyderabad, India.inbredUnknown8657079SS.LEW-(<i>D18Chm124-D18Chm126</i>)/AydSS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown8657135SS.LEW-(<i>D10Chm280-D10Chm216</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/AydcongenicUnknown8657348SS.LEW-(<i>D17Chm131-D17Chm93</i>),MNS-(<i>D2Rat155-D2Chm161</i>),LEW-(<i>D18Chm41-D18Rat92</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd, SS.MNS-(<i>D2Rat155-D2Chm161</i>)/Ayd and SS.LEW-(<i>D18Chm41-D18Rat92</i>)/AydcongenicUnknown8657351SS.MNS-(<i>D2Chm366-D2Rat52</i>),LEW-(<i>D18Rat61-D18Rat45</i>),LEW-(<i>D10Chm128-D10Chm121</i>)/AydA triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm366-D2Rat52</i>)/Ayd, SS.LEW-(<i>D18Rat61-D18Rat45</i>)/Ayd and SS.LEW-(<i>D10Chm128-D10Chm121</i>)/AydcongenicUnknown8657361SS.MNS-(<i>D2Chm254-D2Chm161</i>),LEW-(<i>D10Chm246-D10Chm257</i>),LEW-(<i>D16Chm48-D16Chm60</i>),LEW-(<i>D18Rat55-D18Mgh2</i>)/AydA congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm254-D2Chm161</i>)/Ayd, SS.LEW-(<i>D10Chm246-D10Chm257</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/AydcongenicUnknown8657392SS.LEW-(<i>D10Rat155-D10Chm171</i>)/AydA sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.congenicUnknown8657399SS.MNS-(<i>D2Chm214-D2Chm302</i>)/AydCongenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.congenicUnknown8657402SS.LEW-(<i>D3Rat52-D3Chm57</i>),MNS-(<i>D2Chm214-D2Chm302</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydA triple congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Chm57</i>)/Ayd, SS.MNS-(<i>D2Chm214-D2Chm302</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydcongenicUnknown8661233SS-TgTn(T2GFP)53McwiThis strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 15 near 35.6 Mb (rn4)transgenicUnknown8661234SS-TgTn(T2ePet-eGFP)11McwiThis strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a serotonergic neuron-specific ePet1 promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 7 near 123.8Mb (rn4)transgenicUnknown8661235FHH-TgTn(T2/Rab38)1McwiThis strain was made by pronuclear microinjection of a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving the Brown Norway allele cDNA for Rab38 along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 14 near 13.2 Mb (rn4)transgenicUnknownRab386287528662449LOU/MBbbLOU/M strain maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, GermanyinbredUnknown8662861LOU.BN-(<i>D5Rat59-D5Rat133</i>)/Bbbthe desired chromosomal segment from BN/Rj was introgressed into the genetic background of LOU/MBbbcongenicUnknown8662874LOU.BN-(<i>D5Rat59-D5Rat127</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(<i>D5Rat59-D5Rat133</i>)/Bbb to LOU/MBbbcongenicUnknown8662878LOU.BN-(<i>D5Rat59-D5Rat125</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenicUnknown8662925LOU.BN-(<i>D5Rat59-rs13448399</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenicUnknown8662933LOU.BN-(<i>rs65016308-D5Rat133</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenicUnknown8662955LOU.BN-(<i>rs13448399-D5Rat133</i>)/Bbbthis congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenicUnknown8662958LOU.BN-(<i>D5Rat59-rs13448399</i>)/Bbb-/+this heterozygous congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbbcongenicUnknown8663453BN.ACI-(<i>D14Uwm4-D14Rat39</i>)/ShulThis congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.congenicUnknown8663455BN.ACI-(<i>D14Uwm1-D14Uwm5</i>)/ShulThis congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.congenicUnknown8663458ACI.BN-(<i>D7Rat164-D7Rat142</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicCryopreserved Sperm (as of 2017-09-07)mammary cancer8663462ACI.BN-(<i>D7Uwm32-D7Uwm43</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicCryopreserved Sperm (as of 2017-09-07)mammary cancer8663464ACI.BN-(<i>D7Uwm33-D7Uwm43</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicLive Animals (as of 2017-09-07)mammary cancer8693598LE-Tg(DIO-mCherry)2OttcThe transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter.transgenicCryopreserved Sperm; Cryorecovery9586448SHR/NCrlPrinSubstrain of SHR originally from Charles River now maintained at University of CaliforniainbredUnknown9586450SHR/OlaIpcvPrinThese are substrains of SHR from Czech Academy of Sciences now maintained at University of CaliforniainbredUnknown9587464SD-Tg(UBC-DsRedT3-emGFP)18NarlSD-Tg(UBC-DsRedT3-emGFP)18This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.transgenicLive AnimalsUBC13468539587466SD-Tg(UBC-cre/ERT2)7NarlThis strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter.transgenicCryopreserved Embryo (as of 2017-05-31)UBC13468539587470SD-Tg(UBC-DsRedT3-emGFP)26NarlThis strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.transgenicCryopreserved EmbryoUBC13468539587473SD-Tg(UBC-emGFP)18NarlThis strain was produced by microinjection of UBC-cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)18NarltransgenicLive AnimalsUBC13468539587475SD-Tg(UBC-DsRed-GFP)(Col1a(5A)-cre)NarlThis strain was produced by microinjection of Col1a(5A)-Cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)26Narl. As loxP-flanked DsRed is removed by Col1a(5A) promoter-driven Cre recombinasetransgenicUnknown9587825BN/SsNNarlImported from NIH, now maintained at National Laboratory Animal Center, TaiwaninbredLive Animals (as of 2018-03-28)9587827F344/NNarlImported from NIH, now maintained at National Laboratory Animal Center, TaiwaninbredLive Animals (as of 2018-03-28)9587829LEW/SsNNarlImported from NIH in 1995, now maintained at National Laboratory Animal Center, TaiwaninbredLive Animals (as of 2018-03-28)9587831SHR/NCrlNarlImported from NIH in 2000, now maintained at National Laboratory Animal Center, TaiwaninbredLive Animals (as of 2018-03-28)9587833WKY/NCrlNarlImported from NIH in 2000, now maintained at National Laboratory Animal Center, TaiwaninbredLive Animals (as of 2018-03-28)9587835CrlNarl:LEImported from Charles River in 1997, now maintained at National Laboratory Animal Center, TaiwanoutbredLive Animals (as of 2018-03-28)9588294CrljKwl:SDSprague-Dawley from Charles River Laboratory Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1985; these were turned into SPF by caesarean sectionoutbredUnknown9588298Kwl:LELong Evans from Sasaki Institute, Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1971; these were turned into SPF by caesarean sectionoutbredUnknown9588544SHR-<i>Ndufc2<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Ndufc2<sup>em1Mcwi</sup>95885379588546SHR-<i>Ndufc2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1.mutantCryopreserved Sperm (as of 2017-01-26)Ndufc2<sup>em2Mcwi</sup>95885419588552SD-<i>Nfe2l2<sup>em1Mcwi</sup></i>This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.mutantLive Animals (as of 2017-01-26)Nfe2l2<sup>em1Mcwi</sup>95885499588559LE-Tg(DIO-iRFP)3OttcThe transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter.transgenicCryopreserved Sperm; Cryorecovery9588570LE-Tg(cFos-eGFP)2OttcThe transgene contains reporter rat expressing eGFP in cFos expressing cellstransgenicUnknown9588572LE-Tg(Slc6a3-icre)1OttcThe transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neuronstransgenicUnknowndopamine neurons in drug abuse or neurodegeneration9588576LE-Tg(Slc6a3-icre)5OttcThe transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neuronstransgenicUnknown9588578LE-Tg(Slc6a3-icre)6OttcThe transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neuronstransgenicLive Animals (as of 2017-05-31)neurodegeneration9588581LE-Tg(cFos-LacZ)1OttcThe transgene contains reporter rat expressing beta-galactosidase in cFos expressing cellstransgenicUnknown9588583LE-Tg(cFos-TetO-iCre)4OttcThe transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressortransgenicUnknown9588585LE-Tg(cFos-TetO-iCre)6OttcThe transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressortransgenicUnknown9588587LE-Tg(EF1a-TetR)1OttcThe transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectorstransgenicUnknown9588589LE-Tg(EF1a-TetR)2OttcThe transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectorstransgenicUnknown9588591LE-Tg(Gad1-iCre)2OttcThe transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neuronstransgenicExtinct (as of 2019-02-01)9588593LE-Tg(Gad1-icre)3OttcThe transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neuronstransgenicLive Animals (as of 2019-02-28)9588595LE-Tg(Slc6a5-icre)1OttcThe transgene expresses BAC transgenic using rat GlyT2 promoter to express Cre recombinase in glycinergic neuronstransgenicUnknown9589088ACI.COP-(<i>D3Rat130-D3Rat114</i>)(<i>D6Rat80-D6Rat146</i>)/ShulThis congenic strain contains regions of COP/CrCrl chromosome 3 and COP/CrCrl chromosome 6 transferred to the ACI/SegHsd strain background.congenicCryorecovery (as of 2019-02-26)9590284SS-Tg(ApoC3-CETP)25OpazSS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promotertransgenicCryopreserved Sperm (as of 2019-02-05)9685623SD-<i>Pax6<sup>Sey2</sup></i>/MceThis rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.)Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift.mutantCryopreserved Sperm (as of 2017-02-23)Pax6<sup>Sey2</sup>127909709685625F344-<i>Il2rg<sup>em1Kyo</sup></i>The strain having a zinc finger nuclease-induced 660-bp deletion mutation in Il2rg gene shows severe combined immunodeficiency and grows normally under SPF condition.mutantCryopreserved Sperm (as of 2017-03-27)ImmunologyIl2rg<sup>em1Kyo</sup>127985609685748F344-<i>Il2rg<sup>em2Kyo</sup></i>The severe combined immunodeficiency strain carries a zinc finger induced 1097-bp deletion mutation of Il2rg gene created in the F344/Stm embryos.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-27)ImmunologyIl2rg<sup>em2Kyo</sup>127985619685750F344-<i>Il2rg<sup>em3Kyo</sup></i>This strain shows severe combined immunodeficiency caused by a 332 bp deletion in Il2rg gene and grow normally under SPF condition.mutantUnknownImmunologyIl2rg<sup>em3Kyo</sup>134643409685752TM-<i>Il2rg<sup>em4Kyo</sup></i>The severe combined immunodeficiency strain carries a zinc finger nuclease-induced 162-bp deletion mutation in rat Il2rg gene. Grows normally under SPF condition.mutantUnknownImmunologyIl2rg<sup>em4Kyo</sup>134643399685754TM-<i>Il2rg<sup>em5Kyo</sup></i>This strain shows severe combined immunodeficiency caused by a zinc finger nuclease induced 653-bp deletion in Il2rg gene of TM/Kyo embryo. The rats grow normally under SPF condition.mutantUnknownImmunologyIl2rg<sup>em5Kyo</sup>129100999685755W-Tg(tetO-Pou5f1,-Klf4,-Sox2,Ubc-rtTA,-EGFP)T1-3HinaDoxycycline induced mouse Oct3/4, Klf4, Sox2/ Ubc-promoter EGFP was introduced into embryonic fibroblast of Wistar rat (Slc:Wistar)by replication incompetent type lentivirus vector and iPS cells were induced. Chimeric rats (male) were generated from this iPS cells, and crossed with the wild-type Wistar rat (female).transgenicCryopreserved EmbryoDevelopment9685757W-<i>Il2rg<sup>em1Hina</sup></i>This strain was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar)mutantCryopreserved Embryo (as of 2017-03-27)ImmunologyIl2rg<sup>em1Hina</sup>127985629685759LEW.WKY-(<i>D13Arb15-D13Rat77</i>)(<i>D16Rat40-D16Rat88</i>)/TjaSegment of interest from chr 13 and chr 16 of WKY/NCrl were introgressed into LEW/SsNHsdcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)9685785SS.LEW-(<i>D1Mco36-D1Mco54</i>)/BjThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown9685787SS.LEW-(<i>D1Mco36-D1Rat200</i>)/BjThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown9685791SS.LEW-(<i>D1Mco36-D1Mco61</i>)/BjThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown9685793SS.LEW-(<i>D1Rat200-D1Mco136</i>)/BjThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown9685795SS.LEW-(<i>D1Mco55-D1Wox6</i>)/BjThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown9685797SS.LEW-(<i>D1Mco134-D1Wox6</i>)/BjThis is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant regioncongenicUnknown9831158Y59/ZgdStrain developed by Prof. Borislav Nakic, Prof. Silobrcic and Prof. Andrija Kastelan from outbred Wistar rats during 1960s, maintained at Department of Animal Physiology,Faculty of Science, University of Zagreb, Republic of CroatiainbredLive Animals (as of 2020-10-05)Immunology and transplantational research9835401ZDF-<i>Lepr<sup>m1Rll</sup></i>The Zucker rats from Charles River (ZDF-<i>Lepr<sup>fa</sup></i>/Crl) carry the Lepr<sup>m1Rll</sup> allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269mutantUnknownLepr<sup>m1Rll</sup>98354009835403WDF-<i>Lepr<sup>m1Rll</sup></i>The WDF colony at Vassar College (WDF/Vc) carry the Lepr<sup>m1Rll</sup> allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269mutantUnknownLepr<sup>m1Rll</sup>98354009854707SHR.WKY-(<i>D4Rat143-D4Rat10</i>)/TjaThis congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCrukcongenicUnknownInsulin Resistance9854709SHR.WKY-(<i>D12Rat1-D12Mit3</i>)/TjaThis congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCrukcongenicUnknownInsulin Resistance, Hypertension9854711SHR.WKY-(<i>D16Rat88-D16Rat15</i>)/TjaThis congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCrukcongenicUnknownInsulin Resistance9999141IRL/NCrThe IRL/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production programinbredUnknownPulmonary hypertension9999143LOU/MNCrThe NCI Animal Production Program received this rat strain from NIH in 1987 for production and distribution of the LOU/MNCr rat straininbredUnknown9999145F344/NCrThe F344/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production programinbredUnknownPhenylketonuria10002743DA.E3-(<i>D20Rat42-D20Rat49</i>)/RhdA fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd.congenicUnknown10002745DA.E3-(<i>D20Rat47-AA858870</i>)/RhdA fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd.congenicUnknown10002782SHR-<i>Sbf1<sup>m1Ipcv</i></sup>Spontaneous mutation in the colony of SHR/OlaIpcv in Prague.mutantUnknownSbf1<i><sup>m1Ipcv</sup></i>1000275510002787SD-<i>Krt71<sup>m1Yuyi</i></sup>Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified.mutantUnknownKrt71<i><sup>m1Yuyi</sup></i>1000278510002791SD-<i>Fah<sup>em3Mcwi</sup></i>This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3.mutantCryorecovery (as of 2017-07-18)Fah<sup>em3Mcwi</sup>1000279010002794SD-<i>Il2rg<sup>em2Mcwi</sup></i>This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2.mutantLive Animals (as of 2017-01-26)Il2rg<sup>em2Mcwi</sup>1000279210043120BBDP.ACI-(<i>D2Mit8-D2Rat69</i>)/Sunn104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm32congenicUnknown10043122BBDP.ACI-(<i>D2Mit8-D2Arb16</i>)(<i>D2Rat354-D2Rat69</i>)/Sunn104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>)(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm32 the region from D2Rat99 and D2Rat354 is from the background ACI straincongenicUnknown10043124BBDP.ACI-(<i>D2Mit8-D2Arb16</i>)/Sunn104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm32congenicUnknown10043127BBDP.ACI-(<i>D2Mit8-D2Rat354</i>)/Sunn104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm32congenicUnknown10043129BBDP.ACI-(<i>D2Arb16-D2Rat63</i>)/Sunn104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm26congenicUnknown10043132BBDP.ACI-(<i>D2Rat50-D2Rat63</i>)/Sunn104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm26congenicUnknown10043368NER.F344-(<i>D3M2Mit327-D3Arb10</i>)/KyoThe chromosome 3 region (D3M2Mit327-D3Arb10) was introgressed from F344/NSlc to NER/Kyo by backcrossing.(Sep 12, 2012)congenicCryopreserved SpermNeurobiology10043382F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)<i>Lgi1<sup>m1</sup></i>/KyoTriple congenic rat made by mating F344.NER-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Mgh4-D5Rat36</i>)/Kyo and F344-Lgi1m1Kyo.congenicCryopreserved SpermNeurobiologyLgi162874210043385F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)<i>Scn1a<sup>m1</sup></i>/KyoTriple congenic rat made by mating F344.NER-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Mgh4-D5Rat36</i>)/Kyo and F344-LScn1am1Kyo.congenicCryopreserved SpermNeurobiologyScn1a6936410043617SPRD-<i>Anks6<sup>PKD</sup></i>/FsnThis strain rats was provided to University of Kansas from Central Institute for Laboratory Animal Breeding (Hanover, Germany), and then was introduced to Fujita Health University.mutantCryopreserved Sperm (as of 2018-04-20)Anks6<sup>PKD</sup>1153499610043620SHRSP.WKY-(<i>D1Smu13</i>)/IzmThis congenic strain was made by introducing chromosome 1 region (D1Smu13) of WKY into SHRSP/Izm.congenicCryopreserved SpermCardio Hypertension10043791SHRSP.SHR-(<i>D1Mgh5-D1Rat213</i>)/Izmmale SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/IzmcongenicCryopreserved SpermCardio-Hypertension10043794WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)/IzmA congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm.congenicCryopreserved SpermCardio-Hypertension10043808WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)(<i>D4Mgh7-D4Rat68</i>)/IzmA congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm.congenicCryopreserved Embryo; Cryopreserved SpermCardio-Hypertension10043811SHRSP.MES-<i>Cyba<sup>MES</sup></i>/IzmA congenic strain made by introducing a genetic locus of Cyba from Matsumoto Eosinophilic Shinshu (MES/Slc) rat into SHRSP/Izm rat.congenicCryopreserved SpermCardio-Hypertension10043813SHR/HktIzmSHR/Kyushu rat (Kyushu University) was delivered to Shimane University in 2000 and maintained as inbred.inbredCryopreserved Embryo; Cryopreserved SpermCardio-Hypertension10043816LEA-Tg(Pou5f1-YFP*)3NccoProvided from Kyoto Bioresource center.transgenicCryopreserved SpermOncology, Development10043826SHR/KpoSpontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963.mutantCryopreserved Embryo; Cryopreserved SpermCardio-Hypertension10043828SHR/2KpoSpontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963.mutantCryopreserved Embryo; Cryopreserved SpermCardio-Hypertension10044232SHRSP/KpoOkamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat.inbredCryopreserved Embryo; Cryopreserved SpermCardio-Hypertension10045545CDS/SaszCohen diabetic-sensitive ratOriginal breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony.inbredUnknown10045548CDR/SaszCohen diabetic-rssistant ratOriginal breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony.inbredUnknown10045576SHRSP/2KpoOkamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat.inbredCryopreserved Embryo; Cryopreserved SpermCardio-Hypertension10045578MSHRSP/KpoOkamoto et al. found that a few rats developed higher blood pressure (over 230 mmHg) at 10 weeks old. They selected SHRSP rats that show severe hypertension from young age and M-SHRSP (malignant or precocious SHRSP) rat was established in 1985.inbredCryopreserved EmbryoCardio-Hypertension10045580LE-Tg((ROSA26)Sor-CAG-tdTomato)24JfhyBackground strain: Long Evans | Transgene: CAG-loxP-flanked Neo/STOP cassette-tdTomato was inserted into mouse ROSA26 BAC (RP23 244D9).transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-15)10045582ODURM/OduThis strain shows malocclusion.mutantCryopreserved Embryo; Cryopreserved SpermDentistry10045584SD-Tg(CAG-HRAS*G12V)218HtsuThe transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V(HrasV12)was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc.transgenicCryopreserved EmbryoOncology10045589SD-Tg(CAG-HRAS*G12V)246HtsuThe transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V(HrasV12)was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc.transgenicCryopreserved EmbryoOncology10045590LEA.F344-(<i>D20Rat47-D20Mgh4</i>)/TjLong-Evans Agouti (LEA), type 2 diabetes model, dies from lymphocytic insulitis induced by radiation (4 Gy). This LEA.F344-(D20Rat47-D20Mgh4) strain is a congenic strain made by introducing a segment of chromosome 20 (D20Rat47-D20Mgh4) from F344 strain into LEA strain.congenicCryopreserved SpermDiabetes Obesity10045591F344-<i>Cacna1a<sup>gry</sup></i><i>Scn1a<sup>m1Kyo</sup></i>/OkymGRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) was backcrossed to F344/NSlc, and then crossed to HISS rat (HISS rat has the N1417H mutation in the Scn1a gene) to generate Scn1a/Cacna1a double mutant rats.congenicCryopreserved Sperm (as of 2017-05-05)NeurobiologyCacna1a|Scn1a<sup>m1Kyo</sup>|Cacna1a<sup>gry</sup>2244|12792283|1288038210045593W-<i>Dmd<sup>em1Kykn</sup></i>By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat. The resulting mutation is a 329-bp deletion around exon 3 and 2-bp substitution in exon16.mutantCryopreserved Sperm (as of 2016-12-08)NeurobiologyDmd<sup>em1Kykn</sup>1004559210045597F344-<i>Nfe2l2<sup>em1Kyo</sup></i>Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 7-bp deletion in Nfe2l2 (Nrf2) gene.mutantUnknownNeurobiology; Diabetes ObesityNfe2l2<sup>em1Kyo</sup>1004559410045600F344-<i>Nfe2l2<sup>em2Kyo</sup></i>Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nfe2l2 gene.mutantUnknownNeurobiology; Diabetes ObesityNfe2l2<sup>em2Kyo</sup>1004559810045602W-Tg(CMV-Ddx54)19TsuyThis transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007.transgenicUnknownNeurobiology10045606W-Tg(CMV-Ddx54)37TsuyThis transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007.transgenicUnknownNeurobiology10046035SS.SR-(<i>D13Arb5-D13Arb8</i>)/McwiA region of chromosome 13 containing the renin gene from the Dahl salt-resistant (Dahl R; SR/JrHsd) strain into the SS genetic background (SS/JrHsdMcwi)congenicUnknown10047085SD-<i>Fus<sup>em1Ionsz</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C).mutantUnknownFus<sup>em1Ionsz</sup>1004708410047391LE/OrlBarthLong-Evans/CryptorchidObtained from Centre Nationale de la Researche Scientifique, Orleans, France; then bred at A.I. duPont Hospital for Children Life Science Center, Wilmington, DelawareinbredUnknown10047393SDLEF7/BarthThis hybrid strain was created by interbreeding Crl:SD and Crl:LE for F7 generation.hybridUnknown10053598WI-<i>Foxn1<sup>em1Nips</sup></i>Foxn1 mutation was induced by injecting pX330 espressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97).mutantUnknownFoxn1<sup>em1Nips</sup>1005359610053601WI-<i>Foxn1<sup>em2Nips</sup></i>Foxn1 mutation was induced by injecting pX330 espressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105).mutantUnknownFoxn1<sup>em2Nips</sup>1005359910054231HFJ/Hblacbred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China)inbredUnknown10054233MIJ/Hblacbred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China)inbredUnknown10054235MIJN/Hblacthis strain is derived from MIJ/Hblac, they do not carry the infertile genecoisogenicUnknown10054239DA-<i>Abcd1<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in the exon1 of the Abcd1 gene of DA/OlaHsd rat embryos.mutantCryopreserved Sperm (as of 2018-10-22)Abcd1<sup>em2Mcwi</sup>1005423710054242DA-<i>Abcd1<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Abcd1 gene of DA/OlaHsd rat embryos.mutantExtinct (as of 2016-10-24)Abcd1<sup>em4Mcwi</sup>1005424010054245SS-<i>Adora1<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Adora1 gene.mutantCryopreserved Sperm (as of 2018-10-22)Adora1<sup>em3Mcwi</sup>1005424310054276SD-<i>Vcp<sup>em1Ionsz</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into HismutantUnknownVcp<sup>em1Ionsz</sup>1005427410054279SD-<i>Gfap<sup>em1(2A-Chr2-EYFP)Ionsz</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap.mutantUnknownGfap<sup>em1Ionsz</sup>1005427710054284SS-<i>Adora1<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp deletion in the Adora1 gene.mutantCryopreserved Sperm (as of 2018-10-22)Adora1<sup>em4Mcwi</sup>1005428210054287SS-<i>Adora2a<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp deletion in the Adora2a gene.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Adora2a<sup>em3Mcwi</sup>1005428510054292SS-<i>Arhgef11<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in the Arhgef11 gene.mutantCryopreserved Sperm (as of 2017-01-26)Arhgef11<sup>em4Mcwi</sup>1005428910054296SS-<i>Arhgef11<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene.mutantCryopreserved Sperm (as of 2018-10-22)Arhgef11<sup>em5Mcwi</sup>1005429310054299SS.BN-(<i>D13Rat25-rs106935835</i>)-<i>Btg2<sup>em11Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 16-bp deletion in the Btg2 gene of SS.BN-(<i>D13Rat25-rs106935835</i>)/Mcwi rat embryos.mutantLive Animals (as of 2017-01-26)Btg2<sup>em11Mcwi</sup>1005429710054304SS.BN-(<i>D13Rat25-rs106935835</i>)-<i>Btg2<sup>em13Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 2-bp deletion in the Btg2 gene of SS.BN-(<i>D13Rat25-rs106935835</i>)/Mcwi rat embryosmutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Btg2<sup>em13Mcwi</sup>1005430210054307SS.BN-(<i>D13Rat25-rs106935835</i>)-<i>Btg2<sup>em7Mcwi</sup></i>The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(<i>D13Rat25-rs106935835</i>)/Mcwi rat embryos.mutantUnknown (as of 2020-01-23)Btg2<sup>em7Mcwi</sup>1005430510054310SS-<i>Casr<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Casr gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp (T) insertion in the Casr gene.mutantCryopreserved Sperm (as of 2018-10-22)Casr<sup>em1Mcwi</sup>1005430810054373LEW-<i>Chrna3<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene.mutantUnknown (as of 2018-10-22)Chrna3<sup>em1Mcwi</sup>1005437110054376LEW-<i>Chrna3<sup>em9Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene.mutantCryopreserved Sperm (as of 2018-11-26)Chrna3<sup>em9Mcwi</sup>1005437410054379LEW-<i>Chrna4<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 5-bp deletion in the Chrna4 gene.mutantCryopreserved Sperm (as of 2018-11-26)Chrna4<sup>em4Mcwi</sup>1005437710054383LEW-<i>Chrna4<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna4 gene.mutantCryopreserved Sperm (as of 2018-11-26)Chrna4<sup>em3Mcwi</sup>1005438010054386LEW-<i>Chrna5<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene.mutantCryopreserved Sperm (as of 2018-11-26)Chrna5<sup>em1Mcwi</sup>1005438410054389LEW-<i>Chrna5<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 20-bp deletion in the Chrna5 gene.mutantCryopreserved Sperm (as of 2018-11-26)Chrna5<sup>em2Mcwi</sup>1005438710054398DA-<i>Gla<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene.mutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Gla<sup>em2Mcwi</sup>1005439510054401FHH-Chr 3<sup>BN</sup>-<i>Helz2<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3<sup>BN</sup>/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene.mutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Helz2<sup>em3Mcwi</sup>1005439910054405FHH-Chr 3<sup>BN</sup>-<i>Helz2<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3<sup>BN</sup>/Mcwi rat embryos.The resulting mutation is a 1-bp insertion in the Helz2 gene.mutantCryopreserved Sperm (as of 2018-10-22)Helz2<sup>em4Mcwi</sup>1005440210054408SS-<i>Kcnj10<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Kcnj10 gene.mutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Kcnj10<sup>em1Mcwi</sup>1005440610054411SS-<i>Kcnj10<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp deletion in the Kcnj10 gene.mutantCryopreserved Sperm (as of 2018-10-22)Kcnj10<sup>em3Mcwi</sup>1005440910054414SS-<i>Mmp9<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos.mutantCryopreserved Sperm (as of 2017-01-26)Mmp9<sup>em4Mcwi</sup>1274337810054417SS-<i>Mmp9<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Mmp9 gene.