10000ACI/NA X C 9935, Irish<a href= http://www.rrrc.us/Strain/?x=142>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecoveryspontaneous tumors; chronic renal disease; congenital malformationsTnfrsf1a621237RRID:RRRC_00142Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR)10001AVN/OrlCtr de Selection et d'Elev d'Anim de Lab, Orleans, France.inbredUnknownRRID:RGD_1000110002BBDP/RhwinbredUnknownRRID:RGD_10002S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle.10003BBDR/RhwR. H. William Laboratory, University of Washington, Seattle, WashingtoninbredUnknownRRID:RGD_10003S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 +/- 53 days of age after the first and 67 +/- 10 days of age after the 9th cycle.10004BC/CpbUCentral Laboratory Animal Institute of Utrecht University, The Netherlands.inbredUnknownRRID:RGD_10004Obtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands.10005BDIX/HaninbredUnknownRRID:RGD_10005unknown10006BDVII/CubCharles University, Department of Biology, Prague, inbredUnknownRRID:RGD_10006Druckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype.10008BN/SsNHsdinbredUnknownRRID:RGD_10008Obtained by HSD from nucleus colony at NIH10009BP/CubCharles University, Department of Biology, Prague, inbredUnknownRRID:RGD_1000910010BUF/PitBuffaloinbredUnknownRRID:RGD_1001010011COP/OlaHsdinbredUnknownRRID:RGD_10011These are derived from the original colony which was developed by Dr. W.F. Dunning.10012DA/PitNinbredExtinctRRID:RRRC_00154Unknown10013DON/MelbinbredUnknownRRID:RGD_1001310014F344/PitinbredUnknownRRID:RGD_1001410015FHH/EurErasmus University-RotterdaminbredUnknownRRID:RGD_10015An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.10016GH/OmrGenetically HypertensiveUniversity of Otago Wellcome Med. Res. Inst, New Zealand.inbredUnknownRRID:RGD_10016This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations.10017GK/KyoSweGoto KakizakiDepartment of Molecular Medicine, Karolinska Hospital, Stockholm, SwedeninbredUnknownRRID:RGD_10017Developed from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975).10018IS/Kyoishibashi rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=5 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermOsteosisRRID:RGD_10018Ishibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978.10019LE/MolLong EvansM & B A/S, Denmark.inbredUnknownRRID:RGD_1001910020LEW/PitLewisinbredUnknownRRID:RGD_1002010021LH/MavLaboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, FranceinbredUnknownRRID:RGD_10021In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).10022LN/MavLaboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, FranceinbredUnknownRRID:RGD_10022In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).10023LOU/CHanLouvaininbredUnknownRRID:RGD_10023unknown10024M520/NNIH Animal Genetic ResourceinbredCryopreserved EmbryoRRID:RRRC_00168To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49.10025MHS/GibMilan Hypertensive StrainDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, ItalyinbredUnknownRRID:RGD_10025Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure10026MNR/NMaudsely non-reactiveNIH Animal Genetic ResourceinbredExtinctRRID:RRRC_00174To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.10027MNRA/NNIH Animal Genetic ResourceinbredUnknownRRID:RGD_10027To Harrington in 1965 at F25 (Harrington 1981).10028MNS/GibMilan Normotensive StrainDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, ItalyinbredUnknownRRID:RGD_10028Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.10029MR/PitinbredUnknownRRID:RGD_10029As for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).10030NEDH/KCentral Institute for Diabetes, Karlsburg, Germany.inbredUnknownRRID:RGD_10030Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.10031NP9inbredUnknownRRID:RGD_10031From Wistar10032ODU/NOsaka Dental UniversityNIH Animal Genetic ResourceinbredExtinctRRID:RRRC_00176From outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982).10033OKA/WslProfessor Herve Bazin, Universite de Louvain, FranceinbredUnknownRRID:RGD_1003310034OM/ZtmOsborne-MendelinbredUnknownRRID:RGD_10034unknown10035P5CinbredUnknownRRID:RGD_1003510036PVG/PitinbredUnknownRRID:RGD_1003610037SD/RijinbredUnknownRRID:RGD_10037From Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984).10038SHR/OlaHsdSpontaneously Hypertensive RatinbredUnknownRRID:RGD_1003810039SHRSP/RivSpontaneously Hypertensive Rat, Stroke ProneinbredUnknownRRID:RGD_1003910040SR/JrSalt ResistantDr. John P. Rapp, Medical College of Ohio, USAinbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00056Originated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b).10041SS/JrSalt SensitiveDr. John P. Rapp, Medical College of Ohio, USAinbredCryopreserved Embryo; Cryopreserved SpermHmox12806RRID:RRRC_00055Strain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982)10042WAG/RijKyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=14 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyRRID:RGD_10042Rij > Kyo (1979, F?, GF)10043WF/PitWistar FurthinbredUnknownRRID:RGD_1004310044WIST/NhgWistarGesellschaft f. Strahlen & Umweltforschung, Munich, Germany.inbredUnknownUgt1a1|Abcd23935|69244RRID:RGD_10044From outbred Wistar stock in 1967.10045WN/NInbred Wistar; W/NNIH Animal Genetic ResourceinbredUnknownRRID:RGD_10045Heston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15.10046WKY/OlaHsdinbredUnknownRRID:RGD_1004610047WTC/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=18 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03)RRID:RGD_10047WTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. A missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene (Ohno et al. 2015).60984GHinbredUnknownRRID:RGD_60984University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973).60985BNBN<a href=http://www.criver.com/index.html>Charles River Laboratories</a>inbredUnknownCd36|Tnfrsf1a2301|621237RRID:RGD_60985Billingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b).60986BUF/N<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbredExtinctRRID:RGD_60986Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.60987MHS/NMilan Hypertensive StrainDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, ItalyinbredExtinctAdd1|Add22041|2042RRID:RRRC_00169Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).60988LOU/MinbredUnknownRRID:RGD_60988Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible. Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978).60989BPinbredUnknownRRID:RGD_60989Strain selected for resistance to Walker 256 tumour.60990LH/MavRrrcLyon Hypertensive<a href=http://www.rrrc.us/Strain/?x=57>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2020-02-13)RRID:RRRC_00057Lyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed, unrestrained, conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).60991LELong EvansinbredUnknownRRID:RGD_60991Dr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984).60992MNSMilan normotensive strainDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, ItalyinbredUnknownRRID:RGD_60992Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974).60993FHHFawn Hooded HypertensiveUniversity of Colorado Health Science Center, Denver, ColoradoinbredUnknownRRID:RGD_60993An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.60994F344Fischer<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbredUnknownRRID:RGD_60994Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.60995DRYSankyo Co., Ltd., Tokyo, JapaninbredUnknownRRID:RGD_60995Recombinant inbred strain used as normotensive control in studies of hypertension.60996DONDonryu ratinbredUnknownRRID:RGD_60996R. Sato 1950 by inbreeding Japanese albino rats.60997DADAinbredUnknownEdnrb|Tnfrsf1a2536|621237RRID:RGD_60997Developed from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case.60998COPinbredUnknownRRID:RGD_60998This Copenhagen (COP) rat was an inbred strain from Curtiss 1921 at Columbia University Institute for Cancer Research.60999LEWLewisinbredUnknownFgf2|Tnfrsf1a2609|621237RRID:RGD_60999Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992)61000SHRSpontaneously Hypertensive RatinbredUnknownAgtr1b|Cd36|Ephx22071|2301|620732RRID:RGD_61000Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648).61001NEDHinbredUnknownRRID:RGD_61001Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987.61002BDIXinbredUnknownRRID:RGD_61002Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.61003BCinbredUnknownRRID:RGD_61003Hagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973.61004WIST/ZihkinbredUnknownRRID:RGD_61004From Wistar outbred stock in 1978.61005OM/NOsborne-MendelNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_61005Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).61006PVGPVGinbredUnknownRRID:RGD_61006Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994).61007WFWistar FurthinbredUnknownRRID:RGD_61007J Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995).61008WAGWistar Albino GlaxoinbredUnknownRRID:RGD_61008AL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984).61009AVNinbredUnknownRRID:RGD_61009 Unknown. Keil University from O Stark, Charles University, Prague.61010SHRSPSpontaneously Hypertensive Rat, Stroke ProneIffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-BuchinbredUnknownRRID:RGD_61010The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994).61011BB/NBioBreeding ratinbredExtinctRRID:RRRC_00144Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).61013E3inbredUnknownRRID:RGD_61013Kroning, Gottingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968.61014OLETFOtsuka Long-Evans Tokushima fattyOtsuka Research Institute, Tokushima, JapaninbredUnknownRRID:RGD_61014Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence'61015LN/MavRrrclyon normotensive<a href=http://www.rrrc.us/Strain/?x=58>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00058(taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews).61096SHR/NCrukSpontaneously Hypertensive Rat<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UKinbredUnknownRRID:RGD_61096NIH derived strain maintained at the Charles River, United Kingdom.61097WKY/NCruk<a href=http://guide.labanimal.com/guide/companyd.jsp?b=1602>Charles River Laboratories </a> UKinbredUnknownRRID:RGD_61097NIH derived strain maintained at the Charles River, United Kingdom.61098BXH/IpcvInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_61098These recombinant inbred strains are derived from the (BN-<i>Lx</i>/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic61099HXB/IpcvInstitute of Physiology, Czech Academy of Sciences, Charles University, Praguerecombinant_inbredUnknownRRID:RGD_61099Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published.61100SHR/OlaCzech Academy of Sciences, Prague, Czech RepublicinbredUnknownRRID:RGD_61100Strain originated from an inbred SHR strain from Harlan UK Ltd.61103WKYMedical College of Ohio, Toledo, OhioinbredUnknownCd36|Nos32301|3186RRID:RGD_61103This strain was maintained at Medical College of Ohio, Toledo, Ohio61104LEW/NCrl<a href=http://www.geneticmodels.com/RM/rats/rats_a_c.html>Charles River Laboratories USA </a>inbredUnknownRRID:RGD_61104Substrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34.61105WKY/NHsd<a href =https://www.envigo.com/model/wky-nhsd?selctry=U.S.&ctry=/> Envigo</ainbredUnknownRRID:RGD_61105Derived from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. and maintained at Harlan Indianapolis, Indiana U.S.A.61106SHR.BN-(<i>D8Mit5-D8Mgh6</i>)/IpcvInstitute of Physiology, Czech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_61106A segment of chr. 8 is transferred from the normotensive BN-<i>Lx</i>/Cub rat to the SHR/Ola.61107BB/OKBioBreeding ratCentral Institute for Diabetes, Karlsburg, GermanyinbredCryopreserved SpermDiabetes Obesity; ImmunologyAsns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk52162|2280|2332|2481|2794|3082|3726|3807|69430|70514RRID:RGD_61107This colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada.61109F344/NHsdF344/NHsd<a href =http://www.envigo.com/model/f344-nhsd/>Envigo</a>, <a href =http://www.envigo.com/model/f344-nhsd-aged/>Envigo aged</a>inbredUnknownRRID:RGD_61109Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.61110SHR/MolMollegaard Breeding Centre Ltd., DenmarkinbredUnknownRRID:RGD_61110Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes.61111DA/Slcdark agouti<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=380 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsRRID:RGD_61111These were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983.6111213MLaboratory of Human Behavior and Metabolism, Rockefeller UniversityinbredUnknownRRID:RGD_61112This is a Leprfa/Leprfa substrain derived from the Zucker rat.61113BN-<I>Lx</I>mutantUnknownRRID:RGD_61113These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background.61114DA/BklBantin and Kingman, Fremont, CaliforniainbredUnknownRRID:RGD_61114Commercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls.61115BN/SsNNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_61115To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony.61116SHRSP/A3Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, JapaninbredUnknownRRID:RGD_61116Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness.61117BN-<i>Lx</i>/CubBrown Norway with polydactyly-luxateCharles University, Department of Biology, PragueinbredUnknownRRID:RGD_61117These were derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background.61118BUF/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=458 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermCancer; UrologyBsis2221RRID:RGD_61118Strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.61119WKY/NCrlCrljinbredLive Animals; Cryopreserved Embryo (as of 2023-05-30)RRID:RGD_61119Originated from outbred Wistar of Kyoto University. To NIH from Kyoto University in 1971 and sib mating has started. To Charles River Laboratories, Inc from NIH in 1974 at F11, and to Charles River Japan, Inc. in 1981 at F25. (May 27, 2010). Used as control strain for the SHR strain.61498BN/NHsdMcwiPhysGeninbredLive Animals; CryorecoveryRRID:RGD_61498Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115)61499SS/JrHsdMcwiPhysGeninbredLive Animals; CryorecoveryRRID:RGD_61499Inbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115).61517FHL/EurFawn Hooded Low blood pressureErasmus University-RotterdaminbredUnknownRRID:RGD_61517An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damage67934WOKAinbredUnknownRRID:RGD_67934Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.67935WOKWDept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, GermanyinbredUnknownRRID:RGD_67935Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designated WOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes.67936WRinbredUnknownRRID:RGD_67936 Sykora, Rosice (Stark et al 1968b). No further infromation.67937WSTinbredUnknownRRID:RGD_67937 Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986).67938Y59inbredUnknownRRID:RGD_67938 Strain developed in Zagreb, Jugoslavia.67939YA/NinbredExtinctRRID:RRRC_00191No further information.67940YOinbredUnknownRRID:RGD_67940 Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992)67941Z61inbredUnknownRRID:RGD_67941Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours.67942ZIinbredUnknownRRID:RGD_67942 A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989).67943SHE/N-cpinbredUnknownRRID:RGD_67943Reference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94.67945ISinbredUnknownRRID:RGD_67945from a cross between a wild male and a Wistar female, with sib mating since 1968.67948JCinbredUnknownRRID:RGD_67948 LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984).67957APRinbredUnknownRRID:RGD_67957Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).67958ASAlbino SurgeryNational Institute for Medical Research, Mill Hill, UKinbredUnknownRRID:RGD_67958University of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973).67959AS2inbredUnknownRRID:RGD_67959Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968).67960AUGinbredUnknownRRID:RGD_67960Derived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England.67962ANinbredUnknownRRID:RGD_67962Outbred Wistar Imamichi strain.67965AXCrecombinant_inbredUnknownRRID:RGD_67965 A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976.67966BinbredUnknownRRID:RGD_67966 Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85.67967B/1NinbredExtinctRRID:RGD_67967No further information.67971BBZinbredUnknownRRID:RGD_67971Strain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 367974BDEinbredUnknownRRID:RGD_67974Zentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring.67975BDIinbredUnknownRRID:RGD_67975Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67976BDIIinbredUnknownRRID:RGD_67976Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67977BDIIIinbredUnknownRRID:RGD_67977Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67978BDIVinbredUnknownRRID:RGD_67978Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67981BDVinbredUnknownRRID:RGD_67981Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67983BDVIinbredUnknownRRID:RGD_67983Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67984BDVIIinbredUnknownRRID:RGD_67984Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976)67986BDVIIIinbredUnknownRRID:RGD_67986Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67987BDXinbredUnknownLypd369053RRID:RGD_67987Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain.67988BEGinbredUnknownRRID:RGD_67988from a cross between SC and TE.67989BHinbredUnknownRRID:RGD_67989 D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973.67990BIinbredUnknownRRID:RGD_67990 Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992)67991BIL/1NIH Autoimmune Rat Model RepositoryinbredUnknownRRID:RGD_67991University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.67993BIL/2NIH Autoimmune Rat Model RepositoryinbredUnknownRRID:RGD_67993University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.68000BIRMBinbredUnknownRRID:RGD_68000same as BIRMA.68001BLK/NinbredExtinctAsip2003RRID:RGD_68001This strain has an agouti mutation68007BROFOinbredUnknownRRID:RGD_68007 Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions.68008BSinbredUnknownRRID:RGD_68008 University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966).68011CinbredUnknownRRID:RGD_68011No further information.68012CAPinbredUnknownRRID:RGD_68012 Polish Academy of Sciences, Krakow (Stark et al 1968a).68013CAR/NHunt-Hoppert caries resistant; CA/R<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbredUnknownRRID:RGD_68013Hunt 1937, developed for resistance to dental caries (Hunt et al 1955).68014CASinbredUnknownRRID:RGD_68014Hunt 1937, developed for high incidence of dental caries.68015CBHinbredUnknownRRID:RGD_68015Woodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded).68018CPB-WEinbredUnknownRRID:RGD_68018Wistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands.68019CRDHCohen Rosenthal Diabetic HypertensiveHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelinbredUnknownRRID:RGD_68019 As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995).68020CWSinbredUnknownRRID:RGD_68020R Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open.68022DBinbredUnknownRRID:RGD_68022No further information.68023DEBRDundee experimental bald ratinbredUnknownRRID:RGD_68023The DEBR rats have been bred at the University of Dundee since March 1984. The original crosses involved the inbred stock BDIX rats showing lesion and Wistar rat. The descendants of this cross resulted from full sib-matings.Two strains of DEBR rats are geing developed: the black-hooded and brown-hooded strains.68026DSS/1NinbredExtinctRRID:RRRC_00155Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N).68027DSS/2NinbredExtinctRRID:RRRC_00156Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).68028DSS/3NinbredExtinctRRID:RRRC_00157Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N).68029DXE-1recombinant_inbredUnknownRRID:RGD_68029Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover)68031ETTaisho Pharmaceutical Co. LtdinbredUnknownRRID:RGD_68031 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).68032EXBHinbredUnknownRRID:RGD_68032Hannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990)68034F6RinbredUnknownRRID:RGD_68034Mutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985).68035FCHinbredUnknownRRID:RGD_68035Fice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol.68036FHinbredUnknownRab38<sup>ru</sup>1600311RRID:RGD_68036 Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see strains FHH and FHL), which may have different characteristics.68038FHLinbredUnknownRRID:RGD_68038see FHH.68040FNLinbredUnknownRRID:RGD_68040Fice Normolipidemic strain. Developed as a control strain for FCH (see FCH).68041GinbredUnknownRRID:RGD_68041 Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977)68042GEPRinbredUnknownRRID:RGD_68042Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a).68044GHAinbredUnknownRRID:RGD_68044 The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973).68046HCSinbredUnknownRRID:RGD_68046Harvard to Liverpool, UK in 1960.68047HMTinbredUnknownRRID:RGD_68047Outbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor".68048HSinbredUnknownRRID:RGD_68048 Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus.68049HXB-1-43/IpcvDepartment of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlandsrecombinant_inbredUnknownRRID:RGD_68049Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs.68050IIMinbredUnknownRRID:RGD_68050Set of nine strains bred as parallel strains from a single outbred colony maintained by B. Houssay in 1948. All strains were selected for large body weight and high fertility. One strain designated Beta IIM (RGD:40924649) derived from line 'b' became obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). Alpha IIM (RGD:40924650) was used as a control strain in study.68051INR/NinbredExtinctRRID:RRRC_00160Harrington 1962 from a stock selected by CS Hall for low open field defaecation.68052IRinbredUnknownRRID:RGD_68052Harrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981).68057KinbredUnknownRRID:RGD_68057 Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973).68058KGH/PitNinbredExtinctRRID:RRRC_00162Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).68059KIRBY-BinbredUnknownRRID:RGD_68059 From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980).68060KXinbredUnknownRRID:RGD_68060 developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977)68061KYN/Hok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=69 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RGD_68061Makino, Hokkaido University 1960 from stock the carrying the68062LA/NNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_68062from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982).68063LA/N-<i>cp</i><a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_68063The corpulent (LA/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. The obese homozygous (cp/cp) littermates developspontaneous insulin resistance, obesity, impaired glucose tolerance, hypertriglyceridemia and atherosclerosis.68065LEAinbredUnknownRRID:RGD_68065 Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993)68066LECinbredUnknownRRID:RGD_68066In 1975, at the Center for Experimental Plants and Animals, Hokkaido University, Long Evans Cinnamon was derived originally from a closed colony of Long-Evans rats obtained from Kobe University in 1975.68067LEJ/Hok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=72 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_68067Hok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication).68068LEMinbredUnknownCkb2357RRID:RGD_68068 Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980).68069LEOinbredUnknownRRID:RGD_68069 from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980).68070LEPinbredUnknownRRID:RGD_68070 Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984)68071LER/NinbredExtinctRRID:RRRC_00164Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology.68072LETinbredUnknownRRID:RGD_68072 from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 168073LETLinbredUnknownRRID:RGD_68073 A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan68074LETOinbredUnknownRRID:RGD_68074THe LETO was obtained by mating of Long-Evan rats in Otsuka Pharmaceutical Co.The LETO has not shown the diabetic syndrome.68077LL/MavRrrcLyon hypotensive<a href=http://www.rrrc.us/Strain/?x=59>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00059Lyon Low-Tensive. See LH68079LOUInstitut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, FranceinbredUnknownRRID:RGD_68079 Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978).68082LUDWinbredUnknownRRID:RGD_68082Ludwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU.68083LXBrecombinant_inbredUnknownRRID:RGD_68083 Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover)68084M14inbredUnknownRRID:RGD_68084 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum.68085M17inbredUnknownRRID:RGD_68085AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum.68086M520inbredUnknownRRID:RGD_68086Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992).68087MAXXinbredUnknownRRID:RGD_68087From a cross of BNxLEW with subsequent inbreeding.68088MFinbredUnknownRRID:RGD_68088Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat).68091MLCSMilan low-calpastatin strainDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, Italyrecombinant_inbredUnknownRRID:RGD_68091From a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity.68097MSUBLinbredUnknownRRID:RGD_68097 Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977).68098MWMunich WistarinbredUnknownRRID:RGD_68098Munich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS.68099MWFinbredUnknownRRID:RGD_68099From outbred Wistar rats selected for large numbers of superficial glomeruli.68100NBLinbredUnknownRRID:RGD_68100 Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990).68103NERnoda epileptic ratinbredUnknownRRID:RGD_68103From Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has.68104NIG-III/Hok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=73 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_68104From a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987).68106NSD/NNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_68106NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock.68107NZRinbredUnknownRRID:RGD_68107Subline of AS2 separated at F32.68109ODUSinbredUnknownRRID:RGD_68109As for ODU, but maintained at Osaka Dental University.68113OXYR/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, RussiainbredUnknownRRID:RGD_68113Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain.68114OXYS/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, RussiainbredUnknownRRID:RGD_68114Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats.68115P77PMCinbredUnknownRRID:RGD_68115Wistar rats from Beijing Medical College in 1977.68116PAinbredUnknownRRID:RGD_68116 King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction.68117PETH/NRoyal College of Surgeons, RCS<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbredUnknownRRID:RGD_68117 Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS.68118PKDPKDCentral Institute for Laboratory Animal Breeding, Hanover, GermanyinbredUnknownRRID:RGD_68118Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991.68119PSDO/NinbredExtinctRRID:RRRC_00178Reserved symbol for strain in development now at F6 (NIH 1989).68121RinbredUnknownRRID:RGD_68121Muhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R.68122RCS/NinbredExtinctRRID:RRRC_00180Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline.68123RHA/NRoman high avoidanceNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_68123Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated.68124RII/1inbredUnknownRRID:RGD_68124 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991).68125RII/2inbredUnknownRRID:RGD_68125 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991).68126RLA/NinbredUnknownRRID:RGD_68126Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains.68127RP/AEurRijinbredUnknownRRID:RGD_68127Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991).68128S5BinbredUnknownRRID:RGD_68128 Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating.68129SBHSabra hypertensiveBarzilai Medical Center, Ashkelon, IsraelinbredUnknownRRID:RGD_68129Sabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics).68130SBNinbredUnknownRRID:RGD_68130 As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984).68131SCinbredUnknownRRID:RGD_68131 Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360)68133SDJ/Hok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=74 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermSlc2a23705RRID:RGD_68133Takeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966.68134SDNKinbredUnknownRRID:RGD_68134Sprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan.68136SELinbredUnknownRRID:RGD_68136Dunning 1948. Probably extinct.68137SHHFinbredUnknownGrk2|Grk32062|2063RRID:RGD_68137 JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile.68140SPRD/HsdHarlanoutbredUnknownRRID:RGD_68140Originated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony.68143TAinbredUnknownRRID:RGD_68143Outbred Wistar Imamichi.68144TEinbredUnknownRRID:RGD_68144Outbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987).68145TFinbredUnknownRRID:RGD_68145From outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988).68146THAinbredUnknownRRID:RGD_68146 Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990).68147THE/UtpTsukuba high-emotional rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=516 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermBehaviorRRID:RGD_68147Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE).68148TLE/UtpTsukuba low-emotional rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=515 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoBehaviorRRID:RGD_68148Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE).68149TMTester Moriyama ratInstitute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, JapaninbredUnknownRRID:RGD_68149 Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication).68150TMBinbredUnknownRRID:RGD_68150 PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).68151TMDinbredUnknownRRID:RGD_68151 PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).68152TO/HokTokyo rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=75 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RGD_68152A breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994).68154TOMinbredUnknownRRID:RGD_68154 Toma Institute, Japan (Ikadai, personal communication, 1991)68155TSinbredUnknownRRID:RGD_68155 WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b).68156TS1inbredUnknownRRID:RGD_68156 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).68157TS3/NinbredExtinctRRID:RRRC_00185Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b).68158TTinbredUnknownRRID:RGD_68158 outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991).68160TUinbredUnknownRRID:RGD_68160 From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991)68161TWinbredUnknownRRID:RGD_68161 Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985).68162TXinbredUnknownRRID:RGD_68162 From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991)68163UinbredUnknownRRID:RGD_68163 Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990).68164UChAUniversity of Chile, Casilla, ChileinbredUnknownRRID:RGD_68164 Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.68165UChBUniversity of Chile, Casilla, ChileinbredUnknownRRID:RGD_68165 Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile.68166W/HokinbredUnknownRRID:RGD_68166 Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977).68167W/NhginbredUnknownRRID:RGD_68167 Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany.68168WAinbredUnknownRRID:RGD_68168 St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983.68169WABinbredUnknownRRID:RGD_68169 Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977).68171WBB/1NinbredExtinctRRID:RRRC_00186No further information68172WBB/2NinbredExtinctRRID:RRRC_00187No further information.68173WBNinbredUnknownRRID:RGD_68173 Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived.68174WCFinbredUnknownRRID:RGD_68174 R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot.68175WDFinbredUnknownRRID:RGD_68175Ikeda et al (1981) by backcrossing the fatty gene to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus.68176WECinbredUnknownRRID:RGD_68176 Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).68177WEKinbredUnknownRRID:RGD_68177 Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished).68178WELSinbredUnknownRRID:RGD_68178Outbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984)68180WINinbredUnknownRRID:RGD_68180WI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986).68183WKAinbredUnknownRRID:RGD_68183 King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992)68184WKAH/HokWistar-King Aptekman Hokkaido<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=76 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_68184King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA.68185WKAMinbredUnknownRRID:RGD_68185 King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA.68186WKHA/NinbredExtinctRRID:RRRC_00188From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure.68187WKHT/NinbredExtinctRRID:RRRC_00189From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992).68188WKSinbredUnknownRRID:RGD_68188 National Institute of Genetics, Mishima, Japan.68189HTX/HcjDepartment of Pharmacology, University of Florida, Gainesville.inbredUnknownRRID:RGD_68189D. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30.69369SSBrookhaven National Laboratories, Upton, New YorkinbredUnknownRRID:RGD_69369From a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension.69638BN/KaBrown Norway Katholiek (kininogen or kinin deficient)Kitasato University, Kanagawa, Japan.inbredUnknownRRID:RGD_69638Kitasato University, Kanagawa, Japan.69643F344/DuCrlCrlj<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=537> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsNeurobiology; Cardio HypertensionRRID:RGD_69643This strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976.70410AAAlko, AlcoholResearch Laboratories of the State Alcohol Monopoly (Alko), Helsinki, FinlandinbredUnknownRRID:RGD_70410Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as drink for 10 days, after which they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. Fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight, so alcohol intake was used as a phenotypic measure.70411ANAAlko, Non-AlcoholResearch Laboratories of the State Alcohol Monopoly (Alko), Helsinki, FinlandinbredUnknownRRID:RGD_70411Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure.70413WBBinbredUnknownRRID:RGD_7041370416ACHinbredUnknownRRID:RGD_70416Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research.70417A28807/NNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RRRC_00141Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982).70418A35322inbredUnknownRRID:RGD_70418Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990.70419A7322inbredUnknownRRID:RGD_70419Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus.70420A990inbredUnknownRRID:RGD_70420Curtiss 1921 at Columbia University Institute for Cancer Research.70421AAWinbredUnknownRRID:RGD_70421Atomic Energy Commission, Melbourne (Adams et al 1984).70422ABHNishimura, Hammatsu University School of Medicine, Japan.inbredUnknownRRID:RGD_70422Yamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan.70423ACPinbredUnknownRRID:RGD_70423Dunning to National Cancer Institute 1967 at F54.70424AGAinbredUnknownRRID:RGD_70424Nakic, Zagreb (Stark et al 1968b). Used for immunological studies.70425AGUSinbredUnknownRRID:RGD_70425Germ-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26.70426ALB/NAlbany<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbredUnknownRRID:RGD_70426Wolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer.70427AMinbredUnknownRRID:RGD_70427Torres, Rio de Janeiro, from outbred stock.70428AMDILinbredUnknownRRID:RGD_70428Torres, Rio de Janeiro, from outbred stock70429AOinbredUnknownRRID:RGD_70429From ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995).70440BIRMAinbredUnknownRRID:RGD_70440AM Mandl 1952 from Albino rats purchased from Birmingham market.70446LIH/LacLiverpool HoodedinbredUnknownRRID:RGD_70446"Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981).70447MNRMaudsely non-reactiveinbredUnknownRRID:RGD_70447PL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982).70448MNRAinbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00692Substrain of MNR. To Harrington in 1965 at F25 (Harrington 1981).70449MR/NMaudsely reactive<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbredUnknownRRID:RGD_70449Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982).70450NBRinbredUnknownRRID:RGD_70450Poiley 1966 from heterogeneous stock70451OKAinbredUnknownRRID:RGD_70451From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days.70452OMOsborne-Mendel<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>outbredUnknownRRID:RGD_70452Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982).70453SRinbredUnknownRRID:RGD_70453Rapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen.70454WKY/N<a href=http://dvrnet.ors.od.nih.gov/ratcenter/index.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=190>Rat Resource and Research Center</a>inbredCryopreserved Embryo (as of 2019-02-01)RRID:RRRC_00190National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain.70455WKYO/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=17 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RGD_70455Inbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991).70456WMinbredUnknownRRID:RGD_70456Wistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Mishima in 1951.70457WMSinbredUnknownRRID:RGD_70457Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWF70459ZDFVancouver diabetic fatty ZuckerAnimal Model Core Facility, University of California at DavisinbredUnknownRRID:RGD_70459"Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b).70508SDSprague-DawleyoutbredUnknownAqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f12141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|728892RRID:RGD_70508This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain, probably Wistar) and subsequently to his white female offspring for 7 generations. All the current colonies are from this original stock.70509F344/NRrrc<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=158>Rat Resource and Research Center</a>inbredCryopreserved SpermCdkn2a|Gfap|Tnfrsf1a2323|2679|621237RRID:RRRC_00158Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH.625624LE<i>Tsc2<sup>Eker</sup></i>/HinDepartment of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo JapanmutantUnknownTsc2|Tsc2<sup>Eker</sup>3908|12791989RRID:RGD_625624Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo.625659DRH/Seac<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=111 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_625659Established by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3628372ACI.FHH-(<i>D1Mit34-D1Rat156</i>)/EurAnimal Research Center of the Erasmus University, Rotterdam, The NetherlandscongenicUnknownRRID:RGD_628372The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI.628486NER/KyoNoda epileptic rat, GMS<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=26 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyRRID:RGD_628486Originated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan.628525Ni/HinClea Japan Inc. ShigainbredUnknownRRID:RGD_628525Found in the Sprague-Dawley (Jci:SD) in Japan. In these the Tsc2 gene is not mutated. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream628907SHR.BN-RT1<sup>n</sup>congenicUnknownRRID:RGD_628907This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR.628908SHR.BN-(<i>D1Mit3-Igf2</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownIgf2|Sa|Scnn1b|Scnn1g2870|3616|3640|3641RRID:RGD_628908Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating.628909SHR.BN-(<i>D13Arb5-Ren1</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_628909Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity.629459ZUC-<i>Lepr<sup>faSteJrpz-/-</sup></i>Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USAmutantUnknownRRID:RGD_629459Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology.629462ZUC-<I>Lepr</I><sup>faSte-/-</sup>University of California Davis, Davis, CAmutantUnknownLepr<sup>fa</sup>13432153RRID:RRRC_00839This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size.629463ZUC-<I>Lepr</I><sup>+Ste</sup>University of California Davis, Davis, CAmutantUnknownLepr3001RRID:RGD_629463This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype.629464ZUC-<I>Lepr</I><sup>fa</sup>mutantUnknownLepr<sup>fa</sup>13432153RRID:RGD_629464This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions.629465SHR/NCrlCrljCharles River Japan, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=478> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoCardio HypertensionRRID:RGD_629465NIH derived strain maintained at the Charles River, Japan.629481SHR.WKY-(<i>D1Wox33-D1Got194</i>)Département de Physiologie et Pharmacologie Clinique, Faculté de Pharmacie, FrancecongenicUnknownRRID:RGD_629481This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background.629482WKY.SHR-(<i>D1Wox19-D1Mit2</i>)/NjsUniversity of Leicester, Leicester, UKcongenicUnknownRRID:RGD_629482Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY629484LEW-<i>tl</i>Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MDcongenicUnknownCsf1|Csf1<sup>tl</sup>621063|12910954RRID:RGD_629484The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N.629485LE/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=265 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_629485The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50.629486PVG/OlaHsdinbredCryorecoveryRRID:RGD_629486black hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992629487SHR.WKY-(<i>D1Wox19-D1Wox34</i>)/NjsUniversity of Leicester, Leicester, UKcongenicUnknownRRID:RGD_629487Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR629488SI-Tg(Ednrb)Ywatransgenic spotting lethalUniversity of Texas Southwestern Medical Center, Dallas, TexastransgenicUnknownEdnrb|Ednrb<sup>sl</sup>2536|10755424RRID:RGD_629488A 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals.629489Eker-Tg(Tsc2)5HinDepartment of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, JapantransgenicUnknownTsc23908RRID:RGD_629489Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.629490DA.F344-Aia1/1National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MarylandcongenicUnknownRRID:RGD_629490genomic segments with region of interest from chr 20 were inserted to DA strain629491DA.F344-Aia1/2National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MarylandcongenicUnknownRRID:RGD_629491genomic segments with region of interest from chr 4 were inserted to DA strain629492SlInstitute of Animal Reproduction, Omiya, JapanmutantUnknownEdnrb|Ednrb<sup>sl</sup>2536|10755424RRID:RGD_629492Natural mutation in the progeny of a Wistar-Imamichi female and a wild rat.629493DA.F344-Aia1/3National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MarylandcongenicUnknownRRID:RGD_629493genomic segments with region of interest from chr 4 were inserted to DA strain629494DA.F344-Aia1/4National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MarylandcongenicUnknownRRID:RGD_629494genomic segments with region of interest from chr 10 were inserted to DA strain629495WKY.SHRSP-(<i>Mt1pa-D1Rat57</i>)/BbbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownMt1-ps13118RRID:RGD_629495Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY629499BXS/IpcvCzechoslovak Academy of Sciences, Praguerecombinant_inbredUnknownRRID:RGD_629499These recombinant inbred strains are obtained by crossing normotensive BN-<i>Lx</i>/Cub with hypertensive SHR/Ola progenitor strains.629500LEXF/StmSaitama Cancer Center Research Institute, 818 Komuro Saitama, Japanrecombinant_inbredUnknownRRID:RGD_629500Recombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating.629501SD-Tg(Ren2)27Center for Genome Research, University of Edinburgh, UKtransgenicUnknownAgtr1b|Ace2071|2493RRID:RGD_629501This is a hypertensive rat strain in which the mouse Ren2 renin gene along with its 5' and 3' flanking sequences were microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background.629502SHR.BN-(<i>Il6-Npy</i>)MRC Clinical Centre, London, UKcongenicUnknownIl6|Npy2901|3197RRID:RGD_629502This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes629503SHR.BN-(<i>D19Rat57-D19Mit7</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownAgt2069RRID:RGD_629503The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating.629504WKY.SHR-(<i>D1Mit3-D1Rat57</i>)/IwaiShiga University of Medical Science, Otsu, JapancongenicUnknownRRID:RGD_629504Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY629505SS.MNS-(<i>D10Mit11-D10M11Mit119</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_629505fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr629506LEW-<i>tl</i>.BN-(<i>D2Arb16-D2Wox8</i>)Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MDcongenicUnknownCsf1621063RRID:RGD_629506LEW.<i>tl</i> carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2.629509FHH/EurMcwiPhysGeninbredLive Animals; CryorecoveryRRID:RRRC_00293An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University.629510SS.BN-(<i>D12Arb13-D12Rat79</i>)/McwiPhysGencongenicLive AnimalsRRID:RGD_629510A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629511SS-Chr 2<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629511A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629512FHH-Chr 12<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629512A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed629513SS-Chr 4<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629513A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629514SS-Chr 6<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved SpermRRID:RGD_629514A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629515SS-Chr 7<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629515A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629516SS-Chr 8<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629516A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629517SS-Chr Y<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629517A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629518SS-Chr 9<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629518A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629519SS.BN-(<i>D13Mgh13-D13Mit4</i>)/McwiPhysGencongenicUnknownRRID:RGD_629519A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629520FHH-Chr 1<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved SpermRRID:RGD_629520A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed629521SS-Chr 11<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629521A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629522SS-Chr 20<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629522A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629523SS-Chr 13<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_629523A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629524SS-Chr 16<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved SpermRRID:RGD_629524A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629525SS-Chr 18<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_629525A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed629548SHR.BN-(<i>D1Mit3-Igf2</i>)/1lpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_629548SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv.629578SS.LEW-(<i>D5Rat130-D5Mco10</i>)/JrDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio.congenicUnknownRRID:RGD_629578 A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generations631158DXE1/ZtmZentralinstitut Fur Versuchstierzucht, Hannover, Germanyrecombinant_inbredUnknownRRID:RGD_631158DXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.631160DXE2/ZtmZentralinstitut Fur Versuchstierzucht, Hannover, Germanyrecombinant_inbredUnknownRRID:RGD_631160Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats631161DXE3/ZtmZentralinstitut Fur Versuchstierzucht, Hannover, Germanyrecombinant_inbredUnknownRRID:RGD_631161Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats.631163LE/BluGillUniversity of Illinois at Urbana-ChampaigninbredUnknownRRID:RGD_631163This inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock.631182DA/BklArbNNIH, Arthritis and Rheumatism Branch, Bethesda MDinbredExtinctRRID:RRRC_00091This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding.631219SDT/Jcl<a href =https://www.clea-japan.com/en/products/diabetes/item_a0140> CLEA Japan, Inc</a>inbredLive Animals (as of 2021-04-23)RRID:RGD_631219Established from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating.631220SS.LEW-(<i>D10Mco1-D10Mco31</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_631220Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment631275WKY/CfdWKY/CfdExperimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CAinbredUnknownRRID:RGD_631275Substrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA)631276WKHA/CfdWKHA/CfdExperimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CAinbredUnknownRRID:RGD_631276Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM)631278SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownFst|Gstm1|Vcam1|S1pr12633|2755|3952|61958RRID:RGD_631278Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background.631279SHRSP.WKY-(<I>D2Rat13-D2Mit5</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownFst2633RRID:RGD_631279Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.631280WKY.SHRSP-(<I>D2Mit5-D2Mgh12</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownPklr3336RRID:RGD_631280Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.631281WKY.SHRSP-(<I>Fst-Pklr</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownFst|Pklr2633|3336RRID:RGD_631281Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow.631282DA.F344-(<I>D10Arb20-D10Arb22</I>)/ArbArthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USAcongenicExtinctRRID:RGD_631282This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background.631283DA.F344-(<I>D10Arb21-D10Arb22</I>)/ArbArthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USAcongenicExtinctRRID:RGD_631283This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background.631285IER/IhrInstitute of Experimental Animals of Shiga University, Medical Science, Ohtsu, JapaninbredLive AnimalsNeurobiology; OphthalmologyRRID:RGD_631285A mutant rat strain which is a useful model for human cataract.631286WKY/IzmWistar-Kyoto<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=412 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsRRID:RGD_631286WKY strain from the Izumo colony631294F344.GK-(<I>D1Arb42a-D1Rat90</I>)/SweDepartment of Medical Cell Biology, Uppsala University, Uppsala, SwedencongenicUnknownCyp2c122470RRID:RGD_631294This congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 background631571SS.LEW-(<i>D1Uia8-D1Mco38</i>)/JrDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_631571Segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.631572SBH/YglSabra hypertension proneBen Gurion University Barzilai Medical Center, Ashkelon, IsraelinbredUnknownRRID:RGD_631572Bred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.631573SBN/YglSabra hypertension resistantBen Gurion University Barzilai Medical Center, Ashkelon, IsraelinbredUnknownRRID:RGD_631573Bred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed.631574Wild/KDepartment of Laboratory Animal Science, Greifswald, Karlsburg, GermanywildUnknownRRID:RGD_631574Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany.631576LEW/CrlCrljinbredLive Animals; Cryopreserved EmbryoImmunology; OsteosisRRID:RGD_631576Developed by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34.631577SHR/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=411 > National BioResource Project for the Rat in Japan</a>, Funabashi Farm, Chiba, JapaninbredLive AnimalsCardio HypertensionRRID:RGD_631577Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).631578SHR.BN-(<I>D2Rat171-D2Arb24</I>)/IpcvInstitute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic.congenicUnknownRRID:RGD_631578This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background631579LEW/OlaHsdHarlan FranceinbredUnknownRRID:RGD_631579Obtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands.631581LEW.1FZentralinstitut fur versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_631581Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1<sup>f</sup> haplotype into the LEW stock631582SS.WKY-(<i>Mme-D2Wox18</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownMme3098RRID:RGD_631582Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr631583SS.WKY-(<i>D2Mgh8-D2Mgh9</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_631583Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr631585SS.LEW-(<I>D16Mit2-D16Rat12</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_631585This congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr background631586SS.MNS-(<I>D10Mco14-D10Mit11</I>)/JrMedical College of Ohio, ToledocongenicUnknownRRID:RGD_631586This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.631587SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/JrMedical College of Ohio, ToledocongenicUnknownAce2493RRID:RGD_631587This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.631588SS.MNS-(<i>D10Mit11-Vamp2</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownVamp23949RRID:RGD_631588Fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr631589SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/NjsDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenicUnknownRRID:RGD_631589Congenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHR631590SHR.WKY-(<i>D1Wox34-Sah</i>)/NjsDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenicUnknownAcsm362086RRID:RGD_631590Congenic substrain derived by backcrossing congenic strain SHR.WKY-(<I>D1Wox19-D1Wox34</i>) to SHR631591WKY.SHR-(<i>D1Rat56-D1M7Mit206</i>)/NjsDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenicUnknownRRID:RGD_631591Congenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>DWox19-D1Mit2</i>) to WKY631592WKY.SHR-(<i>D1Rat236-D1M7Mit206</i>)/NjsDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenicUnknownRRID:RGD_631592Congenic substrain derived by backcrossing congenic strain WKY.SHR-(<I>D1Wox19-D1Mit2</i>) to WKY631593LEW/RjHopital Purpan, Toulouse Cedex, FranceinbredUnknownRRID:RGD_631593Strain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).631594BN/RjHopital Purpan, Toulouse Cedex, France; Centre D'Elevage R. Janvier, Route des Chenes-Secs Le Genest-St-Isle, FranceinbredUnknownRRID:RGD_631594Strain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France).631595LEW.1AV1.DA-(<i>D10Rat92-D10Rat135</i>)/UbcBiomedical Center in Uppsala, SwedencongenicUnknownRRID:RGD_631595LEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain.631596LEW.1AV1.DA-(<i>D10Rat92-D10Wox17</i>)/UbcBiomedical Center in Uppsala, SwedencongenicUnknownRRID:RGD_631596Congenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2.631597LEW.1AV1.DA-(<i>D10Wox17-D10Rat135</i>)/UbcBiomedical Center in Uppsala, SwedencongenicUnknownRRID:RGD_631597Congenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2631598LEW.1AV1.DA-(<i>D10Got154-D10Rat135</i>)/UbcBiomedical Center in Uppsala, SwedencongenicUnknownRRID:RGD_631598Congenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2631599SHRSP/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=409 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio Hypertension; NeurobiologyRRID:RGD_631599Strain has been maintained at Kyoto University.631600WKY.SHRSP-(<i>Mt1pa-D1Rat200</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany.congenicUnknownMt1-ps13118RRID:RGD_631600Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY631601WKY.SHRSP-(<i>Asgr1-Vamp2</i>)/BbbMax-Delbruck Center for Molecular Medicine, GermanycongenicUnknownAsgr1|Vamp22160|3949RRID:RGD_631601Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki631602BN/ElhDepartment of Surgery and Biochemistry, University of OtagoinbredUnknownRRID:RGD_631602These rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony.631603WKY/SnkAnimal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, JapaninbredUnknownRRID:RGD_631603The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.631604SHR/SnkAnimal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, JapaninbredUnknownRRID:RGD_631604The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan.631605SS.LEW-(<i>D10Arb9-D10Got101</i>)/JrMedical College of Ohio, ToledocongenicUnknownRRID:RGD_631605Congenic strain originated from an inbred SS/Jr strain.631606SS.MNS-(<i>D10Rat13-D10Mit11</i>)/JrMedical College of Ohio, ToledocongenicUnknownRRID:RGD_631606Congenic strain originated from an inbred SS/Jr strain.631607SS.WKY-(<i>D2N35-Mme</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownMme3098RRID:RGD_631607Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr631610SS.LEW-(<i>D1Rat39-D1Rat131</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_631610Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.631691SHRSP/A3IzmResearch Institute, International Medical Center of JapaninbredUnknownRRID:RGD_631691Substrain originates from the SHRSP/Izm strain.631693WKY.SHRSP-(<i>Shbg-Atp1b2</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownAtp1b2|Shbg2171|3671RRID:RGD_631693This strain has the blood pressure locus from chr 10631694WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_631694This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)631695SS/JrRkbBenjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany.inbredUnknownRRID:RGD_631695This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin631696SHR/FubRkbFreie Universitat BerlininbredUnknownRRID:RGD_631696Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin.631697BBDP/HriHagedorn Research Institute, Gentofte, DenmarkinbredUnknownRRID:RGD_631697This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977.631698BN/MolMollegaard Breeding Centre Ltd., DenmarkinbredUnknownRRID:RGD_631698This strain is maintained at the Mollegaard breeding center.631699BB.SHR-(<i>D6Rat184-D6Rat101</i>)/KUniversity of Greifswald, GermanycongenicUnknownRRID:RGD_631699Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females.631700BB.SHR-(<i>Gnal-D18Mit9</i>)/KDepartment of Laboratory Animal Science, University Greifswald, Karlsburg, GermanycongenicUnknownGnal2715RRID:RGD_631700Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long.631703SS.LEW-(<i>D10Rat207-D10Mgh1</i>)/AydResearch Centre-CHUMcongenicUnknownRRID:RGD_631703Congenic strain originated from an inbred SS strain631844Iusm:HAD1high-alcohol-drinkingDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianaoutbredUnknownRRID:RGD_631844These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2).631845Iusm:LAD1low-alcohol-drinkingDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianaoutbredUnknownRRID:RGD_631845These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2).631846F344.GK-(<i>D1Mgh10-D1Rat90</i>)/SweKarolinska InstitutecongenicUnknownRRID:RGD_631846Congenic strain originated from an inbred F344/Mcwi strain631847F344.GK-(<i>D1Mit7-D1Mgh25</i>)/SweKarolinska InstitutecongenicUnknownRRID:RGD_631847Congenic strain originated from an inbred F344 strain631848SHR/OlaIpcvCzech Academy of Sciences, Prague, Czech RepublicinbredUnknownSbf1<i><sup>m1Ipcv</sup></i>10002755RRID:RGD_631848These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf1 was identified in this strain.634359WF.WKY-(<i>D5Pas1-D5Uwm37</i>)/UwmUniversity of Wisconsin-MadisoncongenicUnknownRRID:RGD_634359WKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region.634363LEW/NIcoCrlfinbredUnknownRRID:RGD_634363A substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.634364SHR/NIcoCrlfinbredUnknownRRID:RGD_634364A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.634365SS/HsdinbredUnknownRRID:RGD_634365This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.634366SR/HsdinbredUnknownRRID:RGD_634366This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18.634367BN/CrlCrlj<a href=http://www.japancorp.net/company_show.asp?compid=3463>Charles River Laboratories Japan</a>,<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=777> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoOphthalmology; ImmunologyRRID:RGD_6343671976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced.634369WBN/KobSlcwistar bonn/kobori<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=378 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsDiabetes Obesity; OphthalmologyRRID:RGD_634369This strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1.634370F344.GK-(<i>D1Mgh10-D1Rat119</i>)/SweKarolinska InstitutecongenicUnknownRRID:RGD_634370GK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain.634372GHSDepartment of Medicine and Physiology, University of Rochester, Rochester, New YorkinbredUnknownRRID:RGD_634372SD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain.634373DA/ZtmRhdSection for Medical Inflammation Research, Biomedical Center, Lund University, SwedeninbredUnknownRRID:RGD_634373DA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.634374E3/ZtmRhdSection for Medical Inflammation Research, Biomedical Center, Lund University, SwedeninbredUnknownRRID:RGD_634374E3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University.634376LEA/NcuNagoya City University Medical School, Nagoya, Aichi, JapaninbredUnknownRRID:RGD_634376These rats were established from a closed colony of Long-Evans.634377BN/SeaBN/SeaSea Life Supply, Sand City, CAinbredUnknownRRID:RGD_634377This inbred strain was obtained from Sea life Supply634380iP/Iusminbred alcohol-preferringDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianainbredUnknownNpy3197RRID:RGD_634380These were inbred alcohol-preferring rats developed from outbred alcohol-preferring rats (Iusm:P) at generation 30 at Indiana University for high-alcohol-preferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding.634381iNP/Iusmalcohol-nonpreferringDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianainbredUnknownNpy3197RRID:RGD_634381These were inbred alcohol-nonpreferring rats developed from outbred alcohol-nonpreferring rats (Iusm:NP) at generation 30 at Indiana University for high-alcohol-nonpreferring behavior. Inbred rats utilized for the development of alcohol-preferring, alcohol-nonpreferring congenic strains were in the27th generation of inbreeding.634382SHR.BN-(<i>D5Wox12-D5Wox20</i>)/IpcvInstitute of Physiology, Czech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_634382This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background634743BILNIH Autoimmune Rat Model RepositoryinbredUnknownRRID:RGD_634743University of Pittsburgh from a mutation in a colony of unknown background held by the NIH.724569MWF/FubRkbMunich Wistar FromterFreie Universitdt Berlin, Berlin, GermanyinbredUnknownRRID:RGD_724569The MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm).724570LEW/RkbFreie Universitdt Berlin, Berlin, GermanyinbredUnknownRRID:RGD_724570The LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany.724571MITE/MnaLaboratory of Animal Reproduction, Nagoya University, Nagoya, JapaninbredUnknownRRID:RGD_724571This strain was established from captured Japanese wild rats.724572SS.LEW-(<i>D10Wox51-D10Rat27</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_724572A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.724573SS/JrTolDahl salt-sensitive (SS/Jr) ratsHoused at the University of Toledo College of Medicine and Life Sciences.inbredLive Animals (as of 2021-06-08)RRID:RGD_724573In the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet.724574SHR/NHsd<a href=https://www.envigo.com/model/shr-nhsd/>Envigo</a>inbredUnknownRRID:RGD_724574SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN)724575SS.LEW-(<i>D10Rat17-D10Mgh1</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_724575A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.724576KDP/TkyKomeda diabetes-prone rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=15 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoDiabetes Obesity; ImmunologyCblb620535RRID:RGD_724576This is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross.724577SS.LEW-(<i>D10Rat27-Igfbp4</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownIgfbp42875RRID:RGD_724577A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.728133BN-<I>RT1<SUP>n</SUP></I>/RjThe Center dElevage R. Janvier, France.coisogenicUnknownRRID:RGD_728133This coisogenic strain was produced by selecting BN rats with the <I>RT1<SUP>n</SUP></I> allele.728134SS.LEW-(<I>D1Rat35-D1Rat49</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728134Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.728135SS.LEW-(<I>D5Uwm14-D5Uwm31</I>)/JrDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenicUnknownRRID:RGD_728135S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain728137SS.LEW-(<I>D10Rat141-D10Mgh1</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_728137Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment728138SS.MNS-(<I>Mme-Gca</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownAtp1a1|Mme|Npr12167|3098|3195RRID:RGD_728138Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive728139WKY.SHRSP-(<I>D1Rat200-D1Rat216</I>)(<I>Shbg-Atp1b2</I>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_728139This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(<I>Shbg-Atp1b2</I>) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(<I>Shbg-Atp1b2</I>) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs728140SS.LEW-(<I>D10Rat11-D10Mgh1</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_728140Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment728142BN.SHR-(<i>Il6-Cd36</i>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownCd36|Il62301|2901RRID:RGD_728142This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR.728143SS.LEW-(<I>D1Mco38-D1Rat49</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728143Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.728144BN.PD-(<I>D8Rat39-D8Rat35</I>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownRRID:RGD_728144This congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM.728145SS.LEW-(<I>D5Rat130-D5Rat108</I>)/JrDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenicUnknownRRID:RGD_728145S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain728146F344.BN-(<I>D3Mgh13-D3Mgh7</I>)/DlwDepartment of Biological Sciences, Oakland University, Rochester, MIcongenicUnknownRRID:RGD_728146This congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USA728147BN.PD-(<I>D8Rat39-D8Rat35</I>),SHR-(<I>D4Mgh2-Cd36</I>),SHR-(<I>D20Wox3-D20Mgh5</I>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownRRID:RGD_728147This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM.728148SS.LEW-(<I>D16Uia2-D16Rat12</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_728148Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment728151UPL/NccHiroshima University, School of Medicine, Hiroshima, JapaninbredUnknownRRID:RGD_728151The UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony.728152SS.LEW-(<I>D1Rat196-D1Mgh7</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728152Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.728153SS.LEW-(<I>D1Rat196-D1Rat49</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728153Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.728155BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/1RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_728155This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.728156SS.LEW-(<I>D5Mco34-D5Mco10</I>)/JrDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenicUnknownRRID:RGD_728156SS.LEW-(<i>D5Rat130-D5Mco10</i>)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain728157SS.LEW-(<I>D5Rat130-D5Mit19</I>)/JrDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenicUnknownRRID:RGD_728157SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain728158SS.LEW-(<I>D5Uia4-D5Mco10</I>)/JrDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614congenicUnknownRRID:RGD_728158SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain728159SS.LEW-(<I>D1Mco36-D1Rat49</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728159Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.728161PD/CubpolydactylousInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepublicinbredUnknownRRID:RGD_728161Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the dolydactyly-luxate syndrome.728162SS.LEW-(<I>D1Mco87-D1Rat71</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728162Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain.728163SS.LEW-(<I>D1Uia2-D1Rat49</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728163Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain.728165SS.LEW-(<I>D1Rat196-D1Mco36</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_728165Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River.728166WKY.SHRSP-(<I>D1Rat112-D1Wox29</I>)/IzmShimane Medical University, Izumo, JapancongenicUnknownRRID:RGD_728166A segment from SHRSP/Izm was transferred on a WKY/Izm background728167SS.LEW-(<I>Nos2-D10M11Mit119</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownNos23185RRID:RGD_728167Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment728168WOKDiabetes Research Center, Karlsberg, GermanyinbredUnknownRRID:RGD_728168The inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germany728170SS.MNS-(<I>Mme-D2Mit14</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownAtp1a1|Mme2167|3098RRID:RGD_728170Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strain728171LEW-<I>RT1<SUP>1</SUP></I>/RjThe Center dElevage R. Janvier, France.coisogenicUnknownRRID:RGD_728171This coisogenic strain was produced by selecting LEW rats with the <I>RT1<SUP>1</SUP></I> allele.728172SS.MNS-(<I>D2Mit6-Adh1</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownAdh1c|Agtr1b|Atp1a12044|2071|2167RRID:RGD_728172Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNS728183WF/N<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>inbredUnknownRRID:RGD_728183To N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia.728184SHRSP/A3NNIH Autoimmune Rat Model Repository and Development CenterinbredExtinct (as of 2020-04-21)RRID:RGD_728184To NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517)728185N:NIHoutbredExtinctRRID:RRRC_00237Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony.728186LEW/SsNNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_728186To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31.728187ACI/N-jNIH Autoimmune Rat Model Repository and Development CentercongenicExtinctRRID:RGD_728187Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH.728188LOU/MNNIH Autoimmune Rat Model Repository and Development CenterinbredExtinct (as of 2020-09-04)RRID:RGD_728188To NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence.728189SHR/N-<I>di</I><a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_728189Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.728190RCS-<I>rdy-c</I>Albino retinal dystrophy<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_728190This congenic strain is obtained from pink-eyed, tan-hooded RCS rats728191LOU/CNNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_728191To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045)728192RCS-rdy-p<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_728192This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks.728193N:SDSprague-Dawley<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>, <a href=http://www.rrrc.us/Strain/?x=239>Rat Resource and Research Center</a>outbredExtinctRRID:RRRC_00239To N 1945 from Sprague Dawley, Inc. Colony closed since then.728194SHR/NNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_728194To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension.728195SHR/N-<i>cp</i><a href=http://www.rrrc.us/Strain/?x=231>Rat Resource and Research Center</a>congenicCryopreserved Embryo (as of 2021-01-20)RRID:RRRC_00231The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolerance. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis.728196RHA/N-<i>j</i>NIH Autoimmune Rat Model Repository and Development CentercongenicExtinctRRID:RGD_728196Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.728197RCS-rdy-+<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_728197This congenic strain is obtained from pink-eyed, tan-hooded RCS rats728198BHE/NBureau of Home EconomicsNIH Autoimmune Rat Model Repository and Development CenterinbredExtinctRRID:RGD_728198To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University.728199RHARoman high avoidance<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_728199Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965).728200ACI/N-<I>di</I><a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_728200Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41.728358SBR. Kalman, Authority for Animal FacilitiesoutbredUnknownRRID:RGD_728358This outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear.728383UPL/CasUpjohn Pharmaceuticals Limited<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=472 > National BioResource Project for the Rat in Japan</a>inbredUnknownGja8<sup>m1Cas</sup>13524999RRID:RGD_728383In 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating.728384SS.LEW-(<i>D10Rat24-Igfbp4</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownIgfbp42875RRID:RGD_728384A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.728385WF.COP-(<i>D2Rat2-D2M13Mit286</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_728385A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.728386SS.LEW-(<i>D10Rat119-D10Rat133</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_728386A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.728387WF.COP-(<i>D2Mit29-D2Uwm13</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_728387A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.728388SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_728388A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.728389WF.COP-(<i>D2Mit29-D2Rat201</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_728389A segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.728391WF.COP-(<i>D2Rat253-D2Uwm17</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_728391A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs.728392RHA/N-<I>di</I>Roman high avoidance-<i>di</i> mutation<a href=http://www.ors.od.nih.gov/dirs/vrp/ratcenter/f_strainlist.html>NIH Autoimmune Rat Model Repository and Development Center</a>congenicUnknownRRID:RGD_728392Brattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.728393SS.LEW-(<i>D10Got125-D10Rat120</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_728393A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.728394SS.LEW-(<i>D10Rat55-D10Rat13</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_728394A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.728395SS.LEW-(<i>D10Rat55-D10Rat120</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_728395A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.728396SS.LEW-(<i>D10Mco15-D10Mgh1</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_728396A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.731185MWF/FubMunich Wistar FromterCharite University Medicine Berlin, Campus Benjamin Franklin, Berlin, GermanyinbredUnknownRRID:RGD_731185Munich Wistar Fromter rats were obtained from colonies at the Freie Universitat, Benjamin Franklin Campus Berlin, Germany731186SHR/FubCharite University Medicine Berlin, Campus Benjamin Franklin, Berlin, GermanyinbredUnknownRRID:RGD_731186Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany731187Iusm:HAD2high-alcohol-drinkingDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianaoutbredUnknownRRID:RGD_731187These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for high alcohol drinking (HAD1 and HAD2).731188Iusm:LAD2low-alcohol-drinkingDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianaoutbredUnknownRRID:RGD_731188These were developed by selective breeding for alcohol preference and consumption from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines. Replicate lines were independently selected for low alcohol drinking (LAD1 and LAD2).731189SHRSP.WKY-(<i>Klk1-D1Rat116</i>)/IzmDepartment of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, JapancongenicUnknownRRID:RGD_731189A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method.731190SS.LEW-(<i>D1Rat211-D1Rat18</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_731190A segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.731191SHRSP.WKY-(<i>D2Rat14-D2Mgh12</i>)/GcrcUniversity of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_731191A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.731192SS.LEW-(<i>D3Rat52-D3Rat130</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_731192A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd731193DA.PVG-(<i>D4Rat141-D4Mgh11</i>)Department of Medicine, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_731193PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies.731194SS.LEW-(<i>D3Chm64-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_731194A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd731195DA.E3-(<i>D14Wox8-D14Rat64</i>)/RhdMedical Inflammation Research, BMC, University of Lund, Lund, SwedencongenicUnknownRRID:RGD_731195The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain.734471SS.LEW-(<i>D1Mgh7-D1Mco41</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_734471This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background.734472SS.LEW-(<i>D1Mco2-D1Wox6</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_734472This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background.734473SS.LEW-(<i>D17Mco3-D17Mco10</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_734473SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.734474SS.LEW-(<i>D5Mit9-D5Mco10</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_734474SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.734475DA/OlaHsd<a href =http://www.envigo.com//model/da-olahsd/> Envigo</a>inbredUnknownRRID:RGD_734475Odell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965.734476Crl:CD(SD)<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbredUnknownRRID:RGD_734476Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system.734478F344/DuCrl<a href=http://www.criver.com> Charles River Laboratories</a>inbredUnknownRRID:RGD_734478This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960.734479SS.LEW-(<i>D1Mco2-D1Rat49</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_734479This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background.734480SS.LEW-(<i>D10Mit10-D10Mgh1</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_734480SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed.734481SS.LEW-(<i>D1Mco2-D1Mco35</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownSa3616RRID:RGD_734481SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background.734482SS.LEW-(<i>D1Rat45-D1Mco41</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownSa3616RRID:RGD_734482This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.734483SS.LEW-(<i>D1Rat42-D1Wox10</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_734483This is a congenic substrain derived from SS.LEW-(<i>D1Mco2-D1Mco35</i>)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background.734526OLETF/GotOtsuka Long Evans TokushimaOtsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, JapaninbredUnknownRRID:RGD_734526Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating.734527OLETF.F344-(<i>D1Rat169-D1Rat459</i>)/GotOtsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, JapancongenicUnknownRRID:RGD_734527Female OLETF/Got rats were crossed with F344/DuCrlCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.734528OLETF.BN-(<i>D1Rat76-D1Rat459</i>)/GotOtsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, JapancongenicUnknownRRID:RGD_734528Female OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations.734531OLETF.F344-(<i>D1Rat306-D1Rat461</i>)/GotOtsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, JapancongenicUnknownRRID:RGD_734531Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation.734758DA/HamDark-agoutiShizuoka Laboratory Animal Center Hamamatsu, JapaninbredUnknownRRID:RGD_734758Original DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).734759SHRSP/GcrcSpontaneously hypertensive rat, stroke proneUniversity of Glasgow, Western Infirmary, Glasgow, UKinbredUnknownRRID:RGD_734759SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH734760WKY/GcrcWistar-KyotoUniversity of Glasgow, Western Infirmary, Glasgow, UKinbredUnknownRRID:RGD_734760WKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH734761WF/KgaWistar-FurthKagoshima University Dental School, Kagoshima, JapaninbredUnknownRRID:RGD_734761Obtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan).737657LEW.1AV1National Veterinary Institute, Uppsala, SwedencongenicExtinctRRID:RRRC_00201Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1<sup>av1</sup> haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region.737658PVG.1AV1Piebald-Virol-GlaxocongenicUnknownRRID:RGD_737658Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany737690F344/CrliinbredUnknownRRID:RGD_737690These animals were from Charles River Italia, Calco, LC, Italy737691BN/Crli<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> ItalyinbredUnknownRRID:RGD_737691These animals were from Charles River Italia, Calco, LC, Italy737703LEW-Tg(HLA-B*0702,B2M)120-4Trg<sup>Tg/Tg</sup><a href=http://www.rrrc.us/Strain/?x=42>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2020-07-08)RRID:RRRC_00042Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity.737857DA.PVG.1AV1-(<i>D4Rat155-D4Rat84</i>)Center for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_737857Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.737858DA.PVG.1AV1-(<i>D4Rat155-Spr</i>)Center for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownSpr3753RRID:RGD_737858Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.737859DA.PVG.1AV1-(<i>D4Mgh17-D4Rat56</i>)Center for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_737859Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.737861DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)Center for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_737861Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.737862SHRSP.WKY-(<i>D2Rat14-D2Mit5</i>)/GcrcUniversity of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_737862A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP.737863SHRSP.WKY-(<i>D2Wox9-D2Mgh12</i>)/GcrcUniversity of Glasgow, Glasgow, UKcongenicUnknownGstm12755RRID:RGD_737863A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP737864SS.SR-(<i>D13Mit9-D13Mit1</i>)/JrJ.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USAcongenicUnknownRRID:RGD_737864Congenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain.737865WKY.SHRSP-(<i>D2Rat14-D2Mgh12</i>)University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_737865A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY.737866WKY.SHRSP-(<I>D2Rat14-D2Mit5</I>)University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_737866A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY737867SS.SR-(<I>D13N1-D13Mit1</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_737867Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient strain737868SS.SR-(<I>Syt2-D13Mit1</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownSyt23804RRID:RGD_737868Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-<I>Ren</i> transferred to the SS/Jr recipient strain737869OLETF.BN-(<I>D1Rat461-D1Rat459</I>)/GotOtsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, JapancongenicUnknownRRID:RGD_737869Female OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study.737870DA.E3-(<i>D20Wox3-D20Mgh4</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_737870A fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA.737871DA.E3-(<i>D12Got46-D12Rat26</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_737871This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.737872DA.E3-(<i>D4Mit16-D4Mgh11</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_737872This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.737873DA.E3-(<i>D6Wox5-D6Rat90</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_737873This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.737885RHA/KunRoman high avoidanceDept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The NetherlandsinbredUnknownRRID:RGD_737885Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands737886BDX/CubDept of Biology, Charles University, Prague, Czech RepublicinbredUnknownRRID:RGD_737886Recombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands737887AO/OlaHsd<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/ao-inbred-rat/> Envigo</a>inbredCryorecoveryRRID:RGD_737887These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands737888LEW/NHsdCpbinbredUnknownRRID:RGD_737888These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands737889LEW/IpcvinbredUnknownRRID:RGD_737889These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands737891Crl:SDoutbredUnknownRRID:RGD_737891Sprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory.737892ACI/SegHsd<a href =http://www.envigo.com/model/aci-seghsd/> Envigo</a>inbredUnknownCarcinogenesis; Estrogen-induced pituitary growth; Transplant immunologyRRID:RGD_737892This substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc.737893F344/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737893Substrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannover737894LEW/OrlInstitut de Transgenose, Orleans, FranceinbredUnknownRRID:RGD_737894Substrain of Lewis rats, maintained in Orleans, France737895WKY/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737895Substrain of WKY rats maintained by Dr. H.J. Hedrich, Hannover737896BN/MaasErasmus MC, DR Rotterdam, The NetherlandsinbredUnknownRRID:RGD_737896Substrain of BN rats, maintained by Dr. Alex Maas, The Netherlands737897ACI/KunCentral Animal Laboratory, Katholieke Universiteit, Nijmegen, The NetherlandsinbredUnknownRRID:RGD_737897Substrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands737898WOKA/KZentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, GermanyinbredUnknownRRID:RGD_737898Substrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germany737899BN/CubDept of Biology, Charles University, Prague, Czech RepublicinbredUnknownRRID:RGD_737899Recombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands737900WF/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737900Recombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germany737901LH/ZtuinbredUnknownRRID:RGD_737901A substrain of LH737902BDIX/OrlInstitut de Transgenose, Orleans, FranceinbredUnknownRRID:RGD_737902Substrain of BDIX, now maintained in Orleans, France737903Hsd:SDSprague DawleyoutbredUnknownRRID:RGD_737903Originated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratories' colonies are direct descendants of this original colony.737904U/AThe Netherlands Cancer Institute, Amsterdam, The NetherlandsinbredUnknownRRID:RGD_737904Substrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Institute737905LEW/MaasUniversity of Limburg, NetherlandsinbredUnknownRRID:RGD_737905Strain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers.737906MWF/HsdMunich Wistar FromterinbredUnknown (as of 2020-04-03)RRID:RGD_737906Substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley737907SS.SR-<i>Inha</i>/JrJ.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USAcongenicUnknownRRID:RGD_737907A chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strain737908WF/NHsd<a href =https://www.envigo.com/model/wf-nhsd/> Envigo</a>inbredCryopreserved Embryo (as of 2022-03-24)RRID:RGD_737908Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley.737909R/AThe Netherlands Cancer Institute, Amsterdam, The NetherlandsinbredUnknownRRID:RGD_737909Substrain of R, from Wistar stock in 1947, to The Netherlands Cancer Institute737910ARISTORAT/WslExperimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles BelgiuminbredUnknownRRID:RGD_737910Substrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgium737911BUF/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737911Substrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germany737912SS/JrIpcvCzech Academy of SciencesinbredUnknownRRID:RGD_737912strain originated from Dr. John P. Rapp, Medical College of Ohio, USA737913E3/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737913Substrain of E3, from Dr. H.J. Hedrich, Hannover, Germany737914SDL/IpcvinbredUnknownRRID:RGD_737914Substrain of SDL737915R/AWaDept of Genetics, Agricultural University, Wageningen, The NetherlandsinbredUnknownRRID:RGD_737915Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986737916DZB/GroCenter for Biology Kerklaan, University of Groningen, The NetherlandsinbredUnknownRRID:RGD_737916Substrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningen737917WF/MolMollegaard Breeding Centre Ltd., DenmarkinbredUnknownRRID:RGD_737917Substrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmark737918BN/OrlInstitut de Transgenose, Orleans, FranceinbredUnknownRRID:RGD_737918Substrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, France737919LEW/HanZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737919Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany737920BH/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737920Substrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973737921BDIV/lfzinbredUnknownRRID:RGD_737921Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971)737922LEW/SsNHsd<a href=https://www.envigo.com/model/lew-lew-ssnhsd> ENVIGO </a>inbredUnknownRRID:RGD_737922Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNHsd rats were descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland USA. Harlan became Envigo in 2015.737923SHR/MaasErasmus MC, DR Rotterdam, The NetherlandsinbredUnknownRRID:RGD_737923Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands737924WAG/RijinbredUnknownRRID:RGD_737924Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979737925BN/GroCenter for Biology Kerklaan, University of Groningen, The NetherlandsinbredUnknownRRID:RGD_737925Substrain of BN, from Billingham and Silvers 1958, to U of Groningen737926F344/NCrl<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbredUnknownRRID:RGD_737926Derived from NIH stock in 1992 by SASCO. To Charles River in 1996.737927ALC/ColleinbredUnknownRRID:RGD_737927Substrain of ALC737928BN/NHsdCpbinbredUnknownRRID:RGD_737928Substrain of BN, from Billingham and Silvers 1958737929Crl:WIWistar rats<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbredUnknownRRID:RGD_737929To Scientific Products Farm, Ltd. [predecessor of Charles River United Kingdom (CRUK)] in 1947 from Wistar Institute. To Charles River in 1975 from CRUK. This particular colony was selected because of a low incidence of hydronephrosis.737930LEW/ZtmLEW/ZtmTierlaboratorium der Medizinischen Hochschule Hannover, GermanyinbredUnknownNcf161307RRID:RGD_737930This inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, Germany737931GC/KuninbredUnknownRRID:RGD_737931737932LEW/CrlLewis<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbredUnknownRRID:RGD_737932Developed by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34.737933SD/AThe Netherlands Cancer Institute, Amsterdam, The NetherlandsinbredUnknownRRID:RGD_737933Sprague-Dawley stock initiated by R. Dawley in 1925737934BN/RijKunCentral Animal Laboratory, Katholieke Universiteit, Nijmegen, The NetherlandsinbredUnknownRRID:RGD_737934Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic University737935LEW/NhgGesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, GermanyinbredUnknownRRID:RGD_737935Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germany737936SR/JrIpcvBaylor College of Medicine, Houston, TXinbredUnknownRRID:RGD_737936Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962)737937SDH/ZtuinbredUnknownRRID:RGD_737937unknown737938AUG/OlaHsd<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/aug-inbred-rat/> Envigo</a>inbredCryorecoveryRRID:RGD_737938Substrain of AUG, derived from US August substrains in 1951737939BBWB/MolMollegaard Breeding Centre Ltd., DenmarkinbredUnknownRRID:RGD_737939unknown737940PAR/WslExperimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles BelgiuminbredUnknownRRID:RGD_737940unknown737941LEP/CubDr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech RepublicinbredUnknownRRID:RGD_737941Substrain of LEP, from Charles University cross of outbred animals737942LE/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737942Substrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973737943R/AEurRijDr. Adam Goedde,inbredUnknownRRID:RGD_737943Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986737944BN/RijNinbredExtinct (as of 2023-12-14)RRID:RGD_737944Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk737945BN/HanZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737945Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973.737946WAG/OlaHsdinbredUnknownRRID:RGD_737946Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawley737947BDII/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737947Substrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971)737948BDE/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737948Substrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color.737949A2/ColleDr. RL Collins, The Jackson Laboratory, Bar Harbor, MEinbredUnknownRRID:RGD_737949unknown737950DA/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737950Substrain of DA/OlaHsd, to Hannover after 1965737951CAP/KuvDr. HU Wottge, Universitat Kiel, Kiel, GermanyinbredUnknownRRID:RGD_737951unknown737952ACI/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737952unknown737953LEW/GutinbredUnknownRRID:RGD_737953Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germany737954AS/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737954unknown737955Hooded/ColleDr. RL Collins, The Jackson Laboratory, Bar Harbor, MEinbredUnknownRRID:RGD_737955unknown737956WF/GutinbredUnknownRRID:RGD_737956substrain of Wistar Furth stock, from J Furth in 1945737957WOKW/KZentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, GermanyinbredUnknownDiabetes Obesity; MetabolismRRID:RGD_737957Substrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991737958CHOC/CubInstitute of Physiology, Czech Academy of Sciences, Charles University, PragueinbredUnknownRRID:RGD_737958unknown737959RNU/MolMollegaard Breeding Centre Ltd., DenmarkinbredUnknownRRID:RGD_737959unknown737960Hsd:WIWistaroutbredUnknownRRID:RGD_737960These are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan.737961SR/JrMolMollegaard Breeding Centre Ltd., DenmarkinbredUnknownRRID:RGD_737961Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaard737962SPRD/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737962Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976737963LEW/CubInstitute of Physiology, Czech Academy of Sciences, Charles University, PragueinbredUnknownRRID:RGD_737963Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Prague737964BN/OlaHsdinbredUnknownRRID:RGD_737964Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis737965AGUS/OlaHsdinbredUnknownRRID:RGD_737965Substrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968737966LEW/KuvUniversitat Kiel, Kiel, GermanyinbredUnknownRRID:RGD_737966Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germany737967BS/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_737967Substrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988737968BN/GutinbredUnknownRRID:RGD_737968Substrain of BN, from Billingham and Silvers 1958737969NAR/SaUnon-albumin ratDept of Laboratory Animal Science, University of Utrecht, The NetherlandsinbredUnknownRRID:RGD_737969Substrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrecht737970AMORAT/WslExperimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, BelgiuminbredUnknownRRID:RGD_737970unknown737971SHRSP/RivmNational Institute of Public Health and Environmental Protection, The NetherlandsinbredUnknownRRID:RGD_737971unknown737972BN/Crl<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_737972Silvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976.738038HEPhigh ethanol preferringInstitut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, FranceinbredUnknownRRID:RGD_738038High ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USA738120LEW-Tg(HLA-B*2705m1,B2M)133-1Trg<sup>Tg/Tg</sup><a href=http://www.rrrc.us/Strain/?x=43>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-20)RRID:RRRC_00043This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating.738122SD-Tg(UBC-EGFP)1BalRrrc<a href=http://www.rrrc.us/Strain/?x=52>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10)RRID:RRRC_00052This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals.1298093LEW/NHsdinbredUnknownRRID:RGD_1298093Descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland. Maintained at Harlan-Sprague Dawley (Indianapolis, Indiana) .1299868SS.SR-(<I>D7Uia1-D7Mco7</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1299868Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment1299869SS.SR-(<I>Cyp11b1</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1299869Congenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strain1299870SS.LEW-(<I>D5Uia8-D5Rat108</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1299870SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain1299871DA.F344-(<I>D20Arb2-D20Arb8</I>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_1299871Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.1299872DA.F344-(<I>D8Arb15-D8Arb22</I>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_1299872Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.1299873SS.LEW-(<I>D5Mco34-D5Rat108</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1299873SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain1299874OLETF.F344-(<i>D1Rat166-D1Rat90</i>)/TjLaboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, JapancongenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_1299874Female OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol.1299875DA.F344-(<i>D7Rat22-D7Mit2</i>)/NsiThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland.congenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studiesRRID:RRRC_00679Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous state1299876SS.LEW-(<I>D5Rat54-D5Rat108</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1299876SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain1299877DA.F344-(<I>D10Rat204-D10Arb22</I>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_1299877Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses.1299878DA.F344-(<I>D4Arb30-D4Arb4</I>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_1299878The DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley1299879SS.SR-(<I>D7Mco7-D7Wox19</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1299879Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment1299880F344.DA-(<I>D20Arb2-D20Arb8</I>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_1299880Region of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses.1299881SS.LEW-(<I>D5Wox3-D5Rat108</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1299881SS.LEW-(<I>D5Rat130-D5Rat108</i>)/Jr was selectively backcrossed with the SS strain1300432HAA/FDSCHatano High AvoidanceHatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, JapaninbredCryopreserved Embryo; Cryopreserved SpermBehaviorRRID:RGD_1300432In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation.1300433LAA/FDSCHatano Low AvoidanceHatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, JapaninbredCryopreserved Embryo; Cryopreserved SpermBehaviorRRID:RGD_1300433In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation.1300439SD-Tg(UBC-EGFP)2BalRrrc<a href=http://www.rrrc.us/Strain/?x=65>Rat Resource and Research Center</a>transgenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10)RRID:RRRC_00065This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21.1302359HsdFcen:SDBioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, ArgentinaoutbredUnknownRRID:RGD_1302359These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.1302360W/HsdFcenBioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, ArgentinainbredUnknownRRID:RGD_1302360These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then.1302372SDDIO/Rrrc<a href=http://www.rrrc.us/Strain/?x=44>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00044This strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet.1302373SDDR/Rrrc<a href=http://www.rrrc.us/Strain/?x=45>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00045This strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet.1302377SPRD-<i>Anks6<sup>PKD</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=46>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-07)Anks6<sup>PKD</sup>11534996RRID:RRRC_00046From outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 (Anks6) mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002.1302416ACI.DA-(<i>D10Rat2-D10Rat19</i>)/ArbCenter for Genomics and Human Genetics, Manhasset, New YorkcongenicUnknownRRID:RGD_1302416A fragment from DA/OlaHsd rats is transferred to ACI/SegHsd.1302597LEXF7C/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=232 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302597This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302598FXLE26/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=264 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLive Animals; Cryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302598This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302599WKY/Ta<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=419 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302599This strain originated from Takeda Chemical Industries, Ltd., Japan1302600HTX/Kyohydrocephalus texas<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=3 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyRRID:RGD_13026001981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992.1302601FXLE23/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=261 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302601This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302602FXLE12/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=250 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302602This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302603FXLE25/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=263 