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Mmp9<sup>em6Mcwi</sup>1005441510054420LEW-<i>Mrpl28<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Mprl28 gene of LEW/NCrl rat embryos. The resulting mutation is a 2-bp insertion in the Mrpl28 gene.mutantCryopreserved Sperm (as of 2017-01-26)Mrpl28<sup>em1Mcwi</sup>1005441810054430LEW-<i>Pkd1<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 15-bp deletion in the Pkd1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Pkd1<sup>em2Mcwi</sup>1005442810054433LEW-<i>Pkd1<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene.mutantCryopreserved Sperm (as of 2018-10-22)Pkd1<sup>em3Mcwi</sup>1005443110054436LEW-<i>Pkd1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/Crl rat embryos. The resulting mutation is a 16-bp deletion in the Pkd1 gene.mutantExtinct (as of 2017-01-26)Pkd1<sup>em1Mcwi</sup>1005443410054439LEW-<i>Pkd1<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene.mutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Pkd1<sup>em6Mcwi</sup>1005443710054444LEW-<i>Rorc<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Rorc gene.mutantCryopreserved Sperm (as of 2017-01-26)Rorc<sup>em3Mcwi</sup>1005444210054447LEW-<i>Rorc<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 59-bp deletion in the Rorc gene.mutantCryopreserved Sperm (as of 2017-01-26)Rorc<sup>em5Mcwi</sup>1005444510054450SS-<i>Sirt3<sup>em25Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene.mutantCryopreserved Sperm (as of 2018-10-22)Sirt3<sup>em25Mcwi</sup>1005444810054453SS-<i>Sirt3<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Sirt3<sup>em4Mcwi</sup>1005445110054456T2DN-<i>Sirt3<sup>em35Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene.mutantCryopreserved Sperm (as of 2018-10-22)Sirt3<sup>em35Mcwi</sup>1005445410054459T2DN-<i>Sirt3<sup>em30Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 31-bp deletion in the Sirt3 gene.mutantCryopreserved Sperm (as of 2017-01-26)Sirt3<sup>em30Mcwi</sup>1005445710054462SS-<i>Stk39<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene.mutantCryopreserved Sperm (as of 2017-01-26)Stk39<sup>em5Mcwi</sup>1005446010054465SS-<i>Stk39<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Stk39 gene.mutantCryopreserved Sperm (as of 2017-01-26)Stk39<sup>em6Mcwi</sup>1005446310054473SS.BN-(<i>D13Rat124-D13Hmgc3694</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown10059570WI-<i>Kiss1<sup>tm1Nips</i></sup>This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide. Founder animals were backcrossed to Crlj:WI.mutantUnknownKiss1<sup>tm1Nips</sup>4090286210059573SS-<i>Adora2a<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene.mutantCryopreserved Sperm (as of 2017-01-26)Adora2a<sup>em5Mcwi</sup>1005957110059576WKY-<i>Sik2<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene.mutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Sik2<sup>em4Mcwi</sup>1005957410059635W-Tg(GnRH-GFP)Mnigenerated by Dr. Masugi Nishihara's grouptransgenicUnknown10395226Sim:LELong EvansReceived from Dr. Evans, University of California, Berkeley - Experimental Institute of Biology in 1949. Caesarean rederived in 1997. Selection is based on the black-hooded phenotype.outbredUnknown10395228Sim:WIWistarReceived from the Lobund Institute, University of Notre Dame in 1957. Caesarean rederived in 1997.outbredUnknown10395233Sim:SDSprague-Dawley DerivedReceived Sprague-Dawley derived breeding stock from Charles River Laboratory in 1958 and crossed with Sprague-Dawley rats received from ARS/Sprague-Dawley in 1975. Caesarean rederived in 1997.outbredUnknown10395235F344/NSimFISCHER 344Gnotobiotic pedigreed breeders received from the NIH repository colony in 2005. Most widely used inbred rat strain, particularly for toxicology and teratology.inbredUnknown10395249FHH.FHH.3<sup>BN</sup>-(<i>3p-D3Rat98</i>)/Mcwi(FHH X FHH-3<sup>BN</sup>/Mcwi) F<sub>2</sub> males were backcrossed with FHH-3<sup>BN</sup>/Mcwi females to produce offsprings, these were intercrossed to generate this congenic linecongenicUnknown10395251FHH.FHH.3<sup>BN</sup>-(<i>D3Hmgc24-3q</i>)/Mcwi(FHH X FHH-3<sup>BN</sup>/Mcwi) F<sub>2</sub> males were backcrossed with FHH-3<sup>BN</sup>/Mcwi females to produce offsprings, these were intercrossed to generate this congenic linecongenicUnknown10395253FHH.FHH.3<sup>BN</sup>-(<i>D3Hmgc24-3q</i>)(<i>3p-D3Rat98</i>)/Mcwi(FHH X FHH-3<sup>BN</sup>/Mcwi) F<sub>2</sub> males were backcrossed with FHH-3<sup>BN</sup>/Mcwi females to produce offsprings, these were intercrossed to generate this congenic linecongenicUnknown10395297GK/FarMcwiGoto-KakizakiGenerated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. Now bred and maintained at Medical College of WisconsininbredUnknown10401195SD-Tg(CAG.LoxP.EGFP)ZiRandom insertion of a Cre inducible expression cassette, controlled by the CAG promoter. LacZ is expressed constitutively, GFP only after Cre mediated recombinationtransgenicLive Animals; Cryopreserved Sperm; Cryorecovery10401201LE-Tg(Th-cre)3.1DeisCre gene was introduced immediately before the ATG of the mouse tyrosine hydroxylase (Th) gene on BAC RP23-350E13transgenicLive Animals; Cryopreserved Sperm (as of 2017-05-31)10401204LE-Tg(ChAT-cre)5.1DeisCre gene was introduced immediately before the ATG of the mouse choline acetyltransferase (Chat) gene in BAC RP23-246B12. This strain is estimated to carry 6 copies of the transgene at the integration site.transgenicLive Animals; Cryopreserved Sperm (as of 2017-05-31)10401208F344-Tg(Prp-APP,Prp-PS1)19/RrrcThe strain was coinjected with two transgenes: one contains the human amyloid beta (A4) precursor protein (hAPP) gene with the Swedish mutation (K595N/M596L) driven by mouse prion promoter (Prp). The other contains the human presenilin 1 gene (PS1) with a deletion of exon 9, also driven by the mouse prion promoter (Prp). Based on segregation patterns, it is believed that the two transgenes have integrated at the same chromosomal site.transgenicLive Animals; Cryopreserved Sperm (as of 2019-02-20)10401212SD-Tg(Thy1.2-NIPA1)Human NIPA1G106R mutation is made by site-directed mutagenesis and then inserted into Thy1.2-promotor cassette. Transgenic vector is injected into fertilized eggs to produce 2 independent lines (A, B)transgenicCryopreserved Sperm; Cryorecovery10401835WKY.F344-(<i>D17Got91-D17Rat51</i>)/TjaA congenic strain made by introducing a 15 Mbp segment of chromosome 17 from F344/NHsd into WKY/Cruk, this region has the distal end of Cm15 QTLcongenicUnknown10401837WKY.F344-(<i>D17Got91-D17Rat47</i>)/TjaA congenic substrain derived from the progenitor strain WKY.F344-(<i>D17Got91-D17Rat51</i>)/TjacongenicUnknown10401839WKY.F344-(<i>D17Rat47-D17Rat51</i>)/TjaA congenic substrain derived from the progenitor strain WKY.F344-(<i>D17Got91-D17Rat51</i>)/TjacongenicUnknown10401841WKY.F344-(<i>D17Rat131-D17Rat51</i>)/TjaA congenic substrain derived from the progenitor strain WKY.F344-(<i>D17Got91-D17Rat51</i>)/TjacongenicUnknown10401843WKY-<i>Slc39a12<sup>em77Tja</sup></i>This strain was produced by injecting ZFNs targeted sequence into WKY/Cruk rat embryos. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.mutantUnknownSlc39a12<sup>em77Tja</sup>1040184210401845WKY-<i>Slc39a12<sup>em77Tja+/-</sup></i>WKY-<i>Slc39a12<sup>em77Tja+</sup></i>/WKY-<i>Slc39a12<sup>em77Tja-</sup></i>ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.mutantUnknownSlc39a12<sup>em77Tja</sup>1040184210401848WKY-<i>Slc39a12<sup>em77Tja-/-</sup></i>WKY-<i>Slc39a12<sup>em77Tja-</sup></i>/WKY-<i>Slc39a12<sup>em77Tja-</sup></i>ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.mutantUnknownSlc39a12<sup>em77Tja</sup>1040184210401851SD-<i>Lep<sup>em1Narl</sup></i>CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermatesmutantUnknownLep300010401918BDIX/HanHsdBDIX/Han maintained at Envigo (Harlan)inbredCryorecovery10402160HCR/1McoHigh-capacity runners; generation 5HCR/Mco bred till the fifth generationinbredUnknown10402163HCR/2McoHigh-capacity runners; generation 26HCR/Mco bred till the twenty-sixth generationinbredUnknown10402165LCR/1McoLow-capacity runners; generation 5LCR/Mco bred till the fifth generationinbredUnknown10402167LCR/2McoLow-capacity runners; generation 26LCR/Mco bred till the twenty-sixth generationinbredUnknown10402390BNW/JerBrown Norway-wildThis is a wild caught strain, characterized by Charles River Laboratories and has been bred brother x sisterinbredUnknown10402393HPE/JerHairless pink eye diluteThis is a strain of unknown background, and has been bred brother x sisterinbredUnknown10402395HBLS/JerHairless black skin pigmentedThis is a result of a cross of the BNW and HPE, this spontaneous hairless black skin mutation was selected from the F2 offspring for the black hairless quality and subsequently bred brother x sisterinbredUnknown10402819DA-<i>Tph2<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.mutantLive Animals (as of 2017-01-26)Tph2<sup>em2Mcwi</sup>1040281710402822DA-<i>Tph2<sup>em3Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.mutantCryorecovery (as of 2017-01-26)Tph2<sup>em3Mcwi</sup>1040282010402834LEW.SS-(<i>D7Rat27-D7Mgh1</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown10402836LEW.SS-(<i>D8Chm12-D8Rat15</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown10402839LEW.SS-(<i>D10Mgh6-D10Mgh1</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown10402842LEW.SS-(<i>D17Rat15-D17Rat51</i>)/AydLEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic straincongenicUnknown10402850LEW.SS-(<i>D7Rat27-D7Mgh1</i>)(<i>D17Rat15-D17Rat51</i>)/Ayddouble congenic strain was generated by combining the two separate congenic strainscongenicUnknown10402852LEW.SS-(<i>D7Rat27-D7Mgh1</i>)(<i>D17Rat15-D17Rat51</i>)(<i>D10Mgh6-D10Mgh1</i>)/Aydmultiple congenic strain was generated by combining the three separate congenic strainscongenicUnknown10412325LE-Tg(Drd1-icre)3OttcThe transgene expresses BAC transgenic using rat dopamine receptor 1 promoter to express Cre recombinase in D1R neuronstransgenicLive Animals (as of 2019-03-18)Drd1251810412327LE-Tg(Drd2-iCre)1OttcThe transgene expresses BAC transgenic using rat dopamine receptor 2 promoter to express Cre recombinase in D2R neuronstransgenicLive Animals (as of 2019-03-18)Drd1251810412329LE-Tg(Pvalb-icre)2OttcThe transgene expresses BAC transgenic using rat parvalbumin promoter to express Cre recombinase in parvalbumin expressing neuronstransgenicLive Animals (as of 2019-03-18)Pvalb345710413850SD-<i>Abcc6<sup>em1Qlju-/-</sup></i>This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.mutantUnknownAbcc6<sup>em1Qlju</sup>1041384310413852SD-<i>Abcc6<sup>em2Qlju-/-</sup></i>This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.mutantUnknownAbcc6<sup>em2Qlju</sup>1041384610413854SD-<i>Abcc6<sup>em3Qlju-/-</sup></i>This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.mutantUnknownAbcc6<sup>em3Qlju</sup>1041384710413856SD-<i>Abcc6<sup>em4Qlju-/-</sup></i>This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.mutantUnknownAbcc6<sup>em4Qlju</sup>1041384810413858SD-<i>Abcc6<sup>em5Qlju-/-</sup></i>This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.mutantUnknownAbcc6<sup>em5Qlju</sup>1041384910450489SD-<i>Bsn<sup>em1Ionsz</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of BsnmutantUnknownBsn<sup>em1Ionsz</sup>1045048810755350F344.ZUC-(<i>Lepr<sup>fa</sup></i>),OLETF-(<i>D14Rat23-D14Rat12</i>)/TjThe F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-<i>Lepr<sup>fa</sup></i> with F344.OLETF-(<i> D14Rat23-D14Rat12</i>) and then selecting Lepr<sup>fa</sup> -Niddm20 (fa/fa-Nidd2/of) homozygotescongenicUnknownDiabetes ObesityLepr300110755352LH/MavRrrcAekLyon HypertensiveLyon Hypertensive rats maintained at Department of Pharmacology, University of IowainbredUnknown10755354LN/MavRrrcAeklyon normotensiveLyon normotensive rats maintained at Department of Pharmacology, University of IowainbredUnknown11040455SHR.BN-(<i>D16Rat88-D16Rat9</i>)/CubSegment of chromosome 16 from BN.<i>Lx</i>/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congeniccongenicUnknown11040519SHR-<i>Ndufc2<sup>em1Mcwi-/+</sup></i>SHR-<i>Ndufc2<sup>em1Mcwi-</sup></i>/<i>Ndufc2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknownNdufc2<sup>em1Mcwi</sup>958853711040521SHR-<i>Ndufc2<sup>em2Mcwi-/+</sup></i>SHR-<i>Ndufc2<sup>em2Mcwi-</sup></i>/<i>Ndufc2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown11040525SHR-<i>Ndufc2<sup>em1Mcwi+/+</sup></i>SHR-<i>Ndufc2<sup>em1Mcwi+</sup></i>/<i>Ndufc2<sup>em1Mcwi+</sup></i>ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown11040527SHR-<i>Ndufc2<sup>em2Mcwi+/+</sup></i>SHR-<i>Ndufc2<sup>em2Mcwi+</sup></i>/<i>Ndufc2<sup>em2Mcwi+</sup></i>ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown11040548CrlCembe:WIWistar ratsCeMBE received breeding stock from Charles River (Crl:WI, strain code 003) in 2014, these are bred according to the Poiley rotation (1960) with permanent monogamous mating.outbredUnknown11040561WI-<i>Htr7<sup>em1Geh</sup></i>CRISPR/Cas9 system was used to generate this mutant; this induced 89 base pair deletion in exon 1 of the Htr7 gene.mutantCryopreserved Sperm; CryorecoveryHtr7<sup>em1Geh</sup>1469671411040563SD-Tg(Adra1a)VccrCardiac specific overexpression of the alpha 1A adrenergic receptor, 40 fold overexpression of the receptortransgenicUnknown11040565LEW-Tg(CAG-OFP)Picrandom insertion of a transgene carrying orange fluorescent protein (OFP) driven by the CAG promotertransgenicCryopreserved Sperm; Cryorecovery11040568W-Tg(RNB1-116K03-EGFP-mRFP)3KyoThe transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.transgenicCryopreserved SpermAtrn6906311040570W-Tg(RNB1-116K03-EGFP-mRFP)20KyoThe transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.transgenicCryopreserved SpermAtrn6906311040572W-Tg(RNB1-116K03-EGFP-mRFP)21KyoThe transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.transgenicCryopreserved SpermAtrn6906311040574W-Tg(RNB1-116K03-EGFP-mRFP)22KyoThe transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.transgenicCryopreserved SpermAtrn6906311040577W-Tg(RNB1-116K03-EGFP-mRFP)41KyoThe transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.transgenicCryopreserved SpermAtrn6906311040579W-Tg(RNB1-116K03-EGFP-mRFP)104KyoThe transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.transgenicCryopreserved SpermAtrn6906311040581TRM.W-Tg(RNB1-186G14)51KyoF344/Stm rat BAC clone RNB1-186G14 was microinjected into embryos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.transgenicCryopreserved Sperm11040675TRM.W-Tg(RNB1-186G14)33KyoF344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.transgenicCryopreserved Sperm11040678TRMR.W-Tg(RNB1-186G14)51KyoF344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.transgenicCryopreserved Sperm11040681TRMR.W-Tg(RNB1-186G14)33KyoF344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.transgenicLive Animals; Cryopreserved Sperm11040683SER.TRMR.W-Tg(RNB1-186G14)51KyoThe sperms from N2 generation rat (ID#252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) were microinjected into SER embyos. The offspring with transgese was backcrossed with SER rats.transgenicCryopreserved Sperm11040916F344-<i>Zeb2<sup>em1Kyo</sup></i>Zinc-finger nucleases (ZFNs) method taregting exon 5 of Zeb2 gene (AGCCAAAGCTTGCCTCCA and GACTACTGACTCAAG) was used; This strain has a 5-bp deletion (cagag) and a 2-bp insertion (tc) in exon7 of Nrf2 gene, resulting in a deletion of Glutamine(Q)541. Background strain: F344/StmmutantCryopreserved SpermNeurobiology; DevelopmentZeb2130727211040918WTC-<i>furue</i>/KyoWTC-furue rat was found in a colony of WTC.ZI-Atrn<zi> congenic strain at national cancer research center in 2000. The tremor phenotype is controlled by an autosomal recessive mutation ("furue")mutantCryopreserved SpermNeurobiology11040920WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)39KyoCHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131transgenicCryopreserved Sperm11040922WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)15KyoCHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131transgenicCryopreserved Sperm11040934WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)92KyoCHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131transgenicCryopreserved Sperm11040936WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)131KyoCHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131transgenicCryopreserved Sperm11040939STOCK.<i>dmy</i>Tg(CMV-Mrs2)KyoA transgene containing the CMV promoter and MRS2 gene was microinjected into the pronuclei of fertilized oocytes collected from Wistar rats. Transgenic offspring founder rats were backcrossed with WTC.DMy-dmy rats to obtain dmy/dmy homozygous and also hemizygous for the transgede (dmy/dmy, tg/+).transgenicCryopreserved SpermMrs270852911040941SD-Tg(Gfap-Tk1)JogSD-Tg(Gfap-Tk1)The rats were originally generated by the University of Michigan Transgenic Animal Model Core, University of Michigan. They used a Crl:CD(SD) sub strain of Sprague-Dawley rats, obtained from Charles River Laboratory (Wilmington, MA, USA). The F1 rats have been bred in the UK with Hsd:Sprague Dawley (Harlan laboratories, UK), which are direct descendants of the original 1925 SD-company colony (Madison, Wisconsin, USA). The GFAP-TK rat was generated by pronuclear injection of a Gfap-Tk Bacterial Artificial Chromosome (BAC) construct, engineered using RedET-mediated homologous recombination methods.transgenicCryopreserved EmbryoGfap|Tk12679|62101411040946F344-<i>Prkdc<sup>em1Kyo</sup></i>This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene, resulting a 46-deletion. Background strain: F344/StmmutantCryopreserved Sperm (as of 2017-06-08)Prkdc|Prkdc<sup>em1Kyo</sup>1308982|1291009511040948F344-<i>Prkdc<sup>em2Kyo</sup>Il2rg<sup>em6Kyo</sup></i>This strain was established by Zinc-finger nucleases (ZFNs) method taregting rat Prkdc gene (227-bp deletion) and Il2rg gene (332-bp deletion). Background strain: F344/StmmutantCryopreserved Sperm (as of 2017-06-08)Il2rg|Prkdc|Prkdc<sup>em2Kyo</sup>|Il2rg<sup>em6Kyo</sup>621466|1308982|12910096|1291009711040950TM-<i>Prkdc<sup>em4Kyo</sup>Il2rg<sup>em5Kyo</sup></i>This strain was established by Zinc-finger nucleases (ZFNs) method causing 20-bp deletion in the exon1 of Prkdc gene and a 653-bp deletion Il2rg gene. Background strain: TM/KyomutantCryopreserved Sperm (as of 2017-07-12)Il2rg|Prkdc|Prkdc<sup>em4Kyo</sup>|Il2rg<sup>em5Kyo</sup>621466|1308982|12910098|1291009911040952WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)(<i>D3Mgh16-D3Rat144</i>)/IzmA congenic strain made by introducing a segments of chromosome 1 and 3 from SHRSP/Izm into WKY/Izm.congenicCryopreserved Embryo; Cryopreserved Sperm11040954LEA-<i>Tp53<sup>tm1(AmCyan1)Ncco</sup></i>LEA rats were provided from Kyoto Bioresource Center in 2006. Then LEA rat ES cells having Oct4-Venus gene and Oct4-Venus Tg rat strain (LEA-Tg(Pou5f1-YFP*)3Ncco) were established.mutantCryopreserved Embryo11040957F344-<i>Tp53<sup>m1Kyo</sup></i>This strain was established by ENU mutagenesis (gene-driven) using F344/NSlc and has a missense mutation(R271C).mutantCryopreserved SpermTp53|Tp53<sup>m1Kyo</sup>3889|1279295511040959SER.TRMR.W-<i>tm<sup>TRM</sup>Atrn<sup>zi</sup></i>Tg(RNB1-186G14)/KyoThe sperms from N2 generation rat (NBRP Rat No:252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP Rat No:0677) were microinjected into SER embryos. The offspring with transgene was backcrossed with SER rats.transgenicCryopreserved Sperm11040962F344-<i>Bscl2<sup>m1Kyo</sup></i>T239A mutation was found by screening of 4608DNA sample from ENU mutagenesis library KURMA. This strain has a T239A (L80X) nonsense mutation in Bscl2 gene.mutantCryopreserved Sperm (as of 2019-01-09)Bscl2|Bscl2<sup>m1Kyo</sup>1308135|1383872711040969DWH/IetDwarfism derived from Wistar Hannover GALAS ratsderived from Wistar Hannover GALAS ratsmutantCryopreserved EmbryoMetabolismTg384811040971F344-<i>Tyr<sup>C</sup>Kit<sup>H</sup>/Kyo</i>1) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to black. Background strain: F344/StmmutantLive Animals; Cryopreserved Sperm (as of 2017-07-17)Kit|Tyr620568|158975511040974F344-<i>Asip<sup>A</sup>Tyr<sup>C</sup>Kit<sup>H</sup>/Kyo</i>1) point mutation in the exon 2 of Tyrosinase (Tyr) gene (albino phenotype), 2) 19-bp deletion in Asip gene (Agouti phenotype), and 3) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to Agouti. Background strain: F344/StmmutantLive Animals; Cryopreserved SpermAsip|Kit|Tyr2003|620568|158975511040977WI-<i>ROSA26<sup>em1(CAG-EGFP)Kyo</sup></i>CAG-GFP vector was knock-in into the rat Rosa26 locus by CRISPR/Cas9 system. Background strain: Crlj:WImutantCryopreserved Sperm (as of 2017-08-08)11040980W-<i>Dmd<sup>em2Kykn</sup></i>By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16mutantCryopreserved Embryo (as of 2017-05-02)Dmd250711040985W-<i>Dmd<sup>em3Kykn</sup></i>By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: Deletion of exon3 to exon16 (a part of intron 3 remain). This straindied out in 2015.mutantExtinct (as of 2017-05-02)Dmd250711040987WIC-Tg(Nanog-YFP*)1UtrBAC (containing rat Nanog gene) vector was injected into Iar:Wistar-Imamichi rats. The construct is as follows: Venus-IRES-puromycin resistance gene.transgenicCryopreserved Sperm (as of 2017-04-21)Nanog130317811041106LE-Tg(Pvalb-tTA)15Hiobackground strain #65306; Long-Evans rat #65288; Iar:Long-Evans #65289; Transgene #65306; (1) Parvalbumin (PV) promoter #65306; mouse derived (MGI:97821). PV is calcium-binding protein. (2) tetracycline transactivator (tTA) #65306; Fusion protein of tetracycline repressor (Escherichia coli-derived) and VP16 (Herpes simplex virus-derived). In the absence of Doxycycline (Dox), tTA binds to tetracycline-responsive element (TRE) and expression of TRE-controlled genes can be induced. Vector #65306; pBlueScript (Stratagene), pBACe3.6 (CHORI)transgenicCryopreserved Sperm11041108CV/IetThe Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started.mutantCryopreserved Sperm11041128TM.KDP-<i>Cblb</i>(<i>D9Rat13-D9Rat4</i>)(<i>D12Rat5-D12Rat45</i>)(<i>D18Mit9-D18Rat44</i>)/NyoThe Cblb mutation, one of the causative gene in type 1 diabetes of KDP/Tky and KDP alleles in other modifier genes were transferred onto the genetic background of TM:Kyo strain.congenicCryopreserved SpermDiabetes ObesityCblb62053511041139F344-Tg(Dct-lacZ)9KyoThe construct was made by connecting a 3,659 bp DNA fragment of rat Dct (dopachrome tautomerase) gene (5'-3237 to 422) with the upstream of lacZ gene. Dct gene was derived from F344/Stm. Background strain: F344/NSlc, plasmid: pLacZ-Basic (Clontech Laboratories)transgenicCryopreserved SpermDevelopmentDct156497511041143PL/IetA new mutant gene that causes preaxial polydactyl in the hindlimbs was found in the Jcl:Wistar -derived strain of rats with fused pulmonary lobes (FRL) at the Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology . Genetic analysis has revealed that the new mutation is not closely linked with the fpl gene. This strain was established by sib mating (over 20 generations).inbredCryopreserved SpermDevelopment11049145SD-<i>Crh<sup>em1Ionsz</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh.mutantUnknownCrh<sup>em1Ionsz</sup>1104914211073612SS-Chr 13<sup>BN</sup>-<i>Mir29b<sup>em1Mcwi</sup></i>This strain was produced by injecting TALENs targeting the sequence TTTAAATAGTGATTGTCtagcaccatttgaaaTCAGTGTTCTTGGTGGA into SS-Chr 13BN/mcwi rat embryos. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequencemutantLive Animals (as of 2017-01-26)Mir29b1<sup>em1Mcwi</sup>1107360811073719SD-<i>Drd1<sup>em1Ionsz</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1.mutantUnknownDrd1<sup>em1Ionsz</sup>1107371711081142SD-<i>Pgr<sup>em1Soar</sup></i>Crispr/Cas9 targeting of Exon 3 of rat Pgr gene resulting in a deletion of Exon3mutantUnknownreproduction, neurobiology, and cancerPgr331711081149SD-<i>Esr2<sup>em1Soar</sup></i>Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 4mutantUnknownreproductionEsr2<sup><i>em1Soar</i></sup>4090284011081151WI-<i>Grm8<sup>em1Geh</sup></i>CRISPR/Cas9 induced 29 base pair deletion in exon 1mutantUnknownneurologic medications, neurologic diseases, normal brain functionsGrm861985811081153SD-Tg(DIO--iRFP)9OttcThe transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter.transgenicLive Animals (as of 2019-02-26)11081177F344<i><sup>tl</sup></i>toothless (tl)A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon.mutantUnknownskeletal and osteoclast biologyCsf1<sup>tl</sup>1291095411084925SD-Tg(CD59-HBA1)BrydTransgene: human CD59 gene (cDNA) under control of alpha-globin regulatory elements (alpha-globin promoter and alpha hemoglobin locus control region). Upon administration of intermedilysin (ILY), cells expressing human CD59 will be selectively ablatedtransgenicCryopreserved Sperm (as of 2017-01-26)intravascular hemolysis and related sequelae of anemia, hemoglobinemia, and hemoglobinuriaCD5973660011084928WKY-<i>Jund<sup>em1Tja</sup></i>The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation.mutantCryopreserved Sperm (as of 2017-01-26)leukemia, breast cancerJund<sup>em1Tja</sup>1108492611084931SD-Tg(RIP7-RLuc-YFP)VpoitTransgene: RIP7-RLuc-YFP. This transgene expresses a renilla luciferase-YFP fusion protein under control of the rat insulin 2 gene promoter (RIP7).transgenicUnknown11087549LE-Tg(GFAP-TK)Hcamrandom insertion of human GFAP promoter driving herpes simples virus thymidine kinasetransgenicUnknownneurogenesis11087551SD-<i>Il15<sup>em1Soar</sup></i>Zinc finger nuclease mediated 7bp deletion within exon 2 of the Il15 gene, resulting in a frameshift and premature stop codon.mutantUnknownIl15|Il15<sup>em1Soar</sup>2887|1291049111087553SD-<i>Mmp12<sup>em1Soar</sup></i>TALEN mediated 664 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codonmutantCryopreserved Sperm; Cryorecovery (as of 2017-08-10)allergy and lung responses and blood coagulationMmp12|Mmp12<sup>em1Soar</sup>620195|1291050011354901SS.SHR-(<i>D9Mco110-D9Mco124</i>)/BjThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.congenicUnknown11354903SS.SHR-(<i>D9Mco110-D9Mco121</i>)/BjThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.congenicUnknown11354924SS.SHR-(<i>D9Mco113-D9Mco124</i>)/BjThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.congenicUnknown11354926SS.SHR-(<i>D9Mco110-D9Got111</i>)/BjThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.congenicUnknown11354928SS.SHR-(<i>D9Mco110-D9Mco114</i>)/BjThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.congenicUnknown11354930SS.SHR-(<i>D9Mco115-D9Mco124</i>)/BjThis is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.congenicUnknown11528524LE-Tg(Slc17a6-icre)3OttcThe BAC-based transgene contains Cre recombinase is expressed from rat Slc17a6 promoter.transgenicExtinct (as of 2019-02-01)11528588SHR.LEW-(<i>D4Rat76-D4Mgh11</i>)This congenic strain contains a LEW chromosome 4 segment containing a QTL affecting anxiety-related response transferred to the SHR background.congenicUnknown11530008CDS.CDR-(D4Rat9-D4Rat153)/YglThis CDS congenic containing genomic elements from CDR was created by crossing the consomic strain CDS-Chr 4CDR/Ygl(RGD:4889499) with CDS. The congenic carries QTL affecting diabeties initation.congenicUnknown11530011CDS.SBN-(D13Rat85-D13Mit4)/YglThis CDS congenic containing the genomic element from SBN/Ygl was created by crossing the SBN/Ygl with CDS. The congenic carries QTL affecting diabeties development.congenicUnknown11530028NP/Iusm-<i>Npy<sup>em6Sage</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Npy into NP/Iusm embryos. A 26-bp deletion, including 6 bp in intron 1 and 20 bp in exon 2 in rat Npy was created in the mutant founders. These mutant founders were backcrossed with NP/Iusm to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring.mutantUnknownNpy<sup>em6Sage</sup>1153002211531089SD-<i>F8<sup>em1Sage+/-</sup></i>/NovoThe heterozygous ZFN mutant rats were produced by backcrossing mutant founders (SD/Novo-<i>F8<sup>em1Sage</sup></i>) with Sprague Dawley. Genotyping of the offspring was carried out by PCR amplification of the deletion fragment which caused a premature translation stop.mutantUnknownF8<i><sup>em1Sage</sup></i>1153109611531091SD-<i>F8<sup>em1Sage-/-</sup></i>/NovoThe homozygous F8 mutant rats were produced by intercrossing the heterozygous ZFN mutants (SD-<i>F8<sup>em1Sage+/-</sup></i>/Novo) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of the deletion fragment which caused a premature translation stop.mutantUnknownF8<i><sup>em1Sage</sup></i>1153109611531094SD-<i>F8<sup>em1Sage</sup></i>/NovoThese ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat F8 into Sprague Dawley embryos. A premature translation stop in rat F8 was created in the mutant founders carrying a 13-bp deletion in exon 16. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring.mutantUnknownF8<i><sup>em1Sage</sup></i>1153109611531104NP/Iusm-<i>Npy<sup>em6Sage+/-</sup></i>The heterozygous ZFN mutant rats were produced by backcrossing mutant founders (NP/Iusm-<i>Npy<sup>em6Sage</sup></i>) with NP/Iusm. Genotyping of the offspring was carried out by PCR amplification of a 26-bp deleted fragment.mutantUnknownNpy<sup>em6Sage</sup>1153002211531106NP/Iusm-<i>Npy<sup>em6Sage-/-</sup></i>The homozygous Npy mutant rats were produced by intercrossing the heterozygous ZFN mutants (NP/Iusm-<i>Npy<sup>em6Sage+/- </sup></i>) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of a 26-bp deleted fragment.mutantUnknownNpy<sup>em6Sage</sup>1153002211532753F344.ZUC-(<i>Lepr<sup>fa</sup></i>),OLETF-(<i>D5Rat166-D5Rat90</i>)/TjThe F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-<i>Lepr<sup>fa</sup></i> with F344.OLETF-(<i> D5Rat166-D5Rat90</i>) and then selecting Lepr<sup>fa</sup> -Niddm24 (fa/fa-Nidd6/of) homozygotescongenicUnknownDiabetes Obesity11535000PKD/MhmPKDThe colony of inbred PKD/Mhm rats was established in the laboratory in Mannheim after 18 additional generations of inbreeding of the Han:SPRD (cy/+).The mutation was a C to T transition that replaces an arginine by a tryptophan at amino acid 823 in the protein sequence.inbredUnknown (as of 2016-11-29)Anks6<sup>PKD</sup>1153499611535031SD-Tg(hCMV-Anks6<sup>PKD</sup>)MhmThis transgenic strain was derived by pronuclear microinjection of fertilized Sprague Dawley oocytes with a 2.8-kb mutated Anks6<sup>PKD</sup> cloned between a human cytomegalovirus promoter upstream and an intron as well as a polyadenylation signal of SV40 downstream.transgenicUnknown (as of 2016-11-29)Anks6<sup>PKD</sup>1153499611535955Crlj:CD(SD)A colony of outbred CD(SD) (RGD: 734476) maintained in the Charles River Laboratories Japan.outbredUnknown11553848WKY-<i>Trpv4<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene.mutantCryopreserved Sperm (as of 2017-01-26)Trpv4<sup>em5Mcwi</sup>1155384711553850WKY-<i>Trpv4<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene.mutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Trpv4<sup>em4Mcwi</sup>1155385111553852SS-<i>Vnn1<sup>em2Mcwi</sup></i>CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryosmutantLive Animals; Cryopreserved Sperm (as of 2018-10-10)Vnn1<sup>em2Mcwi</sup>1155385311553855SS-<i>Vnn1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryosmutantLive Animals; Cryopreserved Sperm (as of 2018-10-10)Vnn1<sup>em1Mcwi</sup>1155385611553858SS-<i>Rbm20<sup>em5Mcwi</sup></i>ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene.mutantCryopreserved Sperm (as of 2017-01-26)Rbm20<sup>em5Mcwi</sup>1155385711553860DA-<i>Scn5a<sup>em2Mcwi</sup></i>ZFN system was used to introduce a mutation in the Scn5a gene of DA/MolTac rat embryos. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene.mutantCryopreserved Sperm (as of 2017-01-26)Scn5a<sup>em2Mcwi</sup>1155385911553862SS-<i>Shc1<sup>em1Mcwi</sup></i>ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Shc1<sup>em1Mcwi</sup>1155385411553873LE-<i>Fmr1<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp insertion in exon 8 of the Fmr1 gene.mutantLive Animals (as of 2016-10-18)Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/FMR1>SFARI GENE</a>)Fmr1<sup>em2Mcwi</sup>1155387211553875LE-<i>Fmr1<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp deletion in exon 8 of the Fmr1 gene.mutantLive Animals (as of 2016-10-18)Fmr1<sup>em4Mcwi</sup>1155387411553877SS-<i>P2rx1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene.mutantExtinct (as of 2017-07-18)P2rx1<sup>em1Mcwi</sup>1155387611553881SS-<i>Rbm20<sup>em10Mcwi</sup></i>ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene.mutantCryopreserved Sperm (as of 2017-01-26)Rbm20<sup>em10Mcwi</sup>1155388011553883SS-<i>Rbm20<sup>em8Mcwi</sup></i>ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene.mutantCryopreserved Sperm (as of 2017-01-26)Rbm20<sup>em8Mcwi</sup>1155388211553886SD-<i>Tp53<sup>em3Mcwi</sup></i>ZFN system was used to introduce a mutation in the Trp53 gene of Crl:SD rat embryos.The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene.mutantCryopreserved Sperm (as of 2017-01-26)Tp53<sup>em3Mcwi</sup>1155388511553889SS-<i>Trpc3<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene.mutantCryopreserved Sperm; Cryorecovery (as of 2018-10-10)Trpc3<sup>em2Mcwi</sup>1155388711553892SS-<i>Trpc3<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene.mutantCryopreserved Sperm (as of 2018-10-10)Trpc3<sup>em1Mcwi</sup>1155389111553894SS-<i>Tpcn2<sup>em1Mcwi</sup></i>ZFN system was used to introduce a mutation in the Tpcn2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene.mutantLive Animals (as of 2017-01-26)Tpcn2<sup>em1Mcwi</sup>1155389311553896SHRSP-<i>Spp1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Spp1<sup>em1Mcwi</sup>1155389511553899WKY-<i>Trpv2<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene.mutantLive Animals (as of 2017-01-26)Trpv2<sup>em1Mcwi</sup>1155389811553902SS-<i>Trpc6<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene.mutantCryorecovery (as of 2017-07-18)Trpc6<sup>em3Mcwi</sup>1155390111553904SS-<i>Shc1<sup>em3Mcwi</sup></i>ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Shc1<sup>em3Mcwi</sup>1155390311553908SS-<i>Trpc6<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene.mutantLive Animals (as of 2017-01-26)Trpc6<sup>em4Mcwi</sup>1155390711553912SS-<i>Trpc6<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene.mutantLive Animals (as of 2017-01-26)Trpc6<sup>em1Mcwi</sup>1155391111553914SS-<i>Shc1<sup>em4Mcwi</sup></i>ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of theShc1 gene.mutantCryopreserved Sperm (as of 2017-01-26)Shc1<sup>em4Mcwi</sup>1155391311553916SS-<i>Shc1<sup>em5Mcwi</sup></i>ZFN system was used to introduce a T>G transversion mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a substitution to generate S36A in Exon 2 of theShc1 gene.mutantLive Animals (as of 2017-01-25)Shc1<sup>em5Mcwi</sup>1155391511554327BDIX.BDIV-<i>D10Mit3-D10Mgh16</i>/ZteThe BDIX.BDIV-<i>D10Mit3-D10Mgh16</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.congenicLive Animals (as of 2016-10-26)11554329BDIX.BDIV-<i>D10Got1-D10Rat45</i>/ZteThe BDIX.BDIV-<i>D10Got1-D10Rat45</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.congenicLive Animals (as of 2016-10-26)11556280ACI.Cg-<i>Du</i>/KyoDownunder (Du) mutation is introduced into ACI/Kyo strain.congenicCryopreserved Sperm (as of 2016-11-10)Development11556282WKY-Tg(UBC-sb10)3WmukfThis strtain has transgene that express SleepingBeauty transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown)transgenicCryopreserved Sperm (as of 2016-11-10)11561897Crl:WI-<i>Lrap<sup>em1Geh</sup></i>The CRISPR/Cas9 genome editing system was used to generate this knockout mutant rat strain. It created a 618-bp deletion in rat Lrap gene. The recipient zygotes were the Wistar rats from Charles River.mutantUnknownbehavior, addictionLrap<sup>em1Geh</sup>1156189611561902WKY-Tg(UBC-pb)5WmukfThis strtain has transgene that expresses piggyBac transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown)transgenicCryopreserved Sperm (as of 2016-11-10)11561905WKY-Tg(Gabrb1<sup>Tn(pb-Bhr2)1Wmukf</sup>)Transposed "Bhr2" was inserted into intron 4 of Gabrb1 gene by piggyBac (pb) transposon system.transgenicCryopreserved Sperm (as of 2016-11-10)Gabrb1|Gabrb1<sup>Tn(pb-Bhr2)1Wmukf</sup>2649|1156192511561909WKY-Tg(Samt4<sup>Tn(pb-Bhr7)1Wmukf</sup>)Transposed "Bhr7" was inserted into the first Met-coding exon region of rat Samt4 gene by piggyBac (pb) transposon system.transgenicExtinct (as of 2016-11-10)Samt4<sup>Tn(pb-Bhr7)1Wmukf</sup>1156192811561966LE.AR-<i>Ednrb<sup>sl</sup></i>/HkvAganglionosis ratThis strain was derived from LE.AR-Ednrbsl/Okkm (NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm) provided by Dr. Dr.Ozaki to Dr. Agui at Hokkaido University.congenicUnknown (as of 2016-11-15)Internal Medicine11561970WKY-Tg(Zbtb20<sup>Tn(pb-Bhr7)1Wmukf</sup>)Transposed "Bhr7" was inserted into the Intron 3 of Zbtb20 gene by piggyBac (pb) transposon system.transgenicCryopreserved Sperm (as of 2016-11-15)Zbtb20<sup>Tn(pb-Bhr7)1Wmukf</sup>1156197211561976WKY-Tg(Plcb1<sup>Tn(pb-Bhr2)1Wmukf</sup>)Transposed "Bhr2" was inserted into into Plcb1 gene by piggyBac (pb) transposon system.transgenicCryopreserved Sperm (as of 2016-11-15)Plcb1<sup>Tn(pb-Bhr2)1Wmukf</sup>1156197411561979LE-Tg((ROSA26)Sor-CAG-tdTomato)9JfhyBackground strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien(UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato(Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9)transgenicUnknown (as of 2016-11-16)11564343LE-Tg((ROSA26)Sor-CAG-tdTomato)14JfhyBackground strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien (UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato (Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9)transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-16)11564346F344-<i>Aspa<sup>em31Kyo</sup></i>The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord.mutantCryopreserved Sperm (as of 2016-11-16)Aspa<sup>em31Kyo</sup>1156434411564349F344-<i>Aspa<sup>em34Kyo</sup></i>The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord.mutantCryopreserved Sperm (as of 2016-11-16)Aspa<sup>em34Kyo</sup>1156434811564350SCR/SscrShumiya Cataract RatGenetic Cataract rat SCR(Shumiya Cataract Rat)was segrigated from a SHR-fa strain colony that developed nuclear cataract at adult stage. This strain is a double mutant caused by recessive gene (ctr1) and dominant lethal gene (Ctr2l) and established by Dr. Shumiya at Tokyo Metropolitan Institute of Gerontology. In 2003, this strain was introduced to Kyoritsu College of Pharmacy (keio University Faculty of Pharmacy). ctr1 is lanosterol synthase (Lss) and Ctr2 is farnesyl diphosphate farnesyl transferase 1 (Fdft1).congenicCryopreserved Embryo (as of 2016-11-16)Fdft1|Lss61834|62095511565091F344-<i>Ccdc85c<sup>em1Kyo</sup></i>TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo. Rats developed hydrocephalus and Subcortical heterotopia. Homozygous rats die within 1 month of hydrocephalus.mutantCryopreserved Sperm (as of 2016-11-18)Ccdc85c<sup>em1Kyo</sup>1156509011565094F344.LEC-(<i>D4Nirs8-D4Nirs2</i>)/NrsThis strain was established by crossing F344.LEC-xhs1/1Nrs (NBR-rat #0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is similar to F344.LEC-xhs1/1Nrs.congenicCryopreserved Sperm (as of 2016-11-18)11565097F344.LEC-(<i>D4Rat54-D4Got87</i>)/NrsThis strain was established by crossing F344.LEC-xhs1/1Nrs (NBRrat NO: 0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is different from F344.LEC-xhs1/1Nrs.congenicCryopreserved Sperm (as of 2016-11-18)11565100NMC/NrsThis strain was found in a colony of F344.LEC-xhs1/1Nrs (NBRP Rat No: 0293). As to radiosensitivity gene, D4Nirs8-D4Rat45 region is LEC type. Affected females with dominant gene on Chr10 develop mammary gland cancer after pregnancy (histological type is undetermined). In many cases, this neoplastis lesion resolve spontaneously after delivery. No homozygous female is obtained at this time. Affected male rats don't show any phenotype.mutantCryopreserved Sperm (as of 2016-11-18)11565116LE-Tg(Chat-tdTomato)3YyanChat-tdToamto-polyA-FRT sequence was inserted into fertilized egg of Long Evans strain (Japan SLC). vector: BAC clone (RP23-246B12) from a C57BL/6J mouse genomic BAC library (BACPAC Resource Center, Oakland, CA, USA)transgenicCryopreserved Sperm (as of 2016-11-21)11565122SHR.Cg-<i>Lepr<sup>cp</sup></i>-Tg(APOB)110/DmcrA BAC clone (CTD-2257F14) containing whole human APOB gene was maicroinjected into fertilized eggs of Wistar rats (Takeda Pharmaceutical Company). Then this Tg rats were backcrossed 9 times with SHR/NDmcr-cp rats (NBRP No.0446, SHR.Cg-Leprcp/NDmcr)(RGD: 2306033)congenicCryopreserved Embryo (as of 2016-11-21)Lepr<sup>cp</sup>1157056511565125SHRSP.SHR-(<i>D18Rat87-D18Got66</i>)/IzmA congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm.congenicCryopreserved Sperm (as of 2016-11-21)11565128SHRSP.SHR-(<i>D18Rat73-D18Rat52</i>)/IzmA congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm.congenicCryopreserved Sperm (as of 2016-11-21)11565130SHRSP.SHR-(<i>D1Rat23-D1Rat213</i>)/IzmA congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/IzmcongenicCryopreserved Sperm (as of 2016-11-21)Diabetes Obesity11565132SHRSP.SHR-(<i>D1Rat95-D1Got87</i>)/IzmA congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/IzmcongenicCryopreserved Sperm (as of 2016-11-21)Diabetes Obesity11565135WKY.SHRSP-(<i>D1Rat25-St8sia2</i>)/IzmA congenic strain established by introducing segments of chromosome 1 from SHRSP/Izm into WKY/Izm.congenicUnknown (as of 2016-11-21)St8sia262184311565826F344-<i>Ttn<sup>em1Sage</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence.mutantUnknown (as of 2016-11-28)Ttn<sup>em1Sage</sup>1156582511565829F344-<i>Ttn<sup>em2Sage</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0).mutantUnknown (as of 2016-11-28)Ttn<sup>em2Sage</sup>1156582711567272SD-<i>Mecp2<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2).mutantLive Animals (as of 2016-12-13)Autism, Rett syndrome, CognitionMecp2<sup>em1Sage</sup>1156803511568040SD-<i>Fmr1<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. This mutant rat has a knockout of Fmr1.mutantLive Animals (as of 2017-05-09)Autism, Fragile X syndromeFmr1<sup>em1Sage</sup>1156804111568058SD-<i>Nrxn1<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in exon1 resulting in knockout of Nrxn1.mutantLive Animals (as of 2018-03-22)Autism, SchizophreniaNrxn1<sup>em1</sup>1156805911568062SD-<i>Pten<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten.mutantLive Animals (as of 2016-12-13)Autism, cancerPten<sup>em1Sage</sup>1156806311568067SD-<i>Grm5<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot.mutantLive Animals; Cryopreserved Embryo (as of 2016-12-13)Autism, Fragile X syndrome, Cognition, Schizophrenia, Anxiety, PainGrm5<sup>em1Sage</sup>1156806811568071SD-<i>Met<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met.mutantCryopreserved Embryo (as of 2016-12-07)Autism Spectrum Disorders, Synaptic Plasticity, Autoimmune disordersMet<sup>em1Sage</sup>1156807211568646SD-<i>Cntnap2<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot.mutantLive Animals (as of 2017-05-05)Autism Spectrum Disorders, Synaptic Plasticity, Language disordersCntnap2<sup>em1Sage</sup>1156864711568700SD-<i>Nlgn3<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot.mutantLive Animals; Cryopreserved Embryo (as of 2016-12-13)Autism, Asperger's syndrome, Synaptic plasticityNlgn3<sup>em1Sage</sup>1156870111568703SD-<i>Cacna1c<sup>em1Sage</sup></i>The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. This model contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an
early stop codon in exon 6.mutantCryopreserved Embryo (as of 2016-12-13)Autism, Timothy syndrome, Long QT syndrome, Schizophrenia,Bipolar disorderCacna1c<sup>em1Sage</sup>1156870411667072Sway/RrrcThis phenotype arose spontaneously during the third generation of selective breeding for decreased intravenous drug self-administration in Wistar rats (see RGD:6482259). After 10 weeks of age no drug administration is needed to see phenotype in which animals exhibits motor abnormalities with degenerative changes in cerebellar Purkinje cells. It appears to be transmitted in an autosomal recessive pattern. Animals have an abnormal swaying gait, which is readily identified as a slow (2 to 3 cycles per second) tremor.inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)11667077SD-<i>Esr2<sup>em2Soar</sup></i>Zinc finger nuclease targeting of exon 3 of the rat estrogen receptor-2 gene resulting in the deletion of exon 3.mutantCryopreserved Sperm (as of 2017-01-26)reproduction, neu7roscience, environmental healthg, cardiovascular11667079SD-<i>Pgr<sup>em2Soar</sup></i>zinc finger nucleases were used to generate a 136 bp deletion within the first exon of the progesterone receptor, resulting in a frameshift, premature stop codon, and a null.mutantCryopreserved Sperm (as of 2017-01-26)Reproduction, neuroscience, environmental health, cardiovascular11667081BDIV-<i>Myo5a</i>/StcRrrcPoint mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker ratsinbredCryopreserved Sperm (as of 2017-01-26)Myo5a<sup>m1Stc</sup>4272197111667084W<sup>Cat</sup>Wistar Cataract RatENU induced total juvenile cataract in inbred Wistar.mutantCryopreserved Sperm (as of 2017-01-26)11667088SD-<i>Esr1<sup>em1Soar</sup></i>zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out.mutantCryopreserved Sperm (as of 2017-01-26)A range of experimentation examining the actions of estrogen in reproduction, cancer, cardiovascular, and neurobiology.Esr1<sup>em1Soar</sup>1291073611667094W-Tg(CFH)Crlmicro-injected with a ~6 kb transgenic cassette, which contained a CMV enhancer, chicken beta-actin promoter, the full-length cDNA encoding human complement factor H, and a rabbit beta-globin poly(A) sequence that had been isolated and purified from plasmid pCAGGS-human fH.transgenicCryopreserved Sperm (as of 2017-01-26)11667096WIST-<i>Tulane</i>Tulane ratMale Wistar rats with inbred congenital unilateral right hydronephrosis were bred from the colony described in 1979 by Friedman et al.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)12437069SS.BN-(<i>D13Rat25-rs198199323</i>)-<i>Btg2<sup>em21Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Btg2 gene of SS.BN-(<i>D13Rat25-rs198199323</i>)/Mcwi rat embryos.mutantLive Animals (as of 2017-01-26)Btg2<sup>em21Mcwi</sup>1279856412437071SS.BN-(<i>D13Rat25-rs198199323</i>)-<i>Btg2<sup>em24Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 2-bp insertion in the exon 1 in the Btg2 gene of SS.BN-(<i>D13Rat25-rs198199323</i>)/Mcwi rat embryos.mutantLive Animals (as of 2017-01-26)Btg2<sup>em24Mcwi</sup>1279856512738212SD-Tg(LRRK2*R1441C)268RwmThese rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the R1441C mutation and fused to a YPet reporter tag.transgenicCryopreserved Sperm (as of 2017-08-22)Parkinson's DiseaseLRRK2135314112738218SD-<i>GEPR-9</i>Genetically Epilepsy-Prone Rats (GEPR-9) have severe levels of seizure predisposition. This colony was bred to exhibit clonic convulsions (severe seizures with an ARS of 9) following a single wild running phase in response to sound. Seizures model human generalized tonic/clonic seizures.inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-30)seizure12738365SD-<i>Rag2<sup>em2Mcwi</sup></i>This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp frameshift deletion,Atgttgagat, in exon 2.mutantLive Animals; Cryopreserved Sperm (as of 2017-02-01)Rag2<sup>em2Mcwi</sup>1273836612738372BDIX.BDIV-<i>D6Mit1-D6Mgh2</i>/ZteThe BDIX.BDIV-<i>D6Mit1-D6Mgh2</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.congenicUnknown12738388BDIX.BDIV-<i>D6Rat132-D6Mgh3</i>/ZteThe BDIX.BDIV-<i>D6Rat132-D6Mgh3</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.congenicUnknown12738394BDIX.BDIV-<i>D6Mit8-D6Rat229</i>/ZteThe BDIX.BDIV-<i>D6Mit8-D6Rat229</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.congenicUnknown12738452ACI.F344-<i>Apc<sup>Pirc</i>Uwm</sup>This strain develops twice the number of colonic tumors as the F344-ApcPircUwm rats (RGD:1641862). Stop codon mutation at amino acid 1137 of the Apc gene. Nucleotide chr18:26,785,272 (Baylor 3.4/rn4) A to T transversion.mutantCryopreserved Sperm (as of 2017-02-06)Apc<sup>Pirc</sup>155432212738455DA.F344-(<I>D10Got155-D10Nsi55</I>)The Cia5a10 (D10Got155-D10Nsi55) interval was introgressed from F344 into DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a10) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.congenicCryopreserved Sperm (as of 2017-02-06)12738457DA.F344-(<I>D10Got152-D10Mcw1</I>)DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a5)(D10Got152-D10Mcw1) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.congenicCryopreserved Sperm (as of 2017-02-06)12738460DA.F344-(<I>D7Rat15-D7Mit2</I>)The Cia4d (D7Rat15 -D7Mit2) interval was introgressed from F344 into DA/BklArb rats through 7 backcrosses into DA/BklArb rats followed by 3 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia4d) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.congenicCryopreserved Sperm (as of 2017-02-06)12738466DA-<i>Asip<sup>m1</sup></i>Developed by Beth Bauer, University of Missouri. Spontaneous mutation of agouti gene with resultant black coat color from Sprague Dawley (SD) X Dark Agouti (DA). Albino mutation and hooded mutation have been bred out of this line so that only the agouti mutation remains.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-06)This strain can be used to generate pigmented embryos for use with albino ES cell lines.Asip<sup>m1</sup>1273846712743611SS-<i>Ren<sup>em1Mcwi+/-</sup></i>SS-<i>Ren<sup>em1Mcwi+</sup>/Ren<sup>em1Mcwi-</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygousmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)12743623BN.F344-<i>Apc<sup>Pirc</i></sup>The phenotype of the BN.F344-<i>Apc<sup>Pirc</i></sup> congenic shows high resistance to cancer. The heterozygous animals get spontaneous intestinal lesions (small intestinal and colonic)starting at 60 days of age in males. BN animals are highly resistant to tumor development and can live over 2 years.mutantCryopreserved Sperm (as of 2017-02-10)Apc<sup>Pirc</sup>155432212743627cNLH-<i>Cat</i>congenital NLH Cataract Ratinbreeding since 2003, juvenile total cataract developed in cNLH line. cNLH = congenital non-learned helpless. congenital non-learned helpless and congenital learned helpless (cLH)lines were developed from outbred Dpargue-Dawley from Charles River.mutantCryopreserved Sperm (as of 2017-02-10)12743630BN-<i>Spib</i>spitzenborduere (spib)Retinae display marked rosett formation in the outer nuclear layer; in the funduscopy irregular, dark pigment flecks are observed, which cannot be identified in the histology. Linkage analysis indicating at least two genes interacting.mutantCryopreserved Sperm (as of 2017-02-10)12743640DA.E3-(<i>RT1-DMa-Ggnbp1</i>)The Tcs1 QTL in DA.E3-(<i>RT1-DMa-Ggnbp1</i>)(DA.1IR85) contains a ~0.5 Mb (min- max 0.43 - 0.63 Mb) insert from DA.1I (RGD:10002743, DA.E3-(D20Rat42-D20Rat49)/Rhd). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, inclduing the RT1-B and RT1-D genes.congenicCryopreserved Sperm (as of 2017-02-13)RT1-DMa|Ggnbp1735053|135972912743645DA.KHW-(<i>RT1-Db1-RT1-DMb</i>)The Tcs2 QTL in DA.KHW-(RT1-Db1-RT1-DMb)(DA.1HR10) contains a ~0.2 from DA.1H [DA.KHW-RT1h]. The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available at GenBank.congenicCryopreserved Sperm (as of 2017-02-14)RT1-DMb|RT1-Db1735096|159328212743647DA.E3-(<i>Btnl2-RT1-DMb</i>)The Tcs2 QTL in DA.E3-(Btnl2-RT1-DMb)(DA.1UR10) contains a ~0.2 Mb fromDA.E3-(D20Rat47-AA858870)/Rhd (RGD:10002745). The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available from GenBank. The genomic sequences of DA/OlaHsd and E3 have been completed and will be available soon (Backdahl et al. BMC Genomics 2014)congenicCryopreserved Sperm (as of 2017-02-14)Btnl2|RT1-DMb620731|73509612743650DA.AS2-(<i>Tesb-RT1-DMb</i>)DA.F-(Tesb-RT1-DMb) (DA.1FR61) contains a ~0.4 Mb (min- max 0.25 - 0.53 Mb) insert from DA.1F (RGD:2307301). The insert spans 12-19 genes in the MHC-II/MHC-III regions, including RT1-B and RT1-D. The 12 genes in the MHC-II region have been sequenced and sequences are available from GenBank.congenicCryopreserved Sperm (as of 2017-02-14)RT1-DMb|Tsbp1735096|159706312743652DA.KHW-(<i>RT1-DMa-Mln</i>)The Tcs1 QTL in DA.KHW-(RT1-DMa-Mln)(DA.1HR83) contains a ~~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1H [DA.KHW-RT1h]. The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes.congenicCryopreserved Sperm (as of 2017-02-14)RT1-DMa|Mln735053|164290712743655DA.E3-(<i>RT1-DMa-Mln</i>)The Tcs1 QTL in DA.E3-(RT1-DMa-Mln)(DA.1UR83) contains a ~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1U (RGD:10002745). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes.congenicCryopreserved Sperm (as of 2017-02-14)12790593DA.ACI-(<i>Gtf2ird1-D12Rat8</i>)/NsiThe strain contains the Cia25 R11 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(Chr12:27462118-Chr12:27611814) [also known as DA.ACI(Cia25) R11] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.congenicCryopreserved Sperm (as of 2017-02-16)arthritis/autoimmunity studiesGtf2ird162085612790595DA.ACI-(<i>D12Mit2-Gtf2i</i>)/NsiThe strain contains the Cia25 R12 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(D12Got43-Chr12:27368751)/Nsi [also known as DA.ACI(Cia25) R12] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.congenicCryopreserved Sperm (as of 2017-02-16)arthritis/autoimmunity studiesGtf2i72796112790599WKY-<i>Asic3<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Asic3 gene of WKY/Ncrlrat embryos. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene.mutantCryorecovery (as of 2017-08-14)Asic3<sup>em6Mcwi</sup>1279059712790602SS-<i>Axl<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene.mutantLive Animals (as of 2017-02-17)Axl<sup>em1Mcwi</sup>1279060012790604SS-<i>Axl<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene.mutantCryorecovery (as of 2017-02-17)Axl<sup>em2Mcwi</sup>1279060512790608SS-<i>Cd14<sup>em1Mcwi</sup></i>The CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of the Cd14 gene of SS/JrHsdMcwi rat embryos.mutantLive Animals (as of 2017-02-17)Cd14<sup>em1Mcwi</sup>1279060612790610SS-<i>Cd14<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Cd14 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a net 7-bp deletion of the Cd14 gene.mutantLive Animals (as of 2017-02-17)Cd14<sup>em2Mcwi</sup>1279061112790615LEW-<i>Chrna4<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene.mutantLive Animals; Cryorecovery (as of 2017-02-17)Chrna4<sup>em5Mcwi</sup>1279061612790621SS-<i>Cybb<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene.mutantCryorecovery (as of 2017-07-18)Cybb<sup>em1Mcwi</sup>1279062012790623SS-<i>Cybb<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene.mutantLive Animals; Cryorecovery (as of 2017-07-18)Cybb<sup>em3Mcwi</sup>1279062412790627LEW-<i>Igh-6<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the exon 2 of the Igh-6 gene.mutantCryorecovery (as of 2017-02-17)Igh-6<sup>em1Mcwi</sup>1279062512790629LEW-<i>Igh-6<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/Ncrl rat embryos. The resulting mutation is a 2-bp deletion in the exon 2 of the Igh-6 gene.mutantCryorecovery (as of 2017-08-07)Igh-6<sup>em4Mcwi</sup>1279063012790632SS-<i>Il2rg<sup>em1Mcwi</sup></i>This strain was produced by injecting TALENs targeting the sequence of Il2rg gene into the SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in exon 2.mutantLive Animals (as of 2017-02-17)Il2rg<sup>em1Mcwi</sup>1279063312790659SD-<i>Il2rg<sup>em3Mcwi</sup></i>This strain was produced by injecting TALENs targeting the Il2rg gene into Crl:SD rat embryos. The resulting mutation is a 2-bp deletion in exon 2.mutantCryopreserved Sperm (as of 2017-02-20)Il2rg<sup>em3Mcwi</sup>1279066012790662WKY-<i>Mb<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene.mutantCryorecovery (as of 2017-07-18)Mb<sup>em6Mcwi</sup>1279066312790676SS-<i>P2rx1<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene.mutantCryorecovery (as of 2017-02-20)P2rx1<sup>em6Mcwi</sup>1279067712790679PCK-<i>P2rx7<sup>em8Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of PCK/CrljCrl-Pkhd1pck/Crl rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene.mutantLive Animals (as of 2017-02-20)Pkhd1<sup>pck</sup>|P2rx7<sup>em8Mcwi</sup>11535943|1279068012790692SS-<i>Pon1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene.mutantCryorecovery (as of 2017-07-18)Pon1<sup>em1Mcwi</sup>1279069312790695SS-<i>Pon1<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene.mutantExtinct (as of 2017-02-20)Pon1<sup>em2Mcwi</sup>1279069612790698SS-<i>Pon1<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene.mutantCryorecovery (as of 2017-07-18)Pon1<sup>em3Mcwi</sup>1279069912790702SS-<i>Pon3<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Pon3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene.mutantCryorecovery (as of 2017-07-18)Pon3<sup>em1Mcwi</sup>1279070312790710SD-<i>Rag2<sup>em3Mcwi</sup></i>This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp deletion in exon 2.mutantCryorecovery (as of 2017-07-18)Rag2<sup>em3Mcwi</sup>1279071112790713SS-<i>Rag2<sup>em1Mcwi</sup></i>This strain was produced by targeting the Rag2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.mutantLive Animals; Cryopreserved Sperm (as of 2017-02-21)Rag2<sup>em1Mcwi</sup>1279071412790717SS-<i>Rfwd2<sup>em1Mcwi</sup></i>This strain was produced by targeting the Rfwd2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 6-bp insertion in exon 4.mutantCryorecovery (as of 2017-07-18)Rfwd2<sup>em1Mcwi</sup>1279071812790721SS.BN-(<i>D13Rat151-D13Rat197)-Serpinc1<sup>em2Mcwi</sup></i>ZFN system was used to introduce a mutation in the Serpinc1 gene of SS.BN-(D13Rat151-D13Rat197)/Mcwi rat embryos. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene.mutantLive Animals (as of 2017-02-21)Serpinc1<sup>em2Mcwi</sup>1279072212790944WKY-<i>Sik2<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene.mutantLive Animals (as of 2017-02-22)Sik2<sup>em5Mcwi</sup>1279094512790947SS-<i>Sorcs2<sup>em7Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 33-bp frameshift deletion in exon 15.mutantCryopreserved Sperm (as of 2017-02-22)Sorcs2<sup>em7Mcwi</sup>1279094812790950SS-<i>Sorcs2<sup>em9Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 15.mutantCryopreserved Sperm (as of 2017-02-22)Sorcs2<sup>em9Mcwi</sup>1279095212790954WKY-<i>Tert<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of WKY/NCrl rat embryos. The resulting mutation is a 17-bp deletion in Tert gene.mutantLive Animals (as of 2017-02-22)Tert<sup>em2Mcwi</sup>1279095512790957SS.SR-(<i>DXrat11-rs64754598</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome X region from DXRat11 to rs64754598 was introgressed on the genetic background of SS.congenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-22)12790959SS.SR-(<i>D1Rat68-rs65309623</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from D1Rat68 to rs65309623 was introgressed on the genetic background of SS.congenicCryopreserved Sperm (as of 2017-02-22)12790962SS.SR-(<i>rs106908358-rs105920659</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from rs106908358 to rs105920659 was introgressed on the genetic background of SS.congenicCryopreserved Sperm (as of 2017-02-22)12790964SS.SR-(<i>rs66001705-D5Mgh16</i>)/OpazCongenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 5 region from rs66001705 to D5Mgh16 was introgressed on the genetic background of SS.congenicCryopreserved Sperm (as of 2017-02-22)12792211SS.BN-(<i>D13Hmgc1048-D13Hmgc664</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown12792212SS.BN-(<i>D13Hmgc1048-D13Hmgc1045</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown12792213SS.BN-(<i>D13Hmgc1048-D13Hmgc1050</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown12792214SS.BN-(<i>D13Hmgc1041-D13Hmgc664</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown12792216SS.BN-(<i>D13Hmgc885-D13Hmgc664</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown12792217SS.BN-(<i>D13Hmgc1041-D13Hmgc885</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic straincongenicUnknown12792226SS.BN-(<i>D13Got45-D13Hmgc664</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792939SS.BN-(<i>D13Got42-D13Rat61</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792944SS.BN-(<i>D13Got42-D13Got45</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792945SS.BN-(<i>D13Got42-D13Rat130</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792946SS.BN-(<i>D13Got42-D13Hmgc354</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792947SS.BN-(<i>D13Got42-D13Hmgc497</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792948SS.BN-(<i>D13Got42-D13Hmgc885</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792949SS.BN-(<i>D13Got42-D13Hmgc664</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792950SS.BN-(<i>D13Mit5-D13Rat32</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792951SS.BN-(<i>D13Hmgc5885-D13Rat32</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792952SS.BN-(<i>D13Hmgc354-D13Rat32</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792953SS.BN-(<i>D13Rat130-D13Rat32</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12792954SS.BN-(<i>D13Got45-D13Rat32</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798529SS.BN-(<i>D13Hmgc37-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798530SS.BN-(<i>D13Rat115-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798531SS.BN-(<i>D13Hmgc86-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798532SS.BN-(<i>D13Hmgc40-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798533SS.BN-(<i>D13Hmgc85-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798534SS.BN-(<i>D13Rat77-D13Got22</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798535SS.BN-(<i>D13Rat111-D13Rat115</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798536SS.BN-(<i>D13Rat111-D13Hmgc86</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798537SS.BN-(<i>D13Rat111-D13Rat20</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12798538SS.BN-(<i>D13Rat111-D13Hmgc85</i>)/McwiSS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12802362SS.BN-(<i>D13Rat25-RN34_13048990782</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12802363SS.BN-(<i>D13Rat25-rs106935835</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12802364SS.BN-(<i>D13Rat25-rs198199323</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi (RGD:2293145), rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12802365SS.BN-(<i>D13Hmgc64-D13Hmgc23</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12802366SS.BN-(<i>D13Hmgc64-4582</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12802367SS.BN-(<i>2340-RN34_13048990782</i>)/McwiSS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic straincongenicUnknown12859278Slc:ZUC-<I>Lepr<sup>fa</sup></I>Zucker fatty ratsThe spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961.This strain was maintained at Japan SLC, Inc. (Hamamatsu, Japan.)outbredUnknownLepr|Lepr<sup>fa</sup>3001|1343215312859279Ho:ZFDM-<I>Lepr<sup>fa</sup></I>Zucker Fatty Diabetes Mellitus ratsIn the Zucker fatty rat colony in Hoshino Laboratory Animals, Inc, they incidentally found fa/fa homozygous male rats having reproductive ability. The Selective breeding using the fa/fa male rats that exhibited relatively high blood glucose levels at 10 weeks of age, resulting in establishment of a diabetic strain. These fa/fa male rats developed diabetes as early as 10 weeks of age, reaching 100% incidence by 21 weeks of age, while none of the fa/+ male rats developed diabetes.outbredUnknownLepr|Lepr<sup>fa</sup>3001|1343215312859287ZDF-<i>Lepr<sup>fa</sup></i>/DrtZucker Diabetic Fatty Rat"Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters.inbredUnknownLepr300112879386W-<i>Ghsr<sup>em1Ottc</sup><i/>The CRISPR/Cas9 genome editing system was used to generate this knock out rat strain with 846- bp deletion in the rat Ghsr gene. The rat strain had Ghsr exon1 deletion in the genome and did not express detectable Ghsr mRNA in brain regions.mutantCryopreserved Sperm; Cryorecovery (as of 2018-12-04)Ghsr<sup>em1Ottc</sup>1288043512879394F344-<i>Atm<sup>m1Kyo</sup></i>Atm missense ratsThis strain is an Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P))rat and was established by ENU mutagenesis using F344/NSlc strain.mutantLive Animals; Cryopreserved Sperm (as of 2017-04-18)ImmunologyAtm<sup>m1Kyo</sup>1287939512879400F344-<i>Atm<sup>em1Kyo</sup></i>ZFN-Atm ratsThis rat strain was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13). Background strain: F344/Stm.mutantLive Animals; Cryopreserved Sperm (as of 2017-04-18)neurobiologyAtm<sup>em1Kyo</sup>1287940112879423W-Tg(HCRT-cre-EGFP)B5Ahkyorexin-Cre ratThis transgenic rat strain was established by Dr. Yamanaka (Nagoya University) in 2012. Background strain: Wistar rat (CLEA Japan). plasmid backbone: pCR2.1. Transgene: human HCRT gene promoter, cre recombinase, EGFP gene, 2A gene. EGFP and cre recombinase are specifically expressed in orexin neurons.transgenicUnknown12879424LE-<i>ROSA26<sup>em1(CAG-COP4*/EGFP)Kyo</sup></i>This strain was established at Kyoto University. ChR90/EGFP fusion gene sequence under CAG promoter is knock-in at the Rosa26 locus. Background strain: Long-Evans strain (charles river). COP4*: Stigeoclonium helveticum-derived channelrhodopsin (Chronos, ChR90)mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-19)12879426ExHC.BN-(<i>D14Got74-D14Rat132</i>)/KyuThis congenic strain was established by introducing a segment of chromosome14 (D14Got74-D14Rat132 including Smek2 gene) from Brown Norway(BN)/seac strain into ExHC/Seac strain.congenicCryopreserved Embryo (as of 2017-04-19)12879428WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)(<i>D3Rat36-D3Rat144</i>)(<i>D4Mgh7-D4Rat68</i>)/IzmA double congenic strain bade by introducing segments of chromosome 1, 3, and 4 from SHRSP/Izm into WKY/Izm. This strain was established by mating between WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm(NBRP Rat No:0713)and WKY.SHRSP-(D1Mgh5-D1Arb21) (D4Mgh7-D4Rat68)/IzmCNBRP Rat No:0714). This strain was established and is maintained in Shimane University.congenicCryopreserved Embryo (as of 2017-04-19)12879431Jcl:WIWistar ratsThis strain is a rat strain originating from the Wistar Institute in Philadelphia (USA). The Wistar Institute was named as a memorial to the famous anatomist Professor Casper Wistar at the University of Pennsylvania. CLEA Japan, Inc. started the production and supply of this strain after it was introduced from Carworth (UK).outbredLive Animals (as of 2021-04-22)behavioral pharmacology, toxicity, pharmacology, drug efficacy, and safety testing.12879432W-<i>Ift140<sup>em1Kyo</sup></i>This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene.mutantCryopreserved Embryo (as of 2017-04-19)Ift140<sup>em1Kyo</sup>1287943312879434W-<i>Ift140<sup>em2Kyo</sup></i>This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 2 (em2) has 2-bp deletion (c.23_24del) in the exon 1 of Ift140 (intraflagellar transport 140) gene.mutantCryopreserved Embryo (as of 2017-04-19)Ift140<sup>em2Kyo</sup>1287943512879437SHC/Taspontaneously hypercholesterolemic ratThis strain (Nephropathy model) was segrigated from SD strain (CLEA Japan,Inc.) by selective mating on the basis of total cholesterol level in blood.inbredLive Animals (as of 2017-04-19)Metabolism12879438F344-Tg(CAG-EGFP,Acr-EGFP)2OsbThis double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data).transgenicCryopreserved Sperm (as of 2017-04-19)12879439F344-Tg(CAG-EGFP,Acr-EGFP)6OsbThis double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data).transgenicCryopreserved Sperm (as of 2017-04-19)12880021SD-<i>Apoe<sup>em1Sage</sup></i>The mutant rat strain was produced by injecting zinc endonuclease targeting the exon 3 of rat Apoe into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in the gene and resulted in complete loss of Apoe protein in homozygotes.mutantLive Animals (as of 2017-05-01)Alzheimer's disease, Neurodegenerative diseasesApoe<sup>em1Sage</sup>1288002212880026SD-<i>App<sup>em1Sage</sup></i>This rat model carries a bi-allelic deletion of the amyloid precursor protein (APP) gene.mutantCryopreserved Embryo (as of 2017-05-01)Alzheimer's disease, Neurodegenerative diseasesApp<sup>em1Sage</sup>1288002712880037SD-<i>Dmd<sup>em1Ang</sup></i>This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation.mutantUnknownDmd<sup>em1Ang</sup>1288003212902614SS.LEW-(<i>D10M11Mit119-D10Rat27</i>)/AydA segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.congenicUnknown12902616SD-<i>Apoe<sup>tm1(APOE*)Sage</sup></i>These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE genemutantLive Animals (as of 2017-05-09)Alzheimer's disease, Neurodegenerative diseasesAPOE73637812902621SD-<i>Bdnf<sup>em1Sage+/-</sup></i>This ZFN model contains a monoallelic deletion of the Bdnf gene, encoding for the nerve growth factor protein BDNF. Homozygous animals carrying the Bdnf deletion are postnatal lethal. Reductions of BDNF have been observed in patients with Alzheimer's disease (AD), and this model may be useful for understanding the role of BDNF in AD.mutantLive Animals (as of 2017-06-20)Schizophrenia and Alzheimer's DiseaseBdnf<sup>em1Sage</sup>1290262212902625SD-<i>Nr1i2<sup>em1Sage</sup></i>This ZFN model contains a 20-bp deletion within the Nr1i2 gene. No induction of Cyp3a1 in the model.mutantLive Animals (as of 2017-05-09)Xenobiotic SensorsNr1i2<sup>em1Sage</sup>1290262612903250SD-<i>Ahr<sup>em1Sage</sup></i>This ZFN model contains a 760-bp deletion in the rat Ahr gene.mutantLive Animals (as of 2017-05-10)Xenobiotic SensorsAhr<sup>em1Sage</sup>1290327112903251LH-Chr 17<sup>LN</sup>/AekChr 17 from LN was introgressed onto the genetic background of LH by crossing LH/MRrrcAek male to LN/MRrrcAek female rats.consomicUnknown12903257LH.LH-Chr 17<sup>LN</sup>-(<i>rs199194111-rs105876746</i>)/AekThis congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from rs199194111 through rs1056876746 transferred to the LH/MRrrcAek background.congenicUnknown12903267SD-<i>Nr1i3<sup>em1Sage</sup></i>This model contains a ZFN-induced 10-bp deletion within rat Nr1i3 gene.mutantLive Animals (as of 2017-05-10)Xenobiotic SensorsNr1i3<sup>em1Sage</sup>1290326812903270SD-<i>Nr1i2<sup>em1Sage</sup></i> <i>Nr1i3<sup>em1Sage</sup></i>This model contains two knockout genes, the 20-bp deletion within rat Nr1i2 and the ZFN-induced 10-bp deletion within rat Nr1i3 gene.mutantLive Animals (as of 2017-05-10)Xenobiotic SensorsNr1i2<sup>em1Sage</sup>|Nr1i3<sup>em1Sage</sup>12902626|1290326812903272SD-<i>Nr1i2<sup>em1Sage</sup></i> <i>Nr1i3<sup>em1Sage</sup></i> <i>Ahr<sup>em1Sage</sup></i>This model contains three knockout genes, the 20-bp deletion within rat Nr1i2, the ZFN-induced 10-bp deletion within rat Nr1i3 gene and the 760-bp deletion in the rat Ahr gene.mutantCryopreserved Embryo (as of 2017-05-10)Xenobiotic SensorsNr1i2<sup>em1Sage</sup>|Nr1i3<sup>em1Sage</sup>|Ahr<sup>em1Sage</sup>12902626|12903268|1290327112904057SD-<i>Abcb1a<sup>em1Sage -/-</sup></i>SD-<i>Abcb1a<sup>em1</sup>-</sup>/Abcb1a<sup>em1</sup>-</sup></i>This ZFN model contains biallelic 20 bp deletion within Abcba1 gene. Animals exhibit increased oral bioavailability of P-gp-specific substrates. The homozygous knockout rats display total loss of protein via Western blot.mutantLive Animals (as of 2017-05-16)Efflux TransporterAbcb1a<sup>em1Sage</sup>1290405812904059SD-<i>(Abcb1a- Abcb1b)<sup>em1Sage</sup></i>This model carries knockout of Abcb1a and Abcb1b.mutantLive Animals (as of 2017-05-16)Efflux Transporter12904063SD-<i>Abcg2<sup>em1Sage</sup></i>This ZFN model carries a 588-bp deletion within Abcg2 gene. Homozygous knockouts display total loss of protein via Western blotmutantLive Animals (as of 2017-05-16)Efflux TransporterAbcg2<sup>em1Sage</sup>1290406412904679WKY-<i>Cyp2j4<sup>em1Sage</sup></i>/TjaZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation.mutantUnknownCyp2j4<i><sup>em1Sage</sup></i>1290468112904684SD-<i>Abcb1a<sup>em1Sage</sup></i> <i>Abcg2<sup>em1Sage</sup></i>This model contains two knockout genes, the 20-bp deletion within rat Abcba1 and the 588-bp deletion within rat Abcg2 gene.mutantLive Animals (as of 2017-05-17)Efflux TransporterAbcb1a<sup>em1Sage</sup>|Abcg2<sup>em1Sage</sup>12904058|1290406412904685SD-<i>Abcc2<sup>em1Sage</sup></i>This ZFN model contains a biallelic 726 bp deletion within the Abcc2 gene. Animals exhibit decreased transport of endogenous glutathione and hyperbilirubinemia. The homozygous knockout rats display total loss of protein via Western blot.mutantLive Animals (as of 2017-05-17)Efflux TransporterAbcc2<sup>em1Sage</sup>1290468712904730SD-<i>Abcb11<sup>em1Sage</sup></i>This ZFN induced knockout model contains biallelic 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot.mutantLive Animals (as of 2017-05-19)Efflux TransporterAbcb11<sup>em1Sage</sup>1290473112904733SD-<i>Slc22a1<sup>em1Sage</sup></i>This ZFN induced knockout model contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot.mutantCryopreserved Embryo (as of 2017-05-19)Uptake TransportersSlc22a1<sup>em1Sage</sup>1290473412904891SD-<i>Slc22a2<sup>em1Sage</sup></i>This ZFN model carries the knockout of the rat Slc22a2.mutantLive Animals (as of 2017-05-24)Uptake TransportersSlc22a26193612904892SD-<i>Slc22a6<sup>em1Sage</sup></i>This ZFN model carries the knockout of the rat Slc22a6.mutantCryopreserved Embryo (as of 2017-05-24)Uptake TransportersSlc22a66933812904893SD-<i>Slc22a8<sup>em1Sage</sup></i>This ZFN model carries the knockout of the rat Slc22a8.mutantCryopreserved Embryo (as of 2017-05-24)Uptake Transporters12904897SD-<i>Tp53<sup>em1Sage</sup></i>This ZFN model carries the monoallelic 11 base pair deletion in Tp53 gene. Animals exhibit broad tumor spectrum with high degree of tumor malignancy.mutantCryopreserved Embryo (as of 2017-05-24)carcinogenicityTp53<sup>em1Sage</sup>1290489812904900SD-<i>Rag1<sup>em1Sage</sup></i>This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Homozygous animals display loss of Rag1 protein and loss of B and T cells by FACS analysis.mutantCryopreserved Embryo (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag1<sup>em1Sage</sup>1290490112904902F344-<i>Rag1<sup>em1Sage</sup></i>This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Rag1 knockout rats lack mature B and T lymphocytes.mutantCryopreserved Embryo (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag1<sup>em1Sage</sup>1290490112904903SD-<i>Rag2<sup>em1Sage</sup></i>This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene on chromosome 3. Homozygous Rag2 knockout rats display loss of RAG2 protein via Western blot. Homozygous Rag2 knockout rats show loss of B and T cells by FACS analysis.mutantLive Animals (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag2<sup>em1Sage</sup>1290490412904905F344-<i>Rag2<sup>em1Sage</sup></i>This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene.on chromosome 3 Rag2 knockout rats completely lack B and T cells.mutantCryopreserved Embryo (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag2<sup>em1Sage</sup>1290490412904907SD-<i>Prkdc<sup>em1Sage</sup></i>This ZFN induced knockout rats have severe combined immunodeficiency (SCID) and lack of both B and T cellsmutantLive Animals (as of 2017-05-24)immunology/Inflamation and ImmunodeficientPrkdc130898212904908SD-<i>Ldlr<sup>em1Sage</sup></i>In this ZFN induced model, a total of 337 bp were deleted at the junction of intron 3 and exon 4 (on chromosome 8), and 4 bp ccgt were inserted rat Ldlr gene on chromosome 8. Homozygous knockout rats display loss of LDLR protein via Western blot. Homozygous knockout rats have increased body weight as compared to wild type. Homozygous knockout rats show significantly elevated serum cholesterol levels.mutantLive Animals (as of 2017-05-24)Ldlr<sup>em1Sage</sup>1290490912904912SD-<i>Lep<sup>em1Sage-/-</sup></i>This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levelsmutantCryopreserved Embryo (as of 2017-05-24)CardiovascularLep<sup>em1Sage</sup>1290492712905029SD-<i>Th<sup>tm1(IRES-cre)Sage</sup></i>This ZFN knock in model expresses cre-recombinase under the control of the endogenous tyrosine hydroxylase promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of Th. The TH-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.mutantLive Animals (as of 2017-05-31)Optogenetics Rats12905031SD-<i>Slc6a3<sup>tm1(IRES-cre)Sage</sup></i>This model expresses cre-recombinase under the control of the endogenous dopamine transporter promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of DAT. The DAT-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.mutantLive Animals (as of 2017-05-31)Optogenetics Rats12905032LE-<i>Camk2a<sup>tm1(IRES-cre)Sage</sup></i>This model expresses cre-recombinase under the control of the endogenous camkIIa promoter enabling specific expression in excititory neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of CamkIIa. The CamkIIa-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.mutantLive Animals (as of 2017-05-31)Optogenetics Rats12905033LE-<i>Slc32a1<sup>tm1(cre)Sage</sup></i>This model expresses cre-recombinase under the control of the endogenous solute carrier family 32 member 1 (Vgat) promoter enabling specific expression in Vgat positive GABAergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of the Vgat gene. The Vgat-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.mutantLive Animals (as of 2017-05-31)Optogenetics Rats12905034LE-<i>Vip<sup>tm1(T2A-cre)Sage</sup></i>This model expresses cre-recombinase under the control of the endogenous vasoactive intestinal peptide (VIP) promoter enabling specific expression in VIP positive GABAergic interneurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the VIP gene. The VIP-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.mutantUnknown (as of 2017-05-31)Optogenetics Rats12905035LE-<i>Tph2<sup>tm1(T2A-cre)Sage</sup></i>This model expresses cre-recombinase under the control of the endogenous Tryptophan Hydroxylase 2 (Tph2) promoter enabling specific expression in Tph2 positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the Tph2 gene. The Tph2-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.mutantLive Animals (as of 2017-05-31)Optogenetics Rats12905036LE-<i>Htr3a<sup>tm1(T2A-cre)Sage</sup></i>This model expresses cre-recombinase under the control of the endogenous 5 prime-hydroxytryptamine receptor 3A (5Ht3a) promoter enabling specific expression in 5Ht3a positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the 5Ht3a gene. The 5Ht3a-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.mutantLive Animals (as of 2017-05-31)Optogenetics Rats12905037LE-<i>ROSA26<sup>em1(CAG-tdTomato)1Sage</sup></i>This CRISPR knock in model possesses the fluorophore tdTomato, sitting behind a floxed stop codon in the Rosa26 locus under control of the CAG promoter. By introducing Cre-recombinase through viral transduction or crossing with one of our Cre-driver rats, tdTomato fluorescence will be observed anywhere Cre- is expressed. The tdTomato Reporter rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines.mutantLive Animals (as of 2017-05-31)12905038LE-<i>ROSA26<sup>em1(CAG-tdTomato-NpHR)1Sage</sup></i>This CRISPR knock in model possesses the Halorhodopsin fused to TdTomato, sitting behind a floxed stop codon in the Rosa26 locus under the control of the CAG promoter. By introducing Cre-recombinase by crossing with one of our Cre-driver rats, neuronal subtype-specific expression of halorhodopsin and TdTomato will be observed anywhere Cre- is expressed. The Halorhodopsin rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines.mutantLive Animals (as of 2017-05-31)12907568WI-<i>Abcb1a<sup>em2Sage</sup></i>This model contains biallelic 19- bp deletion in exon 7 of Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot.mutantUnknownAbcb1a<sup>em2Sage</sup>1290756912907570WI-<i>Abcb1a<sup>em3Sage</sup></i>This model contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot.mutantUnknownAbcb1a<sup>em3Sage</sup>1290757112910101SD-<i>Ldlr<sup>em1</sup></i>This model possesses a 19-bp deletion in the seventh exon of the ldlr gene by ZFN method.mutantUnknownLdlr<sup>em1</sup>1291010212910127SD-Tg(Th-Ghsros)This transgenic strain carries a synthetic 108-nucleotide DNA fragment spanning the 5 prime extracellular region of GHS-R was cloned in the antisense orientation driven by tyrosine hydroxylase (Th) promoter.transgenicUnknownGhsr62139712910483Slc:SDSprague-Dawley DerivedoutbredUnknown12910493LEW.1WR1-<i>Ifnar1<sup>em1</sup></i>The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion in exon 4 of Ifnar1 gene.mutantUnknownIfnar1<sup>em1</sup>1291049512910494LEW.1WR1-<i>Ifnar1<sup>em2</sup></i>The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion and 4-bp insertion in exon 4 of Ifnar1 gene.mutantUnknownIfnar1<sup>em2</sup>1291049612910505SD-<i>Mmp12<sup>em2Soar</sup></i>TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codonmutantUnknownMmp12<sup>em2Soar</sup>1291050612910514SD-<i>Lepr<sup>em1</sup></i>This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion.mutantUnknownLepr<sup>em1</sup>1291051512910517SD-<i>Lepr<sup>em2</sup></i>This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion.mutantUnknownLepr<sup>em2</sup>1291051812910519SD-<i>Lepr<sup>em3</sup></i>This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion.mutantUnknownLepr<sup>em3</sup>1291054612910762BN-<i>Kit<sup>Ws</sup></i>A spontaneous mutant male with a large white spot and coat color dilution was identified in the BN/fMai colony in Yagi Memorial Park (kani-gun, Japan).mutantUnknownKit<sup>Ws</sup>1291076312910940SD-<i>Cdkn1b<sup>we</sup></i>The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype.mutantUnknownCdkn1b<sup>we</sup>1291094113204704W-<i>Myo7a<sup>tnd</sup></i>/HubrWistar tornado ratMale Wistar founder rats were mutagenized using ENU and mated with untreated female to establish F1 population. Selected F1 progeny were mated to produce F2 and then to breed induced mutation to homozygosity.mutantUnknownMyo7a<sup>tnd</sup>/Hubr1320470513204756SS.BN-(D13Hmgc1048-D13Hmgc1050)-<i>Pappa2<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos.mutantCryorecovery (as of 2017-07-18)Pappa2<sup>em4Mcwi</sup>1320475813204788SS.BN-(D13Hmgc1048-D13Hmgc1050)-<i>Pappa2<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos.mutantLive Animals (as of 2017-07-19)Pappa2<sup>em5Mcwi</sup>1320478913207339LH.LH-Chr 17<sup>LN</sup>-(<i>Fancc<sup>rgdv551196202-C</sup>-rs106387478</i>)/AekThis congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from Fancc<sup>rgdv551196202-C</sup> through rs106387478 transferred to the LH/MRrrcAek background.congenicUnknown13207341LH.LH-Chr 17<sup>LN</sup>-(<i>Fancc<sup>rgdv551196202-C</sup>-rs107291522</i>)/AekThis congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from Fancc<sup>rgdv551196202-C</sup> through rs107291522 transferred to the LH/MRrrcAek background.congenicUnknown13207416LH.LH-Chr 17<sup>LN</sup>-(<i>rgdv421102132<sup>T</sup>-rgdv413679765<sup>T</sup></i>)/AekThis congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from Fancc<sup>rgdv551196202-C</sup> through rs106387478 transferred to the LH/MRrrcAek background.congenicUnknown13207488LEW-<i>Chrnb4<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/NCrl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene.mutantLive Animals; Cryorecovery (as of 2017-08-02)Chrnb4<sup>em5Mcwi</sup>1320748913207491SD-Tg(Col3a1-loxP-eGFP-loxP-TurboRFP)McwiBacterial artificial chromosome (BAC) Transgenic rats containing a Cre-inducible reporter switch from eGFP to TurboRFP under the control of the promoter of Col3a1 (BAC: CH230-401H12 )transgenicCryopreserved Sperm (as of 2018-02-12)13207492SD-<i>Cd55<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos.mutantLive Animals (as of 2017-08-02)Cd55<sup>em6Mcwi</sup>1320749313207494SD-<i>Cd55<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos.mutantLive Animals (as of 2017-08-02)Cd55<sup>em4Mcwi</sup>1320749513207497SS-<i>Kcnj13<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene.mutantLive Animals (as of 2017-08-02)Kcnj13<sup>em1Mcwi</sup>1320749813207501SS-<i>Nlrp10<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene.mutantLive Animals (as of 2017-08-03)Nlrp10<sup>em2Mcwi</sup>1320750213207503SS-<i>Nlrp10<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene.mutantLive Animals (as of 2017-08-03)Nlrp10<sup>em3Mcwi</sup>1320750413207507SS-<i>Nlrp12<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene.mutantLive Animals; Cryopreserved Sperm (as of 2018-11-12)Nlrp12<sup>em1Mcwi</sup>1320750813207509SS-<i>P2rx1<sup>em7Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene.mutantLive Animals; Cryopreserved Sperm; Cryorecovery (as of 2018-10-10)P2rx1<sup>em7Mcwi</sup>1320751013207511SS.BN-(D13Rat151-D13Rat197)-Tg(Slc12a1-Ncf2-2A-Luc)26McwiA transgenic rat created by Sleeping Beauty transposon system with proximal tubule-specific overexpression of Ncf2 and Luciferase via a self cleaving 2A peptide, under control of the Slc12a1 (also known as Nkcc2) promoter produced in the line 26 strain.transgenicCryorecovery (as of 2017-08-03)Ncf2130942413207513SS-Tg(Slc12a1-Ncf2-2A-Luc)-Ncf2<sup>em1</sup>McwiThis is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi.mutantCryorecovery (as of 2017-08-03)Ncf2<sup>em1Mcwi</sup>514408913207514SD-<i>ROSA26<sup>em1(Epac-SH187)Mcwi</sup></i>CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor.mutantLive Animals (as of 2017-08-03)13207516SD-<i>Rag2<sup>em3Mcwi</sup></i><i>Il2rg<sup>em2Mcwi</sup></i>This strain was produced by crossing of SD-Rag2em3Mcwi and SD-Il2rgem2Mcwi.mutantLive Animals (as of 2017-08-03)Il2rg<sup>em2Mcwi</sup>|Rag2<sup>em3Mcwi</sup>10002792|1279071113207518SHR-<i>Hspa1<sup>em1Mcwi</sup></i>CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos.mutantCryorecovery (as of 2018-05-01)Hspa1b|Hspa1a|Hspa1l2840|1593284|159592513207525SS-<i>Spp1<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene.mutantLive Animals (as of 2017-08-04)spp1<sup>em3Mcwi</sup>1320752813207529SS-<i>Spp1<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene.mutantLive Animals (as of 2017-08-04)Spp1<sup>em4Mcwi</sup>1320753013207537SD-Tg(Cdh5-cre)2McwiTransgenic rat overexpressing Cre under the control of the Cdh5 (VECadherin) promoter.transgenicLive Animals (as of 2017-08-04)13207551SS-Tg(Nphs2-cre/ERT2)4McwiTransgenic rat overexpressing tamoxifen inducible Cre/ERT2 under the control of the Nphs2 (Podocin) promotertransgenicLive Animals (as of 2017-08-04)13207560SS-Tg(Aqp2-cre/ERT2)4McwiTransgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Aquaporin 2 promotertransgenicLive Animals (as of 2017-08-04)13207563SS-Tg(Mylpf-cre/ERT2)22McwiTransgenic overexpressing tamoxifen inducible CreERT2 under the control of the Mylpf (also known ad Mlc2) promotertransgenicLive Animals (as of 2017-08-04)13207595WKY-<i>Tph1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene.mutantLive Animals (as of 2017-08-07)Tph1<sup>em1Mcwi</sup>1320823013208223LE-(ROSA26) <sup>em1(LTR-nLuc)Ottc</sup>The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus.mutantUnknown13208224LE-(ROSA)26 <sup>em1(CAG-Cas9)Ottc</sup>The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of Cas9 under the control of CAG promoter inserted to the rat ROSA26 locus.mutantUnknown13208231WKY-<i>Tph1<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene.mutantLive Animals (as of 2017-08-08)Tph1<sup>em3Mcwi</sup>1320823213208517SD-<i>Nfe2l2<sup>em1Mcwi+/+</sup></i>SD-<i>Nfe2l2<sup>em1Mcwi+</sup></i>/Nfe2l2<sup>em1Mcwi+</sup></i>This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.mutantLive Animals (as of 2017-08-09)13208518SD-<i>Nfe2l2<sup>em1Mcwi-/-</sup></i>SD-<i>Nfe2l2<sup>em1Mcwi-</sup></i>/Nfe2l2<sup>em1Mcwi-</sup></i>This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.mutantLive Animals (as of 2017-08-09)Nfe2l2<sup>em1Mcwi</sup>958854913208519SD-<i>Nfe2l2<sup>em1Mcwi+/-</sup></i>SD-<i>Nfe2l2<sup>em1Mcwi+</sup></i>/Nfe2l2<sup>em1Mcwi-</sup></i>This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.mutantLive Animals (as of 2017-08-09)13208537HsdFfyb:WIDescendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan (Indianapolis).Since 1995 maintained at Bioterio Central- Facultad de Farmacia y Bioquÿ¿mica de la Universidad de Buenos Aires. Contact: Junin 956 8 piso Ciudad Autÿ¿noma de Buenos Aires, Argentina Tel/Fax: +54 11 5287 4811 Mail: bioterio@ffyb.uba.aroutbredLive Animals (as of 2017-08-11)13208540CrlFvetFfyb:SDDescendants of rats from the Charles River Laboratories (USA),then to Fvet at Buenos Aires University and since 2014 maintained at Bioterio Central of Facultad de Farmacia y Bioqu¿mica de la Universidad de Buenos Aires. Junin 956 Ciudad Aut¿noma de Buenos Aires, ArgentinamutantLive Animals (as of 2017-08-11)13208571SS-Tg(Cyp11b2-cre/ERT2)2McwiTransgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Cyp11b2 promotertransgenicLive Animals (as of 2019-04-26)13208576SS-Tg(Slc5a2-cre/ERT2)2McwiTransgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Slc12a1 (Sglt2) promotertransgenicLive Animals (as of 2017-08-14)13208583SS-Tg(Ubc-Wisp2)2McwiTransgenic overexpressing Wisp2 under the control of the Ubiqutin C promotertransgenicLive Animals (as of 2017-08-14)13208584SS-Tg(Ubc-Wisp2)3McwiTransgenic overexpressing Wisp2 under the control of the Ubiqutin C promotertransgenicLive Animals (as of 2017-08-14)13208842SS-<i>Ptgs2<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene.mutantLive Animals (as of 2017-08-21)Ptgs2<sup>em1Mcwi</sup>1320884313208844SS-<i>Ptgs2<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion of exon 4 in the Ptgs2 gene.mutantLive Animals (as of 2017-08-21)Ptgs2<sup>em2Mcwi</sup>1320884513210578SD-<i>Lep<sup>em1</sup></i>This CRISPR/Cas9 model possesses a 3 bp(ATC) deletion resulting in the deletion of isoleucine at position 14. The Lep mutant rats exhibited similar mutant phenotypes to Lep and Lepr null rats.mutantUnknownLep<sup>em1</sup>1321058013210773ACI.BN-(<i>Fer1l6<sup>rgdv775925951-C</sup>-D7Uwm27</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicCryopreserved Sperm (as of 2017-09-07)mammary cancer13210774ACI.BN-(<i>Fer1l6<sup>rgdv775925951-C</sup>-D7Uwm28</i>)/ShulThis congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.congenicUnknownmammary cancer13432148SS.ZUC-<i>Lepr<sup>fa-/-</sup></i>/SlcSS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain.congenicUnknownDiabetes ObesityLepr<sup>fa</sup>1343215313432150SS.ZUC-<i>Lepr<sup>fa-/+</sup></i>/SlcSS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain.congenicUnknownDiabetes ObesityLepr|Lepr<sup>fa</sup>3001|1343215313432151SS.ZUC-<i>Lepr<sup>fa+/+</sup></i>/SlcSS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain.congenicUnknownDiabetes ObesityLepr300113432199SHRSP.WKY-(<i>D3Wox20-D3Rat114</i>)/GcrcCongenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.congenicUnknown13432200SHRSP.WKY-(<i>D3Mgh16-D3Rat80</i>)/GcrcCongenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.congenicUnknown13432201SHRSP.WKY-(<i>D3Mgh16-D3Wox3</i>)/GcrcCongenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.congenicUnknown13432202SHRSP.WKY-(<i>D3Mgh16-rs65433898</i>)/GcrcCongenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.congenicUnknown13432203SHRSP.WKY-(<i>D3Mgh16-rs197649383</i>)/GcrcCongenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.congenicUnknown13432204SHRSP.WKY-(<i>D3Mgh16-D3Mit10</i>)/GcrcCongenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.congenicUnknown13437612SS-<i>Adamts16<sup>em1Bj</sup></i>This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.mutantUnknownAdamts16<sup>em1Bj</sup>1343761313441556LE-Tg(Cx3cr1-cre/ERT2)1OttcThis strain was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. Cre-ERT2 controllable with Tamoxifen.transgenicUnknown13441557LE-Tg(Cx3cr1-cre/ERT2)3OttcThis strain was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter.transgenicUnknown13446407SD-Tg(Camk2a-cre/ERT2)/ZiRrrcThe hemizygous rats have random insertion of calcium/calmodulin-dependent protein kinase II alpha (Camk2a)- cre/ERT2 (tamoxifen inducible Cre recombinase) transgene in the genome. This transgenic exhibits expression of cre/ERT2 fusion protein in neural populations where the mouse Camk2a promoter region found in the transgene is active.transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-11-07)13450922SD-<i>GEPR-3</i>Genetically Epilepsy-Prone Rats (GEPR-3) have moderate levels of seizure predisposition. This colony,initially referred to as an AGS (audiogenic response score) colony, was bred to exhibit clonic convulsions (moderate seizures with an ARS of 3) following a single wild running phase in response to sound. Siezures model human generalized tonic/clonic seizures.inbredUnknownseizure13451132BN-<i>Crb1<sup>m1</sup></i>This Brown Norway from Janvier rat strain spontaneously develops progressive focal retinal layer disorganization, loss of photoreceptors, cystic cavitation, and RMG abnormalities associated with early retinal vascular telangiectasia and late stage subretinal neovascularization. This phenotype bears reminiscent of human Macular telangiectasia 2. A deletion insertion mutation in exon 6 of the rat crb1 was identified to be responsible for this retinal phenotype.mutantUnknownCrb1<sup>m1</sup>1345113313451538FHH-Chr 1<sup>BN</sup>-<i>Dusp5<sup>em1Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC-CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449 and 464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid 121.mutantUnknownDusp5<sup>em1Mcwi</sup>1345153913452382SD-Tg(Htt<sup>*</sup/>)This rat model was developed by injection of SD embryos with construct containing rat huntingtin cDNA fragment with 51 CAG repeats (from HD patient) under control of the native rat huntingtin promoter.transgenicUnknownHTT6847213452406SHR/NHsdAkrSpontaneously Hypertensive RatSHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at the University of Akron breeding colonies, Akron, OhioinbredUnknown13452407WKY/NHsdAkrThese animals were bought from Harlan Indianapolis, Indiana U.S.A. and maintained at the University of Akron breeding colonies, Akron, Ohio.inbredUnknown13462044LE-Tg(Thy1-GCaMP6f)9RrrcPronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator.transgenicUnknown13462045LE-Tg(Thy1-GCaMP6f)7RrrcPronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator.transgenicLive Animals (as of 2021-02-12)13464263F344-<i>Il2rg<sup>em1Iexas</sup></i>This strain was established by CRISPR/Cas9 targeting rat Il2rg gene using electroporation. background strain: F344/Jcl. This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion of Il2rg gene. This strain grows normally under SPF condition.mutantLive Animals; Cryopreserved Sperm (as of 2018-01-02)ImmunologyIl2rg<sup>em1Iexas</sup>1346426413464268GH/HtruUniversity of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). Characteristics Develops hypertension, cardiac hypertrophy and vascular disease (Phelan 1968, Simpson and Phelan 1984, Simpson et al, 1994).inbredCryopreserved Embryo (as of 2018-01-02)13464270Seac:LISLister Rat, Sea:Lister HoodedIn 1990, this strain was introduced from Harlan Olac (UK) to Seiwa Institute of Experimental Animals. Then this strain was introduced to KYUDO Company in 2004.outbredCryopreserved Embryo (as of 2018-01-02)13464272CrljJclKud:SDIn 2004, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016.outbredCryopreserved Embryo (as of 2018-01-02)13464273JclKud:WIWistar ratsIn 1977, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016.outbredCryopreserved Embryo (as of 2018-01-02)13464320STOCK <i>Aspa<sup>em34Kyo</sup> Hcn1<sup>A354V</sup></i>/KyoThis double mutant strain was established by crossing WTC/Kyo (NBRP Rat No. 0020) and F344-<i>Aspa<sup>em34Kyo</sup></i> (NBRP Rat No. 0806). WTC/Kyo has a missense mutation (Hcn1A354V) in Hcn1 (Hyperpolarization-activated cyclic nucleotide-gated channel 1) gene and F344-<i>Aspa<sup>em34Kyo</sup></i> has a 16-bp deletion in the exon4 of Aspa (Aspartoacylase) gene (c.622_637del).inbredUnknownAspa<sup>em34Kyo</sup>|Hcn1<sup>A354V</sup>11564348|1346431913464326LE.W-Tg(Slc32a1-YFP*)1Yyan/VipThe original strain, W-Tg(Slc32a1-YFP*)1Yyan (NBRP No.0554 rat), was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006 (Uematsu et al. Cerebral Cortex (2008). This original strain rats were was crossed with Long-Evans rat (Iar:Long-Evans) for 10 generations to establish the congenic strain.congenicCryopreserved Embryo (as of 2018-01-03)13464327WKY.Cg-<i>clest</i>/IetWhen the depositor (The Institute of Environmental Toxicology ) conducted mating experiment using male Crl:CD(SD) rats, the offsprings of backcrossed-generation showed multiple malformations such as ectrodactylism, cleft palate or lip in 2013. These phenotype might be inherited in an autosomal recessive pattern. Therefore the congenic strain was established using WKY strain as the recipient strain.congenicCryopreserved Sperm (as of 2018-01-03)13464329FPL/IetFused pulmonary lobes, FPLThis spontaneous mutant strain wa found in a colony of Jcl:Wistar strain at the Institute of Environmental Toxicology in 1978: 3 rats out of 13 rats showed fused right pulmonary lobes with reduction deformity of middle pulmonary lobes. These rats also had the syndactylism or paten tof the eyelid. It was difficult to maintain this strain in homozygous condition, mating system has been changed to sib mating between heterozygous rats.inbredCryopreserved Embryo (as of 2018-01-03)Frem2<sup>fpl</sup>1346433013503336W;Cg-<i>Acr<sup>tm1Osb</sup></i>Acr KO, Acr {tm1 Osb}After homologous recombination using ES cells derived from hybrid (mix) breed of Slc:Wistar (female) and F344/NSlc (male), Acr KO strain was established by GLT at Osaka University. The genomic region including exon 1 to exon 3 is replaced by Neo resistance gene. After mating with Slc:Wistar, this strain is maintained by sib mating or with Slc:Wistar rats.mutantCryopreserved Sperm (as of 2018-01-12)13506176SS-<i>Nox4<sup>em2</sup>Ncf2<sup>em1</sup>McwiBreeding together of SS-Nox4em2Mcwi (RGDID: 4139883) and SS-Ncf2em1Mcwi (RGDID: 5144104), both models were generated by ZFN mutagenesis.mutantCryopreserved Sperm; Cryorecovery (as of 2018-11-12)Nox4<sup>em2Mcwi</sup>|Ncf2<sup>em1Mcwi</sup>4139868|514408913506737GKThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s, GK rats were initiated with breeding pairs in several places and also commercially available from Japanese breeders Charles River Japan, Yokohama, Oriental Yeast, Tokyo, Clea Japan Inc., Osaka (GK/Clea), Japan SLC, Shizuoka (GK/SLC), Takeda Lab Ltd., Osaka (GK/Taked), and from Taconic, USA (GK/Mol/Tac).inbredUnknown13506738GK/ParThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generation.In 1988, GK/Par substrain was established in Paris, France by initiating breeding pairs F35 from Japanese colonies .inbredUnknown13506739GK/JclThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.This strain was introduced from Tohoku University, and CLEA Japan Inc started its production and supply as GK/Jcl.inbredUnknown13506831SS-<i>P2rx7<sup>em10Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2mutantCryopreserved Sperm (as of 2018-02-21)P2rx7<sup>em10Mcwi</sup>1379280513506832SS-<i>P2rx7<sup>em13Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2mutantLive Animals; Cryopreserved Sperm (as of 2018-10-10)P2rx7<sup>em13Mcwi</sup>1379280613506918F344/NFischerCurtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from NIH.inbredUnknown13506919F344/NctrFischerCurtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Center for Toxicological Research, FDA.inbredUnknown13508588WIWistar ratThe Wistar rat is an outbred albino rat. This breed was developed at the Wistar Institute in 1906 for use in biological and medical research, and is notably the first rat developed to serve as a model organism.outbredUnknown13513909SD-Tg(Ren2)27<sup>-/-</sup>This is a littermate wild type control strain for SD-Tg(Ren2)27 (RGD:629501), which was generated by the mouse Ren2 renin gene along with its 5' and 3' flanking sequences being microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background.transgenicUnknown13524863LEC/CrljLong Evans CinnamonThe LEC/Crlj is available at Japan Charles River Inc. (Yokohama, Japan) since 1991 from the Center for Experimental Plants and Animals, Hokkaido University.inbredUnknown13524998UPLIn 1989, a femal sprague-Dawley rat with spontaneous cataracts was observed in the Upjohn Pharmaceuticals Limited Tsukuba Research Laboratory colony. The cataract was demonstrated to be hereditary and it was determined that there are two cataract types with different onset ages.inbredUnknown13525002Gunn ratsThis mutation was observed for the first time in the breeding stock of the rat colony of the Connaught Laboratories in 1934. It is of Wistar origin.segregating_inbredUnknown13592602SD-Tg(LRRK2*G2019S)418RwmThese rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag.transgenicCryopreserved Sperm; Cryorecovery (as of 2018-05-14)Parkinson's DiseaseLRRK2135314113592603SD-Tg(LRRK2)302RwnThese rats were created using BAC constructs consisting of the entire 144kb human wild type LRRK2 locus fused to a YPet reporter tag.transgenicCryopreserved Sperm; Cryorecovery (as of 2018-05-14)LRRK2135314113592604SD-Tg(LRRK2*G2019S)416RwmThese rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag.transgenicCryopreserved Sperm; Cryorecovery (as of 2018-05-14)Parkinson's Disease13592605F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561BrydF344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561The transgene consists of a SpeI fragment from plasmid pCAG-loxPSTOPloxP-ZsGreen (Addgene plasmid #51269, donated by Pawel Pelczar). Hemizygous animals contain approximately 4 copies of the transgene integrated at a site on Chromosome 2.transgenicLive Animals (as of 2019-03-18)13602097LE.Cg-(ROSA26) <sup>em1(CAG-Cas9*D10A)Ottc</sup>The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of CRISPR associated protein 9 (Cas9) catalytic mutant protein D10A under the control of CAG promoter inserted to the rat ROSA26 locus.mutantUnknown13628730SD-<i>Il2rg<sup>em1Ang</sup></i>TALEN targeting the 2nd exon of rat Il2rg gene was designed and mRNA coding these TALEN was microinjected into Crl:SD embyo.This strain carrying an 80 bp deletion generated a premature stop codon in the 3rd exon. No Il2rg protein was detected by western blot.mutantUnknownIl2rg<sup>em1Ang</sup>1362873113673907NMcwiWfsm:HSHeterogeneous stock25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy. These HS rats were derived from NMcwi:HS at the Medical College of Wisconsin and maintained at Wake Forest Baptist Medical Center starting in 2017.outbredUnknown13702080SD-<i>Ahr<sup>em1Soar</sup></i>Crispr/Cas9 targeted deletion of DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The established Ahr null strain lacks responsiveness to Ahr ligands.mutantCryopreserved Sperm; Cryorecovery (as of 2019-01-21)Toxicology, reproduction, cancerAhr<sup>em1Soar</sup>1370208113702084BBDP.BBDR-<i>Gimap5</i>/SunnTo generated Gimap5 congenic BBDP/WorSunn rats, the laboratory introgressed the wild-type Gimap5 locus derived from BBDR (BBDR/Wor) rats (Biomedical Research Models) into BBDP/WorSunn rats. Briefly, BBDP/WorSunn and BBDR/Wor rats were crossed, and the resulting F1 animals were backcrossed to BBDP/WorSunn rats. This step was followed by 10 more, marker- assisted backcrosses of Gimap5 heterozygous progeny to BBDP/WorSunn rats. After the eleventh backcross, nonlymphopenic rats were intercrossed, and their progeny homozygous for wild-type Gimap5 were selected for establishing the congenic non-lymphopenic BBDP/WorSunn line (also called BBDP/WorSunn.BBDR-Iddm2).congenicUnknownGimap562887113702085BBDP.BBDR-Gimap5, WF-(<i>D13Rat124-D13Mgh5</i>)/SunnThe Gimap5 congenic BBDP/WorSunn rats (BBDP.BBDR-Gimap5/Sunn) were corssed with the BBDP/WorSunn.WF-CD45 inbred line (BBDP.WF-(D13Rat124-D13Mgh5)/Sunn) to develop an inbred BBDP/WorSunn strain that would be congenic for both wild type Gimap5, hence non T lymphopenic (and consequently diabetes resistant), and for the WF-derived CD45.2 (RT7) allele (the original BBDP/WorSunn strain carries the CD45.1 allele).congenicCryopreserved Sperm; Cryorecovery (as of 2019-03-18)Ptprc|Gimap53451|62887113703119SD-<i>Lamp2<sup>em1</sup></i>This strain was produced by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion and results in knockout of Lamp2 protein in Lamp2 y/- male.mutantUnknownLamp2<sup>em1</sup>1370312113781890SD-<i>Rnaset2<sup>em1Sage</sup></i>Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats. WT, heterozygous and homozygous (KO) rats were born in the expected Mendelian ratio, and homozygous RNaseT2 KO rats were viable and fertile.mutantUnknownRnaset2<sup>em1Sage</sup>1378189113782128SD-<i>Pde4b<sup>em1Sage</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 1 of rat Pde4b into Sprague Dawley embryos. The 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 in rat was created in the mutant founders. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring.mutantCryopreserved Embryo (as of 2018-08-22)Pde4b<sup>em1Sage</sup>1378212913782146SD-<i>Bace1<sup>em1Sage-/-</sup></i>SD-<i>Bace1<sup>em1Sage-</sup></i>/<i>Bace1<sup>em1Sage-</sup></i>Bace1 (-/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)mutantUnknownBace1<sup>em1Sage</sup>1378214813782163SD-<i>Snca<sup>tm1(SNCA*)Sage</sup></i>This model contains a knockin of the A53T-mutated SNCA gene deeming the rat SNCA gene non-functional. The knockin contains humanized amino acids for the region spanning amino acids 53-122. The resulting model expresses a humanized A53T alpha-synuclein protein without endogenous rat alpha-synuclein.mutantLive Animals (as of 2018-08-24)13782164SD-<i>Snca<sup>em1Sage</sup></i>This model contains a deletion of the endogenous rat SNCA gene, encoding the alpha-synuclein protein. This model was generated using the CRISPR/Cas9 genome targeting strategy.mutantLive Animals (as of 2018-08-24)13782280SS-<i>Kcnj1<sup>em1Kasu+/+</sup></i>Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein. This strain is the wild type littermate from heterozygous cross.mutantUnknown13782351SS-<i>Kcnj1<sup>em1Kasu+/-</sup></i>Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is TCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single -cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes.mutantUnknownKcnj1<sup>em1Kasu</sup>1378235213782353SS-<i>Kcnj1<sup>em1Kasu-/-</sup></i>Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes.mutantUnknownKcnj1<sup>em1Kasu</sup>1378235213782371SD-<i>Cacna1f <sup>csnb</sup></i>congenital stationary night blindness ratA naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains.mutantUnknownCacna1f <sup>csnb</sup>1378237213792570WI-<i>Oprl1<sup>m1Hubr+/-</sup></i>The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.mutantUnknownOprl1<sup>m1Hubr</sup>1379257113792572WI-<i>Oprl1<sup>m1Hubr-/-</sup></i>NOPr knockout ratThe original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.NOPr is completely absent in homozygous mutants.mutantUnknownOprl1<sup>m1Hubr</sup>1379257113792573SD-<i>Lep<sup>em1Sage+/-</sup></i>This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levelsmutantCryopreserved Embryo (as of 2018-09-13)CardiovascularLep<sup>em1Sage</sup>1290492713792575SD-<i>Lep<sup>em1Sage+/+</sup></i>These wild type rats are littermates of homozygous knockout rats from heterozygote matings. The Lepr knockout model possesses a 151 bp deletion spanning the exon 1/intron 1 junction of the Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levelsmutantUnknown (as of 2018-09-13)Cardiovascular13792606SD-<i>Cd59<sup>em1Ask</sup>-/-</sup></i>SD-<i>Cd59<sup>em1</sup>-/</sup></i><i>Cd59<sup>em1</sup>-</sup></i>The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants.mutantUnknownCd59<sup>em1Ask</sup>1379272013792607SD-<i>Cd59<sup>em1Ask+/+</sup></i>The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion in exon 3. No protein expression was detected in the blood smear of homozygous mutants. Breeding of CD59 +/- rats was done to generate wildtype (CD59+/+)and homozygous mutant (CD59-/-) rats.mutantUnknown13792682SD-<i>Abcc6<sup>em2Qlju+/-</sup></i>This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.mutantUnknownAbcc6<sup>em2Qlju</sup>1041384613792683SD-<i>Abcc6<sup>em2Qlju+/+</sup></i>This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. This wild type mutant is the wild type offspring from the cross of heterozygous mutants.mutantUnknown13792701SD-<i>Trpv1<sup>em1Sage-/-</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created. Homozygous knockout rats exhibit complete loss of Trpv1 protein.mutantCryopreserved Embryo (as of 2018-09-21)Trpv1<sup>em1Sage</sup>1379270213792705SD-<i>Trpv1<sup>em1Sage+/+</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created ( SD-Trpv1em1Sage-/-). This wild type mutant is the wild type offspring from the cross of heterozygous mutants.mutantUnknown13792727HanRj:WIZentralinstitut fur Versuchstierzucht (Hannover) 1982 (from Allington Farm - UK 1964). This strain was selected by DONALDSON in 1906 at the Wistar Institute (USA), from a batch belonging to Chicago University (RUSSEL-LINDSAY, 1979).outbredUnknown13792794SD-<i>Fh<sup>em1+/-</sup></i>A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. No homozygous -/- mutant was revealed in litters.mutantUnknownFh<sup>em1</sup>1379279713792795SD-<i>Fh<sup>em1+/+</sup></i>A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. Breeding of Fh +/- rats was done to generate wildtype (Fh+/+)and Fh (+/-). No homozygous mutant were observed.mutantUnknown13792801SS-<i>Nlrp3<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion of exon 1 in the Nlrp3 gene.mutantCryopreserved Sperm (as of 2018-09-28)Nlrp3<sup>em2Mcwi</sup>1379279913792803SS-<i>P2rx7<sup>em12Mcwi</sup></i>This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp insertion in Exon 2 of the P2rx7 gene.mutantUnknownP2rx7<sup>em12Mcwi</sup>1379280213792808SS-<i>Ptk2b<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.mutantUnknownPtk2b<sup>em1Mcwi</sup>1379281013792811SS-<i>Ptk2b<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a7-bp deletion in exon 2.mutantUnknownPtk2b<sup>em3Mcwi</sup>1379281213792813SHRSP-<i>Spp1<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene.mutantCryopreserved Sperm (as of 2018-10-01)Spp1<sup>em2Mcwi</sup>1379281413792821SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1McwiSD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.transgenicUnknown13792822SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2McwiSD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line B.transgenicUnknown13792823SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)3McwiThe Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line C.transgenicUnknown13792825SD-Tg(CAG-loxP-stop-loxP-Mfn1-GFP)1McwiThe Sleeping Beauty transposon system was used to introduce a Mfn1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette. This is line A.transgenicUnknown13792827WKY-Tg(Ubc-cre/ERT2)4McwiThe Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line D.Cre activity is detected even without tamoxifen induction.transgenicCryopreserved Sperm (as of 2018-10-02)13792828WKY-Tg(Ubc-cre/ERT2)5McwiThe Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line E.Cre activity is detected even without tamoxifen induction.transgenicCryopreserved Sperm (as of 2018-10-02)13793372SS-<i>Tlr4<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2.mutantUnknownTlr4<sup>em1Mcwi</sup>1379337313793374DA-<i>Tph1<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4.mutantCryopreserved Sperm (as of 2018-10-03)Tph1<sup>em4Mcwi</sup>1379337513793376SS-<i>Avpr2<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2.mutantCryopreserved Embryo (as of 2018-10-03)Avpr2<sup>em4Mcwi</sup>1379337713793378SS-<i>Avpr2<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2.mutantCryopreserved Sperm (as of 2018-10-03)Avpr2<sup>em5Mcwi</sup>1379337913799346SS-<i>Cgnl1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 80-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryosmutantCryopreserved Sperm (as of 2018-10-10)Cgnl1<sup>em1Mcwi</sup>1379934713799348SS-<i>Cgnl1<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 88-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryosmutantCryopreserved Sperm (as of 2018-10-10)Cgnl1<sup>em2Mcwi</sup>1379934913799350T2DN-<i>F2r<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos.mutantCryopreserved Sperm (as of 2018-10-10)F2r<sup>em1Mcwi</sup>1379935113800555F344/IcoCrlFrom mating #344 of rats purchased from a local breeder (Fischer). The colony was originated by M. R. Curtis, Columbia University in 1920. To the Germ-Free Animal Laboratory at CNRS, Gif-sur-Yvette, France from the Lobund Institute, University of Notre-Dame, South Bend, Indiana, U.S.A. Subsequently introduced to Charles River France in 1970 as an axenic colony.inbredUnknown13800556F344-<i>Hsd11b2<sup>em1Jmul-/-</sup></i>F344-<i>Hsd11b2<sup>em1Jmul-</sup>/Hsd11b2<sup>em1Jmul-</sup></i>The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG.mutantUnknownHsd11b2<sup>em1Jmul</sup>1380056013800557F344-<i>Hsd11b2<sup>em1Jmul+/+</sup></i>F344-<i>Hsd11b2<sup>em1Jmul+</sup>/Hsd11b2<sup>em1Jmul+</sup></i>This is the wild-type litter mates of the Hsd11b2 F344 mutants created by ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG.mutantUnknown13800746SS-<i>F8<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos.mutantCryopreserved Sperm (as of 2018-10-17)F8<sup>em1Mcwi</sup>1380074713800749Lew-<i>Glp1r<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos.mutantUnknownGlp1r<sup>em1Mcwi</sup>1380075013800810SS-<i>Kcnq1<sup>em5Mcwi</sup></i>CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2018-10-18)Kcnq1<sup>em5Mcwi</sup>1380081313800825FHH-<i>Muc1<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos.mutantCryopreserved Sperm (as of 2018-10-18)Muc1<sup>em1Mcwi</sup>1380082713800838FHH-<i>Mybphl<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos.mutantUnknownMybphl<sup>em1Mcwi</sup>1380084113800845FHH-<i>Mybphl<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 1-bp insertion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos.mutantUnknownMybphl<sup>em2Mcwi</sup>1380084613800848SS-<i>Nlrp3<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene.mutantUnknownNlrp3<sup>em1Mcwi</sup>1380085013800869SS-<i>P2ry2<sup>em6Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene.mutantUnknownP2ry2<sup>em6Mcwi</sup>1380087013800871SS-<i>P2ry2<sup>em7Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene.mutantUnknownP2ry2<sup>em7Mcwi</sup>1380087313800875SS-<i>Prl<sup>tm1(PRL)Mcwi</sup></i>CRISPR/Cas9 and plasmid donor containing floxed human prolactin cDNA were used to insert the human cDNA into the start coden of rat prolactin genemutantUnknownPRL73618713800877LH-Chr 17<sup>LN</sup>-<i>C17h6orf52<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a net 10-bp insertion in exon 2 of rat C17h6orf52.mutantCryopreserved Sperm (as of 2018-10-18)C17h6orf52<sup>em2Mcwi</sup>1380087813825143WKY-<i>Gja5<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos.mutantUnknownGja5<sup>em1Mcwi</sup>1382514413825147SS-<i>Per1<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos.mutantUnknownPer1<sup>em3Mcwi</sup>1382514813825196SS-<i>Sh2b3<sup>tm1Mcwi</sup></i>CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exonsmutantCryopreserved Sperm (as of 2018-11-21)Sh2b3<sup>tm1Mcwi</sup>1439461013825199WI-<i>Mc4r<sup>m1Hubr</sup></i>The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.mutantUnknownMc4r<sup>m1Hubr</sup>1382520013838845SD-<i>Ahr<sup>em2Sage</sup></i>ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene.This ZFN model contains a 29-bp deletion in the rat Ahr gene.mutantUnknownAhr<sup>em2Sage</sup>12679051014390067WI-<i>Slc6a4<sup>m1Hubr-/-</sup></i>The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The homozygoous mutant rats were generated by incrossed between heterozygous Slc6a4 knock out rats.mutantUnknownSlc6a4<sup>m1Hubr</sup>1439006814390069WI-<i>Slc6a4<sup>m1Hubr+/-</sup></i>The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The heterozygoous mutant rats were used to generate homozygous Slc6a4 knock out rats.mutantUnknownSlc6a4<sup>m1Hubr</sup>1439006814390082SD-Tg(Fos-LacZ)BhopeThe lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Rats were rederived from frozen embryos in 2002 and bred onto SD background for >35 generations at NIDA IRP (Bruce Hope lab)transgenicUnknown14390083WI-Tg(Fos-LacZ)BhopeThe lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Initial SD rats were then bred onto Wistar background for >10 generations at NIDA IRP (Bruce Hope lab)transgenicUnknown14392784ACI.SD-<i>Esr1<sup>em1Soar</sup></i>This strain was produced by backcrossing the ZFN induced 482 deletion allele (Esr1em1Soar) in HsdHot:SD to the ACI/SegHsd background for 12 generations. ACI strain is particularly sensitive to Estrogen-induced tumorigenesis.mutantUnknown (as of 2019-02-28)Esr1<sup>em1Soar</sup>1291073614392813SD-<i>Cftr<sup>em1Sage+/-</sup></i>Cftr ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. This Cftr heterozygous rats exhibited similar bioelectric and other characteristics to wild-type.