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302603This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302604LEXF4/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=226 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302604This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302605LEXF2A/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=222 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLive AnimalsDiabetes Obesity; CancerRRID:RGD_1302605This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302606SHRSP/Ta<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=414 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_1302606This strain originated from Takeda Chemical Industries, Ltd., Japan1302607FXLE21/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=259 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302607This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302608CXH6/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=506 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoMetabolism; ImmunologyRRID:RGD_1302608Strain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan1302610KMI/Tkyminiature rat ishikawa<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=29 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermOsteosisPrkg23401RRID:RGD_1302610Miniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College.1302611FXLE24/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=262 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302611This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302612LEXF10C/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=238 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302612This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302613BN/fMaiHok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=65 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoRRID:RGD_1302613Kyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F211302614WKY/NMna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=460 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302614Inbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain.1302615FXLE14/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=252 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302615This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302616LEXF10B/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=237 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302616This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302617LEXF6B/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=228 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302617This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302618LEXF9/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=235 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLive Animals; Cryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302618This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302619FXLE16/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=254 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-16)Diabetes Obesity; CancerRRID:RGD_1302619This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302620SHR/Kyospontaneous hypertension rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=9 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-12)Cardio HypertensionRRID:RGD_1302620Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972).1302621LEXF10A/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=236 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302621This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302622WF/Kop<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=510 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_1302622Inbred originated from Kagoshima University, Japan.1302623TM/Kyotester moriyama rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=10 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermHematologyRab38<sup>ru</sup>1600311RRID:RGD_1302623Tester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 .1302624RICO/Ngs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=479 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension; OphthalmologyRRID:RGD_1302624Strain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan.1302625F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/TjcongenicUnknownRRID:RGD_1302625Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302626BN.UPL-(<I>D2Rat134-D2Rat2</I>)/Cas<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=473 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermOphthalmologyRRID:RGD_1302626Strain originated from Hiroshima University, Japan1302627F344/NSlc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=379 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsRRID:RGD_1302627Strain originated from Japan SLC, Inc, Shizuoka, Japan.1302628ACIS/Hok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=63 > National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302628Spontaneous mutation from ACI/Hok in 1981.1302629WKY.SHRSP-(<I>D1Rat49-D1Rat112</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=314 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302629The desired fragment is transferred from SHRSP to WKY.1302630F344.OLETF-(<I>D10Wox7-D10Wox6</I>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=77 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_1302630Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.1302631BN/SsNSlc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=371 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved SpermImmunologyRRID:RGD_1302631Strain originated from Japan SLC, Inc, Shizuoka, Japan.1302632WKY.SHRSP-(<I>D1Smu11-D1Arb21</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=313 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302632The desired fragment is transferred from SHRSP to WKY.1302633FXLE20/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=258 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302633This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302634BB/WorTkyBioBreeding rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=30 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoDiabetes Obesity; ImmunologyRRID:RGD_1302634Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983.1302635F344.OLETF-(<i>D12Rat8-D12Rat16</i>)/TjcongenicUnknownRRID:RGD_1302635Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302636WKY.SHRSP-(<I>D1Wox29-D1Arb21</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=318 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302636This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background1302637LAAHatano Low AvoidanceHatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, JapaninbredUnknownRRID:RGD_1302637Strain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan1302638LEXF11/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=239 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302638This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302639KHR/Kyokaken hairless rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=4 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermDermatologyOca22318412RRID:RGD_1302639Kaken hairless rat were detected by Kimura from Gunn1302640ACI/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=501 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_1302640Strain originated from The University of Tokushima, Tokushima, Japan.1302641LEXF1A/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=219 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302641This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302642LEA/Hkm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=495 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoRRID:RGD_1302642Strain originated at the University of Tokushima, Japan.1302643ACI/NKyoaugust copenhagen irish<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=6 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermReproductionRRID:RGD_1302643NIH (1988, F143) > Kyo (F43)1302644CXA5/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=505 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoMetabolism; ImmunologyRRID:RGD_1302644Strain originated at the University of Tokushima, Japan.1302645DMY/Kyodemyelination ratThe Laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991 via Institute Pasteur, ParismutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29)NeurobiologyMrs2<sup>dmyKyo</sup>12793071RRID:RGD_1302645From a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996).1302646LEXF2C/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=224 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302646This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302647F344.OLETF-(<i>D5Rat166-D5Rat90</i>)/TjLaboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, JapancongenicUnknownRRID:RGD_1302647Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302648LEC/HokLong Evans Cinnamon<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=71 > National BioResource Project for the Rat in Japan</a>mutantUnknown (as of 2016-12-01)Cancer; ImmunologyAtp7b<sup>hts</sup>11532742RRID:RGD_1302648At the Center for Experimental Plants and Animals, Hokkaido University, LEC, along with LEA, was established from a closed colony of Long-Evans rats obtained from Kobe University in 1975. In 1984, within the LEC rats of their F24 generation, a rat exhibiting spontaneous hepatitis with severe jaundice was found (Yoshida, 1987). The LEC was available from Charles River Japan, Inc., Kanagawa, as of spring, 1991.1302649LEXF7B/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=231 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302649This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302650F344.OLETF-(<i>D9Mgh8-D9Rat15</i>)/TjcongenicUnknownRRID:RGD_1302650Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302651CXA1/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=504 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoMetabolism; ImmunologyRRID:RGD_1302651Strain originated from the The University of Tokushima, Japan.1302652LEXF7A/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=230 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302652This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302653LEXF8A/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=233 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302653This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302654F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=81 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_1302654Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred.1302655TO/Hkm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=493 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_1302655Strain originated from the Graduate School of Medicine, Hokkaido University, Japan.1302656LEA/HokLong Evans Agouti<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=70 > National BioResource Project for the Rat in Japan</a>inbredUnknown (as of 2016-12-01)RRID:RGD_1302656Long Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour . It is used as the control strain of the LEC rat, which is reported to exhibit several mutant phenotypes such as hepatic disorder (hts), blockage of the T cell differentiation (thid) and X-ray hypersensitivity (xhs1 and xhs2).1302657DOP/Nemdilute-opisthotonus (dop)<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=151 > National BioResource Project for the Rat in Japan</a>segregating_inbredCryopreserved Embryo; Cryopreserved SpermNeurobiologyMyo5a3143RRID:RGD_1302657Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established.1302658LEJ/Hkm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=494 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsRRID:RGD_1302658Strain originated at the Graduate School of Medicine, Hokkaido University, Japan.1302659CXH5/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=508 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoMetabolism; ImmunologyRRID:RGD_1302659Strain originated at the University of Tokushima, Japan.1302660RCS/Kyoroyal college of surgeons ratDepartment of Ophthalmology & Visual Sciences, Kyoto UniversitymutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-29)OphthalmologyMertk<sup><i>rdy</i></sup>40902839RRID:RGD_1302660From Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998.1302661F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=87 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_1302661Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred.1302662CXH2/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=509 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoMetabolism; ImmunologyRRID:RGD_1302662Strain originated at the University of Tokushima, Japan.1302663F344.OLETF-(<i>D11Rat4-D11Rat1</i>)/TjcongenicUnknownRRID:RGD_1302663Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302664WNA/Nshm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=149> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302664Nagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research1302665FXLE13/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=251 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302665This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302666LEXF1C/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=221 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302666This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302667F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/TjcongenicUnknownRRID:RGD_1302667Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302668IS-<I>Tlk</I>/Kyotail anomaly lethal kyoto<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=25 > National BioResource Project for the Rat in Japan</a>coisogenicCryopreserved Embryo; Cryopreserved SpermOsteosisRRID:RGD_1302668Spontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto)1302669HAAHatano High AvoidanceHatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, JapaninbredUnknownRRID:RGD_1302669Strain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan.1302670ACI/NSlc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=381 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsRRID:RGD_1302670Strain is from Japan SLC, Inc., Shizuoka, Japan.1302671WM/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=503 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302671Strain is from the University of Tokushima, Japan.1302672W/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=13 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302672Hok>Hkm>Kyo1302673FXLE15/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=253 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302673This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302674VF/Kyovacuole formation rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=21 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-10)NeurobiologyRRID:RGD_1302674The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS). A nonsense mutation in the dopey family member 1 (Dopey1) was identified as the likely causative gene for the neurological disease phenotype of the VF rat.1302675WKY.SHRSP-(<I>D1Smu13-D1Smu11</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=319 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302675The desired fragment is transferred from SHRSP to WKY.1302676NER/Slcnoda epileptic rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=382 > National BioResource Project for the Rat in Japan</a>mutantLive AnimalsNeurobiologyRRID:RGD_1302676Strain is from Japan SLC, Inc. Shizuoka, Japan.1302677NIG-III/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=502 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_1302677Strain is from the University of Tokushima, Japan.1302678NAR/Slcnon albumin rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=375 > National BioResource Project for the Rat in Japan</a>mutantLive AnimalsHematologyRRID:RGD_1302678Strain originated from Japan SLC, Inc, Shizuoka, Japan.1302679TRMR/Kyotremor resistant<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=12 > National BioResource Project for the Rat in Japan</a>segregating_inbredUnknownAspa621693RRID:RGD_1302679Tremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. This strain is a substrain of TRM/Kyo and does not show tremor behavior. This strain carrying wild type Hcn1, is considered as segregating inbred strain of TRM.1302680SHR/Ta<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=418 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_1302680Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan.1302681WKY.SHRSP-(<I>D1Smu11-D1Rat112</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=325 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302681The desired fragment is transferred from SHRSP to WKY.1302682FXLE18/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=256 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302682This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302683FXLE22/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=260 > National BioResource Project for the Rat in Japan</a>recombinant_inbredLive AnimalsDiabetes Obesity; CancerRRID:RGD_1302683This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302684F344/NHok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=68 > National BioResource Project for the Rat in Japan</a>inbredUnknownRRID:RGD_1302684Dwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals1302685F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=99 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_1302685Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment.1302686F344/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=266 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302686Derived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating.1302687WKAH/HkmSlcWistar King A, Hokkaido<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=376 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsRRID:RGD_1302687Strain originated from Japan SLC, Inc., Shizuoka, Japan.1302688ACI/NMna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=461 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302688This strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan.1302689WKY.SHRSP-(<I>Ntrk3-D1Smu13</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=320 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302689The desired fragment is transferred from SHRSP to WKY.1302690FXLE19/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=257 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302690This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302691ALB/HokAlbany<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=64 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoDentistryRRID:RGD_1302691Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok)1302692WKY.SHRSP-(<I>D1Wox18-D1Rat44</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=323 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302692The desired fragment is transferred from SHRSP to WKY.1302693KZ-<I>Lepr</I><sup>faTky</sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=32 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; MetabolismLepr3001RRID:RGD_1302693A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980.1302694WKA/Seac<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=112 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermImmunologyRRID:RGD_1302694Wistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 19791302695SER/Kyospontaneously epileptic rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=28 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn|Aspa69063|621693RRID:RGD_1302695Spontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac1302696FH/HamSlcfawn hooded rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=384 > National BioResource Project for the Rat in Japan</a>mutantLive AnimalsCardio HypertensionRRID:RGD_1302696Strain originated at Japan SLC, Inc., Shizuoka , Japan.1302697KND/Tkykomeda non-diabetic rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=16 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoDiabetes ObesityRRID:RGD_1302697Komeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls.1302698SDR/SlcSpontaneous dwarf ratJapan SLC, IncmutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-05-04)MetabolismGh1<sup>sdr</sup>12880380RRID:RRRC_00066The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype. This spontaneous mutation affected the 3' splice/acceptor site. Judging from this point mutation, one would predict an abnormal splicing and a 1-base deletion in the GH mRNA. Strain is from Japan SLC, Inc., Shizuoka, Japan.1302699LEXF8D/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=234 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302699This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302700HOB/Snkhobble rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=154 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermNeurobiologyUnc5c|Unc5c<sup>hob</sup>735109|12802353RRID:RGD_1302700HOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13.1302701LEW/SsNSlc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=372 > National BioResource Project for the Rat in Japan</a>inbredLive Animals (as of 2020-08-26)ImmunologyRRID:RGD_1302701Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNSlc rats were descended from a colony obtained from the National Institutes of Health, Bethesda, Maryland USA in 1994 to Japan SLC, Inc.,Shizuoka, Japan.1302702TRM/Kyotremor rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=11 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03)NeurobiologyAspa|Hcn1<sup>A354V</sup>621693|13464319RRID:RGD_1302702In 1980, a spontaneous tremor mutant rat was found in the colony of Kyo:Wistar (Yamada, 1985). This disorder was found to be caused by an autosomal recessive gene and was designated tremor (tm). Deletion of Aspa gene was identified in the animal with no aspartoacylase activity in the brain and measurable level of activity in the kidney. TRM was established as a segregating inbred strain. In F18 progeny, a rat which did not have tm mutation was separated and established as a control strain of WTC (NBRP No.0020). (Dec 8, 2010)1302703WKY.SHRSP-(<I>D1Wox29-D1Rat112</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=315 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302703The desired fragment is transferred from SHRSP to WKY.1302704WKY.SHRSP-(<I>D1Wox29-D1Rat199</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=321 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302704The desired fragment is transferred from SHRSP to WKY.1302705WKY.SHRSP-(<I>D1Wox29-D1Smu13</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=322 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302705The desired fragment is transferred from SHRSP to WKY.1302706F344.OLETF-(<i>D5Rat32-D5Rat26</i>)/TjcongenicUnknownRRID:RGD_1302706Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302707LEXF3/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=225 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302707This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302708FXLE17/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=255 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoDiabetes Obesity; CancerRRID:RGD_1302708This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.1302709WKY/Hcm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=442 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_1302709Strain is from the Hyogo College of Medicine, Japan.1302710LEXF2B/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=223 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302710This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302711ExHC/Seac<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=115 > National BioResource Project for the Rat in Japan</a>inbredUnknownRRID:RGD_1302711Isolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 19931302712ZIMY/KyoZitter Masao Yamada<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=24 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-17)NeurobiologyAtrn69063RRID:RGD_1302712ZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada). This strain is homozygous for zi and wild-type for tm. ZIMY (Zitter Masao Yamada)1302713F344.OLETF-(<i>D8Rat58-D8Mgh17</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=90 > National BioResource Project for the Rat in Japan</a>congenicUnknownRRID:RGD_1302713Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.1302714KZC/TkyKomeda Zucker Creeping rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=20 > National BioResource Project for the Rat in Japan</a>segregating_inbredCryopreserved Embryo; Cryopreserved SpermNeurobiologyReln3553RRID:RGD_1302714Komeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983.1302715WKY.SHRSP-(<I>D1Wox18-D1Wox29</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=324 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1302715The desired fragment is transferred from SHRSP to WKY.1302716OM/NSlcOsborne-Mendel rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=385 > National BioResource Project for the Rat in Japan</a>inbredLive AnimalsRRID:RGD_1302716The Instutite of Medical Science, The University of Tokyo to Slc (1985)1302717ACI/NHok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=62 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoCardio HypertensionRRID:RGD_1302717NIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F1351302718HWY/Slchairless wistar yagi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=374 > National BioResource Project for the Rat in Japan</a>mutantLive AnimalsDermatologyRRID:RGD_1302718Strain is from Japan SLC, Inc., Shizuoka, Japan.1302719DON/KyoDonryu rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1302719Japanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/21302720CXH10/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=507 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoMetabolism; ImmunologyRRID:RGD_1302720Strain is from the University of Tokushima, Japan.1302721LEC/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=80 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoCancerAtp7b<sup>hts</sup>11532742RRID:RGD_1302721Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 19891302722PVG/SeacPiebald Virol Glaxo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=113 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermImmunologyRRID:RGD_1302722Strain is from Seac Yoshitomi, LTD., Fukuoka, Japan.1302723LEXF5/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=227 > National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_1302723This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.1302724SHR/Hcm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=441 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoCardio HypertensionRRID:RGD_1302724Strain is from the Hyogo College of Medicine, Japan.1302726ZI/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=23 > National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn<sup><i>zi</i></sup>40902832RRID:RGD_1302726Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo.1302727SHRSR/Ta<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=416 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_1302727Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan.1302728MES/SlcMatsumoto Eosinophilia Shinshu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=383> National BioResource Project for the Rat in Japan</a>mutantLive AnimalsHematologyCyba<sup>m1Sdi</sup>13209000RRID:RGD_1302728Derived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999)1302729LEA/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=79 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoCancerRRID:RGD_1302729Found in Long Evans strain at Kobe University; Inbreeding at Hokkaido University; Otsuka Pharmaceutical Co.; The University of Tokushima 19891302795HTGPrague hypertriglyceridemicInstitute of Physiology, Academy of Sciences Prague, Czech RepublicinbredUnknownRRID:RGD_1302795These were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding.1302921F344-Tg(NPHS2-HBEGF)WigDivision of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, MichigantransgenicUnknownRRID:RGD_1302921hDTR (HBEGF) cDNA was inserted at the 3' of the 2.5 kb human podocin (NPHS2) promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs.1303393LEC/NcuNagoya City University Medical School, Nagoya, Aichi, JapaninbredUnknownRRID:RGD_1303393These rats were established from a closed colony of Long-Evans.1304487BBDR/WorinbredUnknownRRID:RGD_1304487Diabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies.1331811LEW.BN-(<i>D10Rat32-D10Rat133</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331811This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331812LEW.BN-(<i>D10Rat83-D10Rat133</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331812This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331813BN.GK-(<i>D8Rat29-D8Got130</i>)/OxWellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenicUnknownRRID:RGD_1331813This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.1331814BN.GK-(<i>D8Got302-D8Got130</i>)/OxWellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenicUnknownRRID:RGD_1331814This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.1331815LEW/MolLEW/MolMollegaard Breeding Center Ltd., DenmarkinbredUnknownNcf161307RRID:RGD_1331815This substrain can be traced originally to Scripps Clinic, La Jolla, to University of Pennsylvania to Simonsen Laboratories in 1966, to Institute of Pathological Anatomy, University of Copenhagen, Denmark 1973. From University of Copenhagen to M&B A/S (Mollegaard Breeding Center Ltd., Denmark ) from 1977 to 2002. (now Taconic Europe)1331816DA.ACI-(<i>D10Rat2-D10Rat29</i>)/KiniNeuroimmunology Unit, Center for Molecular Medicine, Stockholm, SwedencongenicCryopreserved SpermNeurobiology; ImmunologyRRID:RGD_1331816(DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA.1331817BN.LEW-(<i>D10Rat32-D10Mgh4</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331817This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.1331818LEW.BN-(<i>D10Rat43-D10Mco4</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331818This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331819F344/EerF344/EerDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, IllinoisinbredUnknownRRID:RGD_1331819Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana1331820LEW.BN-(<i>D10Got9-D10Rat2</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331820This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331821LEW.BN-(<i>D10Wox26-D10Arb4</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331821This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331822DA.ACI-(<i>D10Rat2-D10Rat6</i>)Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, SwedencongenicUnknownRRID:RGD_1331822DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.1331823LEW.BN-(<i>D10Rat43-D10Rat27</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331823This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331824DA.ACI-(<i>D10Rat219-D10Rat29</i>)Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, SwedencongenicUnknownRRID:RGD_1331824DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.1331826LEW.BN-(<i>D10Mgh7-D10Rat27</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331826This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331827DA.ACI-(<i>D10Rat10-D10Rat142</i>)Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, SwedencongenicUnknownRRID:RGD_1331827DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.1331828DA.ACI-(<i>D10Rat12-D10Rat144</i>)Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, SwedencongenicUnknownRRID:RGD_1331828DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.1331829BN.LEW-(<i>D9Got8-D9Got200</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331829This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.1331830F344.BN-(<i>D5Rat1-D5Mit5</i>)/DlwDepartment of Biological Sciences, Oakland University, Rochester, MIcongenicUnknownRRID:RGD_1331830This congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USA1331831LEW.BN-(<i>D10Rat173-D10Rat133</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331831This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background.1331832BN.LEW-(<i>D10Rat72-D10Arb4</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331832This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.1331833DA.ACI-(<i>D10Rat15-D10Rat29</i>)Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, SwedencongenicUnknownRRID:RGD_1331833DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region.1331834BN.LEW-(<i>D10Rat100-D10Rat126</i>)/RjInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1331834This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background.1331836WKY/EerWKY/EerDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, IllinoisinbredUnknownRRID:RGD_1331836Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana1354669BN/OrlIcoCrlf<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> FranceinbredUnknownRRID:RGD_1354669Strain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991.1354670F344/IcoCrlf<a href=http://www.geneticmodels.com/crfrance/services.html>Charles River</a> FranceinbredUnknownRRID:RGD_1354670These are inbred rats that were bought from Charles River, Les Oncins near Lyon, France.1357172WF.BBDR-(<i>D4Arb29-D4Rat44</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1357172This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.1357173SS.MNS-(<i>Vamp2-D10M11Mit84</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownVamp23949RRID:RGD_1357173This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.1357174BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>)/RhwDepartment of Medicine University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_1357174S. Bieg and coworkers (1998) generated this congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ñ 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. Lacks one C nucleotide at 478 position which causes a frameshift mutation in the ORF of exon 3 forming a significantly truncated protein.1357175F344.DR-(<i>D4Mit6-D4Mit24</i>)-Tg(Gimap5)McwiDepartment of Physiology, Medical College of Wisconsin, Milwaukee WisconsintransgenicUnknownRRID:RGD_1357175Wild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(<i>D4Mit6-D4Mit24</i>)1357176WF.BBDR-(<i>D4Arb29-D4Rat96</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1357176This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.1357177F344.DR(DP)-(<i>D4Mit6-D4Mit24</i>)/RhwDepartment of Medicine University of Washington, Seattle, WashingtoncongenicCryopreserved EmbryoRRID:RRRC_00082The lymphopenia locus from BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding.1357178CDCohen diabetic ratHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelinbredUnknownRRID:RGD_1357178Originally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism.1357179SS.WKY-(<i>D2N35-Mme</i>),MNS-(<i>D10Mit11-D10M11Mit119</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1357179SS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F<sub>1</sub> were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister mating1357180SS.LEW-(<I>D8Chm14-D8Rat16</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownGrik42734RRID:RGD_1357180Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada1357181CDR/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, IsraelinbredUnknownRRID:RGD_1357181Cohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.1357182Eker-Tg(Tsc2)28HinDepartment of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, JapantransgenicUnknownTsc23908RRID:RGD_1357182Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats.1357183SS.MNS-(<i>D10Mco10-Aldoc</i>)/JrMedical College of Ohio, ToledocongenicUnknownNos23185RRID:RGD_1357183This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.1357184Crl:ZUC-<I>Lepr</I><sup>fa</sup>Zucker rats<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownLepr<sup>fa</sup>13432153RRID:RGD_1357184The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company.1357185RHA.Gunn-<i>Ugt1a1</i><sup>j</sup>/NDevelopmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USAcongenicUnknownRRID:RGD_1357185RHA/N rats were crossed with Gunn rats. F<sub>1</sub> hybrids were intercrossed for 12 cycles while selecting for jaundice loci.1357186Gunn-<i>Ugt1a1</i><sup>j</sup>/BluHsdGunn ratmutantUnknownUgt1a1<sup>j</sup>13432064RRID:RGD_1357186This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.1357187WF.BBDR-(<i>D4Rat16-D4Got39</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1357187This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.1357189SS.LEW-(<I>D8Rat56-D8Rat51</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1357189Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada1357190SS.MNS-(<I>Adh1-D2Mit5</I>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownAdh1c2044RRID:RGD_1357190This congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr background1357191CDS/YglCohen diabetic-sensitive ratHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelinbredUnknownRRID:RGD_1357191Cohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations.1357192WF.BBDR-(<i>D4Got39-D4Rat44</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1357192This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.1357193WF.BBDR-(<i>D4Got51-D4Rat44</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1357193This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.1357194WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1357194This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.1357195SS.MNS-(<i>Aldoc-D10Mco1</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownNos23185RRID:RGD_1357195This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient.1357196WF.BBDR-(<i>D4Arb29-D4Rat265</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1357196This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers.1357345DA/KDark Agouti/KarlsburgDept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, GermanyinbredUnknownRRID:RGD_1357345Dark agouti rats which were bred and housed in Dept. of Laboratory Animal Science, Karlsburg, Germany1357346BB.SHR-(<i>D4Mit6-Spr</i>)/KDepartment of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, GermanycongenicUnknownNpy|Spr3197|3753RRID:RGD_1357346BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected.1357417SD-Tg(Npy)400McwiDepartment of Physiology, Medical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_135741714.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene.1357953WAG/RijHfrEnvigo (Harlan France)inbredUnknownRRID:RGD_1357953Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Envigo (Harlan France)1357954F344/NHfrinbredUnknownRRID:RGD_1357954Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France.1357955WF/NHfrWistar-FurthinbredUnknownRRID:RGD_1357955Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France.1357957LEW/HanHfr<a href=https://www.envigo.com/model/lew-han-hsd> ENVIGO France </a>inbredUnknownThe LEW/HanHsd is very susceptible to the induction of EAE, while the LEW/SsNHsd is not susceptible to the induction of EAERRID:RGD_1357957Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. To Central Institute for Laboratory Animal Breeding, Hannover, in 1973 at F58. In 1994, to Harlan Netherlands through acquisition of Central Institute for Laboratory Animal Breeding. Harlan became Envigo in 20151357958BN/RijHfrinbredUnknownRRID:RGD_1357958Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France.1357959FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/McwiDepartment of Physiology, Medical College of Wisconsin, Milwaukee WisconsincongenicLive AnimalsCtsc|Grm5|Nox4|Rab38|Tyr2445|2746|620600|628752|1589755RRID:RGD_1357959The Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH.1357960LE/CpbHfrEnvigo (Harlan France)inbredUnknownRRID:RGD_1357960Substrain of LE which was bred at Harlan CPB now at Harlan France.1357974BB.SHR-(<i>D4Got41-Gimap5</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownGimap5628871RRID:RGD_1357974Originated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.1357975SS.LEW-(<i>D1Mco4-D1Rat18</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1357975This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.1357976BB.SHR-(<i>D4Got41-D4Rat171</i>)/KDepartment of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownRRID:RGD_1357976Originated from BB.SHR-(<i>D4Got41-Tacr1</i>) rats crossed with BB/OK rats to create a congenic substrain.1357977SS.LEW-(<i>D1Mco8-D1Rat213</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1357977This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.1357978SS.MNS-(<i>D2Mit6-D2Rat303</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownRRID:RGD_1357978Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain1357979SS.MNS-(<i>Mme-D2Rat131</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownMme3098RRID:RGD_1357979Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain1357980BB.SHR-(<i>D4Got41-Tacr1</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicCryopreserved SpermDiabetes Obesity; MetabolismTacr13811RRID:RGD_1357980Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997.1357981SS.LEW-(<i>D3Mco21-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1357981A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd1357982SS.LEW-(<i>D3Rat52-D3Chm63</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1357982A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd1357983SS.LEW-(<i>D1Mco75-D1Rat18</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1357983This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.1357984SS.MNS-(<i>D2Mit6-D2Rat166</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownRRID:RGD_1357984Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain1357985LOU/InsINSERM, C.H.U. Bichat-Claude Bernard, Paris, FranceinbredUnknownRRID:RGD_1357985originated from Universite Catholique de Louvain.1357986SS.LEW-(<i>D1Uia8-D1Rat211</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1357986This strain was constructed from the progenitor strain SS.LEW-(<i>D1Uia8-D1Rat18</i>)/Mco by crossing the progenitor strain to SS rats to get F<sub>1</sub> followed by F<sub>1</sub> X F<sub>1</sub> intercross to get F<sub>2</sub> which was screened for the desired recombinants.1357987SS.LEW-(<i>D1Uia8-D1Rat18</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1357987A 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony.1357988SS.LEW-(<i>D3Rat52-D3Rat17</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1357988A segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.1357994SHR/NCrl<a href=http://www.criver.com> Charles River Laboratories</a>inbredLive Animals (as of 2020-01-23)RRID:RGD_1357994To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneous hypertension.1358112WKY/NCrl<a href=https://www.criver.com/products-services/find-model/wistar-kyoto-wky-rat?region=3611> Charles River Laboratories</a>inbredUnknownRRID:RGD_1358112Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F111358114SS-Chr 5<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved SpermRRID:RGD_1358114A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed1358150SS.LEW-(<i>D16Rat12-D16Chm23</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_1358150This congenic strain originated from a SS/Jr parental strain.1358151FHH-Chr 8<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358151A FHH genomic background with a BN chromosome 8 introgressed.1358152SS-Chr 14<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358152A SS genomic background with a BN chromosome 14 introgressed.1358153COP/CrCrl<a href=http://www.criver.com> Charles River Laboratories</a>inbredUnknownRRID:RGD_1358153Inbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998.1358154SS-Chr 3<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved SpermRRID:RGD_1358154A SS genomic background with a BN chromosome 3 introgressed.1358155SS.LEW-(<i>D10Rat119-D10Mgh1</i>)(<i>D16Rat21-D16Rat112</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_1358155This double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (<i>D10Rat119-D10Mgh1</i>)and (<i>D16Rat21-D16Rat112</i>) from the LEW strain1358156SS.MNS-(<i>D2Rat183-D2Chm113</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownRRID:RGD_1358156Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.1358157FHH-Chr 7<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358157A FHH genomic background with a BN chromosome 7 introgressed.1358158FHH-Chr 16<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358158A FHH genomic background with a BN chromosome 16 introgressed.1358159FHH-Chr 6<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358159A FHH genomic background with a BN chromosome 6 introgressed.1358160SS.BN-(<i>D8Rat163-D8Rat81</i>)/McwiPhysGencongenicUnknownRRID:RGD_1358160A SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81.1358161SS.LEW-(<i>D16Rat38-D16Chm66</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_1358161This congenic strain originated from a SS/Jr parental strain.1358162SS-Chr 12<sup>BN</sup>/McwiPhysGenconsomicLive AnimalsRRID:RGD_1358162A SS genomic background with a BN chromosome 12 introgressed.1358163SS-Chr 15<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1358163A SS genomic background with a BN chromosome 15 introgressed.1358164FHH-Chr 17<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358164A FHH genomic background with a BN chromosome 17 introgressed.1358165SS.MNS-(<i>D2Chm51-D2Rat341</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownRRID:RGD_1358165Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-D2Rat166</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain.1358166SS.LEW-(<i>D16Mit3-D16Rat112</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_1358166This congenic strain originated from a SS/Jr parental strain.1358167SS.MNS-(<i>D2Wox27-Adh1</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownAdh1c2044RRID:RGD_1358167Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.1358168SS.LEW-(<i>D16Mit2-D16Chm23</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_1358168This congenic strain originated from a SS/Jr parental strain.1358169SS.MNS-(<i>D2Chm25-D2Rat131</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownRRID:RGD_1358169Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Chm90-D2Wox37</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.1358170FHH-Chr 5<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358170A FHH genomic background with a BN chromosome 5 introgressed.1358171SS-Chr 17<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358171A SS genomic background with a BN chromosome 17 introgressed.1358172SS.MNS-(<i>D2Chm25-Fgg</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownFgg2613RRID:RGD_1358172Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.1358173FHH-Chr 11<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358173A FHH genomic background with a BN chromosome 11 introgressed.1358174SS-Chr 19<sup>BN</sup>/McwiPhysGenconsomicCryopreserved Sperm (as of 2021-05-07)RRID:RRRC_00601A SS genomic background with a BN chromosome 19 introgressed.1358175FHH-Chr 20<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358175A FHH genomic background with a BN chromosome 20 introgressed.1358176FHH-Chr 18<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358176A FHH genomic background with a BN chromosome 18 introgressed.1358177SS.MNS-(<i>D2Chm25-D2Mit14</i>)/AydCentre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,CanadacongenicUnknownRRID:RGD_1358177Congenic strain was created by backcrossing congenic strain SS.MNS-(<i>D2Mit6-Adh1</i>)/Lt strain into the parental Dahl Salt-sensitive (SS) strain.1358178SS-Chr 10<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358178A SS genomic background with a BN chromosome 10 introgressed.1358179FHH-Chr 13<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1358179A FHH genomic background with a BN chromosome 13 introgressed.1358180FHH-Chr 19<sup>BN</sup>/McwiPhysGenconsomicCryopreserved Sperm (as of 2021-05-07)RRID:RRRC_00581A FHH genomic background with a BN chromosome 19 introgressed.1358258RCS/LavRrrcroyal college of surgeons rat<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=314>Rat Resource and Research Center</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30)RRID:RRRC_00314Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Then to University of California- San Francisco, School of Medicine, deposited to Rat Resource & Research Center.1358259RCS-<i>p</i><sup>+</sup>/LavRrrc<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=315>Rat Resource and Research Center</a>congenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30)RRID:RRRC_00315This strain has homozygous wild type at the pink eye (p+) locus and homozygous for a deletion in the Mertk gene. Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain.1358277RCS-<I>rdy</I><sup>+</sup>/LavRrrc<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=317&log=yes>Rat Resource and Research Center</a>congenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-07-16)RRID:RRRC_00317Developed by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated.1358278RCS-<i>rdy</I><sup>+</sup><I>p</I><sup>+</sup>/LavRrrc<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=316>Rat Resource and Research Center</a>congenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12)RRID:RRRC_00316Developed by crossing a pink-eyed control(RCS-rdy<sup>+</sup>/Lav x black-eyed dystrophic(RCS-p<sup>+</sup>/Lav) The F12 progeny was backcrossed to RCS-rdy<sup>+</sup>/Lav. The strain is pigmented (p+) congenic control strain (rdy+, wild-type at the retinal dystrophy locus) for the pigmented RCS-p+ dystrophic (rdy-) strain1358298SD-Tg(Rho*P23H)1LavRrrc<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http://www.rrrc.us/Strain/?x=639>Rat Resource and Research Center</a>transgenicLive Animals (as of 2021-05-07)Rho11239RRID:RRRC_00639This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).1358299SD-Tg(Rho*P23H)2Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>transgenicUnknownRRID:RGD_1358299This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).1358300SD-Tg(Rho*P23H)3Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http://www.rrrc.us/Strain/?x=641>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00641This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).1358302SD-Tg(Rho*S334X)3Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>, <a href=http://www.rrrc.us/Strain/?x=643>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00643This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.1358303SD-Tg(Rho*S334X)4Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http:///www.rrrc.us/Strain/?x=645>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00645This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.1358304SD-Tg(Rho*S334X)5Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>transgenicUnknownRRID:RGD_1358304This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.1358305SD-Tg(Rho*S334X)7Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>transgenicUnknownRRID:RGD_1358305This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.1358306SD-Tg(Rho*S334X)9Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>transgenicUnknownRRID:RGD_1358306This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein.1358632MR/HarMaudsely reactiveCenter for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania. inbredCryopreserved Embryo (as of 2019-02-20)RRID:RRRC_00691This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.1358633MNRA/HarCenter for Developmental and Health Genetics, Pennsylvania State University, PennsylvaniainbredUnknownRRID:RGD_1358633Originally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.1358918W-<i>Plp1<sup>md</sup></i>/NyaW-<i>Plp1</i><sup>md</sup>Division of Laboratories and Research, New York State Department of Health, Albany, New YorkmutantUnknownPlp1|Plp1<i><sup>md</sup></i>3354|12802346RRID:RGD_1358918Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders.1358919F344/SeacSEAC Yoshitomi Co., Fukuoka, JapaninbredUnknownRRID:RGD_1358919Inbred strain originated from F344 rats1358921WF.DA-(<i>D19Mit1-D19Mit6</i>)/Kopkagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, JapancongenicCryopreserved EmbryoCancerNqo12503RRID:RGD_1358921Congenic strain originated from a parental DA/Slc strain.1358922BB.WOKW-(<i>D4Got41-Fabp1</i>)/KDept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, GermanycongenicUnknownFabp12590RRID:RGD_1358922Congenic strain originated from a BB/OK parental strain.1358923LE-<i>Mbp<sup>md</sup></i>Department of Pathology and Molecular Medicine, McMaster University, Hamilton, CanadamutantUnknownMbp|Mbp<sup>md</sup>3054|12802351RRID:RGD_1358923A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks.1358989WKY.SHR-(<I>D2Rat174-D2Rat28</I>)(<I>D2Rat161-D2Rat185</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1358989This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrl1358990DA.F344-(<i>D10Mit9-D10Rat24</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030congenicUnknownRRID:RGD_1358990Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd1358991F344.HTX-(<i>D11Rat4-D11Arb4</i>)/HcjDepartment of Pharmacology, University of Florida, GainesvillecongenicUnknownRRID:RGD_1358991Congenic strain originated from F344/NHsd parental strain bred to HTX/Hcj1358992SHR.WKY-(<I>D2Rat40-D2Rat50</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1358992Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers1358993WKY.SHR-(<I>D2Rat161-D2Rat185</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1358993This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrl1358994SHR.WKY-(<I>D2Rat161-D2Rat241</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1358994This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) congenic strain to the parental strain SHR/NCrl1358995F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/TjLaboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, JapancongenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_1358995Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.1358996SHR.WKY-(<I>D2Rat10-D2Mgh13</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1358996This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background1358997WKY.SHR-(<I>D2Rat241-D2Rat185</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1358997This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrl1358998BUF/NHsdHarlaninbredUnknownRRID:RGD_1358998Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan.1358999WKY.SHR-(<I>D2Rat174-D2Rat28</i>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1358999This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>) to parental strain WKY/NCrl1359000DA.F344-(<i>D10Arb27-D10Rat6</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030congenicUnknownRRID:RGD_1359000Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd1359001WKY.SHR-(<I>D2Rat42-D2Rat139</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1359001Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers1359002NTac:WKYoutbredUnknownRRID:RGD_1359002The Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony.1359003LEW/JrMedical College of Ohio, Toledo, Ohio, USAinbredUnknownRRID:RGD_1359003This strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA.1359004DA.F344-(<i>D10Mit9-D10Rat11</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030congenicUnknownRRID:RGD_1359004Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd1359005SHR.WKY-(<I>D2Rat15-D2Rat50</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1359005This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(<I>D2Rat10-D2Mgh13</I>) to parental strain SHR/NCrl1359006WKY.SHR-(<I>D2Rat27-D2Rat243</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1359006This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrl1359007WKY.SHR-(<I>D2Rat174-D2Rat62</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1359007This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(<i>D2Rat174-D2Rat185</i>)/NCrl to parental strain WKY/NCrl1359008F344.HTX-(<i>D11Rat4-D11Arb4</i>)(<i>D17Rat23-D17Rat154</i>)/HcjDepartment of Pharmacology, University of Florida, GainesvillecongenicUnknownRRID:RGD_1359008Double congenic strain originated from a cross between single congenic strains F344.HTX-(<i>D11Rat4-D11Arb4</i>)/Hcj and F344.HTX-(<i>D17Rat23-D17Rat154</i>)/Hcj.1359009WKY.SHR-(<I>D2Rat174-D2Rat185</I>)Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USAcongenicUnknownRRID:RGD_1359009Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers1359010WF.BBDR-ART2<SUP>a</SUP>/WorWistar FurthUniversity of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605congenicUnknownRRID:RGD_1359010Congenic strain created by backcrossing WF strain to BBDR strain which are RT1 <SUP>u/u</SUP> , ART2<SUP>a</SUP>.1547865FHH-Chr 3<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1547865A FHH genomic background with a BN chromosome 3 introgressed.1547866F344/Jcl<a href =https://www.clea-japan.com/en/products/outbred/item_a0470> CLEA Japan, Inc</a>inbredLive Animals (as of 2021-04-22)RRID:RGD_1547866Inbred strain originated from F3441547867FHH-Chr 4<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1547867A FHH genomic background with a BN chromosome 4 introgressed.1547868FHH-Chr 2<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1547868A FHH genomic background with a BN chromosome 2 introgressed.1547869ACI/EurAugust x Copenhagen IrishDepartment of Pediatric Surery, Erasmus Medical Center, Rotterdam, NetherlandsinbredUnknownRRID:RGD_1547869Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH1547870FHH-Chr 14<sup>BN</sup>/McwiPhysGenconsomicLive AnimalsRRID:RGD_1547870A FHH genomic background with a BN chromosome 14 introgressed.1547871ACI.FHH-(<i>D1Rat324-D1Rat156</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_1547871Congenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains.1547872FHH-Chr X<sup>BN</sup>/McwiFHH-Chr X<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1547872A FHH genomic background with a BN chromosome X introgressed.1547873FHH-Chr 15<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1547873A FHH genomic background with a BN chromosome 15 introgressed.1547874FHH-Chr Y<sup>BN</sup>/McwiFHH-Chr Y<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1547874A FHH genomic background with a BN chromosome Y introgressed.1547875ACI.FHH-(<i>D17Rat117-D17Arb5</i>)(<i>D17Rat180-D17Rat51</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_1547875Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.1547876FHH-Chr 10<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1547876A FHH genomic background with a BN chromosome 10 introgressed.1549794SS.LEW-(<i>D2Rat199-D2Mco17</i>)/AydResearch Centre Hospitalier de l'Universite de Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1549794Congenic strain was created from a SS/Jr parental strain1549795SS.LEW-(<i>D2Rat199-D2Rat143</i>)/AydResearch Centre Hospitalier de l'Universite de Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1549795Congenic strain was created from a SS/Jr parental strain1549796BN/2Hok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=67 > National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Cryopreserved EmbryoRRID:RGD_1549796Transferred from Hokkaido University, Chromosome Research Unit, 1987 F161549797BUF.ACI-(<i>D16Rat31-D16Arb1</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=171 > National BioResource Project for the Rat in Japan</a>congenicUnknownRRID:RGD_1549797This congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method.1549798BB.PVG-<i>RT1</i><sup>u/a</sup>/Tky<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=31 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; ImmunologyRRID:RGD_1549798A congenic strain with the genetic background of the BB/WorTky strain (RT1.B<sup>u</sup>,D<sup>u</sup> ) onto which the MHC locus of PVG.R23 strain (RT1.B<a>,D<a>) has been transferred.1549799BB.SHR-<i>(D6Rat184-D6Rat3)</i>/K<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=517 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermMetabolismRRID:RGD_1549799Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000.1549800BN/KunKtsSlcmutantUnknown (as of 2022-06-09)MetabolismRRID:RGD_1549800Kitasato University School of Medicine to Slc (2001)1549801BN/SeacSeac Yoshitomi, LTD, Fukuoka, Japan.inbredCryopreserved SpermBehavior; OphthalmologyRRID:RGD_1549801Seac Yoshitomi, LTD, Fukuoka, Japan1549802BN/1Hok<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=66 > National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1549802Transferred from Hokkaido University, Chromosome Research Unit, 1987 F151549803ACI-<i>Lyst</i><sup>bg-Kyo</sup>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=7 > National BioResource Project for the Rat in Japan</a>coisogenicCryopreserved Embryo; Cryopreserved SpermHematologyRRID:RGD_1549803Spontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999.1549804BUF/NacJclCarcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, JapaninbredUnknownRRID:RGD_1549804CLEA Japan, Inc., Tokyo Japan1549805BUF.Cg-<i>Foxn1</i><sup>rnu</sup>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=459 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermUrologyRRID:RGD_1549805BUF/Mna, NN1H-Rnu/Rnu1549806BUF.ACI-(<i>D3Rat56-D3Rat83</i>)/NccCarcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, JapancongenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_1549806This strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strain1549808SS.LEW-(<i>Prlr-D2Rat143</i>)/AydResearch Centre Hospitalier de l'Universite de Montreal, Quebec, CanadacongenicUnknownPrlr3407RRID:RGD_1549808Congenic strain was created from a SS/Jr parental strain1549809BN/KtsSlcinbredUnknown (as of 2022-06-09)ImmunologyRRID:RGD_1549809Kitasato University School of Medicine to Slc (2002)1549810AI/Msikamelogenesis imperfecta rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=443 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermDentistryRRID:RGD_1549810This strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc.1549811ACI/NJclCarcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, JapaninbredUnknownRRID:RGD_1549811ACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan.1549813F344.ACI-<i>Lmx1a<sup>qc</sup></i>/KyoInstitute of Laboratory Animals at Kyoto University, JapancongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-12)Apoa2|Selp|Lmx1a2131|3656|1304784RRID:RGD_1549813Congenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. The short-tail mutation, âqueue courteâ in French (with qc as a symbol), occurred spontaneously in 1994, in the ACI/Pas inbred strain of rat maintained at the Institute Pasteur (Paris, France), and was kept segregating in this stock. Since importation into the Institute of Laboratory Animals at Kyoto University, it has been maintained as a congenic strain F344.ACI-qc using F344/NSlc as an inbred partner.1554301WKHA/BordUniversite Victor Segalen Bordeaux 2, Bordeaux cedex, FranceinbredUnknownRRID:RGD_1554301Strain was originated from WHHA/Edh at the University of Vermont College of Medicine1554302HOB-<I>Unc5c<sup>hob</sup></I>/Snkhobble rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=545 > National BioResource Project for the Rat in Japan</a>mutantUnknownUnc5c|Unc5c<sup>hob</sup>735109|12802353RRID:RGD_1554302Homozygous hobble rats that were taken from the inbred hobble rat colony.1554303CVD/OpuCerebellar vermis defect ratDepartment of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, JapanmutantUnknownUnc5c735109RRID:RGD_1554303Originated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates.1554304GAERS/MaveGenetic Absence Epilepsy Rats from Strasbourg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=557 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermNeurobiologyRRID:RGD_155430430% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding.1554305DA-Tg(CAG-lacZ)30Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=531 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDevelopmentRRID:RRRC_00295lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.1554306GK/SlcGoto Kakizaki Rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=377 > National BioResource Project for the Rat in Japan</a>mutantLive AnimalsDiabetes ObesityRRID:RGD_1554306Spontaneous mutant GK rat which were obtained from Japan SLC, Inc.1554307W-Tg(LAC3)YsYS New Technology Institute, Tochigi, JapantransgenicUnknownRRID:RGD_1554307These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase.1554308Gunn-<i>Ugt1a1<sup>j</i></sup>/SlcGunn<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=370 > National BioResource Project for the Rat in Japan</a>segregating_inbredLive AnimalsNeurobiology; MetabolismUgt1a1<sup>j</sup>13432064RRID:RGD_1554308Segregated inbred Gunn rat which were obtained from Japan SLC, Inc.1554309W-Tg(CAG-GFP)184Ys<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=525 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=259>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermDevelopmentRRID:RRRC_00259These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator.1554310DA-Tg(CAG-lacZ)19Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=530 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=294>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermDevelopmentRRID:RRRC_00294lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining.1556748F344/SnkMedicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, JapaninbredUnknownRRID:RGD_1556748Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan1558660SHRSP/TkyoDepartment of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, JapaninbredUnknownRRID:RGD_1558660Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo1558661WKY/TkyoDepartment of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, JapaninbredUnknownRRID:RGD_1558661Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo1558662SHR/TkyoDepartment of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, JapaninbredUnknownRRID:RGD_1558662Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo1559030LEC-Tg(ATP7B)Tohm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=457 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_1559030A 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA.1559031NE/Mave<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=558 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyRRID:RGD_1559031The control strain of GAERS, free of any spontaneous spike and wave discharges.1559032SS.LEW-(<I>D17Rat65-D17Chm2</I>)/AydResearch Centre, Centre Hosp Univ Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1559032This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment1559033SS.LEW-(<I>D17Rat65-Prl</I>)/AydResearch Centre, Centre Hosp Univ Montreal, Quebec, CanadacongenicUnknownPrl3403RRID:RGD_1559033This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain1559034SS.LEW-(<I>D17Chm14-D17Rat97</I>)/AydResearch Centre, Centre Hosp Univ Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1559034This congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment1559035SS.LEW-(<I>D17Chm14-D17Rat181</I>)/AydResearch Centre, Centre Hosp Univ Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1559035This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain1559036LEW/Jms<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=54>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01)RRID:RRRC_00054Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.1559037SS.LEW-(<I>D17Chm9-D17Rat97</I>)/AydResearch Centre, Centre Hosp Univ Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1559037This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(<I>D17Rat65-Prl</i>) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment1559039ODS/ShiOsteogenic disorder ShionogiShionogi & Co., Ltd. JapanmutantUnknownRRID:RGD_1559039Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.1559040MD/Tamamyelin deficient rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=248 > National BioResource Project for the Rat in Japan</a>mutantLive AnimalsNeurobiology; DevelopmentRRID:RGD_1559040X-linked mutant of the Wistar rat.1559041SHRSP/Ngsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=303 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology; Cardio Hypertension; OsteosisRRID:RGD_1559041Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980.1559042SHR/Nig<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=286 