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2019-03-04)Cftr<sup>em1Sage</sup>1439281414392815SD-<i>Cftr<sup>em1Sage-/-</sup></i>CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats are produced by crossing the Cftr heterozygous rats.mutantUnknown (as of 2019-03-04)Cftr<sup>em1Sage</sup>1439281414392817SD-<i>Cftr<sup>em1Sage+/+</sup></i>CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats and wild-type rats are produced by crossing the Cftr heterozygous rats.mutantUnknown14394485SD-<i>Bace1<sup>em1Sage</sup></i>The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)mutantUnknownBace1<sup>em1Sage</sup>1378214814394486SD-<i>Bace1<sup>em1Sage+/-</sup></i>SD-<i>Bace1<sup>em1Sage+</sup>/Bace1<sup>em1Sage-</sup></i>The Bace1 (+/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)mutantUnknownBace1<sup>em1Sage</sup>1378214814394487SD-<i>Bace1<sup>em1Sage+/+</sup></i>SD-<i>Bace1<sup>em1Sage+</sup>/Bace1<sup>em1Sage+</sup></i>The Bace1 (+/+) rats were generated by crossing SD-Bace1em1Sage. The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)mutantUnknown14394488Lew-<i>Glp1r<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos.mutantUnknownGlp1r<sup>em2Mcwi</sup>1439448914394491Lew-<i>Glp1r<sup>em3Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos.mutantUnknownGlp1r<sup>em3Mcwi</sup>1439449214394494SS-<i>Kcnj2<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos.mutantCryopreserved Sperm (as of 2019-03-22)Kcnj2<sup>em2Mcwi</sup>1439449514394496SS-<i>Kcnj2<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 2-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos.mutantUnknownKcnj2<sup>em4Mcwi</sup>1439449714394501SHR-<i>Klrb1a<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos.mutantCryopreserved Sperm (as of 2019-03-25)Klrb1a<sup>em1Mcwi</sup>1439450314394504SHR-<i>Klrb1a<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos.mutantUnknown (as of 2019-03-25)Klrb1a<sup>em2Mcwi</sup>1439450514394506SS-<i>P2ry2<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3.mutantCryopreserved Sperm (as of 2019-03-25)P2ry2<sup>em5Mcwi</sup>1439450714394508BBDR.BBDP-(D4Mit6-D4Mit7)-<i>Tlr4<sup>em5Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos.mutantCryopreserved Sperm (as of 2019-03-25)Tlr4<sup>em5Mcwi</sup>1439450914394515LE-<i>Grin2b<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3.mutantUnknownAutism, Developmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/GRIN2B>SFARI GENE</a>)Grin2b<sup>em1Mcwi</sup>1439451714394518LE-<i>Arid1b<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4.mutantUnknownAutism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/ARID1B>SFARI GENE</a>)Arid1b<sup>em1Mcwi</sup>1439451914394520SS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1McwiSS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1The Sleeping Beauty transposon system was used to introduce a Rpl10a-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassettetransgenicUnknown14394616DA-<i>Tph2<sup>em3Mcwi+/+</sup></i>This wild type strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.mutantUnknownTph2<sup>em3Mcwi</sup>1040282014394617DA-<i>Tph2<sup>em3Mcwi+/-</sup></i>The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.mutantUnknownTph2<sup>em3Mcwi</sup>1040282014394618DA-<i>Tph2<sup>em3Mcwi-/-</sup></i>This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.mutantUnknownTph2<sup>em3Mcwi</sup>1040282014394619DA-<i>Tph2<sup>em2Mcwi+/+</sup></i>This wild type strain was produced by crossing Tph2em2Mcwi heterozygous rats and confirmed by sequencing. The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.mutantUnknown14394620DA-<i>Tph2<sup>em2Mcwi+/-</sup></i>The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.mutantUnknownTph2<sup>em2Mcwi</sup>1040281714394621DA-<i>Tph2<sup>em2Mcwi-/-</sup></i>The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing.mutantUnknownTph2<sup>em2Mcwi</sup>1040281714398460SS-<i>Cd40<sup>em1Uthal-/-</sup></I>Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein.mutantUnknownCd40<sup>em1Uthal</sup>1439846114398463SS-<i>Prr5<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene.mutantCryopreserved Sperm (as of 2019-04-19)Prr5<sup>em1Mcwi</sup>4081825614398465SS-<i>Prr5<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene.mutantCryopreserved Sperm (as of 2019-04-19)Prr5<sup>em2Mcwi</sup>4081825514398479SS-<i>Xdh<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos.mutantUnknownXdh<sup>em1Mcwi</sup>1439848014398481SS-<i>Xdh<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos.mutantUnknownXdh<sup>em2Mcwi</sup>1439848214398499LE-<i>Drd1<sup>em1(iCre)Berke</sup></i>The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE.mutantLive Animals (as of 2021-02-12)Drd1<sup>em1(iCre)Berke</sup>1439850014398734LE-<i>Adora2a<sup>em1(iCre)Berke</sup></i>The CRISPR system was used to created target insertion of iCre recombinase immediately after Adora2a gene, with P2A linker, of the embryos of BluHsd:LE.mutantLive Animals (as of 2021-02-12)Adora2a<sup>em1(iCre)Berke</sup>1439873514398825SD-<i>Fah<sup>em15Dlli-/-</sup></i>This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates.mutantUnknownFah<sup>em15Dlli-/-</sup>1439882614398828SD-<i>Fah<sup>em10Dlli-/-</sup></i>This strain was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermatesmutantUnknownFah<sup>em10Dlli-/-</sup>1439882914402419LE-<i>Chrna5<sup>em18Pas</sup></i>The Zinc Finger Nuclease system was used to create184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous.mutantUnknownChrna5<sup>em18Pas</sup>1440242014402421LE-<i>Chrna5<sup>em20(D398N)Pas</sup></i>The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous.mutantUnknownChrna5<sup>em20(D398N)Pas</sup>1440242214694847LE-<i>Pvalb<sup>em1(flpo)Berke</sup></i>/RrrcA double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. The CRISPR/Cas9 system was used to knock in the plasmid into the targeted gene in the Crl:LE embryo. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. )mutantUnknownPvalb<sup>em1(flpo)Berke</sup>1469484914694998SD-<i>Sdhb<sup>em1Ast</sup></i>This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 4 bp-deletion in Sdhb.mutantUnknown14694999SD-<i>Sdhb<sup>em2Ast</sup></i>This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 6 bp-deletion in Sdhb.mutantUnknown14695000SD-<i>Sdhb<sup>em3Ast</sup></i>This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 15 bp-deletion in Sdhb.mutantUnknown14695002SD-<i>L1cam<sup>em1Jgn</su></i>The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain.mutantUnknownL1cam<sup>em1Jgn</sup>3859901514695003SD-<i>L1cam<sup>em2Jgn</su></i>The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. No protein expression was detected in the brain.mutantUnknownL1cam<sup>em2Jgn</sup>1469678814695004BBDR.F344-(D4Mgh24-D4Rhw6),BBDP-(D4Rhw6-D4Rhw10)/Rhw3 Mb of F344 DNA introgressed on Chr.4 between D4Mgh24 (73.75 Mb) and D4Rhw6 (76.83 Mb), and BB diabetes prone (DP) DNA introgressed from D4Rhw6 to D4Rhw10 (the most distal marker the end of the chromosome)congenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-06-27)14695026W-Tg(Crh-cre)MsgCre recombinase has been inserted into the genome under the control of the Crh promoter. Generated on Wistar and backcrossed to Wistar every generation.transgenicLive Animals (as of 2021-02-12)14695028SD.DA-<i>Kcnh2<sup>tm(EGFP-Pac)1Qly </sup></i>This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.3kb 5' and 2.1kb 3' homology arm. The Kcnh2 gene 7th and 8th exons are replaced with a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain.mutantUnknown14695029SD.DA-<i>Kcnh2<sup>tm(FRT-CAG-EGFP-IRES-Pac-FRT)1Qly </sup></i>This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 7.5kb 5' and 1.6kb 3' homology arm. A FRT-CAG-EGFP-IRES-Pac-FRT cassette is inserted into the intron between 8th and 9th exons of Kcnh2 gene. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strainmutantUnknown14695030SD.DA-<i>Pex1<sup>Tm(G843D-FRT-CAG-Pac-FRT)1Qly</sup></i>This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 5.8kb 5' and 1.7kb 3' homology arms. A G843D point mutation is introduced into the Pex1 gene. The 12th and 13th exons are flanked with two loxP sites. A FRT-CAG-Pac-FRT cassette is inserted into the intron between Pex1 13th and 14th exon. This strain mimics the Peroxisomal Disorders. Heterozygote does not show any abnormalities.mutantUnknown14695031SD.DA-<i>Il2rg<sup>Tm(G843D-FRT-CAG-Pac-FRT)1Qly</sup></i>This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.0kb 5' and 1.8kb 3' homology arms and a FRT-CAG-Pac-FRT cassette. The FRT-CAG-Pac-FRT cassette is inserted into the intron between Il2rg 4th and 5th exon. No genomic sequence is deleted. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain.mutantUnknown14695032SD-Tg(CAG-loxP-mCherry-loxP-EGFP)1QlyA CAG-loxP-mCherry-loxP-EGFP cassette was injected into SD zygote to generate this line. The integration site is not determined. This transgenic line could be mated to other rat lines that express Cre/CreER for lineage tracing.transgenicUnknown14695033SD-Tg(CAG-Flpe)QlyA CAG-Flpe cassette was injected into SD zygote to generate this line. The integration site is not determined.This transgenic line could be used to mate with other rat models that contains FRT sites to remove the cassette that is flanked by those FRT sites.transgenicUnknown14695034ZUC-<I>Lepr</I><sup>fa</sup>.BN-(D1Rat183-D1Rat90)/SteCongenic for distal half of Chromosome 1 from D1Rat183 to D1Rat90 from Brown Norway (BN) on the UC Davis ZUC Lepr faSte/+ strain background. The genetic backgound of the ZUC strain carries a defective leptin receptor on Chromosome 4.congenicUnknown14695052ACI-Tg(ROSA26-ALPP)RrrcF344-Tg(ROSA26-ALPP)EpsRrrc (RGD:1566458) received in 1999 from Dr. Eric Sandgren, Univ. Wisconsin-Madison. Since 1999 bred on ACI background.transgenicCryopreserved Sperm (as of 2019-07-01)ALPP131439514695053ZDF-<i>Cnr1<sup>em1</sup></i>/RrrcZDF-<i>Cnr1<sup>em1</sup></i>11bp deletion from genomic DNAfor the cannabinoid-1 receptor (Cnr1)using Zinc-Fingers Nucleases. Animals are resistant to the development of type-2 diabetes.mutantUnknown14695054F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551BrydF344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551transgenicLive Animals (as of 2019-07-01)14695055MHS/RomanMilan Hypertensive StrainInbred hypertension model linked to a mutation in Add1 gene that has been validated as one of the genes linked to hypertension in numerous human genetic studies. Inbred strain originally developed by Dr. Bianchi in Milan in 1979.inbredUnknown14695058SD-<i>Add3<sup>em1Roman</sup></i>frame shift deletion in an exon 12 of Add3 gene causing a stop codon and loss of function. SD outbred background.mutantUnknown14695059BBDP/WorSunn.WAG-rnu/SunnTo develop BBDP rats congenic for the rnu mutation (nude BBDP), researchers introgressed the rnu mutation from inbred rnu/rnu WAG rats (obtained from Biomedical Research Models) using marker assisted genotyping.congenicUnknown14695060WKY-Tg(Ef1a-GFP)TjaTransgenic strain using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP) under the rat elongation factor 1 alpha (Ef1a) promoter. Two integration sites located on chromosome 8:28170658 and chromosome 1:276465837, both located in intronic gene areas, Jam3 (RGD:1303248) intron 1 and Vti1a (RGD:621490) intron 6, respectively. The Jam3 intron 1 is 51bp long, and the transgene resides at 37kb from exon 1 and 13kb from exon 2. In Vti1a intron 6, 102 bp long, the transgene is located at 81.4 kb from exon 5 and 21 kb from exon 6.transgenicUnknown14695061W/LobMale L-W develop spontaneous tumors in the anterior and ventral prostate and the seminal vesicle @ an average of 20 months. Tumors can be induced with N-methylnitrosourea and testosterone propinate in an average of 10 months. A cell line of a prostate adenocarcinoma was also created from the strain (PAIII) and can be administer SC in L-W rats with palpable tumor in 7-14 days and metastasis to the lymph nodes and lungs in 28-30 days.mutantUnknown14695063BN.LEW-(<i>D10Rat258 and D10Rat51</i>)/SsnSevere osteopetrosis with numerous non-functioning osteoclasts. Locus on chromosome 10. Homozygotes not fertile, need to test breed to ID heterozygotes. Homozygotes have no teeth, require ground food. One of only 4 osteopetrotic mutations in rat. Genetic lesion is not yet known but mutation is inherited in an autosomal recessive manner. The candidate gene region has been localized to Chr 10 between D10Rat258 and D10Rat51. original background strain is LEW/Ssn.congenicUnknown14695083W/LnneAudiogenic Wistar ratWistar rats maintained at the animal facility of the Ribeirao Preto School of Medicine at the University of Sao Paulo, Brazil, were tested for audiogenic seizures, using as criteria an SI and the L1 (ref. RGD:14695082). The WAR colony foundation stock was produced by mating animals displaying at least procursive behaviors in three consecutive tests, one every 4 days (two males and four females). Each couple produced two or three lit-ters, from which selected individuals displaying the highest SI and shortest L1 were mated, at adult age,with their fathers and mothers. From the second generation on, brother and sister matings were done, in a ratio of one male to two females, selected accordingto the criteria above.inbredUnknown14695085SD-<i>Trim63<sup>em1(hiLuc)</sup></i>/RrrcThe use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, can be used as a universalbiomarker of skeletal muscle atrophyin vivo, and has abioluminescent readout compatible with whole animal imagingmodalities.mutantUnknownTrim63<sup>em1(hiLuc)</sup>1469678914695086Zuc/VcJwZucker fattyThe original background strain derived from Sherman and Merck stock M rats (13 M strain). Obese animals produced by crossing homozygous obese males to heterozygous lean females.inbredUnknown14695088WMS/SimfBRMunich WistarReceived from Munich, Germany via the V.A. San Francisco as line bred stock. Caesarean rederived when pedigreed brother x sister matings began. Selected for surface glomeruli and prominent elongated nephrons at the 6th, 12th and 18th .This strain also possess elongated nephrons. Unlike other Wistar strains with surface glomeruli, these animals do not become proteinuric as they age, which allows for the study of long term, chronic models. Age related proteinuria and spontaneous renal disease could interfere with experimentally-induced conditions.inbredCryopreserved Embryo (as of 2019-07-03)14695547LEW-Tg(HLA-B*2705,B2M)33-3TrgThis strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 55 copies of HLA-B*2705 and 29 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center .transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08)B2M|HLA-B735892|135283614695548LEW-Tg(HLA-B*2705,B2M)21-4HTrgThis strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 150 copies of HLA-B*2705 and 90 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center .transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08)B2M|HLA-B735892|135283614696715SD-<i>Htr7<sup>em1Msu</sup></i>CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene.mutantUnknownHtr7<sup>em1Msu</sup>1469671614696719F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi+/+</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the wild type mutant.mutantUnknown14696720F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi-/-</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the homozygous mutant.mutantUnknown14696721F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi-/+</sup></i>These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the heterozygous mutant.mutantUnknown14696722SD-<i>Cyp3a23/3a1<sup>em1Myliu</sup></i>,<i>Cyp3a2<sup>em1Myliu</sup></i>This rat strain is a double knock out for Cyp3a23/3a1 and Cyp3a2 created by using CRISPR/Cas9 targeting exons of Cyp3a23/3a1 and Cyp3a2. This strain carries a 22-bp deletion of Cyp3a23/3a1 and a 10-bp deletion of Cyp3a2 on Sprague Dawley background.mutantUnknownCyp3a23-3a1<sup>em1Myliu</sup>|Cyp3a2<sup>em1Myliu</sup>14696724|1469672514700890SD-Tg(Cx3cr1-cre/ERT2)3OttcThis strain was generated by microinjection of Sprague-Dawley embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter.transgenicLive Animals (as of 2021-02-12)14975242ACI.FHH-(rs105487995-rs105373896)/McwiThis congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.congenicUnknown14975243ACI.FHH-(rs105487995-rs106411696)/McwiThis congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.congenicUnknown14975244ACI.FHH-(rgdv393055223-rs107095981)/McwiThis congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] ((also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.congenicUnknown14975245ACI.FHH-(rgdv393055223-rs198922144)/McwiThis congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.congenicUnknown14975246ACI.FHH-(rgdv393055223-rs198076037)/McwiThis congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.congenicUnknown14975247ACI.FHH-(rs105373896-rgdv253272372)/McwiThis congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.congenicUnknown14975248ACI.FHH-(rs198076037-rs105278863)/McwiThis congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.congenicUnknown14975305F344-<i>Bmpr2<sup>em1Sage+/-</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. The strains of both sexes were confirmed Bmpr2 haplodeficiency.mutantUnknownBmpr2<sup>em1Sage</sup>1498158714981588F344-<i>Bmpr2<sup>em2Sage+/-</sup></i>These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. The strains of both sexes were confirmed Bmpr2 haplodeficiency.mutantUnknownBmpr2<sup>em2Sage</sup>1498158914981597SD-Tg(SOD1*G93A)26DwcTacSD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation. Originally created by John Kulik at Wyeth. Transgenic Model of SOD1 mediated Amyotrophic Lateral Sclerosis (ALS, Lou Gehrig's Disease). Came to Taconic in April 2002 for David Howland at Wyeth for distribution as an Emerging Model. Joint collaboration between Wyeth and The ALS Association.transgenicUnknownSOD173085514985210LE-<i>Cyfip1<sup>em1Sage+/-</sup></i>The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8.mutantUnknownCyfip1<sup>em1Sage</sup>1498521114995941WpkWistar polycystic kidney ratThe wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain.mutantUnknownTmem67<sup>wpk</sup>1499594315017093Wpk <sup>+/-</sup>Wpk heterozygous ratThe wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L).mutantUnknownTmem67<sup>wpk</sup>1499594315017094Wpk <sup>-/-</sup>Wpk homozygous ratThe wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L).mutantUnknownTmem67<sup>wpk</sup>1499594315036806WKAH/TjWistar-King A, WKAWKAH/Tj inbred rats were bred in the Institute for Animal Experimentation, the University of Tokushima School of Medicine, under specific pathogen free conditions.inbredUnknown (as of 2019-11-18)15045605SD-Tg(Prnp-LacZ/EGFP)12084This transgenic strain line 12084 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter.transgenicUnknown15045606SD-Tg(Prnp-LacZ/EGFP)12085This transgenic strain line Tg12085 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter.transgenicUnknown15045607SD-Tg(Prnp-Prnp)2919This transgenic strain line Tg2919 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter.transgenicUnknown15045608SD-Tg(Prnp-Prnp)2922This transgenic strain line Tg2922 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter.transgenicUnknown15090817WI-<i>Ahr<sup>em1Hyama+/-</sup></i>Heterozygous rats carrying a defective exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI.mutantUnknownAhr<sup>em1Hyama</sup>1509081815090819WI-<i>Ahr<sup>em1Hyama-/-</sup></i>The homozygous rats carrying 2 defective Ahr genes. The deletion of part of exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI.mutantUnknownAhr<sup>em1Hyama</sup>1509081818182944SS-<i>Vwf<sup>em2Mcwi-/-</sup></i>CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryosmutantLive Animals (as of 2020-01-14)Bleeding DisordersVwf<sup>em2Mcwi</sup>1818294518182946SS-<i>Vwf<sup>em3Mcwi-/-</sup></i>CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryosmutantCryopreserved Sperm (as of 2020-01-14)Bleeding DisordersVwf<sup>em3Mcwi</sup>1818294718337282Iar: LELong-Evans RatsThis strain was established by Dr. Long and Dr. Evans in 1915. This traces its roots to Monash University to Tohoku University in 1984; to Institute for Animal Reproduction through acquisition in 1996.outbredUnknownOphthalmology, Behavior19165133F344;SD-<i>C3<sup>em1Linf</sup></i>This mutant strain was created by CRISPR/Cas9 genome editing system. The mutant carried insertion of a premature termination codon in exon 2 and was predicted to result in loss of protein expression due to non-sense mediated decay of mRNA. The heterozygous knock out rats (F344/Sprague Dawley mixed background) were bred to each other, and the pups were genotyped to identify the WT and C3 homozygous knock out littermates.mutantUnknownC3<sup>em1Linf</sup>1916513419259464SHR-<i>Camk2n1<sup>em1Tja-/-</sup></i>SHR-<i>Camk2n1<sup>em1Tja-</sup>/Camk2n1<sup>em1Tja-</sup></i>SHR-Camk2n1-/- knockout rats were generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1, into one-cell stage SHR/NCrl embryos that were implanted into pseudopregnant rats. Heterozygous progeny, from a founder harboring a 38bp deletion in Camk2n1, were intercrossed to generate homozygous knockout rats.mutantUnknownCamk2n1<sup>em1Tja</sup>1925946521079475SD-<i>Lepr<sup>em4Lizh</sup></i>The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR.mutantUnknown21083604SD-ROSA26 <sup>em1(LTR-nLuc)Ottc</sup>The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus.mutantUnknown21409748DA/MmabDark AgoutiDark Agouti rats which were bred and housed at the Military Medical Academy in Belgrade, SerbiainbredUnknown21409752DA/IbissDark AgoutiinbredUnknown25314294MWF/ZtmMunich Wistar FromterFromter selected from outbred Munich-Wistar rats for large numbers of superficial glomeruli.inbredUnknown25330087LE-<i>Cntnap2<sup>em1Mcwi</sup></i>The rat strain was produced by injecting CRISPR/Cas9 targeting rat Cntnap2 into Crl:LE embryos. The result is a 1-bp deletion in exon 6 of the gene.mutantUnknownAutism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Bipolar disorder (from <a href=https://gene.sfari.org/database/human-gene/CNTNAP2>SFARI GENE</a>)Cntnap2<sup>em1Mcwi</sup>2533010125330088LE-<i>Chd8<sup>em1Mcwi</sup></i>The rat strain was produced by injecting the CRISPR/Cas9 system targeting rat Chd8 gene of Crl:LE embryos. The result is a 5-bp deletion in exon 3 of rat Chd8 gene.mutantUnknownAutism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia (from <a href=https://gene.sfari.org/database/human-gene/CHD8>SFARI GENE</a>)Chd8<sup>em1Mcwi</sup>2533010025330089LE-<i>Nrxn1<sup>em1Mcwi</sup></i>The rat strain was produced by injecting CRISPR/Cas9 targeting rat Nrxn1 into Crl:LE embryos. The result is a 4-bp deletion in exon 1.mutantUnknownAutism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia, Bipolar disorder (from <a href=https://gene.sfari.org/database/human-gene/NRXN1>SFARI GENE</a>)25330091SS-<i>Rictor<sup>em4Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene.mutantUnknownRictor<sup>em4Mcwi</sup>4081825425330093SD-<i>Mir146b<sup>em1Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b.mutantUnknown25330342SS-<i>Rr1<sup>em3Mcwi</sup></i>CRISPR/Cas9 was used to introduce a large deletion in the regulatory region near rat Npr3 gene. The deletion location is at the genomic region chr2:82815769-82845639 (Rn5)mutantUnknown25394526LE-<i>Dyrk1a<sup>em3Mcwi</sup></i>The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene.mutantUnknownDevelopmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/DYRK1A>SFARI GENE</a>)25394528SD-<i>Ephx2<sup>em2Mcwi</sup></i>CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3.mutantUnknownEphx2<sup>em2Mcwi</sup>2539452925394530LE-<i>Scn2a<sup>em1Mcwi</sup></i>The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT).mutantUnknownScn2a<sup>em1Mcwi</sup>2539453125394532LE-<i>Scn2a<sup>em2Mcwi</sup></i>The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 4-bp deletion in exon 5 of the gene.mutantUnknownScn2a<sup>em2Mcwi</sup>2539453325824850NHla:SDThe colony history began with a colony of rats established by Robert Dawley around 1925. SD rats are often referred to as "Sprague-Dawley" Mr. Dawley used both his name and the maiden name, "Sprague", of his wife to create the name of the stock. The colony then went to Sprague Dawley, Inc. in 1945. NIH began a closed colony with animals obtained from Sprague Dawley, Inc. Hilltop Lab Animals, Inc. received animals from NIH in 1984. Through cesarean rederivation, the animals were fostered onto gnotobiotic rats in isolation. Descendants of these animals then became the colonies currently available. All colony histories contain some possibility of inaccuracy. This information is provided to the best of Hilltop's knowledge.outbredUnknown27095885SS.BN-(<i>D13Hmgc41-D13Rat101</i>)-<i>Ren<sup>em2Mcwi</sup></i>This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Rat101)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5.mutantUnknownRen<sup>em2Mcwi</sup>2709588630309956SS.BN-(<i>D13Hmgc41-D13Rat101</i>)/McwiThese were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.congenicUnknown32716420BDIX.BDIV-<i>D6Rat132-D6Rat229</i>/ZteThe BDIX.BDIV-<i>D6Rat132-D6Rat229</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.congenicUnknown35668858LEW-Tg(HLA-B*2705m1,B2M)133-1Trg<sup>Tg/0</sup>This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. The strain carries 12 copies of HLA-B*2705 and 4 copies of the human beta-2-microglobulin gene.transgenicUnknown35668859W-<i>Gnrh1<sup>tm1(IRES-cre)Aeh</sup></i>This model was generated using zinc finger nuclease (ZFN) method. Cre recombinase was expressed under the control of the endogenous Gnrh1 gene by inserting an internal ribosomal entry site (IRES)-Cre cassette 30bp downstream from the translational stop site of the Gnrh1 open reading frame. This was achieved by pronuclear co-injection of zinc finger nucleases (ATCCACAACATCCGAGTGtgacattGACGCTGAGATCCATGAC; cleavage site in lower case) along with a donor plasmid containing two 800bp homologous arms (HA) flanking IRES-Cre into a one-cell stage rat embryo.mutantLive Animals (as of 2020-07-09)Neuroendocrinology, Neurobiology, Development35668861LEW-Tg(HLA-B*2705,B2M)21-3Trg<sup>Tg/0</sup>This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene.transgenicUnknown35668863LEW-Tg(HLA-B*2705,B2M)21-3Trg<sup>Tg/Tg</sup>This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 40 copies of HLA-B*2705 and 30 copies of human beta-2-microglobulin gene. Founder 21-3 was selected and carrier animals from this founder were mated and bred to homozygosity.transgenicUnknown36174030SD-<i>Hamp<sup> em1Jfcol +/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol +/- (RGD: 36174030) is heterozygous carrying a 169-bp deletion between exons 2 & 3 of rat Hamp gene.mutantCryopreserved Sperm (as of 2020-07-28)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em1Jfcol </sup>3845598736174220SD-<i>Hamp<sup> em1Jfcol -/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol -/- (RGD:36174220) is homozygous carrying the 169-bp deletion between exons 2 & 3 of both rat Hamp alleles.mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em1Jfcol </sup>3845598736174221SD-<i>Hamp<sup> em2Jfcol +/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol +/- (RGD:36174221) is heterozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene.mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em2Jfcol </sup>3845598936174222SD-<i>Hamp<sup> em2Jfcol -/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol -/- (RGD:36174222) is homozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of both rat Hamp alleles.mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em2Jfcol </sup>3845598936174223SD-<i>Hamp<sup> em3Jfcol +/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol +/- (RGD:36174223) is heterozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene.mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em3Jfcol </sup>3845599036174224SD-<i>Hamp<sup> em3Jfcol -/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol -/- (RGD:36174224) is homozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of both rat Hamp alleles.mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em3Jfcol </sup>3845599036174225SD-<i>Hamp<sup> em4Jfcol +/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol +/- (RGD:36174225) is heterozygous carrying a 15-bp deletion in exon 2 of the rat Hamp genemutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em4Jfcol </sup>3845599136174226SD-<i>Hamp<sup> em4Jfcol -/-</sup></i>Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol -/- (RGD:36174226) is homozygous carrying a 15-bp deletion in exon 2 of both rat Hamp allelesmutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em4Jfcol </sup>3845599138456008LOU/CBazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of immunocytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978).inbredUnknown38500209NISAGNISAG were stress-sensitive hypertensive rats that exhibited normal systolic pressure during the first weeks after birth. The development of hypertension in these rats is accompanied by increased sensitivity of the hypothalamic-pituitary-adrenocortical and sympathoadrenal systems to stress.inbredUnknown38501059SD-<i>Cp<sup>em1Ang+/+</sup></i>The wild type rats were littermates of cross of heterozygotes Cp mutant rats. The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.mutantUnknown38501060SD-<i>Cp<sup>em1Ang+/-</sup></i>The heterozygous Cp mutant rats were created by CRISPR/Cas9. They contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.mutantUnknownCp<sup>em1Ang</sup>3850106238501061SD-<i>Cp<sup>em1Ang-/-</sup></i>The homozygous Cp mutant rats are littermates of cross of heterozygotes Cp mutant rats . The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop codon in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.mutantUnknownCp<sup>em1Ang</sup>3850106238501086SD-<i>Bmpr2<sup>em1Ang+/-</sup></i>BMPR2-deficient rats were generated by using zinc-finger nucleases (Sigma, St. Louis, MO). The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates.mutantUnknownBmpr2<sup>em1Ang</sup>3850108738508891F344-Tg(Cx3cr1-cre/ERT2)3OttcThe transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter.transgenicUnknown38508893F344.LE-ROSA26 <sup>em1(LTR-nLuc)Ottc</sup>The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus.mutantUnknown38543943SD-<i>Rag2<sup>em1Hera</sup></i>The Rag2 gene in rat spermatogonia stem cells (SSC, SD-WT2) was targeted by TALENs and resulted in a 27-bp in-frame deletion. The genome modified SSC was transplanted to Busulfan-treated, Dazl-deficient male Sprague Dawley rats and mated with wild type female Sprague Dawley rats 70 to 81 later. The allele was then bred to homozygosity to generate the Sprague-Dawley Rag2 (SDR)-knockout rat.mutantUnknown38548914SD-<i>Rag1<sup>em1</sup></i><i>Rag2<sup>em1</sup></i>/MlitThe Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2.mutantUnknown38548915SD-<i>Il2rg<sup>em1-/y</sup></i>/MlitThe Il2rg knock-out rats were obtained by injecting Il2rg-targeting sgRNA into 1-cell embryos. The resulted mutation is 1-bp insertion (A) at 71169012 position. No protein was detected in the spleen of this Il2rg knock out.mutantUnknown38548916SD-<i>Rag1<sup>em1</sup></i><i>Rag2<sup>em1</sup>Il2rg<sup>em1-/y</sup></i>/MlitThe Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915).mutantUnknown38548927HsdCpb:WUWistar Wu RatThe Wistar rat is selected at the Wistar Institute, Philadelphia, USA, prior to 1910. In 1932, from Wistar Institute to Glaxo Laboratory, UK. In 1933, from Glaxo to the Dutch Institution for Nutrition, Amsterdam. In 1941, the Unilever Company, Vlaardingen, the Netherlands, obtained a breeding stock from Dutch Institution for Nutrition. Thereafter, the Unilever stock was referred as the Wistar Unilever or WU rat. In 1958, transferred from Unilever to TNO Central Institute for the Breeding of Laboratory Animals. To Harlan Laboratories through acquisition in 1986. Harlan became Envigo in 2015.outbredUnknown38549341RP/AEurRijHsdMuhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). To Harlan (?).inbredUnknown38549343WKY/NIcoCrlfA substrain of WKY from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.inbredUnknown38549351HXB10/IpcvMcwiEmbryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, and maintain by Medical College of Wisconsin.recombinant_inbredUnknown38549352SHR/OlaIpcvMcwiThese are re-derived rats of SHR substrain (SHR/OlaIpcv, RGD:9586450) from Czech Academy of Sciences now maintained at Medical College of Wisconsin.inbredUnknown38549353SD-<i>Defb23<sup>em1Mlit</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2.mutantUnknownDefb23<sup>em1Mlit</sup>3859901138549354SD-<i>Defb26<sup>em1Mlit</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2.mutantUnknownDefb26<sup>em1Mlit</sup>3859901238549355SD-<i>Defb42<sup>em1Mlit</sup></i>CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2.mutantUnknownDefb42<sup>em1Mlit</sup>3859901338549356SD-<i>Defb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup></i>CRISPR/Cas9 system was used to generate this double-gene knockout. The Slc:SD zygotes were injected with sgRNAs that containing 4 sgRNAs (5 ng/ml each) targeting 2 adjacent sites (target sites 1 and 2) of each of the 2 genes. The resulting mutations are 317 bp (Defb23) and 380 bp (Defb26) fragments which were deleted in the Defb23/Defb26 double-mutant strain.mutantUnknownDefb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup>3859901438549357SD-<i>Defb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup>Defb42<sup>em1Mlit</sup></i>CRISPR/Cas9 system was used to generate the Defb23, Defb26 double-gene knockout (RGD:38549356) and Defb42 (RGD:38549355). The triple-KO rats were generated by crossing the heterozygous Defb23/26 mutation rats with the heterozygous Defb42 mutation rats.mutantUnknownDefb42<sup>em1Mlit</sup>|Defb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup>38599013|3859901438549372SD-<i>Eif2ak4<sup>em1</sup></i>The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4.mutantUnknownEif2ak4<sup>em1</sup>3859901638596327WI-<i>Tbc1d4<sup>em1Gdcz</sup></i>The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) .mutantUnknownTbc1d4<sup>em1</sup>3859633038596339SD-<i>Rarres2<sup>em1Msu</sup></i>Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2.mutantUnknownRarres2<sup>em1Msu</sup>3859634138599146BN-<i>Aire<sup>em1Ang-/-</sup></i>The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG-
39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear
localization signal sequence, causing a premature stop codon.mutantUnknownAire<sup>em1Ang</sup>3859914838599147SD.BN-<i>Aire<sup>em1Ang-/-</sup></i>The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG-
39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear
localization signal sequence, causing a premature stop codon.mutantUnknownAire<sup>em1Ang</sup>3859914838599152WI-<i>Lpin1<sup>m1Hubr</sup></i>The mutant rats were created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5'-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity.mutantUnknownLpin1<sup>m1Hubr</sup>3859915338599155BN-<i>Themis<sup>m1Adej</sup></i>This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption.mutantUnknownThemis<sup>m1Adej</sup>3859915638599157F344-<i>Depdc5<sup>em1Kyo+/-</sup></i>TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5.mutantUnknownDepdc5<sup>em1Kyo</sup>3859919438599158F344-<i>Depdc5<sup>em2Kyo+/-</sup></i>TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5.mutantUnknownDepdc5<sup>em2Kyo</sup>3859919538599187SHRSP.SHR-(<i>D1Mgh5-D1Got87</i>)(<i>D18Rat73-D18Rat11</i>)/IzmA double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University.congenicCryopreserved Sperm (as of 2020-09-14)Hypertension and cerebral apoplexy38599188SHRSP.SHR-(<i>D1Rat23-D1Rat213</i>)(<i>D18Rat73-D18Rat11</i>)/IzmA double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University.congenicCryopreserved Sperm (as of 2020-09-14)Hypertension and cerebral apoplexy38599189F344-<i>Rag2<sup>em1Iexas</sup></i>This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition.mutantCryopreserved Embryo (as of 2020-09-14)immunology/Inflamation and ImmunodeficientRag2<sup>em1Iexas</sup>3859919138599190F344-<i>Il2rg<sup>em1Iexas</sup>Rag2<sup>em1Iexas</sup></i>This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late.mutantCryopreserved Embryo (as of 2020-09-14)severe combined immunodeficiencyRag2<sup>em1Iexas</sup>|Il2rg<sup>em1Iexas</sup>38599191|3859919238599197W.F344-<i>Lep<sup>m1Kyo</sup></i>This cocngenic strain was made by backcrossing F344-Lepm1Kyo(RGD: 8549776, F344/NSlc rats having an induced mutation in the Lep gene by ENU mutagenesis) to W/Kyo (RGD:1302672).mutantLive Animals; Cryopreserved Sperm (as of 2020-09-14)ObesityLep<sup>m1Kyo</sup>1279296338599201SHRSP.SHR-(<i>D18Rat73-D18Rat8</i>)/IzmA congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm.congenicCryopreserved Sperm (as of 2020-09-15)Hypertension and cerebral apoplexy38599202SHRSP.SHR-(<i>D1Rat23-D1Rat213</i>)(<i>D18Rat73-D18Rat52</i>)/IzmA double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm.congenicCryopreserved Sperm (as of 2020-09-15)Hypertension and cerebral apoplexy38599203LE-Tg(Gt(ROSA26)Sor-CAG-COP4*C167A/YFP*)2JfhyThe transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 3, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number.transgenicCryopreserved Sperm (as of 2020-09-15)38599204LE-Tg(Gt(ROSA26)Sor-CAG-COP4*C167A/YFP*)1JfhyThe transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 1, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number.transgenicCryopreserved Sperm (as of 2020-09-15)38599206SHR-<i>Prdx2<sup>em2Izm</sup></i>This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 6-bp deletion (5'-CTCCGG-3', c.6_12del6) in the exon2 of Prdx2 gene.
Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT).mutantCryopreserved Sperm (as of 2020-09-15)38599208SHR-<i>Prdx2<sup>em1Izm</sup></i>This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion (5'-CTCCGGC-3', c.6_13del7) in the exon2 of Prdx2 gene.
Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT).mutantCryopreserved Sperm (as of 2020-09-15)38599241SD;DA-Tg(Thy1-APP*)1DspbMutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are different among Lines (12>1>14>6).transgenicCryopreserved Sperm (as of 2020-09-16)dementia38599242SD;DA-Tg(Thy1-APP*)6DspbMutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6).transgenicCryopreserved Sperm (as of 2020-09-16)dementia38599243SD;DA-Tg(Thy1-APP*)12DspbMutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6).transgenicCryopreserved Sperm (as of 2020-09-16)dementia38599244SD;DA-Tg(Thy1-APP*)14DspbMutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6).transgenicCryopreserved Sperm (as of 2020-09-16)dementia38599245LE-Tg(Tac1-cre)6-7KobaBackground strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs. This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)6-7Koba are lower than in LE-Tg(Tac1-cre)4-1Koba (RGD:38599247)transgenicCryopreserved Sperm (as of 2020-09-16)38599247LE-Tg(Tac1-cre)4-1KobaBackground strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs.This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)4-1Koba are higher than in LE-Tg(Tac1-cre)6-7Koba (RGD:38599245).transgenicCryopreserved Sperm (as of 2020-09-16)38676250F344-<i>Hcn1<sup>em3Kyo</sup></i>TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 13-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein.mutantCryopreserved Sperm (as of 2020-09-16)38676251F344-<i>Hcn1<sup>em2Kyo</sup></i>TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 24-bp deletion in the exon4 of Hcn1 gene. It is predicted that 8 amino-acid deleted HCN1 protein is expressed.mutantCryopreserved Sperm (as of 2020-09-16)38676253F344-<i>Hcn1<sup>em1Kyo</sup></i>TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein.mutantCryopreserved Sperm (as of 2020-09-16)Hcn1<sup>em1Kyo</sup>15042963238676254F344-<i>Pparg<sup>m1Kyo</sup></i>By using ENU mutagenesis followed by MuT-POWER screening of the KURMA (Kyoto University Rat Mutant Archive) samples, the depositors generated a heterozygous PPARg mutant (Ppargmkyo/+) rat with a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg. The PpargG488T homozygous rats are embryonic lethal. Heterozygous Ppargmkyo/+ rats showed reduced fat mass with adipocyte hypertrophy and insulin resistance, which were highly predictable from known actions of Pparg agonists and phenotypes of patients with the PPARG mutation.mutantCryopreserved Sperm (as of 2020-09-16)Pparg<sup>m1Kyo</sup>12728561738676255F344-<i>Hcn1<sup>em4Kyo</sup></i>TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed.mutantCryopreserved Sperm (as of 2020-09-16)38676310RjHan:SDThe outbred strain [Sprague-Dawley] was created by R. W. Dawley in 1925, from a hooded male hybrid of unknown origin and an albino female (probably Wistar), and was crossed with the female's progeny for 7 generations. Janvier Labs received from Zentralinstitut fur Versuchstierzucht (Hannover) in1982.outbredLive Animals (as of 2020-09-17)38676445W-Tg(Slc32a1-cre)1_4FusaThis strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system.transgenicCryopreserved Sperm (as of 2020-09-17)38676446W-Tg(Slc32a1-cre)2_5FusaThis strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system.transgenicCryopreserved Sperm (as of 2020-09-17)38676447W-Tg(Slc32a1-cre)5_9FusaThis strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system.transgenicCryopreserved Sperm (as of 2020-09-17)38676448W-<i>Trpa1<sup>em1Kcrd</sup></i>This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted.mutantCryopreserved Embryo (as of 2020-09-17)Trpa1<sup>em1Kcrd</sup>3867644938676450F344-<i>Phf24<sup>em2Kyo</sup></i>In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation.mutantLive Animals; Cryopreserved Sperm (as of 2021-07-01)38676451W-<i>Phf24<sup>em11Iexas</sup></i>This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined.mutantCryopreserved Sperm (as of 2020-09-17)38676452W-<i>Phf24<sup>em24Iexas</sup></i>This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined.mutantCryopreserved Sperm (as of 2020-09-17)38676453F344; W-<i>Phf24<sup>em6(EGFP)Iexas</sup></i>This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc.mutantCryopreserved Sperm (as of 2020-09-17)38676459HHR/HatHirosaki hairless ratHirosaki hairless rat (HHR) is a mutant strain spontaneously derived from Sprague-Dawley rats, and its inheritance is autosomal recessive. . These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster. HHR attain sexualmaturity at approximately 10 weeks of age and give birth to young but are not able to nurse them.mutantUnknown38676461HiSER/HatHirosaki small-eye ratHiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1.mutantUnknown38676463HHSE/HatHHSE/Hat was derived from Hirosaki hairless rat (HHR) and Hirosaki small-eye rat (HiSER), which are Sprague-Dawley rat (SDR)mutant lines. HHR was established in 1984 as a spontaneous mutant of SDR that has been inbred in Department of Biochemistry and Genome Biology Hirosaki University Graduate School of Medicine. Whole body shows hypotrichosis, abnormal differentiation of thymus, and regressed mammary gland in females. These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster and the lectin-like receptor gene Ly49s3. HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat maintained in our course in the same way as HHR/Hat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. The mutations in HHR and HiSER are on different chromosomes and do not affect each other.mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2020-09-18)Cryba1<sup>Hiser</sup>3867646238676464WIC-<i>Cspg4<sup>em1Kyst</sup></i>By CRISPR/Cas9 system, mutation was introduced in <i>Cspg4</i> gene of Wistar-Imamichi rat. 7 bp deletion on Exon1.mutantCryopreserved Sperm (as of 2020-09-18)38676495BN-<i>Lx</i>/CubMcwiBrown Norway with polydactyly-luxateThese are re-derived rats of BN-Lx/Cub now maintained at Medical College of Wisconsin. The parent strain was derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background.mutantUnknown (as of 2021-07-21)The Hybrid Rat Diversity Panel39128162WIC-<i>Cspg4<sup>em2Kyst</sup></i>By CRISPR/Cas9 system, mutation was introduced in <i>Cspg4</i> gene of Wistar-Imamichi rat. 7 bp deletion on Exon1.mutantCryopreserved Sperm (as of 2020-09-23)39128163WIC-<i>Cspg4<sup>em3Kyst</sup></i>By CRISPR/Cas9 system, mutation was introduced in <i>Cspg4</i> gene of Wistar-Imamichi rat. 2 bp insertion on Exon1.mutantCryopreserved Sperm (as of 2020-09-23)39128166WIC-<i>Sparc<sup>em1Kykn</sup></i>By CRISPR/Cas9 system, mutation was introduced in Sparc gene of Wistar-Imamichi rat. 7 bp deletion around Exon7.mutantCryopreserved Sperm (as of 2020-09-23)39128167W-Tg(Grp-YFP*)14HskmtThis strain was generated by microinjecting YFP* (Venus): yellow fluorescent protein variant, which is inserted at downstream of Grp-promoter (4 kb) to Wistar rat zygotes. The number of inserted gene is approximately 100 copy.transgenicLive Animals; Cryopreserved Sperm (as of 2020-09-23)39128170SHRSP-<i>Stim1<sup>em1Izm</sup></i>"This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence.
The sequence of the guide RNA target site is as follows,
Stim1: 5'-GCAGGGTAGCTGAAACACAC-3'
The sequence of the ssODN for homologous recombination is as follows,
5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'"mutantCryopreserved Sperm (as of 2020-09-23)39128171LE-Tg(Pvalb-cre)2-28KobaThis strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs.mutantLive Animals; Cryopreserved Sperm (as of 2020-09-23)39128172W-Tg(Slc32a1-cre)3_5FusaThis strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT(Slc32a1: mouse, Kanamycin resistance gene(E. coli), Cre(P1 phage), polyA signal(SV40 virus). Mouse BAC clone: RP23-392-P11transgenicCryopreserved Sperm (as of 2020-09-23)39128239GK/CskCrljThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995.inbredUnknown39128242SD-<i>Vwf<sup>em1Mcwi-/-</sup></i>CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon.mutantCryopreserved Sperm (as of 2020-10-09)Vwf<sup>em1Mcwi</sup>3945794839456105F344/StmMcwiF344/StmMcwi was redelivered from F344/Stm which was derived from F344/DuCrlj.inbredLive Animals (as of 2020-10-02)39456107LE/StmMcwiThe LE/StmMcwi was rederived from LE/Stm and maintained at Medical College of Wisconsin. The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50.inbredLive Animals (as of 2020-10-02)39456108SD-<i>Trpv4<sup>em1Sage</sup></i>TRPV4 gene?specific zinc finger constructs directed against exon 13, containing the coding sequence for part of TM5, the pore region, and TM6, were injected in zygotes from Sprague-Dawley rats. An animal with an 899 bp deletion in the TRPV4 gene was selected as a founder for further breeding. This deletion completely removes exon 13, plus parts of intron 12-13 and intron 13-14 .mutantUnknownTrpv4<sup>em1Sage</sup>3945610939457682LCR-mt<sup>HCR</sup>/TolMitochodrial genome of LCR/ was selectively replaced by HCR to create this conplastic strain; these have the mitochondrial genome of HCRl on LCR nuclear genetic backgroundconplasticUnknown39457683HCR-mt<sup>LCR</sup>/TolMitochodrial genome of HCR/ was selectively replaced by LCR to create this conplastic strain; these have the mitochondrial genome of LCRl on HCR nuclear genetic backgroundconplasticUnknown39457699LCR/TolLow-capacity runnersArtificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for low capacity based on distance run to exhaustion on a motorized treadmill.inbredUnknown39457701HCR/TolHigh-capacity runnersArtificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for high capacity based on distance run to exhaustion on a motorized treadmill.inbredUnknown39457945WI-<i> Lpar1<sup>m1Hubr</sup></i>The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function.mutantUnknownLpar1<sup>m1Hubr</sup>12684873939457947SD-<i>Bckdk<sup>m1Dbsa</i></sup>The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk.mutantUnknown39457950SD-<i> Ngly1<sup>em1Ta-/-</sup></i>The homozygous Ngly1 mutant rats are littermates of cross of heterozygotesNgly1 mutant rats . The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. By the time of deposition, this strain was crossed twice to Crl:CD (SD). "Homozygous rats are obtained by crossing between heterozygous rats.
Maintain the strain by crossing between heterozygous rats or by backcrossing to Crl:CD (SD) rats.
Homozygous rats, both females and males, have no record of pregnancy and reproduction. They are more likely to be infertile."mutantCryopreserved Sperm (as of 2021-07-22)Ngly1<sup>em1Ta</sup>14973556540818253LE-<i>Dyrk1a<sup>em1Mcwi</sup></i>The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 14-bp deletion in exon 3mutantUnknown40818401M520/NRrrcMcwiTo N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. It was then sent to Rat Resource and Research Center (RRRC). Medical College of Wisconsin received live animals from cryo-resuscitated pairs at RRRC in 2009.inbredUnknown40924649Beta IIMNine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' were separated in 1958 and raised at the School of Medicine at Rosario. In 1976, some degree of overweight was found in the original 'b' group and in 1980, the obesity group was identified as Beta line.inbredUnknown40924650Alpha IIMNine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' and 'alpha' were separated in 1958 and 1972 respectively and raised at the School of Medicine at Rosario. This line alpha (Alpha IIM) ), obtained from the F1 'a' X 'd', was used as control for the obese Beta line (RGD:40924649).inbredUnknown40924656BN.ZUC-<i>Lepr<sup>fa</sup></i>Established as congenics by introducing fa from 13M/Vc to BN/CrlmutantUnknown (as of 2021-01-19)Lepr<sup>fa</sup>1343215340924661LA-<i>cp</i>/NRllThis corpulent rat used by Rudolph L Leibel's laboratory was developed at the National Institutes of Health (NIH). It was a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. This congenic carrying the recessive Leprcp (RGD:11570565) identified in in the obese spontaneously hypertensive Koletsky rat.mutantUnknownLepr<sup>cp</sup>1157056541404646SD-<i>Lrp5<sup>em1Vari</sup></i>CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos.mutantUnknownLrp5<sup>em1Vari</sup>4140464741404648SD-<i>Lrp5<sup>em2Vari</sup></i>CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos.mutantUnknownLrp5<sup>em2Vari</sup>4140465041404651SD-<i>Lrp5<sup>em3Vari</sup></i>CRISPR/Cas9 system was used to introduce an
inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos.mutantUnknownLrp5<sup>em3Vari</sup>4140465241404660GK/JpeThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s,inbredUnknown41404661W/JpeInbred Wistar rats maintained at Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, PortugalinbredUnknown41404705SD-<i>Shank3<sup>em1Bux</sup></i>The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon.mutantUnknownShank3<sup>em1Bux</sup>4140470641404723DA.W-<i>Ncf1<sup>W</sup></i>/RhdThe Wistar Ncf1 (Ncf1W) allele was backcrossed to the DA background for 10 generationscongenicUnknownNcf1<sup>W</sup>4140472441408337DA.F344-Dpp4<sup>DPPIV</sup>/SvHGeneration of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient
congenic DA strain is maintained via brother=sister matingmutantUnknownDpp4<sup>DPPIV</sup>1279294241408339WI.SD-<i>Pclo<sup>Tn(sb-B-Geo)Fkh</sup></i>The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame.mutantUnknownPclo<sup>Tn(sb-B-Geo)Fkh</sup>4140834041410881WI-<i>Grm2<sup>em1</sup></i>This mutant rat strain was produced by Transposagen Biopharmaceutical and available in mGluR2+/- breeding pairs. The genome modification created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional.mutantUnknownGrm2<sup>em1</sup4141088241412170BBDR/RhwMcwiThis strain was given to Medical College of Wisconsin by Ake Lernmark and maintained there.inbredUnknown41412172BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>)/RhwMcwiThe lymphopenia locus from diabetic proned BBDP rat was transferred onto the genome of diabetic-resistant BB rat by marker-assisted selection in nine cycles of cross-intercross breeding. This congenic strain from Ake Lernmark, Laboratory, University of Washington, Seattle, Washington to Medical College of Wisconsin.congenicUnknown41412186BBDP/WorDiabetic prone BB rats. The Biobreeding rats (BB) spontaneously developed autoimmune diabetes mellitus were found in a closed colony of outbred WI (Wistar) rats at the Bio-Breeding Laboratories, Ottawa, Ontario in 1974. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center
(laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and and 2 strains were produced: disease prone (DP) and disease resistant (DR) by selected progenies were diabetic (DP) or remained diabtes free (DR).inbredUnknown41457452WI-<i>Prdm14<sup>em10Nips</sup></i>Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype.mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24)Prdm14<sup>em10Nips</sup>4145745342721973LEW/SsNArcThis strain is now maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The LEW rats were received from National Institutes of Health
, Bethesda MD, USA.inbredUnknown42721974LEW-<i>Nek8<sup>lpk</sup></i>/ArcThe Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene.mutantUnknownNek8<sup>lpkArc</sup>4272197542721977SD-<i>Pde6b<sup>em1Baek</sup></i>Cpf1 mRNA (50 ng per uL) and CRISPR RNA (100 ng per uL) were co-microinjected into the cytoplasm of pronuclear stage embryos; surviving embryos were transplanted into the oviducts of pseudo-pregnant surrogate mothers to generate live animals. A Pde6b-mutant rat line with an 11-bp deletion in exon 1 was established. Western blot analysis confirmed deficiency of Pde6b protein in the homozygous mutant retina, indicating successful generation of Pde6b-deficient rats with Cpf1-mediated gene targeting.mutantUnknownPde6b<sup>em1Baek</sup>4272197942722004F344-Tg(HIV)1HsdNoninfectious clone containing gag-pol-deleted HIV-1 provirus under the viral LTR promoter was microinjected into fertilized one-cell Sprague�Dawley � Fisher 344/NHsd F1. Female founder with opaque cataracts was mating with wil-type Fischer 344/NHsd.
Tg rats from line 1 contained 20�25 copies.transgenicUnknown45073130SD-<i>Fmr1<sup>em1Mzhe</sup></i>The CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of the rat Fmr1 gene of outbred Sprague-
Dawley embryos. The resulting mutation is a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification results in a frame-shift starting from the second Agenet-like 2 domain in the Fmr1 protein.mutantUnknownFmr1<sup>em1Mzhe</sup>12471548045073133SD-<i>Pon1<sup>em1Lizh</sup></i>CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague-
Dawley embryos. The destruction of Pon1 gene caused the absence of the the expression of Pon1 mRNA, protein in liver, spleen and thymus in the Pon1 homozygous knock-out rat.mutantUnknownPon1<sup>em1Lizh</sup>12471548153621137SD-Tg(Wnt1-cre/ERT2)AppscRrrcThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT2transgenicLive Animals (as of 2021-07-19)56677892SD-Tg(GFAP-cre/ERT2)AppscRrrcThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicLive Animals (as of 2021-07-19)58366897SD-Tg(Tie2-cre/ERT2)AppscRrrcThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2transgenicLive Animals (as of 2021-07-19)124713544W-<i>Cyp27b1<sup>em1Thka</sup></i>This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes.mutantUnknownCyp27b1<sup>em1Thka</sup>124713545124713546W-<i>Vdr<sup>em1Thka</sup></i>This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array
near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr (R270L) rats for analysis were fed an F-2 formula diet (Oriental Yeast
Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2
diet partially reversed their rickets symptoms. Homozygotes Vdr(R270L mutants were maintained bymating of heterozygotes.mutantUnknownVdr<sup>em1Thka</sup>124713547124713548W-<i>Vdr<sup>em2Thka</sup></i>This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array
near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes.mutantUnknownVdr<sup>em2Thka</sup>124713550125093746SD-<i>Disc1<sup>em1Rst</sup></i>CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation.mutantUnknownDisc1<sup>em1Rst</sup>125093747125097486SD-<i>Nr3c1<sup>em1Kuan</sup></i>The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. The LoxP sequences were inserted in the 5prime and 3prime sides of exon 3. For CaMKIIa cell-specific knockdown, 0.1 ul of AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40 (CaMKIIa Cre) [Penn Vector Core] was injected bilaterally and allowed a minimal of 3 weeks to incubate.mutantUnknownNr3c1<sup>em1Kuan</sup>125097487125097491WI.WDB-<i>Prdm14<sup>tm1(H2BVenus)Nips</sup></i>Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation . Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats.
Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype.mutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Prdm14<sup>tm1(H2BVenus)Nips</sup>126781696125097492WI-<i>Sall1<sup>em1Nips</sup></i>Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1.mutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Sall1<sup>em1Nips</sup>126781694125097494WI.WDB-<i>Sall1<sup>tm4(tdTomato)Nips</sup></i>Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation.Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats..These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1.mutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Sall1<sup>tm4(tdTomato)Nips</sup>126781695125097496Iar:WICIar:Wistar-ImamichioutbredUnknownMetabolism; Development125097497WIC;WI;WDB-<i>Kiss1<sup>tm8Nips</sup></i>This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination. Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Iar:Wistar-Imamichi rats to produce heterozygous founder rats. This rat strain is being maintained by crossing the founder rat with Iar:Wistar-Imamichi rats.mutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Kiss1<sup>tm8Nips</sup>126781693126777684WI-<i>Mkx<sup>em1Asah</sup><i/>The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 14- bp deletion causing frameshift mutation in the gene.mutantUnknownMkx<sup>em1Asah</sup>126777685126777687WKY-<i>Dnd1<sup>ter</sup></i>/ZtmA spontaneous mutation (ter) leading to the formation of congenital ovarian and testicular tumors was detected in the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. This recessive ter mutation has a complete penetrance of teratocarcinogenesis and infertility of both sexes in homozygous genotype.mutantUnknownDnd1<sup>ter</sup>150340622126779578LOU/MWslA substrain of LOU/M maintained in the laboratory of Dr. H. Bazin at Universite de Louvain.inbredUnknown126779586SD-<i>Csf1r<sup>tm(EGFP)+/-</sup></i>/TsetTargeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipientsmutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692126779587DA-<i>Csf1r<sup>tm(EGFP)+/-</sup></i>/HumeHeterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia.mutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692126779591SD-<i>Csf1r<sup>tm(EGFP)-/-</sup></i>/TsetTargeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. The homozygotes were obtained by crossing of heterozygotes.mutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692126779592DA-<i>Csf1r<sup>tm(EGFP)-/-</sup></i>/HumeHeterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. The homozygotes were obtained by crossing of heterozygotesmutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692126781838SD-Tg(PDGFB-cre/ERT2)AppscRrrcThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19)126781839SD-Tg(Olfr16-cre/ERT2)AppscRrrcThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19)126781841SD-Tg(Mnx1-cre/ERT2)AppscRrrcThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2transgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)126781842SD-Tg(Drd1-cre/ERT2)AppscRrrcThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neuronstransgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)126781843SD-Tg(Gad1-cre/ERT2)AppscRrrcThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes.transgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)126781844SD-Tg(SMHC-cre/ERT2)AppscRrrcThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicLive Animals (as of 2021-07-19)126781845SD-Tg(CAG-GFP-LacZ)AppscRrrcA transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 linetransgenicUnknown126790464SD-<i>Ube3a<sup>em1Jue</sup></i>The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos and inserted
into a surrogate. Two genomic RNAs (gRNAs) were designed to target the 5ʹ-end of the Ube3a gene (upstream of the Ube3a coding sequence) and two gRNAs target sequences downstream of Ube3a. gRNA pairs were used on each end of the deletion to maximize the probability of a complete deletion of the 90-kb region encompassing the Ube3a gene. The 90 kb deletion in Ube3a was confirmed by genome sequencing. Only pups with maternal inheritance of the deletion carried traits for model of Angleman Syndrome.mutantUnknownUbe3a<sup>em1Jue</sup>126790465126790469F344.Cg-<i>Foxn1<sup>rnu-/-</sup></i>/JclThis congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats.congenicLive Animals (as of 2021-04-22)Immuno deficiency126790472F344.Cg-<i>Foxn1<sup>rnu-/+</sup></i>/JclThis congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats.congenicLive Animals (as of 2021-04-22)Immuno deficiency126790496SD-<i>Shank2<sup>em13Sage</sup></i>The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNAmutantUnknownShank2<sup>em13Sage</sup>126790499126790511Jcl:WISTCLEA Japan, Inc., Taconic Farms Inc. (USA), and Taconic Europe (Denmark) created the Global Alliance for Laboratory Animal Standardization (GALASTM) agreement in collaboration with the Central Institute for Experimental Animals to promote the international standardization of outbred stocks usable for safety testing in the field of toxicity and pharmacology. Based on these activities,Wistar Hannover GALAS rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.). At and after the end of 1998, RCC Ltd. gave more than 50 pairs of pedigreed BrlHan:WIST rats to each GALAS member to use as seed rats for the Wistar Hannover GALAS strain.outbredLive Animals (as of 2021-04-23)126790547SD-<i>Rin1<sup>em1-/-Hcz</sup></i>This strain was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene.mutantUnknownRin1<sup>em1Hcz</sup>126790548126848737WI-<i> Msh6<sup>m1Hubr</sup></i>The Msh6 knockout mutant rat line was generated by target-selected ENU-driven mutagenesis on Crl:WI rats. The founder rat carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene was bred to obtain homozygous animals.mutantUnknownMsh6<sup>m1Hubr</sup>126848738126848740SDT.Cg-<i>Lepr<sup>fa</sup></i>/JttJclSDT fatty<i>Lepr<sup>fa</sup></i> allele from ZDF was introgressed into SDT rats using the speed congenic method. The newly establised congenic strain of a SDT rat for Leprfa was maintained by intercross between fa-heterozygous littermates in Japan CLEA Inc.congenicLive Animals (as of 2021-05-06)126848751RCS-<i>Mertk<sup>rdy</sup>p</i>/LavJclThis strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for a deletion in the Mertk gene.congenicLive Animals (as of 2021-04-28)Mertk<sup><i>rdy</i></sup>40902839126848763ODS-<i>Gulo<sup>od+/+</sup>/ShiJclOsteogenic disorder Shionagi rat, wild typeThis is the wild type control for ODS-Gulood/od/ShiJcl (RGD:4140404) . Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.inbredLive Animals (as of 2021-04-29)126848776RCS-<i>Mertk<sup>rdy+</sup>p</i>/LavJclThis strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for wild type Mertk gene.congenicLive Animals (as of 2021-04-30)126848777SD-Tg(HRAS)128NccJclHras128 is a transgenic rat, introduced human proto-type c-Ha-ras gene to Jcl:SD rat fertilized egg by Dr. Hiroyuki Tsuda, Natl. Cancer Center, in 1998. The strain has been kept by CLEA Japan from its creation and supplied to the related research organization after concluded an agreement with Natl. Cancer Center and Japan Science and Technology Agency (JST). This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region.transgenicLive Animals (as of 2021-04-30)126848778SD-Tg(CAG-KRAS*G12V)301JclThe transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-Kras*G12V (KrasV12) was injected into embryos of SD rat (RGD:8547938). This strain was generated at CLEA Japan,Inc. This strain is introduced 3 copies of hemagglutinin (HA) epitope tag connected HA-K-rasv12 gene expression cassette by using Cre/loxP system for controlling term/location expression of human mutated form K-rasv12 gene (changing glycine to valine at the 12 amino acid sequence) that normally floxed rat does not express K-rasv12 gene.transgenicLive Animals (as of 2021-04-30)Oncology126848793SS-<i>Gper1<sup>em1Bj-/-</sup></i>CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. The homozygous founders had complete deletion of Gper1 was confirmed by DNA sequenching.mutantUnknown126848794SHR-<i>Zbtb16<sup>em1Ipcv+/-</i></sup>TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. The founder was bred with SHR to generate more heterozygous animals. The homozygous animals die perinatally because of multiple developmental abnormalities.mutantUnknownZbtb16<sup>em1Ipcv</sup>150340624126848804F344-<i>Trpc4<sup>Tn(sb)1Bni</sup></i>The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. Trpc4 knock-out (510 bp) and wild-type allele (905 bp) were confirmed using PCR and gel electrophoresismutantUnknownTrpc4<sup>Tn(sb)Tngen</sup>126848808126908010SD-<i>Kcnk3<sup>em1Ang-/-</sup></i>The homozygous Kcnk3 mutant rats are littermates of cross of heterozygotesKcnk3 mutant rats . The mutation created by CRISPR/Cas9 contained a 94- bp deletion in exon1 of resulted a premature stop codon.mutantUnknownKcnk3<sup>em1Ang</sup>126908015126908013SD-<i>Kcnk3<sup>em1Ang-/+</sup></i>The heterozygous Kcnk3 mutant rats were created by CRISPR/Cas9. The mutated allele contained a 94- bp deletion in exon1 of resulted a premature stop codon.mutantUnknownKcnk3<sup>em1Ang</sup>126908015126925134SD-<i>Il36rn<sup>tm1(Myh6-cre)Mhzh</sup></i>This line was produced by mating rats carrying Il36rnf/f allele and Myh6-cre-allele. The expression of Il36rn was knockout in cardiomyocytes.mutantUnknownIl36rn<sup>tm1(Myh6-cre)Mhzh</sup>126925161126925135SD-<i>Il1rl2<sup>tm1(Myh6-cre)Mhzh</sup></i>This line was produced by mating rats carrying IIl1rl2f/f allele and Myh6-cre-allele. The expression of Il1rl2 was knockout in cardiomyocytes.mutantUnknownIl1rl2<sup>tm1(Myh6-cre)Mhzh</sup>126925159126925136SD-<i>Mstn<sup>em1Cqin</sup></i>ZFN constructs were designed to target the genomic region of rat Mstn exon 1. ZFN mutant founders were backcrossed to Spargue Dawley rats to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.mutantUnknown126925137SD-<i>Ogdh<sup>em1Yuyi</sup></i>The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. No homozygous rats were obtained from mating of heterozygotes that suggests embryonic lethal for the homozygotic mutant.mutantUnknownOgdh<sup>em1Yuyi</sup>126925168126925138SD-<i>Ubd<sup>em1</sup></i>This Ubd (FAT10) knockout rat strain was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd.mutantUnknownUbd<sup>em1</sup>126925166126925139SD-<i>Dnmt1<sup>tm1(Myh6-cre)Cqin</sup></i>To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO ratsmutantUnknownDnmt1<sup>tm1(Myh6-cre)Cqin</sup>126925165126925196F344-<i>Slc6a3<sup>m1Span</sup></i>This strain was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence.mutantUnknownSlc6a3<sup>m1Span</sup>126925197126925212WI-<i> Drd1<sup>m1Hubr</sup></i>The Drd1 mutant rat line was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein.mutantUnknownDrd1<sup>m1Hubr</sup>126925213126925756SD-<i>Cryba1<sup>Nuc1Dbsa</sup></i>This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1.mutantUnknownCryba1<sup>Nuc1Dbsa</sup>126925758126925949SD-<i>Myh7b<sup>em1Blar+/-</sup></i>The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was
approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.mutantUnknownMyh7b<sup>em1Blar</sup>126925953126925952SD-<i>Myh7b<sup>em1Blar-/-</sup></i>The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was
approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.mutantUnknownMyh7b<sup>em1Blar</sup>126925953126925978SD-<i>Ercc6<sup>em1Cgen</sup></i>The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA). A silent mutation (ACC to ACG) was also introduced to prevent the binding and re-cutting of the sequence by gRNA after HDR. Founder animals harboring the expected single-nucleotide substitution were bred to produce heterozygous and homozygous rats.The heterozygous rats had phenotypes similar to the wild type littermates.mutantUnknownErcc6<sup>em1Cgen</sup>126925980126925992SD-<i>Cftr<sup>em1Ang</sup></i>The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification.mutantUnknownCftr<sup>em1Ang</sup>126925993126925994SD-<i>Cftr<sup>em2Ang</sup></i>The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon. Two knockout founders ( referred as MUKORAT8.3 and MUKORAT 6.4) exhibit no difference in phenotypes and were pooled for study.mutantUnknownCftr<sup>em2Ang</sup>126925995126928141SD-Tg(ITGA2B-F8*)McwiThis transgenic was produced by crossing the SD transgenic rat carrying Lentivirus constructs containing the 2bF8 vector [B-domain deleted human FVIII under control of ITGA2B (IIb) promoter] with an F8 knockout rat SD-F8em1Sage-/-/Novo (RGD:11531091). This transgenic rat strain expressed B-domain deleted human F8 under the control of ITGA2B promoter in the absence of rat F8 product.transgenicUnknownF8<i><sup>em1Sage</sup></i>11531096126928146ACI.Cg.-<i>Cdkn1b<sup>em1Musc</sup></i>The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em2Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-<i>Cdkn1b<sup>em1Musc</sup></i> harbors 32-bp deletion of Cdkn1b exhibits same phenotype as the em4Musc with 65-bp deletionmutantUnknownCdkn1b<sup>em1Musc</sup>126928147126928150ACI.Cg.-<i>Cdkn1b<sup>em4Musc</sup></i>The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em2Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-<i>Cdkn1b<sup>em4Musc</sup></i> harbors 65-bp deletion of Cdkn1b exhibits same phenotype as the em1Musc with 32-bp deletionmutantUnknownCdkn1b<sup>em4Musc</sup>126928151127284837GK/WnsmThe Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations. This GK/Wnsm colony was established at the University of Wales College of Medicine (Cardiff, UK) after received breeding
pairs provided by Professor Y Goto (Tohoku University School of Medicine, Sendai, Japan).inbredUnknown127284865F344-<i>Nppc<sup>em1Kyo</sup></i>This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em1Kyo</sup></i> strain ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1).mutantUnknownNppc<sup>em1Kyo</sup>127284866127284868F344-<i>Nppc<sup>em2Kyo</sup></i>This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em2Kyo</sup></i> strain ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194,
NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length NppcmutantUnknownNppc<sup>em2Kyo</sup>127284869127284870F344-<i>Nppc<sup>em3Kyo</sup></i>This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em3Kyo</sup></i> strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1)mutantUnknownNppc<sup>em3Kyo</sup>127284871127284872F344-<i>Nppc<sup>em4Kyo</sup></i>This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em4Kyo</sup></i> strain ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats.mutantUnknownNppc<sup>em4Kyo</sup>127284873127284883SD-<i>Aqp4<sup>em1Hrt</sup></i>The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate Aqp4-deficient rats. The synthesized TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. The founder animal lacking three base pairs was crossed with wild-type rat to produced the F1 generration and the heterozygous offspring of F1 were corssed to produce mutant strains and confirmed by sequencing analysis of PCR products of modified genome region.mutantUnknownAqp4<sup>em1Hrt</sup>127284884127285380SD-<i>Mir31<sup>em1Sage</sup></i>CRISPR/Cas9 system was used to introduce the gene knockout of Mir31 in the Sprague Dawley embryos.mutantUnknown127285404SHR-<i>Cfb<sup>em1Tja</sup></i>This strain was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion.mutantUnknownCfb<sup>em1Tja</sup>127285405127285409SD-<i>Abcc8<sup>em1Cgen</sup></i>TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This strain carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats is homozygous. No Abcc8 protein was detected in the liver and muscle tissues.mutantUnknownAbcc8<sup>em1Cgen</sup>127285598127285661SD-<i>Adgrl3<sup>em1Huyc</sup></i>The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs
targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three
primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp.mutantUnknownAdgrl3<sup>em1Huyc</sup>127285662127285810SD-<i>Trpa1<sup>em1Gne</sup></i>This Trpa1-deleted Sprague Dawley strain was generated by using CRISPR/Cas9. Rats harboring a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901 were identified.mutantUnknownTrpa1<sup>em1Gne</sup>127285812127338473WM/NemThis Strain was from the National Institute of Genetics., Mishima, Japan to the research institute of Environmental Medicine, Nagoya University.inbredUnknown127338474BDIX/NemThis strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973inbredUnknown127345097SD-<i>Muc1<sup>em1Cgen</sup></i>The Muc1 knock out Sprague Dawley rats were produced by targeted gene mutation at rat Muc1 gene. The deletion was made by microinjection of TALENs and located in the exon 1 of rat Muc1 gene (Gen Bank: NM_012602.1). Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5′-CTAGCAAGCCTAAAAGGTGAGAGGT-3′ and reverse primer 5′-ACGAAGAGCATTTGCCTACTC-3′, followed by DNA sequencing analysis.mutantUnknownMuc1<sup>em1Cgen</sup>127345099127345123F344-<i>Angptl8<sup>em1Kyo-/-</sup></i>This line #1 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3' (sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1.mutantUnknownAngptl8<sup>em1Kyo</sup>127345127127345124F344-<i>Angptl8<sup>em1Kyo+/-</sup></i>This line #1 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1.mutantUnknownAngptl8<sup>em1Kyo</sup>127345127127345125F344-<i>Angptl8<sup>em2Kyo-/-</sup></i>This line #2 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon.mutantUnknownAngptl8<sup>em2Kyo</sup>127345128127345126F344-<i>Angptl8<sup>em2Kyo+/-</sup></i>This line #2 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon.mutantUnknownAngptl8<sup>em2Kyo</sup>127345128149735334SD-<i>Wfs1<sup>em1Ptsn</sup></i>Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1<sup>em1</sup> ( Wfs1-ex5-KO232), Wfs1<sup>em2</sup> (Wfs1-ex5-KO266) and Wfs1<sup>em3</sup> (Wfs1-ex5-INS244). Wfs1<sup>em1</sup> rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine).mutantUnknownWfs1<sup>em1Ptsn</sup>149735335149735336SD-<i>Wfs1<sup>em2Ptsn</sup></i>Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1<sup>em1</sup> ( Wfs1-ex5-KO232), Wfs1<sup>em2</sup> (Wfs1-ex5-KO266) and Wfs1<sup>em3</sup> (Wfs1-ex5-INS244). Wfs1<sup>em2</sup> rats carry a 27 amino acids deletion in exon 5 (aa212-238).mutantUnknownWfs1<sup>em2Ptsn</sup>149735337149735338SD-<i>Wfs1<sup>em3Ptsn</sup></i>Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1<sup>em1</sup> ( Wfs1-ex5-KO232), Wfs1<sup>em2</sup> (Wfs1-ex5-KO266) and Wfs1<sup>em3</sup> (Wfs1-ex5-INS244). Wfs1<sup>em3</sup> rats carry a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226)
into YCMNTI in the WFS1 protein.mutantUnknownWfs1<sup>em3Ptsn</sup>149735339149735356SD-Tg(Wnt1-cre/ERT2)AppscThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT2transgenicLive Animals (as of 2021-07-19)149735357SD-Tg(PDGFB-cre/ERT2)AppscThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19)149735358SD-Tg(Olfr16-cre/ERT2)AppscThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19)149735359SD-Tg(Mnx1-cre/ERT2)AppscThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2transgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)149735361SD-Tg(Drd1-cre/ERT2)AppscThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neuronstransgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)149735362SD-Tg(Gad1-cre/ERT2)AppscThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes.transgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)149735363SD-Tg(GFAP-cre/ERT2)AppscThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicLive Animals (as of 2021-07-19)149735364SD-Tg(Tie2-cre/ERT2)AppscThe CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2transgenicLive Animals (as of 2021-07-19)149735365SD-Tg(SMHC-cre/ERT2)AppscThe 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent.transgenicLive Animals (as of 2021-07-19)149735366SD-Tg(CAG-GFP-LacZ)AppscA transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 linetransgenicUnknown149735371SHR-<i>C3<sup>em1Kyo</sup></i>ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The DNA of 10 day old pups was extracted and screened for ZFN-induced mutations. Briefly, DNA extracted from ear tissue was amplified using primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'-AATAGAGGCCACCAATGCAC-3'). This mutant revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg).advanced_intercross_lineCryopreserved Embryo (as of 2021-07-20)C3<sup>em1Kyo</sup>149735372149735516LL/MavRrrcAekLyon hypotensiveIn 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. The strain from Rat Resource & Research Center was maintained at Department of Pharmacology, University of IowainbredUnknown (as of 2021-07-21)149735517LEXF10A/StmMcwiThese are re-derived rats of LEXF10A/Stm now maintained at Medical College of Wisconsin. The parent strain was derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.recombinant_inbredUnknown149735518HXB4/IpcvMcwiThese are re-derived rats of HXB4/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown149735519HXB31/IpcvMcwiThese are re-derived rats of HXB31/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown149735520HXB2/IpcvMcwiThese are re-derived rats of HXB2/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub.recombinant_inbredUnknown149735521HXB20/IpcvMcwiThese are re-derived rats of HXB20/Ipcv now maintained at Medical College of Wisconsin. The parent strain wasDerived from founder strains SHR/OlaIpcv and BN-Lx/Cubrecombinant_inbredUnknown149735530BXH2/CubMcwiThese are re-derived rats of BXH2/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcvrecombinant_inbredUnknown149735533BXH3/CubMcwiThese are re-derived rats of BXH3/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv.recombinant_inbredUnknown149735557LE-Tg(Pdyn-cre)2-9KobaThis strain was produced by injecting a modified BAC, in which a Cre recombinase was inserted into the third exon of the rat Pdyn gene, into rat zygotes (Iar:Long-Evans, RGD:18337282). This strain is a transgenic rat that expresses Cre recombinase under the control of the Pdyn gene.transgenicCryopreserved Sperm (as of 2021-07-22)149735558F344.LEA-Ugl/OktA congenic strain in which the ugl locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the ugl locus, which contains a 13 bp deletion in the Ctns gene.Cystinosis model rat.congenicCryopreserved Sperm (as of 2021-07-22)149735559F344.LEA-Idao/OktA congenic strain in which the Idao locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the Idao locus, which contains a 54.1 kb deletion in the Dao gene.congenicCryopreserved Sperm (as of 2021-07-22)149735560LE-<i>Gad1<sup>em15Yyan</sup></i>Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes.mutantCryopreserved Sperm (as of 2021-07-22)Gad1<sup>em15Yyan</sup>149735561149735562LE-<i>Gad2<sup>em24Yyan</sup></i>Knockout rats in which the Gad2 gene was disrupted using the TALEN. In this strain, the Gad2 gene encoding GAD65 was knocked out. In homozygous rats, a high rate of epileptic seizures was observed at 2 to 3 weeks of age.mutantCryopreserved Sperm (as of 2021-07-22)Gad2<sup>em24Yyan</sup>149735563149735570F344-<i>Atg16l1<sup>em8Rrrc</sup></i>CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal.mutantLive Animals (as of 2021-07-23)Inflammatory Bowel Disease, autophagyAtg16l1<sup>em8Rrrc</sup>149735571149735895LEW-Tg(Col2a1-luc,-mCherry)RmptRrrcRandom insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferintransgenicUnknownSkeletal Regenerative Medicine149735896LEW-Tg(Col2a1-luc,-mCherry)RmptRandom insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferintransgenicUnknownSkeletal Regenerative Medicine149735897F344-<i>Cacna1a<sup>gry</sup></i>/OkymThis strain is derived from GRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) provided from NBRP-Rat.
GRY/Idr was backcrossed to F344/NSlc.congenicCryopreserved Sperm (as of 2021-07-29)Neurobiology149735898SD-<i>Myh7b<sup>em1Blar+/+</sup></i>This is the homozygous wild type littermate from crossing of heterozygous SD-Myh7b mutants. The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was
approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.mutantUnknown149735906RCCHan:WISTWistar Hannover rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.)outbredUnknown150340617SHRSP.SHR-(<i>rs197197017 -rs198445122</i>)/UtxA congenic strain made by introducing B2 fragment (a segment of chromosome 1, 154.7 Mb - 203 Mb) from SHR/Utx into SHRSP/BbbUtx.The B2 fragment contains wild-type Stim1 as confirmed by sequencing.congenicUnknown150340629SS-<i>Tgfb1<sup>em3Mcwi+/+</sup></i>SS-<i>Tgfb1<sup>em3Mcwi+</sup>/Tgfb1<sup>em3Mcwi+</sup></i>ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed to produce homozygous wild type and heterozygous mutant littermates.mutantUnknown150404267LEW-<i>Myo15a<sup>ci2</sup></i>/ZtmLEW/Ztm-ci2 rat is an animal model for syndromal deafness that arose from a spontaneous mutation. Base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region.mutantUnknownMyo15a<sup>ci2</sup>150404269150429598SS-<i>Vwf<sup>em4Mcwi</sup></i>The rat strain was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting rat strain has a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. Some mRNA must make it through to translation, because low levels of VWF protein are detectable via ELISA (<10%). Both homozygous pairs and heterozygous pairs were used for breeding.mutantUnknownType I von Willebrand DiseaseVwf<sup>em4Mcwi</sup>150429599150429601MWF.SHR-(<i>D6Rat1-D6Rat30</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Rat30</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429602MWF.SHR-(<i>D6Rat1-D6Rat106</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Rat106</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429603MWF.SHR-(<i>D6Rat1-D6Mit8</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Mit8</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429604MWF.SHR-(<i>D6Rat1-D6Rat121</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Rat121</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429605MWF.SHR-(<i>D6Rat1-D6Mgh4</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Mgh4</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429606MWF.SHR-(<i>D6Rat1-D6Rat81</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Rat81</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429607MWF.SHR-(<i>D6Rat1-D6Rat115</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Rat115</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429608MWF.SHR-(<i>D6Rat1-D6Rat184</i>)/RkbThe congenic MWF.SHR-(<i>D6Rat1-D6Rat184</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.congenicUnknown150429614FHH-Tg(CAG-Add3)McwiRomanA full-length rat wild type Add3 cDNA obtained from an expression plasmid pCMV6-entry-Add3 purchased from Origene (Rockville, MD) was inserted in a sleeping beauty transposon vector. The expression of wild type ADD3 in the transposon vector was driven
by a CAG promoter. The construct was injected into the pronucleus ofoocytes collected from female FHH/EurMcwi rats along with SB100 transposase mRNA. A single-transgene insertion was identified on chromosome 10, which is located .64 kbp away from the protein shisa-6 homolog precursor at its 59 end and .360 kbp away from the phosphoinositide-interacting protein at the 3 prime end. Heterozygous founders were intercrossed to derive a homozygous transgenic line that was used for studies.transgenicUnknownAdd32043150429615SD-<i>Add3<sup>em1Mcwi</sup></i>/ RomanZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was
injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant
females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain
to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line usedmutantUnknown (as of 2021-09-09)Add3<sup>em1Mcwi</sup>150429617150429618FHH-Chr 1<sup>BN</sup>-<i>Add3<sup>em2Mcwi</sup></i> /RomanZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was
injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant
females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain
to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line usedmutantUnknownAdd3<sup>em2Mcwi</sup>150429619150429634F344 -<i>Aspa<sup>em34Kyo</sup> Hcn1<sup>em1Kyo</sup></i>F344-Aspaem34Kyo (RGD:11564349) and F344-Hcn1em1Kyo (RGD:38676253) rats
from the National BioResource Project-Rat
were intercrossed to produce F1 hybrids and then to obtain F2 progeny.
Rats homozygous for both Aspa and Hcn1 knockout
alleles were selected from among F2 progeny and were
used to generate the F344-Aspaem34Kyo/Hcn1em1Kyo double-
knockout strain.mutantUnknownAspa<sup>em34Kyo</sup>|Hcn1<sup>em1Kyo</sup>11564348|150429632150429707SD-<i>Cyp2c11<sup>em1Nju</sup></i>CRISPR/Cas9 system containing two pairs of single guide RNA
(sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG-
TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC-
39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39;
reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT)
insertion into exon 6 of CYP2C11 and resulting in the knockout allele.mutantUnknownCyp2c11<sup>em1Nju</sup>150429708150429760SHRSP.SHR-(<i>rs198233821-rs198932221</i>)/UtxA congenic strain made by introducing IgH haplotype block (a segment of chr6:146,030,387 to 154,214,590 ,Rn5 assembly of the rat genome). from SHR-B2 (SHR/Utx) into SHR-A3 (SHRSP/BbbUtx). The igH block contains sequences that are highly divergent between of SHR-A3 and SHR-B2 .congenicUnknown150429814SD-<i>Gnal<sup>em1Hpng+/-</sup></i>The heterozygousGnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to
position 34 to 46 downstream of the translation start point ATG of the
Gnal splicing variant 2 was detected resulting in an early stop at position
150 and producing a truncated protein with 50 amino acids .mutantUnknownGnal<sup>em1Hpng</sup></i>150429816150429815SD-<i>Gnal<sup>em1Hpng+/+</sup></i>The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids .mutantUnknown150429817SD-<i>Gnal<sup>em1Hpng-/-</sup></i>Thehomozygous Gnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to
position 34 to 46 downstream of the translation start point ATG of the
Gnal splicing variant 2 was detected resulting in an early stop at position
150 and producing a truncated protein with 50 amino acids. Only 5% of homozygous Gnal knockout mice could survive till maturitymutantUnknownGnal<sup>em1Hpng</sup></i>150429816150429818BN/HsdMcwiRrrcInbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115). This strain was maintained at RRRC.inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-09-30)150429825SD-<i>Scn9a*<sup>tm1Amgn</sup></i>/CrlExon 25 of the rat Scn9a gene was replaced with the human
SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the
active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase).mutantUnknownScn9a*<sup>tm1Amgn</sup>150429827150429828SD-<i>Tspo<sup>em1Vpl</sup></i>Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting
with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using
the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and
273 bp for the mutant,(89 bp deletion).mutantUnknownTspo<sup>em1Vpl</sup>150429831150429830SD-<i>Tspo<sup>em2Vpl</sup></i>Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting
with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using
the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and
COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30.; Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion).mutantUnknownTspo<sup>em2Vpl</sup>150429832150429960WIC-<i>Wwox<sup>lde</sup></i>/FtaEstablished from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting severe dwarfism, short lifespan (early postnatal lethality), and high incidence of epileptic seizures. Mutant rats showed growth retardation after 3 d of age, and at 21 d their weight was about 56% that of normal rats. Sequencing of the full-length Wwox transcript identified a 13-bp deletion in exon 9 in lde/lde rats. This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal.mutantUnknownWwox<sup>lde</sup>150429961150429963WI-<i>Pmch<sup>m1Hubr</sup></i>The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.mutantUnknownPmch<sup>m1Hubr</sup>150429964150429965SD-<i>Apoa4<sup>em1Bcgen</sup></i>TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp.mutantUnknownApoa4<sup>em1Bcgen</sup>150429966