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio Hypertension; PharmacologyRRID:RGD_1559042Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976.1559043MV/Opumyelin vacuolation rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=187 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn<sup><i>mv</i></sup>40902835RRID:RGD_1559043The myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999.1559044SS.SR-(<i>D3Mco19-D3Mco5</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownEdn32534RRID:RGD_1559044A region of chr 3 which contains the Edn3 gene was introgressed into the SS rats1559045LEW/CrlcinbredUnknownRRID:RGD_1559045LEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canada1559046SHR-Chr Y<sup>W</sup>/K<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=518 > National BioResource Project for the Rat in Japan</a>consomicUnknownRRID:RGD_1559046Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996.1559047SHRSP/Ezo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=357 > National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology; Cardio HypertensionRRID:RGD_1559047Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan1559048SHR.ODS-<i>Gulo<sup>od</sup></i>/Shi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=114 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCardio Hypertension; OsteosisGulo620701RRID:RGD_1559048A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995.1566430SimTac:LEoutbredUnknownRRID:RGD_1566430Taconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock.1566431BN/MolTacinbredUnknownRRID:RGD_1566431The BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003.1566432WKY/NMolTacWistar KyotoinbredUnknownRRID:RGD_1566432The inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit.1566433HanTac:WHoutbredUnknownRRID:RGD_1566433In 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000.1566434NTac:SHRoutbredUnknownRRID:RGD_1566434Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony.1566437SS-Chr X<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1566437A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed1566438DA/MolTacinbredUnknownRRID:RGD_1566438Developed at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004.1566439F344/NTacinbredUnknownRRID:RGD_1566439Axenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH.1566440NTac:SDoutbredUnknownRRID:RGD_1566440Taconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies.1566443LEW/MolTacLewisinbredUnknownRRID:RGD_1566443Scripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived.1566444MolTac:SDoutbredUnknownRRID:RGD_1566444The SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993.1566445ACI.BN-(<I>D5Mgh17-D5Rat205</I>)/ShulDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, NebraskacongenicExtinctRRID:RGD_1566445This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background1566447GK/MolTacGoto-Kakizaki<a href=https://www.taconic.com/rat-model/goto-kakizaki</a>inbredUnknownRRID:RGD_1566447The Goto-Kakizaki inbred model was developed by Tohoku University in 1975. Aarhus University Hospital in Denmark received stock in 1994. M&B A/S (now Taconic Europe) received stock from Aarhus in 1997. The rats were derived by embryo transfer in 2005 at Taconic US.1566448FHH-Chr 9<sup>BN</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_1566448A FHH genomic background with a BN chromosome 9 introgressed.1566453SD-Tg(HIV-LacZ)AngRrrc<a href=http://www.rrrc.us/Strain/?x=49>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00049Fertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid.1566454BDIV/ZteBDIV/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanyinbredUnknownRRID:RGD_1566454derived from Berlin-Druckrey strain BDIV1566455HTX/HcjRrrc<a href=http://www.rrrc.us/Strain/?x=50>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm; CryorecoveryRRID:RRRC_00050Available at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30.1566456BDIX/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanyinbredUnknownRRID:RGD_1566456derived from Berlin-Druckrey strain BDIX1566457SPRDSprague-DawleyinbredUnknownRRID:RGD_1566457From outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990).1566458F344-Tg(ROSA26-ALPP)EpsRrrc<a href=http://www.rrrc.us/Strain/?x=48>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-07-01)ALPP1314395RRID:RRRC_00048F344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP, ALPP).1566459F344-Tg(ROSA26-EGFP)EpsDepartment of Pathobiological Sciences, University of Wisconsin-Madison, Madison, WisconsintransgenicUnknownRRID:RGD_1566459F344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP).1566460SD-Tg(ICAM2-DAF)AngRrrc<a href=http://www.rrrc.us/Strain/?x=51>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00051Embryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter.1578692BN.LEW-(<i>D10Rat32-D10Rat116</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578692Congenic strain was bred from BN.LEW-(<i>D10Mco17-D10Mco14</i>)/Ciml backcrossed to BN/Rj.1578693LEW.BN-(<i>D10Mco17-D10Rat221</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578693Congenic strain created from parental LEW/Rj and BN/Rj strains.1578694ATAlcohol-Tolerant<a href=http://www.rrrc.us/Strain/?x=76>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00076The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.1578695SHA/BruRrrcSyracuse High Avoidance<a href=http://www.rrrc.us/Strain/?x=68>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00068Selective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats.1578696LAS1Low Alcohol Sensitive strain 1<a href=http://www.rrrc.us/Strain/?x=80>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00080Selectively bred for 24 generations for low sensitivity to ethanol then inbred.1578697BN.LEW-(<i>D10Rat32-D10Rat31</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578697Congenic strain was bred from BN.LEW-(<i>D10Rat32-D10Rat221</i>)/Ciml backcrossed to BN/Rj.1578698LAS2Low Alcohol Sensitive strain 2<a href=http://www.rrrc.us/Strain/?x=81>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00081Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred1578699BGanemic BelgradeinbredCryopreserved Embryo; Cryopreserved Sperm; CryorecoveryRRID:RRRC_00072These are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY.1578700HAS1High Alcohol Sensitive strain 1<a href=http://www.rrrc.us/Strain/?x=77>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00077Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred1578701HAS2High Alcohol Sensitive strain 2<a href=http://www.rrrc.us/Strain/?x=79>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00079Selectively bred for high ethanol sensitivity for 24 generations, then inbred.1578702LEW.BN-(<i>D10Rat32-D10Rat133</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578702Congenic strain created from parental LEW/Rj and BN/Rj strains.1578703SLA/BruRrrcSyracuse Low Avoidance<a href=http://www.rrrc.us/Strain/?x=69>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00069Selective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats.1578704WLPWarsaw Low PreferingDepartment of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, PolandinbredUnknownRRID:RGD_1578704These were bred from albino stock of Wistar rats as lines that had low ethanol preference.1578705LEW.BN-(<i>D10Arb4-D10Rat133</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578705Congenic strain created from parental LEW/Rj and BN/Rj strains.1578706LEW.BN-(<i>D10Mco17-D10Mco14</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578706Congenic strain created from parental LEW/Rj and BN/Rj strains.1578708LEW.BN-(<i>D10Mgh7-D10Rat221</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578708Congenic strain created from parental LEW/Rj and BN/Rj strains.1578709IAincisor absent<a href=http://www.rrrc.us/Strain/?x=64>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00064These rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption.1578710LEW.1AR1-<I>iddm</I>/ZtmInstitute for Laboratory Animal Science, Hannover Medical School, Hanover, GermanycoisogenicUnknownDock8<sup>m1Ztm</sup>13830868RRID:RGD_1578710arose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup>) in the intra-MHC recombinant inbred strain LEW.1AR1; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain since1578711LEW.BN-(<i>D10Mco17-D10Rat133</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578711Congenic strain created from parental LEW/Rj and BN/Rj strains.1578712BN.LEW-(<i>D10Mco17-D10Mco14</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578712Congenic strain created from parental LEW/Rj and BN/Rj strains.1578713BN/ZtmInstitute for Laboratory Animal Science, Hannover Medical School, Hanover, GermanyinbredUnknownRRID:RGD_1578713substrain of BN1578714BN.LEW-(<i>D10Mco17-D10Rat80</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_1578714Congenic strain created from parental LEW/Rj and BN/Rj strains.1578715ANTAlcohol-Nontolerant<a href=http://www.rrrc.us/Strain/?x=78>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermGabra661861RRID:RRRC_00078The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado.1578716LEW.1AR1/ZtmInstitute for Laboratory Animal Science, Hannover Medical School, Hanover, GermanycongenicUnknownRRID:RGD_1578716Lewis strain containing MHC haplotype <i>RT1.A<SUP>a</sup>B/D<SUP>u</sup>C<SUP>u</sup></i>1578717WHPWarsaw High PreferingDepartment of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, PolandinbredUnknownRRID:RGD_1578717These were bred from albino stock of Wistar rats as lines that had ethanol preference.1579677FHH-<i>Madd<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Madd<i><sup>m1Mcwi</sup></i>1578796RRID:RGD_1579677Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated.1579678ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicLive Animals; Cryopreserved SpermRRID:RGD_1579678Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.1579680Wild/TkuWildCaught in TokyowildUnknownRRID:RGD_1579680These rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed.1579681BN-<i>Birc3<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2016-10-24)Birc3<i><sup>m1Mcwi</sup></i>1578788RRID:RGD_1579681Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated.1579682FHH-<i>Tlr4<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Tlr4<i><sup>m1Mcwi</sup></i>1578785RRID:RRRC_00411Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V489A mutation is generated.1579683FHH-<i>Ghsr<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Ghsr<i><sup>m1Mcwi</sup></i>1578794RRID:RRRC_00405Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. codon CAG/TAG mutation is generated which changes the AA Q343Stop.1579684FHH-<i>Slc8a2<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Slc8a2<i><sup>m1Mcwi</sup></i>1578786RRID:RRRC_00404Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y213Stop mutation is generated from the codon change TAT/TAA.1579685FHH-<i>Tgfbr2<sup>m2Mcwi</sup></i>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Tgfbr2<i><sup>m2Mcwi</sup></i>1578782RRID:RRRC_00400Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG.1579686GH/OmrMcwiPhysGeninbredLive Animals; Cryopreserved EmbryoRRID:RGD_1579686This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then.1579687FHH-<i>Proc<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Proc<i><sup>m1Mcwi</sup></i>1578790RRID:RRRC_00410Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L312P mutation is generated.1579688BN-<i>Tgfbr2<sup>m1Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Tgfbr2<i><sup>m1Mcwi</sup></i>1578800RRID:RGD_1579688Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG.1579689FHH-<i>F10<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)F10<i><sup>m1Mcwi</sup></i>1578783RRID:RRRC_00401Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V453G mutation is generated from the codon change GTC/GGC.1579690FHH-<i>Slc27a5<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Slc27a5<i><sup>m1Mcwi</sup></i>1578799RRID:RGD_1579690Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated.1579691SS.SHR-(<i>D11Mgh3-D11Rat31</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579691Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.1579692FHH-<i>Lcat<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Lcat<i><sup>m1Mcwi</sup></i>1578793RRID:RRRC_00402Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H353L mutation is generated from the codon change CAC/CTC.1579693T2DN/McwiDepartment of Physiology, Medical College of Wisconsin, Milwaukee WisconsininbredUnknownRRID:RGD_1579693Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained.1579694FHH-<i>Egln3<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Egln3<i><sup>m1Mcwi</sup></i>1578781RRID:RRRC_00409Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E60G mutation is generated.1579695ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_1579695Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains.1579696SS.SHR-(<i>D6Wox13-D6Rat84</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579696Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.1579697SS.SHR-(<i>D13Rat63-D13Mit1</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579697Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.1579698FHH-<i>Adra1a<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Adra1a<i><sup>m1Mcwi</sup></i>1578792RRID:RRRC_00408Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a.1579699WKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdWKY.WKHA-(<I>D5Rat45-D5Rat245</I>)/CfdExperimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CAcongenicUnknownRRID:RGD_1579699This congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain background1579700ACI.FHH-(<i>D1Rat475-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_1579700Double congenic strain from backcross of ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eur and ACI.FHH-(<i>D3Wox2-D3Rat59</i>)/Eur.1579701BN-<i>Nos1<sup>m1</i>Mcwi</sup>PhysGenmutantExtinct (as of 2017-01-26)Nos1<i><sup>m1Mcwi</sup></i>1578795RRID:RGD_1579701Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L72Stop mutation is generated.1579702SS.SHR-(<i>D9Wox16-D9Rat64</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579702Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.1579703SS.SHR-(<i>D2Rat61-D2Mco18</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579703Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains.1579704FHH-<i>Agtr1b<sup>m1Mcwi</i></sup>PhysGen, Rat Resource & Research CentermutantExtinct (as of 2016-11-29)Agtr1b<i><sup>m1Mcwi</sup></i>1578784RRID:RGD_1579704Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A 3bp deletion generates a mutation at TTC (del251F)of rat Agtr1b.1579705FHH-<i>Nr0b2<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Nr0b2<i><sup>m1Mcwi</sup></i>1578798RRID:RRRC_00403Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC.1579706FHH-<i>Nr4a1<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Nr4a1<i><sup>m1Mcwi</sup></i>1578791RRID:RGD_1579706Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA.1579707FHH-<i>Adipoq<sup>m2Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-13)Adipoq<i><sup>m2Mcwi</sup></i>1578797RRID:RRRC_00407Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq.1579708FHH-<i>Des<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Des<i><sup>m1Mcwi</sup></i>1578801RRID:RGD_1579708Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated.1579709Wild/McwiWildCaught in Milwaukee WisconsinwildUnknownRRID:RGD_1579709These rats were caught wild in Milwaukee, used for experiments and then sacrificed.1579710GK/FarGoto-KakizakiJames A. Haley Veterans Hospital, Tampa FloridainbredUnknownRRID:RGD_1579710Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan.1579711FHH-<i>Adipoq<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-13)Adipoq<i><sup>m1Mcwi</sup></i>1578787RRID:RRRC_00406Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.Y162C mutation is generated on rat Adipoq.1579712FHH-<i>Klf6<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Klf6<i><sup>m1Mcwi</sup></i>1578789RRID:RGD_1579712Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated.1579894SS.LEW-(<i>D10Rat204-D10Rat9</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579894A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.1579895FHH-<i>Bdkrb2<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2016-10-24)Bdkrb2<i><sup>m1Mcwi</sup></i>1579889RRID:RGD_1579895Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated.1579896SS.LEW-(<i>D2Rat18-D2Chm277</i>)/AydResearch Centre Hospitalier de l'Universite de Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579896Congenic strain was created from a SS/Jr parental strain1579897SS.SR-(<i>D9Rat69-D9Mco14</i>)/McoDepartment of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579897A congenic strain derived from the progenitor strains SS and SR.1579898SS.LEW-(<i>D10Chm128-D10Chm121</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579898A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.1579899SS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat31</i>)/JrMcwiDepartment of Physiology, Medical College of Wisconsin, MilwaukeecongenicUnknownRRID:RGD_1579899This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.1579900SS.SR-(<i>D9Rat89-Resp18</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_1579900Congenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strain1579901SS.LEW-(<i>D10Chm224-D10Chm6</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579901A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.1579902SS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiSS.LEW-(<i>D5Rat130-D5Rat108</i>)/JrMcwiDepartment of Physiology, Medical College of Wisconsin, MilwaukeecongenicUnknownRRID:RGD_1579902This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations.1579903SS.LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579903A congenic substrain derived from the progenitor strain SS.LEW-(<i>D10Rat119-D10Mgh1</i>)/Ayd.1579904SS.SR-(<i>D9Mgh11-D9Mco33</i>)/McoDepartment of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579904A congenic strain derived from the progenitor strains SS and SR.1579905SS.SR-(<i>D9Rat89-D9Mco27</i>)/McoDepartment of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1579905Congenic strain derived from parental strains SS and SR.1579906FHH-<i>Adipoq<sup>m3Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-13)Adipoq<i><sup>m3Mcwi</sup></i>1579887RRID:RRRC_00414Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L119P mutation is generated from the codon change CTG/CCG of rat Adipoq.1579907SS.LEW-(<i>D10Chm128-D10Chm169</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579907A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.1579908SS.SR-(<i>D9Mco95-Resp18</i>)/McoDepartment of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_1579908A congenic strain derived from the progenitor strains SS and SR.1579909FHH-<i>Fgl2<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Fgl2<i><sup>m1Mcwi</sup></i>1579885RRID:RGD_1579909Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA.1579910FHH-<i>Ccr2<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Ccr2<i><sup>m1Mcwi</sup></i>1579888RRID:RRRC_00399Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N117S mutation is generated from the codon change AAT/AGT.1579911SS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiSS.LEW-(<i>D5Rat130-D5Rat72</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, MilwaukeecongenicUnknownRRID:RGD_1579911This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background.1579912FHH-<i>F10<sup>m2Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)F10<i><sup>m2Mcwi</sup></i>1579886RRID:RRRC_00412Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C388 Stop mutation is generated from the codon change TGC/TGA1579913SS.LEW-(<i>D10Chm224-D10Chm222</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579913A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Wox51-D10Rat27</i>)/Ayd.1579914SS.LEW-(<i>D10Mco30-D10Got92</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_1579914A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.1580542PCK-<i>Pkhd1<sup>pck</i></sup>/CrljCrl<a href=http://www.criver.com/products-services/find-model/pck-rat?region=3611> Charles River Laboratories</a>coisogenicUnknownPkhd1<sup>pck</sup>11535943RRID:RGD_1580542This model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Harris and associates in 2002. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD).1581616DA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat23-D15Rat71</i>)/KiniCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, SwedencongenicUnknownRRID:RGD_1581616This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain1581617SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13GarUniversity of Texas Southwestern Medical Center, Dallas TexastransgenicUnknownRRID:RGD_1581617This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)1581618SHRSP/BbbMax - Delbruck - Center for Molecular Medicine, GermanyinbredUnknownRRID:RGD_1581618This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany.1581619BN.PD-(<i>D8Rat39-D8Rat35</i>),SHR-(<i>D2Mit4-D2Rat28</i>),SHR-(<i>D2Rat103-D2Rat107</i>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownRRID:RGD_1581619This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-<i>Lx</i>.1581620SS.SR-(<i>D9Mco61-D9Mco27</i>)/McoDepartment of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_1581620A congenic strain derived from the progenitor strains SS and SR.1581621DA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat48</i>)/KiniCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, SwedencongenicUnknownRRID:RGD_1581621This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain1581622SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrcUniversity of Texas Southwestern Medical Center, Dallas, TexastransgenicCryopreserved Embryo (as of 2017-08-17)RRID:RRRC_00318This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA)1581623LA/Humdlow autotomyInstitute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbredUnknownRRID:RGD_1581623Low Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.1581624FHH-<i>Lipe<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Lipe<i><sup>m1Mcwi</sup></i>1581495RRID:RGD_1581624Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L347P mutation is generated from the codon change CTA/CCA.1581625BN-<i>Hand1<sup>m1Mcwi</i></sup>PGAmutantUnknownHand1<i><sup>m1Mcwi</sup></i>1581493RRID:RGD_1581625Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC.1581626FHL/EurMcwiFawn Hooded Low blood pressurePGAinbredUnknownRRID:RGD_1581626The low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage.1581627WF.WKY-(<i>D5Uwm66-D5Uwm67</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_1581627A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).1581628DA.ACI-(<i>D15Rat6-D15Rat13</i>)/KiniDA.ACI-(<i>D15Rat 6-D15Rat13</i>)/KiniCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, SwedencongenicUnknownRRID:RGD_1581628This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain1581629WF.WKY-(<i>D5Wox8-D5Uwm62</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_1581629A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).1581630WF.WKY-(<i>D5Uwm63-D5Uwm64</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_1581630A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).1581631WF.WKY-(<i>D5Uwm61-D5Uwm37</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_1581631A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).1581632WF.WKY-(<i>D5Uwm65-D5Uwm60</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_1581632A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37).1581633DA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat6-D15Rat71</i>)/KiniCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, SwedencongenicUnknownRRID:RGD_1581633This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain1581634BN-<i>Adora2a<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2016-10-24)Adora2a<i><sup>m1Mcwi</sup></i>1581476RRID:RGD_1581634Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a.1581635WKY/BbbMax - Delbruck - Center for Molecular Medicine, GermanyinbredUnknownRRID:RGD_1581635This WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany.1581636BN-<i>Cebpe<sup>m1Mcwi</i></sup>PGAmutantUnknownCebpe<i><sup>m1Mcwi</sup></i>1581494RRID:RGD_1581636Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG.1581637FHH-<i>Has1<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Has1<i><sup>m1Mcwi</sup></i>1581477RRID:RGD_1581637Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG.1581638DA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniDA.ACI-(<i>D15Rat126-D15Rat71</i>)/KiniCenter for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, SwedencongenicUnknownRRID:RGD_1581638This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain1581639HAn/Humdhigh autotomy newInstitute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbredUnknownRRID:RGD_1581639Males and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.1581640HA/Humdhigh autotomyInstitute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbredUnknownRRID:RGD_1581640High Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.1581641WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_1581641A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).1581642FHH-<i>Ccr4<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Ccr4<i><sup>m1Mcwi</sup></i>1581492RRID:RGD_1581642Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA.1581643LAn/Humdlow autotomy newInstitute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israelsegregating_inbredUnknownRRID:RGD_1581643Males and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters.1581644FHH-<i>Htr1a<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Htr1a<i><sup>m1Mcwi</sup></i>1581496RRID:RRRC_00413Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C266Y mutation is generated from the codon change TGT/TAT.1581645LL/MavLaboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, FranceinbredUnknownRRID:RGD_1581645In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain.1582184SR/JrHsdDahl Salt-ResistantinbredUnknownRRID:RGD_1582184Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.1582185SS.SR-(<i>D3Mco36-D3Got166</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1582185SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome1582186FHH.FHH.1<sup>BN</sup>-(<i>D1Rat183-D1Rat76</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_1582186FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.1582187SS.SR-(<i>D3Mco24-D3Got130</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1582187SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome1582188SS.SR-(<i>D3Mco36-D3Mco46</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicCryopreserved Sperm (as of 2019-02-18)RRID:RRRC_00660SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome1582189SS.SR-(<i>D3Mco39-D3Got130</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1582189SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome1582190SS/JrHsdDahl Salt-Sensitive<a href =http://www.envigo.com/products-services/research-models-services/models/research-models/rats/inbred/dahl-salt-sensitive-resistant-(rapp)-inbred-rat/ss-jrhsd/>Envigo</a>inbredUnknownRRID:RGD_1582190Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986.1582191FHH.FHH.1<sup>BN</sup>-(<i>D1Rat287-D1Rat84</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_1582191FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.1582192SS.SR-(<i>D3Mco36-D3Got159</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1582192SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome1582193FHH.FHH.1<sup>BN</sup>-(<i>D1Mgh13-D1Rat89</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_1582193FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.1582194SS.SR-(<i>D3Mco78-D3Got130</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1582194SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome1582195FHH.FHH.1<sup>BN</sup>-(<i>D1Rat173F6B-D1Rat84</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_1582195FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.1582196FHH.FHH.1<sup>BN</sup>-(<i>D1Rat234-D1Rat265</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_1582196FHH-1<sup>BN</sup>/Mcwi was backcrossed with FHH/EurMcwi to generate these rats.1598797WF.WKY-(<i>D10Got124-D10Rat187</i>)/UwmDepartment of Oncology, University of Wisconsin, Madison WisconsincongenicUnknownRRID:RGD_1598797WKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL.1598798BBDP/WorNNIH Autoimmune Rat Model Repository and Dev CtrinbredExtinct (as of 2021-02-22)RRID:RRRC_00092Diabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.1598799ACI.FHH-(<i>D1Rat384-D1Rat452</i>)(<i>D17Rat61-D1Arb5</i>)(<i>D17Rat51</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_1598799Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain.1598800ACI.FHH-(<i>D1Rat384-D1Rat156</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_1598800Congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain.1598801ACI.FHH-(<i>D1Mit18-D1Mit8</i>)(<i>D14Mit11-D14Hmgc14b</i>)(<i>D14Rat65-D14Rat90</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_1598801Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.1598802BBDR/WorNNIH Autoimmune Rat Model Repository and Dev CtrinbredExtinct (as of 2021-02-22)RRID:RRRC_00094Diabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation1598803BBNB/WorNNIH Autoimmune Rat Model Repository and Dev Ctr.inbredUnknown (as of 2020-02-24)RRID:RRRC_00093Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony.1598804WKY.GHS-(<i>D1Rat32-D1Mit32</i>)Department of Medicine and Physiology, University of Rochester, Rochester New YorkcongenicUnknownRRID:RGD_1598804GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTL1599674BBDP.WF-(<i>D8Rat59-D8Sunn1467</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_1599674WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP1599675BBDP.WF-(<i>D13Rat124-D13Mgh5</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownPtprc3451RRID:RGD_1599675The BBDP/WorSunn rats were crossed with inbred WF rats (that share the same MHC haplotype as BBDP/WorSunn rats but differ at the CD45 allele) obtained from Charles River. Introgression of the WF CD45 (RT7.2) allele into BBDP/WorSunn was performed by phenotypic selection of backcross breeders for >10 generations, followed by intercrossing. This led to WF RT7.2 allele introgressed onto the genetic background of BBDP rats and also called BBDP/WorSunn.WF-CD45 inbred line.1599755F344.BN-(<i>D16Mit5-D16Rat75</i>)Department of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, ItalycongenicUnknownRRID:RGD_1599755BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segment1599756BN-<i>Has2<sup>m1Mcwi</i></sup>PGAmutantUnknownHas2<i><sup>m1Mcwi</sup></i>1599566RRID:RGD_1599756Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA.1599757BN-<i>Adora2a<sup>m2Mcwi</i></sup>PhysGenmutantExtinct (as of 2016-10-24)Adora2a<i><sup>m2Mcwi</sup></i>1599561RRID:RGD_1599757Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a.1599758SS-<i>Sod3<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2021-11-03)Sod3<i><sup>m1Mcwi</sup></i>1599567RRID:RRRC_00415Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT.1599759GRY/Idrgroggy rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=498&StrainsDir=Asc&s_Strainname=GRY> National BioResource Project for the Rat in Japan</a>, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto JapanmutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12)NeurobiologyCacna1a<sup>gry</sup>12880382RRID:RGD_1599759Groggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003.1599760SPRD.WKY-(<i>D18Wox8-D18Rat44</i>)/IbmmUniversite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, BelgiumcongenicUnknownRRID:RGD_1599760SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.1599761BN-<i>Lcat<sup>m2Mcwi</i></sup>PGAmutantUnknownLcat<i><sup>m2Mcwi</sup></i>1599570RRID:RGD_1599761Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG.1599762SS-<i>Bdkrb2<sup>m2Mcwi</i></sup>PGAmutantUnknownBdkrb2<i><sup>m2Mcwi</sup></i>1599568RRID:RGD_1599762Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA.1599763SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/IbmmUniversite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, BelgiumcongenicUnknownRRID:RGD_1599763SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.1599764COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoUniversity of Toledo College of Medicine, Toledo, OhiocongenicUnknownRRID:RGD_1599764Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.1599765SS-<i>Klf4<sup>m2Mcwi</i></sup>PGAmutantUnknownKlf4<i><sup>m2Mcwi</sup></i>1599559RRID:RGD_1599765Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC.1599766SS-<i>Hps6<sup>m1Mcwi</i></sup>PGAmutantUnknownHps6<i><sup>m1Mcwi</sup></i>1599564RRID:RGD_1599766Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG.1599767SS-<i>Htr1a<sup>m2Mcwi</i></sup>PGAmutantUnknownHtr1a<i><sup>m2Mcwi</sup></i>1599562RRID:RGD_1599767Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC.1599768SS-<i>Klf4<sup>m1Mcwi</i></sup>PGAmutantUnknownKlf4<i><sup>m1Mcwi</sup></i>1599569RRID:RGD_1599768Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC.1599769COP.DA-(<I>D3Rat233-D3Mgh14</I>)/McoUniversity of Toledo College of Medicine, Toledo, OhiocongenicUnknownRRID:RGD_1599769Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP.1600337F344.GK-(<i>D1Mgh14-D1Rat90</i>)/SweKarolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_1600337This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.1600338SHR.F344-(<i>D12Mgh5-D12Mgh6</i>)/SnkMedicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, JapancongenicUnknownRRID:RGD_1600338Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique1600339BN.GK-(<i>D1Wox18-D1Got254</i>)/OxThe Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenicUnknownRRID:RGD_1600339This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.1600340DA/BklArbNsiFeinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NYinbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00693Originally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI.1600341LEW-Tg(Ren2)27/JmulWake Forest University School of Medicine, Winston-Salem, North CarolinatransgenicUnknownRRID:RGD_1600341This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl rats1600342F344.GK-(<i>D1Got250-D1Rat90</i>)/SweKarolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_1600342This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.1600343SHRSP.WKY-(<I>D1Wox29-D1Arb21</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=480> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_1600343This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy1600344F344.GK-(<i>D1Rat175-D1Rat90</i>)/SweKarolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_1600344This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.1600345F344.GK-(<i>D1Rat83-D1Rat376</i>)/SweKarolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_1600345This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.1600346F344.GK-(<i>D1Swe4-D1Rat85</i>)/SweKarolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_1600346This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(<I>D1Arb42a-D1Rat90</I>)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding.1600490SS-Chr 1<sup>BN</sup>/McwiPhysGenconsomicLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RGD_1600490A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed1625284Wild1/HubrHubrecht Laboratory, Utrecht, The NetherlandswildUnknownRRID:RGD_1625284This rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolation1626207BN-<i>Adora2a<sup>m3Mcwi</i></sup>PhysGenmutantExtinct (as of 2016-10-24)Adora2a<i><sup>m3Mcwi</sup></i>1642070RRID:RGD_1626207Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E207K mutation is generated from the codon change GAG/AAG of rat Adora2a.1626210BN-<i>Lipe<sup>m2Mcwi</i></sup>PGAmutantUnknownLipe<i><sup>m2Mcwi</sup></i>1642169RRID:RGD_1626210Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q52L mutation is generated from the codon change CTG/CAG.1626211SS-<i>Cpf2<sup>m1Mcwi</i></sup>PGAmutantUnknownRRID:RGD_1626211Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.1626213BN-<i>Oxtr<sup>m1Mcwi</i></sup>PGAmutantUnknownOxtr<i><sup>m1Mcwi</sup></i>1642173RRID:RGD_1626213Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F225Y mutation is generated from the codon change TTC/TAC.1626214BN-<i>Slc27a5<sup>m2Mcwi</i></sup>PGAmutantUnknownSlc27a5<i><sup>m2Mcwi</sup></i>1642170RRID:RGD_1626214Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K160E mutation is generated from the codon change AAA/GAA.1641831MWF-Chr 6<sup>SHR</sup>/RkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, GermanyconsomicUnknownRRID:RGD_1641831MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing1641849SS.LEW-(<i>D10Mit1-D10Mgh1</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641849This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641850SHR.WKY-(<i>D1Got158-D1Got161</i>)/NjsDepartment of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UKcongenicUnknownSpon1619918RRID:RGD_1641850This is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region1641851SHR.PD-(<I>D8Rat42-D8Arb23</I>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownZbtb16|Zbtb16<sup>Lx</sup>727921|12910834RRID:RGD_1641851A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-<i>Lx</i> strain1641852WF.BBDR-(<i>D4Got48-D4Got43</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownRRID:RGD_1641852This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.1641853SS.LEW-(<i>D10Mco38-D10Mgh1</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641853This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641854HAS.LAS-(<i>D5Rat70-D5Rat37</i>)/RarDepartment of Pharmaceutical Sciences, University of Colorado at Denver, Denver, ColoradocongenicUnknownRRID:RGD_1641854HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped,1641855BBDP.WF-(<i>D8Rat73-D8Rat20</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_1641855WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP1641856P.NP-(<i>D4Rat119-D4Rat55</i>)/IusmDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianacongenicUnknownRRID:RGD_1641856iP and iNP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection1641857BBDP.WF-(<i>D8Rat16-D8Sunn1467</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_1641857WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP1641858SHR.WKY-(<i>D1Rat420-D1Rat278</i>)/NjsDepartment of Cardiovascular Sciences, University of Leicester, Glenfield Hospital, UKcongenicUnknownRRID:RGD_1641858This is a congenic substrain developed by crossing SHR.WKY-(<i>D1Wox34-D1Rat164</i>)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region1641859SS.MNS-(<i>D10Bra1-D10Mit11</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641859This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641860SS.MNS-(<i>D10Mco62-D10Mit1</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641860This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641861HAS.LAS-(<i>D2Rat53-D2Rat138</i>)/RarDepartment of Pharmaceutical Sciences, University of Colorado at Denver, Denver, ColoradocongenicCryopreserved Sperm (as of 2019-02-26)RRID:RRRC_00729HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped,1641862F344-<i>Apc<sup>Pirc</i></sup>/UwmUniversity of Wisconsin-Madison, Madison, WisconsinmutantLive Animals; Cryopreserved Sperm (as of 2018-07-16)Apc<sup>Pirc</sup>1554322RRID:RRRC_00782Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam)1641863SHR.PD-(<I>D8Mgh9-D8Rat149</I>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownZbtb16|Zbtb16<sup>Lx</sup>727921|12910834RRID:RGD_1641863A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv.1641864WF/CrCrli<a href=http://guide.labanimal.com/guide/companyd.jsp?b=9143>Charles River Laboratories </a> ItalyinbredUnknownRRID:RGD_1641864J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute.1641865SD-<i>Brca2<sup>m1Uwm</i></sup>University of Wisconsin-Madison, Madison, WisconsinmutantCryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01)Brca2<i><sup>m1Uwm</sup></i>728326RRID:RRRC_002869 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. Nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon).1641866SS.LEW-(<i>D10Mit10-D10Rat24</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641866This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641867Iusm:Palcohol-preferringIndiana Alcohol Research Center at the Indiana University School of MedicineoutbredUnknownSnca3729RRID:RGD_1641867These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop this preference line (P) and non-preference line (Iusm:NP, RGD:1641873).1641868WF.BBDR-(<i>D4Rat93-D4Rat228</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownTcrb3834RRID:RGD_1641868This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.1641869SS.MNS-(<i>D10Mco31-D10Mit11</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641869This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641870BBDP.WF-(<i>D8Rat73-D8Rat121</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_1641870WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP1641871SS.MNS-(<i>D10Mco62-D10Mco31</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641871This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641872SS.LEW-(<i>D10Mco38-D10Mco41</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1641872This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mit10-D10Mgh1</i>/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1641873Iusm:NPalcohol-nonpreferringDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianaoutbredUnknownSnca3729RRID:RGD_1641873These were developed at Indiana University for alcohol-preferring behavior through bidirectional selective breeding of Wistar rats from the Walter Reed Army Institute of Research, Washington, DC. A single pair of rats with high preference and another pair with low preference were mated to develop a preference line (Iusm:P, RGD:1641867) and this non-preference line (Iusm:NP).1641874BBDP.WF-(<i>D8Rat73-D8Rat90</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_1641874WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP1641875SHR-Chr Y<sup>BN</sup>/CubCzech Academy of Sciences, Prague, Czech RepublicconsomicUnknownRRID:RGD_1641875BN-<i>Lx</i>/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations1641876BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_1641876WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP1641877NP.P-(<i>D4Rat119-D4Rat55</i>)/IusmDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianacongenicUnknownAkr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap12092|3197|3729|68368|735049|1307836|1308501|1310949|1311418RRID:RGD_1641877Male iP and female iNP rats were crossed to get F1 animals which were further backcrossed to iNP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection1641878WF.BBDR-(<i>Clcn1-D4Rat228</i>)/WorUniversity of Massachusetts Medical School, Worcerster, MAcongenicUnknownClcn12360RRID:RGD_1641878This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(<i>D4Rat96-D4Rat44</i>)/Wor were transferred to WF background and the animals were screened using microsatellite markers.1641879SS-Chr 19<sup>SHR</sup>/RkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, GermanyconsomicUnknownRRID:RGD_1641879SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing1641880SD-<i>Brca1<sup>m1Uwm</i></sup>University of Wisconsin-Madison, Madison, WisconsinmutantCryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01)Brca1|Brca1<i><sup>m1Uwm</sup></i>2218|728298RRID:RRRC_002859 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon.1642017BBDR/WorBrm<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>inbredUnknownRRID:RGD_1642017Diabetes resistant BB rats maintained in BRM. This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at Biomedical Research Models, Inc.1642018BBDP/WorBrm<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>inbredUnknownRRID:RGD_1642018This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester.1642036SHR/OlaIpcv-mt<sup>BN/Crl</sup>Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech RepublicconplasticUnknownRRID:RGD_1642036Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic background1642269SS-<i>Birc3<sup>m2Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Birc3<i><sup>m2Mcwi</sup></i>1642178RRID:RGD_1642269Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K170E mutation is generated from the codon change AAG/GAG.1642270BN-Lcat<i><sup>m3Mcwi</i></sup>PGAmutantCryopreserved Sperm; CryorecoveryLcat<i><sup>m3Mcwi</sup></i>1642175RRID:RRRC_00397Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC.1642271SS-<i>Klf4<sup>m3Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Klf4<i><sup>m3Mcwi</sup></i>1642179RRID:RRRC_00417Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H344L mutation is generated from the codon change CAT/CTT.1642272SS.LEW-(<i>D10Mco84-D10Got93</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642272This is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642273SS-<i>Thbd<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Thbd<i><sup>m1Mcwi</sup></i>1642182RRID:RGD_1642273Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N256K mutation is generated from the codon change AAC/AAA.1642274SS-<i>Has1<sup>m2Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Has1<i><sup>m2Mcwi</sup></i>1642171RRID:RGD_1642274Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V155L mutation is generated from the codon change GTC/CTC.1642275SS.LEW-(<i>D10Rat29-D10Mco88</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642275This is a congenic substrain developed by crossing SS.LEW-(<i>D10Rat29-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642276SS-<i>Kcna5<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Kcna5<i><sup>m1Mcwi</sup></i>1642177RRID:RRRC_00418Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N152K mutation is generated from the codon change AAT/AAA.1642277SS-<i>Cpt2<sup>m1Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Cpt2<i><sup>m1Mcwi</sup></i>1642174RRID:RRRC_00416Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F475L mutation is generated from the codon change TTC/CTC.1642278SS-<i>Ghsr<sup>m2Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Ghsr<i><sup>m2Mcwi</sup></i>1642180RRID:RGD_1642278Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S342P mutation is generated from the codon change TCC/CCC.1642279SS.LEW-(<i>D10Arb9-D10Rat161</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642279This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642281SS-<i>Podxl<sup>m1Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Podxl<i><sup>m1Mcwi</sup></i>1642176RRID:RGD_1642281Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA.1642282SS-<i>Cacna1g<sup>m1Mcwi</i></sup>PGAmutantUnknownCacna1g<i><sup>m1Mcwi</sup></i>1642168RRID:RGD_1642282Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S490T mutation is generated from the codon change TCT/ACT.1642283SS.LEW-(<i>D10Rat29-D10Got93</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642283This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642284SS-<i>Fgl2<sup>m2Mcwi</i></sup>PGAmutantUnknownFgl2<i><sup>m2Mcwi</sup></i>1642181RRID:RGD_1642284Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K129N mutation is generated from the codon change AAG/AAT.1642285SS.LEW-(<i>D10Arb9-D10Rat57</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642285This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642287SS.LEW-(<i>D10Arb9-D10Mco84</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642287This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642288SS.LEW-(<i>D10Mco89-D10Got101</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642288This is a congenic substrain developed by crossing SS.LEW-(<i>D10Arb9-D10Got101</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642289SS-<i>Serpina5<sup>m1Mcwi</i></sup>PGAmutantUnknownSerpina5<i><sup>m1Mcwi</sup></i>1642167RRID:RGD_1642289Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H24R mutation is generated from the codon change CAT/CGT.1642362SS-<i>Has1<sup>m3Mcwi</i></sup>PGAmutantUnknownHas1<i><sup>m3Mcwi</sup></i>1642359RRID:RGD_1642362Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D167D mutation is generated from the codon change GAT/GAC.1642363BN-<i>Fgl2<sup>m3Mcwi</i></sup>PGAmutantUnknownFgl2<i><sup>m3Mcwi</sup></i>1642355RRID:RGD_1642363Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N353H mutation is generated from the codon change AAT/CAT.1642364SS-<i>Ghsr<sup>m3Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Ghsr<i><sup>m3Mcwi</sup></i>1642357RRID:RRRC_00421Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N26K mutation is generated from the codon change AAC/AAA.1642365SS-<i>Fgl2<sup>m4Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Fgl2<i><sup>m4Mcwi</sup></i>1642354RRID:RRRC_00420Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H338P mutation is generated from the codon change CAT/CCT.1642366SS-<i>Lcat<sup>m4Mcwi</i></sup>PhysGen, Rat Resource & Research CentermutantExtinct (as of 2017-01-26)Lcat<i><sup>m4Mcwi</sup></i>1642358RRID:RGD_1642366Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT.1642367BN-<i>Ccr2<sup>m2Mcwi</i></sup>PhysGenmutantExtinct (as of 2017-01-26)Ccr2<i><sup>m2Mcwi</sup></i>1642356RRID:RGD_1642367Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I99T mutation is generated from the codon change ATC/ACC.1642439SS-<i>Lcat<sup>m5Mcwi</i></sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Lcat<i><sup>m5Mcwi</sup></i>1642438RRID:RRRC_00419Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y297Stop mutation is generated from the codon change TAC/TAA.1642689BN.OLETF-(<i>D1Rat169-D1Rat90</i>)/GotOtsuka Pharmacuetical Company, Tokushima, JapancongenicUnknownPrlhr71037RRID:RGD_1642689OLETF/Got females were crossed with BN/Crlj to produce F<sub>1</sub> which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotyped1642690LA-<i>cp</i>/NJcrDepartment of Surgery, University of Alberta, Edmonton, CanadacongenicUnknownRRID:RGD_1642690Originated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta.1642968SS.LEW-(<i>D10Mco84-D10Rat58</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642968This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642969SS.LEW-(<i>D10Mco84-D10Mco134</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642969This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642970SS.LEW-(<i>D10Mco113-D10Got93</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642970This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642971SS.LEW-(<i>D10Mco84-D10Mco129</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642971This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642972SS.LEW-(<i>D10Mco84-D10Mco143</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_1642972This is a congenic substrain developed by crossing SS.LEW-(<i>D10Mco84-D10Got93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region1642989SS-Tg(CAG-EGFP)1McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicCryopreserved Sperm (as of 2019-04-04)RRID:RGD_1642989This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.1642990SD-Tg(CAG-EGFP)63McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642990This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.1642991SS-Tg(CAG-eGFP)18McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642991This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.1642992SS-Tg(CAG-EGFP)28McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642992This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.1642993SD-Tg(CAG-EGFP)97McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642993This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos.1642994SS-Tg(CAG-EGFP)43McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642994This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.1642995SS-Tg(CAG-eGFP)10McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642995This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.1642996SS-Tg(CAG-EGFP)2McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642996This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.1642997SS-Tg(CAG-EGFP)23McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_1642997This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos.1643001FH/UncFawn-hoodedDepartment of Psychiatry, University of North Carolina, Chapel Hill, North CarolinainbredUnknownRRID:RGD_1643001A substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hill1643002SHR.WKY-(<i>D1Rat420-D1Got161</i>)/NjsDept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UKcongenicUnknownSpon1619918RRID:RGD_1643002Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR1643007DA.ACI-(<i>D12Wox12-D12Rat53</i>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_1643007ACI/SegHsd and DA/OlaHsd were crossed to get F<sub>2</sub> animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsd1643010F344.OLETF-(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/TjUniversity of Tokushima Graduate School, Kuramato-cho, Tokushima, JapancongenicUnknownRRID:RGD_1643010double congenic strain generated by intercrossing F344.OLETF-(<i>D7Rat18-D7Mit2</i>)/Tj and F344.OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj and F<sub>2</sub> rats screened for homozygosity2289819SS.MNS-(<i>D10Mco62-D10Got99</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289819This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289820SS.MNS-(<i>D10Mco30-D10Got91</i>)/1McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289820This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289821SS.MNS-(<i>D10Mco30-D10Got91</i>)/3McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289821This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289822SS.MNS-(<i>D10Mco30-D10Got112</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289822This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289823SS.MNS-(<i>D10Mco62-D10Mco30</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289823This is a congenic substrain developed by crossing SS.MNS-(<i>D10M11Mit119-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289824SS.MNS-(<i>D10Mco30-D10Got101</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289824This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289825SS.MNS-(<i>D10Rat24-D10Mco31</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289825This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289826SS.MNS-(<i>D10Mco30-D10Got91</i>)/2McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289826This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco30-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289827SS.MNS-(<i>D10Mco30-D10Mco31</i>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2289827This is a congenic substrain developed by crossing SS.MNS-(<i>D10Mco62-D10Mco31</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289913SS.MNS-(<i>D10Rat13-D10Rat12</i>)/JrMedical College of Ohio, ToledocongenicUnknownRRID:RGD_2289913This is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289916SS.MNS-(<i>D10Mco15-D10Mit11</i>)/JrMedical College of Ohio, ToledocongenicUnknownRRID:RGD_2289916This is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2289917SS.MNS-(<i>D10Mco70-D10Mit11</i>)/JrMedical College of Ohio, ToledocongenicUnknownRRID:RGD_2289917This is a congenic substrain developed by crossing SS.MNS-(<i>D10Rat13-D10Mit11</i>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2290056F344-<i>Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Elmod3<sup>Tn(sb-T2/Bart3)2.42Mcwi</sup>2290055RRID:RRRC_00423These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4<sup>th</sup> intron of the Rbed1 gene.2290057F344-TgTn(T2/Bart3)1CebPGAtransgenicCryopreserved SpermRRID:RGD_2290057The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.2290064F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi</sup>2290060RRID:RRRC_00344These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene.2290065F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup></i>PGAmutantUnknownCA338503<sup>Tn(sb-T2/Bart3)2.196Mcwi</sup>2290059RRID:RGD_2290065this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD: 2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).2290066F344-<i>Nell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup></i>PGAmutantUnknownNell1<sup>Tn(sb-T2/Bart3)2.195Mcwi</sup>2290061RRID:RGD_2290066These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the second intron of the Nell1.2290067F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup></i>PGAmutantUnknownBI285226<sup>Tn(sb-T2/Bart3)2.193Mcwi</sup>2290062RRID:RGD_2290067this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).2290078F344-<i>Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Myo9a<sup>Tn(sb-T2/Bart3)2.186Mcwi</sup>2290068RRID:RRRC_00385These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene.2290079F344-<i>BI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup></i>PGAmutantUnknownBI285226<sup>Tn(sb-T2/Bart3)2.194Mcwi</sup>2290069RRID:RGD_2290079this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290080F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup></i>PGAmutantUnknownBI284938<sup>Tn(sb-T2/Bart3)2.187Mcwi</sup>2290074RRID:RGD_2290080this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290081F344-<i>BI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup></i>PGAmutantCryopreserved SpermBI284934<sup>Tn(sb-T2/Bart3)2.185Mcwi</sup>2290072RRID:RRRC_00367this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290082F344-<i>Brinp3<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Brinp3<sup>Tn(sb-T2/Bart3)2.189Mcwi</sup>2290071RRID:RRRC_00425These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene.2290083F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup></i>PGAmutantUnknownSlc24a3<sup>Tn(sb-T2/Bart3)2.188Mcwi</sup>2290073RRID:RGD_2290083These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene.2290100F344-<i>Entpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup></i>PGAmutantUnknownEntpd6<sup>Tn(sb-T2/Bart3)2.174Mcwi</sup>2290086RRID:RGD_2290100These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Entpd6 gene.2290101F344-<i>CB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup></i>PGAmutantUnknownCB706876<sup>Tn(sb-T2/Bart3)2.181Mcwi</sup>2290092RRID:RGD_2290101this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290102F344-<i>Klhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup></i>PGAmutantUnknownKlhl13<sup>Tn(sb-T2/Bart3)2.176Mcwi</sup>2290085RRID:RGD_2290102These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene.2290103F344-<i>Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Nrg1<sup>Tn(sb-T2/Bart3)2.183Mcwi</sup>2290090RRID:RRRC_00343this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb and F344-Tg(PGK2-sb11)Ceb. This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene.2290104F344-<i>Cadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup></i>PGAmutantUnknownCadm2<sup>Tn(sb-T2/Bart3)2.180Mcwi</sup>2290088RRID:RGD_2290104These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene.2290105F344-<i>Sptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup></i>PGAmutantUnknownSptbn4<sup>Tn(sb-T2/Bart3)2.179Mcwi</sup>2290097RRID:RGD_2290105These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene.2290106F344-<i>BQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup></i>PGAmutantUnknownBQ195794<sup>Tn(sb-T2/Bart3)2.182Mcwi</sup>2290070RRID:RGD_2290106this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290107F344-<i>Cyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup></i>PGAmutantUnknownCyss<sup>Tn(sb-T2/Bart3)2.173Mcwi</sup>2290095RRID:RGD_2290107These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Cyss gene.2290108F344-<i>LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)LOC290071<sup>Tn(sb-T2/Bart3)2.170Mcwi</sup>2290089RRID:RRRC_00338These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene.2290109F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup></i>PGAmutantUnknownCA338503<sup>Tn(sb-T2/Bart3)2.168Mcwi</sup>2290087RRID:RGD_2290109this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290110F344-<i>Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Lims1<sup>Tn(sb-T2/Bart3)2.169Mcwi</sup>2290096RRID:RRRC_00362These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene.2290111F344-<i>Cst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup></i>PGAmutantUnknownCst3<sup>Tn(sb-T2/Bart3)2.172Mcwi</sup>2290093RRID:RGD_2290111These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1<sup>st</sup> intron of the Cst3 gene.2290112F344-<i>CA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup></i>PGAmutantUnknownCA338503<sup>Tn(sb-T2/Bart3)2.175Mcwi</sup>2290094RRID:RGD_2290112this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290113F344-<i>Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Fam19a2<sup>Tn(sb-T2/Bart3)2.184Mcwi</sup>2290098RRID:RRRC_00387These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene.2290114F344-<i>Slc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup></i>PGAmutantUnknownSlc24a3<sup>Tn(sb-T2/Bart3)2.178Mcwi</sup>2290091RRID:RGD_2290114These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene.2290135F344-<i>Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Chsy1<sup>Tn(sb-T2/Bart3)2.165Mcwi</sup>2290123RRID:RRRC_00337These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2<sup>nd</sup> intron of the Chsy1.2290136F344-<i>Slc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup></i>PGAmutantUnknownSlc24a4<sup>Tn(sb-T2/Bart3)2.145Mcwi</sup>2290127RRID:RGD_2290136These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2<sup>nd</sup> intron of the Slc24a4 gene.2290137F344-<i>BF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup></i>PGAmutantCryopreserved SpermBF522453<sup>Tn(sb-T2/Bart3)2.166Mcwi</sup>2290126RRID:RRRC_00361this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290138F344-<i>Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup></i>PGAmutantExtinct (as of 2016-12-12)Glis1<sup>Tn(sb-T2/Bart3)2.149Mcwi</sup>2290128RRID:RRRC_00332These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene.2290139F344-<i>AW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup></i>PGAmutantUnknownAW527406<sup>Tn(sb-T2/Bart3)2.156Mcwi</sup>2290122RRID:RGD_2290139this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290140F344-<i>BI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup></i>PGAmutantUnknownBI285110<sup>Tn(sb-T2/Bart3)2.167Mcwi</sup>2290115RRID:RGD_2290140this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290141F344-<i>Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup></i>PGA, Transposagen.mutantCryopreserved Sperm (as of 2016-11-11)Abat<sup>Tn(sb-T2/Bart3)2.163Mcwi</sup>2290121RRID:RRRC_00381These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene.2290142F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup></i>PGAmutantUnknownLOC681893<sup>Tn(sb-T2/Bart3)2.161Mcwi</sup>2290118RRID:RGD_2290142These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene.2290143F344-<i>Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Napb<sup>Tn(sb-T2/Bart3)2.162Mcwi</sup>2290116RRID:RRRC_00335These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene.2290144F344-<i>Adgrl3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-13)Adgrl3<sup>Tn(sb-T2/Bart3)2.151Mcwi</sup>2290129RRID:RRRC_00334These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 gene.2290145F344-<i>BI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup></i>PGAmutantUnknownBI284938<sup>Tn(sb-T2/Bart3)2.155Mcwi</sup>2290120RRID:RGD_2290145this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2290146F344-<i>Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Plce1<sup>Tn(sb-T2/Bart3)2.146Mcwi</sup>2290125RRID:RRRC_00380These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene.2290147F344-<i>Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Sptlc3<sup>Tn(sb-T2/Bart3)2.147Mcwi</sup>2290124RRID:RRRC_00331These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6<sup>th</sup> intron of the Sptlc3 gene.2290148F344-<i>Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup></i>PGAmutantExtinct (as of 2016-12-21)Map2k5<sup>Tn(sb-T2/Bart3)2.150Mcwi</sup>2290117RRID:RRRC_00333These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene.2290159F344-<i>Spetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup></i>PGAmutantUnknownSpetex-2H<sup>Tn(sb-T2/Bart3)2.136Mcwi</sup>2290150RRID:RGD_2290159These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Spetex-2H gene.2290160F344-<i>Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Rph3a<sup>Tn(sb-T2/Bart3)2.104Mcwi</sup>2290154RRID:RRRC_00326These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene.2290161F344-<i>Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup></i>PGAmutantExtinct (as of 2017-01-30)Tmco1<sup>Tn(sb-T2/Bart3)2.135Mcwi</sup>2290156RRID:RRRC_00328These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene.2290162F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Inpp4b<sup>Tn(sb-T2/Bart3)2.143Mcwi</sup>2290149RRID:RRRC_00379These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene.2290163F344-TgTn(T2/Bart3)2Cebtransposon sleeping beautyPGAtransgenicExtinct (as of 2016-11-14)RRID:RGD_2290163The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression.2290164F344-<i>Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Syne1<sup>Tn(sb-T2/Bart3)2.68Mcwi</sup>2290153RRID:RRRC_00325These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109<sup>th</sup> intron of the Syne1 gene.2290165F344-<i>Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup></i>PGAmutantExtinct (as of 2017-01-24)Ntm<sup>Tn(sb-T2/Bart3)2.130Mcwi</sup>2290157RRID:RRRC_00327These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene.2290166F344-<i>Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Plcb3<sup>Tn(sb-T2/Bart3)2.69Mcwi</sup>2290155RRID:RRRC_00424These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene.2290167F344-<i>Dlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup></i>PGAmutantUnknownDlg1<sup>Tn(sb-T2/Bart3)2.133Mcwi</sup>2290152RRID:RGD_2290167These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6<sup>th</sup> intron of the Dlg1 gene.2290168F344-<i>Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup></i>PGAmutantExtinct (as of 2017-01-24)Pde5a<sup>Tn(sb-T2/Bart3)2.144Mcwi</sup>2290151RRID:RRRC_00330These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). The trap construct targeted to the 4th intron of the Pde5a gene.2290169F344-Tg(PGK2-sb11)CebSleeping beauty transposase transgenicPGAtransgenicExtinct (as of 2016-11-14)RRID:RGD_2290169sb11 cDNA linked to human PGK2 promoter was used.2290170F344-<i>Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Cd226<sup>Tn(sb-T2/Bart3)2.141Mcwi</sup>2290158RRID:RRRC_00329These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3<sup>rd</sup> intron of the Cd226 gene.2290171F344-<i>LOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup></i>PGAmutantUnknownLOC681893<sup>Tn(sb-T2/Bart3)2.159Mcwi</sup>2290119RRID:RGD_2290171These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene.2290186SD-Tg(SOD1*G93A)39Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, JapantransgenicUnknownSOD1730855RRID:RGD_2290186SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation2290187SD-Tg(SOD1*H46R)4Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, JapantransgenicUnknownSOD1730855RRID:RGD_2290187SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutation2290272SS/JrNgs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=798> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_2290272strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan2290273SHRSP.WKY-<i>(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)</i>/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=785> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290273The desired fragment is transferred from WKY to SHRSP2290274SHRSP.WKY-<i>(D15Rat2-D15Rat94)</i>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=795> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290274This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2290275SHRSP.WKY-<i>(D3Tkyo7-D3Rat1)</i>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=786&StrainsPage=20&StrainsDir=Asc>National Bio Resource Project</a> JapancongenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290275The desired fragment is transferred from WKY to SHRSP2290276SHRSP.WKY-<i>(D3Mgh16-D3Mgh15)</i>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=787> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290276This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2290277SHRSP.WKY-<i>(D3Rat227-D3Rat166)</i>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=783> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290277The desired fragment is transferred from WKY to SHRSP2290278SR/JrNgs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=799> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_2290278strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan2290279SHRSP.WKY-<i>(D15Rat68-D15Rat106)</i>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=796> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290279This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2290280SHRSP.WKY-<i>(D3Mgh16-D3Rat110)</i>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=780> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290280The desired fragment is transferred from WKY to SHRSP2290281SHRSP.WKY-<i>(D3Rat227-D3Rat1)</i>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=794> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290281This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2290282SHRSP.WKY-<i>(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)</i>/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=784> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2290282The desired fragment is transferred from WKY to SHRSP2290298SHR-Tg(Thy1-MAPT)318Axon-Neuroscience GmbH, Vienna, AustriatransgenicUnknownMAPT736496RRID:RGD_2290298SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-3912290299SHR-Tg(Thy1-MAPT)72Axon-Neuroscience GmbH, Vienna, AustriatransgenicUnknownMAPT736496RRID:RGD_2290299SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-3912290311SD-Tg(SOD1*G93A)26DwcLudwig Institute of Cancer Research, University of California at San Diego, La Jolla, CaliforniatransgenicUnknownSOD1730855RRID:RGD_2290311SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation2290386SD-Tg(Wld<sup>s</sup>)23ColeUniversity of Cologne, Cologne, GermanytransgenicUnknownRRID:RGD_2290386SD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changes2290387SD-Tg(UbC-APPswe)6590Karolinska Institutet, Stockholm, SwedentransgenicUnknownAPP736021RRID:RGD_2290387SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutation2290391SD-Tg(Wld<sup>s</sup>)79ColeUniversity of Cologne, Cologne, GermanytransgenicUnknownRRID:RGD_2290391SD rats were microinjected with a mouse Wld<sup>s</sup> with a Ube4b-derived domain with A46R and M60T amino acid changes2290429SS-Tg(ApoC3-CETP)53OpazWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00310SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter2291840F344-<i>Dzank1<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup></i>PGAmutantExtinct (as of 2016-10-17)Dzank1<sup>Tn(sb-T2/Bart3)2.164Mcwi</sup>2291839RRID:RGD_2291840These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene.2292168ISIAHInherited stress-induced arterial hypertensionInstitute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, RussiainbredUnknownRRID:RGD_2292168Selected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stress2292384SS.LEW-(<i>D10Chm167-D10Chm257</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2292384A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.2292385SS.LEW-(<i>D10Mco30-D10Got107</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2292385A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.2292386SS.LEW-(<i>D10Chm155-D10Rat127</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2292386A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd.2292387SS.LEW-(<i>D10Chm224-D10Chm259</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2292387A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.2292388SS.LEW-(<i>D10Chm246-D10Chm257</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2292388A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm128-D10Chm182</i>)/Ayd.2292389SS.LEW-(<i>D10Chm10-D10Chm14</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2292389A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat13-D10Rat11</i>)/Ayd.2292390SS.LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2292390A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.2292451F344-<i>Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Stxbp5l<sup>Tn(sb-T2/Bart3)2.202Mcwi</sup>2292450RRID:RRRC_00386These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene.2292452F344-<i>Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Syndig1<sup>Tn(sb-T2/Bart3)2.171Mcwi</sup>2292449RRID:RRRC_00342These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene.2292453F344-<i>BE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved SpermBE329202<sup>Tn(sb-T2/Bart3)2.198Mcwi</sup>2292448RRID:RRRC_00345this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2292454F344-<i>RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)RGD1564304<sup>Tn(sb-T2/Bart3)2.201Mcwi</sup>2292447RRID:RGD_2292454These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene.2292459WF.LEW-<i>RVFV</i><a href=http://www.rrrc.us/Strain/?x=208>Rat Resource and Research Center</a>congenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-11-15)RRID:RRRC_00208This rat strain was developed by classical breeding technique inserting the gene for resistance to lethal RVFV infection from the LEW rat strain into the genetic background of the WF rat strain.2292526SS-Tg(Atp1a1)48Opaz<a href=http://www.rrrc.us/Strain/?x=281>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24)RRID:RRRC_00281SS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase2292527SS-Tg(RA1V9)64Opaz<a href=http://www.rrrc.us/Strain/?x=308>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00308Dahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal.2292528F344-Tg(APPswe)Opaz<a href=http://www.rrrc.us/Strain/?x=283>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00283F344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter2292529LEW-Tg((ROSA)26Sor-luc)11Jmsk<a href=http://www.rrrc.us/Strain/?x=299>Rat Resource and Research Center</a>, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=649> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-08-08)DevelopmentRRID:RRRC_00299LEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site2292530SD-Tg(Pou5f1-Dsred)<a href=http://www.rrrc.us/Strain/?x=320>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00320This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells.2292531SD-Tg(Pou5f1-EGFP)<a href=http://www.rrrc.us/Strain/?x=319>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2018-04-23)RRID:RRRC_00319This transgenic strain carries a random insertion of a construct containing mouse promoter Pou5f1 to drive the expression of EGFP.2292532F344-Tg(betaCTF-l45F)<a href=http://www.rrrc.us/Strain/?x=277>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00277F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein2292564ACI.COP-(<i>D6Rat80-D6Rat146</i>)/ShulDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, NebraskacongenicUnknownRRID:RGD_2292564Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped2292565ACI.COP-(<i>D3Mgh16-D3Rat119</i>)/ShulDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, NebraskacongenicUnknownRRID:RGD_2292565Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped2292566ACI.COP-(<i>D3Rat130-D3Rat114</i>)/ShulDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, NebraskacongenicUnknownRRID:RGD_2292566Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped2292567ACI.COP-(<i>D10Mgh20-D10Rat4</i>)/ShulDepartment of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, NebraskacongenicUnknownRRID:RGD_2292567Female COP/CrCrl and male ACI/SegHsd were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped2292647SS.LEW-(<I>D1Mco36-D1Rat106</I>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2292647This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2292648SS.LEW-(<I>D1Mco36-D1Mco77</I>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2292648This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2292649SS.LEW-(<I>D1Mco36-D1Rat131</I>)/1McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2292649This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2292650SS.LEW-(<I>D1Mco36-D1Rat131</I>)/2McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2292650This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2292651SS.LEW-(<I>D1Mco99-D1Rat49</I>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2292651This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2292652SS.LEW-(<I>D1Mco85-D1Rat49</I>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2292652This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2292653SS.LEW-(<i>D1Mco36-D1Mco101</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2292653This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Rat49</I>)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2293012ACI.BBDP-(<i>RT1<sup>u</sup></i>)(<i>Gimap5</i>)/SunnSunnybrook Research Institute, Toronto, Ontario, Canada.congenicUnknownRRID:RRRC_007882 BBDP regions [Iddm1(RT1u) and Iddm2(Gimap5)] were introgressed into the ACI/SegHsd background2293120LOU.BN-(<i>D10Mgh1-D10Mgh14</i>)/InsCardiovascular Physiopathology, INSERM, Montpellier, FrancecongenicUnknownAce2493RRID:RGD_2293120segment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOU2293143SS.BN-(<i>D13Rat20-D13Rat127</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRen3554RRID:RGD_2293143SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2293144SS.BN-(<i>D13Rat91-D13Rat179</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2293144SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2293145SS.BN-(<i>D13Hmgc64-RN34_13048990782</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRen3554RRID:RGD_2293145SS/JrHsdMcwi were crossed with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2293146SS.BN-(<i>D13Rat20-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2293146SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2293354LEW.WKY-(<i>D16Rat88-D16Rat40</i>)/TjaImperial College, London, UKcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00708segment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsd2293355WKY.LEW-(<i>D16Rat88-D16Rat40</i>)/TjaImperial College, London, UKcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_0070622.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrl2293729SHR-<i>Gja8</i><sup>m1-/-Cub</sup>Department of Biology, Charles University in Prague, Prague, Czech RepublicmutantUnknownGja8<sup>m1Cub</sup>12791992RRID:RGD_2293729This strain is a coisogenic mutant derived from SHR/OlaIpcv where a mutation is observed in the NH<sub>2</sub>-terminal cytosolic domain of Cx50, L7Q2293761LH-Chr 17<sup>BN</sup>/MavLaboratoire de Physiologie, Lyon Cedex , FranceconsomicUnknownRRID:RGD_2293761Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped2293770SHHF/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanyinbredUnknownRRID:RGD_2293770Initial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breeding2293832LOU.BN-(<i>D6Rat128-D6Rat115</i>)/InsINSERM, Paris, FrancecongenicUnknownRRID:RGD_2293832segment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercross2298494Kini:DA,PVG-G10Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedenadvanced_intercross_lineUnknownRRID:RGD_2298494Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG.1AV1 females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couples2298498W/GaoxDepartment of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, ChinainbredUnknownRRID:RGD_2298498Generated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine University2298772WF<sup>fzHsd</sup>Fuzzy ratTulane University to Skin and Cancer Hospital, Temple University, PhiladelphiamutantCryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-14)RRID:RRRC_00340Sparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987)2299122F344-<i>Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Tasp1<sup>Tn(sb-T2/Bart3)2.219Mcwi</sup>2299101RRID:RGD_2299122These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene.2299123F344-<i>AW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup></i>PhysGenmutantUnknownAW921689<sup>Tn(sb-T2/Bart3)2.209Mcwi</sup>2299108RRID:RGD_2299123this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2299124F344-<i>Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Ubqln4<sup>Tn(sb-T2/Bart3)2.230Mcwi</sup>2299109RRID:RRRC_00350These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene.2299125F344-<i>Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Ccdc85a<sup>Tn(sb-T2/Bart3)2.248Mcwi</sup>2299113RRID:RRRC_00356These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene.2299126F344-<i>Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Kcnip4<sup>Tn(sb-T2/Bart3)2.225Mcwi</sup>2299100RRID:RRRC_00348These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene.2299127F344-<i>Eva1a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Eva1a<sup>Tn(sb-T2/Bart3)2.233Mcwi</sup>2299094RRID:RGD_2299127These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene.2299128F344-<i>Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Lama2<sup>Tn(sb-T2/Bart3)2.2013Mcwi</sup>2299103RRID:RRRC_00432These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene.2299129F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup></i>PhysGen, TransposagenmutantExtinct (as of 2017-01-26)Lrrc4c<sup>Tn(sb-T2/Bart3)2.224Mcwi</sup>2299107RRID:RGD_2299129These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene.2299130F344-<i>Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-13)Ada<sup>Tn(sb-T2/Bart3)2.237Mcwi</sup>2299093RRID:RRRC_00426These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene.2299131F344-<i>Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Grk1<sup>Tn(sb-T2/Bart3)2.234Mcwi</sup>2299115RRID:RRRC_00388These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene.2299132F344-<i>Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Cadm1<sup>Tn(sb-T2/Bart3)2.229Mcwi</sup>2299116RRID:RGD_2299132These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene.2299133F344-<i>Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Rap1gds1<sup>Tn(sb-T2/Bart3)2.251Mcwi</sup>2299098RRID:RRRC_00357These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene.2299134F344-<i>Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Ppapdc1a<sup>Tn(sb-T2/Bart3)2.207Mcwi</sup>2299105RRID:RRRC_00347These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene.2299135F344-<i>Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Mgat4c<sup>Tn(sb-T2/Bart3)2.244Mcwi</sup>2299106RRID:RRRC_00354These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene.2299136F344-<i>Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Snph<sup>Tn(sb-T2/Bart3)2.214Mcwi</sup>2299117RRID:RGD_2299136These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene.2299137F344-<i>Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Erbb4<sup>Tn(sb-T2/Bart3)2.208Mcwi</sup>2299110RRID:RRRC_00383These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene.2299138F344-<i>Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Nrxn2<sup>Tn(sb-T2/Bart3)2.250Mcwi</sup>2299118RRID:RRRC_00449These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene.2299139F344-<i>Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Dnhd1<sup>Tn(sb-T2/Bart3)2.243Mcwi</sup>2299114RRID:RGD_2299139These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene.2299140F344-<i>Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Dcc<sup>Tn(sb-T2/Bart3)2.205Mcwi</sup>2298938RRID:RRRC_00384These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene.2299141F344-<i>Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Ppp2r2b<sup>Tn(sb-T2/Bart3)2.239Mcwi</sup>2299104RRID:RGD_2299141These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene.2299142F344-<i>Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup></i>PhysGen, TransposagenmutantExtinct (as of 2017-01-26)Inpp4b<sup>Tn(sb-T2/Bart3)2.232Mcwi</sup>2299095RRID:RGD_2299142These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene.2299143F344-<i>Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Kif16b<sup>Tn(sb-T2/Bart3)2.200Mcwi</sup>2299111RRID:RRRC_00346These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene.2299144F344-<i>Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Trdn<sup>Tn(sb-T2/Bart3)2.238Mcwi</sup>2299099RRID:RRRC_00368These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene.2299145F344-<i>Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Rprd1a<sup>Tn(sb-T2/Bart3)2.247Mcwi</sup>2299096RRID:RGD_2299145These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene.2299146F344-<i>Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Ptpre<sup>Tn(sb-T2/Bart3)236Mcwi</sup>2299097RRID:RGD_2299146These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene.2299147F344-<i>Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Prr5l<sup>Tn(sb-T2/Bart3)2.228Mcwi</sup>2299112RRID:RRRC_00349These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene.2299148F344-<i>Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Immp1l<sup>Tn(sb-T2/Bart3)2.246Mcwi</sup>2299102RRID:RRRC_00355These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene.2300018SHRSP.ZUC-(<i>D5Rat4-D5Rat36</i>)/IzmDmcrMukogawa Women's University, Nishinomiya, Hyogo JapancongenicLive AnimalsDiabetes Obesity; Cardio HypertensionRRID:RGD_2300018Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm2300195EHC.BN-(<i>D14Rat43-D14Rat132</i>)/KyuKyushu University, Fukuoka, JapancongenicUnknownRRID:RGD_2300195EHC/Seac and BN/Seac were crossed to get F<sub>1</sub> progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenics2300215SHR.BN-(<i>D10Mgh3-D10Rat85</i>)/IpcvInstitute of Physiology, Czech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_2300215Congenic substrain derived from SHR.BN-(<i>D10Mgh3-Srebf1</i>)/Ipcv2300216SHR-Tg(PEPCK-SREBF1)1IpcvInstitute of Physiology, Czech Academy of Sciences, Prague, Czech RepublictransgenicUnknownSREBF169473RRID:RGD_2300216SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal2300217SHR.BN-(<i>D10Mgh3-Srebf1</i>)/IpcvInstitute of Physiology, Czech Academy of Sciences, Prague, Czech RepubliccongenicUnknownSrebf169423RRID:RGD_230021753.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background2301079F344-<i>Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Lrrc7<sup>Tn(sb-T2/Bart3)2.253Mcwi</sup>2301078RRID:RRRC_00360These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7.2301080F344-<i>Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Lrrc4c<sup>Tn(sb-T2/Bart3)2.254Mcwi</sup>2301076RRID:RRRC_00359These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene.2301081F344-<i>Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Mmel1<sup>Tn(sb-T2/Bart3)2.255Mcwi</sup>2301077RRID:RRRC_00358These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1.2301246SS.LEW-(<i>D3Rat61-D3Wox1</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301246A segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.2301247SS.LEW-(<i>D16Got3-D16Rat112</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301247A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Mit2-D16Chm23</i>)/Ayd2301248SS.LEW-(<i>D3Got33-D3Chm68</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301248A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat17</i>)/Ayd2301249SS.LEW-(<i>D18Rat30-D18Chm29</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301249A segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.2301315LE/OrlLong-Evans/CryptorchidCentre Nationale de la Researche Scientifique, Orleans, FranceinbredUnknownRRID:RGD_2301315Obtained from Centre Nationale de la Researche Scientifique, Orleans, France2301330KHInternational Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, OklahomainbredUnknownRRID:RGD_2301330Develped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahoma2301367SHRSP.WKY-(<I>D2Mit5-D2Rat133</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownRRID:RGD_2301367Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment2301368SHRSP.WKY-(<I>D2Wox15-D2Rat133</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownRRID:RGD_2301368Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment2301369SHRSP.WKY-(<I>D2Rat132-D2Rat53</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownRRID:RGD_2301369Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment2301370SHRSP.WKY-(<I>D2Wox9-D2Rat231</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownRRID:RGD_2301370Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment2301371SHRSP.WKY-(<I>D2Mit21-D2Rat157</I>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownGstm1|Vcam1|S1pr12755|3952|61958RRID:RGD_2301371Congenic substrain generated by crossing SHRSP.WKY-(<I>D2Rat13-D2Rat157</I>)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment2301381SS.LEW-(<I>D18Chm41-D18Rat92</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301381SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301382SS.LEW-(<I>D18Chm91-D18Rat67</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301382SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301383SS.LEW-(<I>D18Chm31-D18Rat55</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301383SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301384SS.LEW-(<I>D18Chm41-D18Rat45</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301384SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301385SS.LEW-(<I>D18Rat29-D18Rat55</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301385SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301386SS.LEW-(<I>D18Rat61-D18Rat45</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301386SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301387SS.LEW-(<I>D18Rat67-D18Rat55</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301387SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301388SS.LEW-(<I>D18Chm56-D18Rat55</I>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2301388SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain2301700F344-<i>Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Spata13<sup>Tn(sb-T2/Bart3)2.267Mcwi</sup>2301697RRID:RRRC_00373These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene.2301701F344-<i>Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Ptpra<sup>Tn(sb-T2/Bart3)2.261Mcwi</sup>2301698RRID:RRRC_00370These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene.2301702F344-<i>Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Sf4<sup>Tn(sb-T2/Bart3)2.264Mcwi</sup>2301696RRID:RRRC_00371These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene.2301937BN.GH-(<i>D18Rat41-D18Mgh4</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2301937Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations2301938BN.GH-(<i>D6Mit12-D6Rat15</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2301938Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations2301939BN.GH-(<i>D2Rat22-D2Mgh11</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2301939Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations2301986BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D18Rat41-D18Mgh4</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2301986desired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh background2301987BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2301987desired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh background2301988BN.GH-(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2301988desired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh background2301989BN.GH-(<i>D2Rat22-D2Mgh11</i>)(<i>D6Mit12-D6Rat15</i>)(<i>D18Rat41-D18Mgh4</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2301989desired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh background2302067F344/DuCrlSweSection for Medical Inflammation Research, Biomedical Center, Lund University, SwedeninbredUnknownRRID:RGD_2302067Substrain of Fischer rats maintained at Malmo, Sweden2302080Rhd:F344,GK-G21Section for Medical Inflammation Research, Biomedical Center, Lund University, Swedenadvanced_intercross_lineUnknownRRID:RGD_2302080GK/Swe and F344/Swe were bred to create F<sub>1</sub> generation, couples of F<sub>1</sub> with GK/Swe and F344/Swe females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding random couples which were intercrossed to get further generations2302081DA.E3-(<i>D11Got79-D11Wox5</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_2302081This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers. The region corresponding with he production of RF-Igl ambda antibodies was mapped to a narrower region 'D11Got79-D11Rat50.'2302106SHRSP.WKY-(<I>D1Rat44-D1Arb21</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=485> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2302106SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection2302108SHRSP.WKY-(<I>D1Mgh5-D1Wox29</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=446> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2302108SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection2302109SHRSP.WKY-(<I>D1Mgh5-D1Rat44</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=444> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2302109SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection2302110SHRSP.WKY-(<I>Apbb1-D1Arb21</I>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=488> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionApbb12122RRID:RGD_2302110SHRSP.WKY-(<I>Klk1-D1Rat116</I>)/Izm was backcrossed with SHRSP/Izm, resulting F<sub>1</sub> were intercrossed to obtain F<sub>2</sub> recombinant individuals were selected by marker assisted selection2302132SHRSP-Tg(Tagln-ACE2)6918BdrMax-Delbruck-Center for Molecular Medicine, Berlin-Buch, GermanytransgenicUnknownTagln|ACE23723|1347174RRID:RGD_2302132Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos2302141F344-Tg(Cyp1a1-Ren2)10JmulUniversity of Edinburgh Medical School, Edinburgh, UKtransgenicUnknownCyp1a1|Ren22458|1622375RRID:RGD_2302141Generated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression. The integration site was on Y chromosome as suggested by Southern blot analysis.2302148SHR-Tg(EEF1A1-Cd36)10IpcvCzech Academy of Sciences, Prague, Czech RepublictransgenicUnknownCd362301RRID:RGD_2302148Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter)2302149SHR-Tg(EEF1A1-Cd36)19IpcvCzech Academy of Sciences, Prague, Czech RepublictransgenicUnknownCd362301RRID:RGD_2302149Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter)2302150SHR-Tg(EEF1A1-Cd36)93IpcvCzech Academy of Sciences, Prague, Czech RepublictransgenicUnknownCd362301RRID:RGD_2302150Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter).2302151SHR-Tg(EEF1A1-Cd36)106IpcvCzech Academy of Sciences, Prague, Czech RepublictransgenicUnknownCd362301RRID:RGD_2302151Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector (with human EEF1A1 promoter)2302279F344.SDT-(<i>D3Wox9-D3Arb20</i>)/KbeKobe University School of Medicine, Chuo-ku, Kobe, JapancongenicUnknownRRID:RGD_2302279Female F344/NSlc were crossed with male SDT/CrljJcl, then female F<sub>1</sub> were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markers2302387DA.ACI-(<i>D2Mit12-D2Mgh29</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studiesRRID:RRRC_00667Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsi2302649F344-<i>Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Nsun4<sup>Tn(sb-T2/Bart3)2.286Mcwi</sup>2302645RRID:RRRC_00435These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene.2302650F344-<i>Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Enox1<sup>Tn(sb-T2/Bart3)2.282Mcwi</sup>2302641RRID:RRRC_00470These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene.2302651F344-<i>Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Klra1<sup>Tn(sb-T2/Bart3)2.279Mcwi</sup>2302638RRID:RRRC_00431These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene.2302652F344-<i>Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Pde4d<sup>Tn(sb-T2/Bart3)2.285Mcwi</sup>2302644RRID:RRRC_00436These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene.2302653F344-<i>Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup></i>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Mov10<sup>Tn(sb-T2/Bart3)2.281Mcwi</sup>2302647RRID:RRRC_00377These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene.2302654F344-<i>Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Csmd3<sup>Tn(sb-T2/Bart3)2.288Mcwi</sup>2302637RRID:RRRC_00390These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene.2302655F344-<i>Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Tmtc2<sup>Tn(sb-T2/Bart3)2.276Mcwi</sup>2302646RRID:RRRC_00376These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene.2302656F344-<i>Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Casp7<sup>Tn(sb-T2/Bart3)2.280Mcwi</sup>2302642RRID:RGD_2302656These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene.2302657F344-<i>Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Orc3<sup>Tn(sb-T2/Bart3)2.275Mcwi</sup>2302648RRID:RRRC_00375These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene.2302658F344-<i>Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Bbx<sup>Tn(sb-T2/Bart3)2.291Mcwi</sup>2302640RRID:RRRC_00428These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene.2302659F344-<i>Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Snx25<sup>Tn(sb-T2/Bart3)2.270Mcwi</sup>2302636RRID:RRRC_00374These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene.2302660F344-<i>Nectin1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Nectin1<sup>Tn(sb-T2/Bart3)2.284Mcwi</sup>2302639RRID:RRRC_00378These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1.2302661F344-<i>Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Gramd1b<sup>Tn(sb-T2/Bart3)2.287Mcwi</sup>2302635RRID:RRRC_00389These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene.2302662F344-<i>Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Slc7a11<sup>Tn(sb-T2/Bart3)2.266Mcwi</sup>2302643RRID:RRRC_00372These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene.2302666Scr:sPSardinian alcohol-preferring ratsThe Scripps Research Institute, LaJolla, CaliforniaoutbredUnknownRRID:RGD_2302666sP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding.2302984SS.BN-(<i>D13Rat151-D13Rat197</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302984SS/JrHsdMcwi were crossed with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302985SS.BN-(<i>D13Rat111-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302985SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302986SS.BN-(<i>D13Rat88-D13Rat91</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302986SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302987SS.BN-(<i>D13Rat7-D13Rat60</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302987SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302989SS.BN-(<i>D13Rat57-D13Rat192</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302989SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302994SS.BN-(<i>D13Rat127-D13Rat61</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302994SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302995SS.BN-(<i>D13Rat115-D13Rat101</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302995SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302996SS.BN-(<i>D13Rat7-D13Rat88</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302996SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302997SS.BN-(<i>D13Rat91-D13Got45</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302997SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2302999SS.BN-(<i>D13Rat178-D13Got45</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2302999SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303000SS.BN-(<i>D13Rat123-D13Rat150</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303000SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303001SS.BN-(<i>D13Rat111-D13Rat127</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303001SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303002SS.BN-(<i>D13Rat123-D13Rat197</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303002SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303003SS.BN-(<i>D13Rat7-D13Rat127</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303003SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303004SS.BN-(<i>D13Rat115-D13Rat61</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303004SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303005SS.BN-(<i>D13Rat127-D13Rat77</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303005SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303006SS.BN-(<i>D13Rat101-D13Rat46</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303006SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303007SS.BN-(<i>D13Rat127-D13Rat46</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303007SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303008SS.BN-(<i>D13Rat61-D13GRat197</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303008SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303009SS.BN-(<i>D13Rat183-D13Rat192</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303009SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303010SS.BN-(<i>D13Got51-D13Rat192</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303010SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303011SS.BN-(<i>D13Got51-D13Rat57</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_2303011SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain2303099F344-<i>Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Kcnh7<sup>Tn(sb-T2/Bart3)2.295Mcwi</sup>2303095RRID:RRRC_00430These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene.2303100F344-<i>Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Slc16a12<sup>Tn(sb-T2/Bart3)2.298Mcwi</sup>2303097RRID:RRRC_00438These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene.2303101F344-<i>Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup></i>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Kcnab1<sup>Tn(sb-T2/Bart3)2.300Mcwi</sup>2303094RRID:RRRC_00471These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene.2303102F344-<i>Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Dnah11<sup>Tn(sb-T2/Bart3)2.293Mcwi</sup>2303098RRID:RRRC_00429These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene.2303103F344-<i>Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Pebp4<sup>Tn(sb-T2/Bart3)2.299Mcwi</sup>2303096RRID:RRRC_00455These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene.2303116SPRD.WKY-(<i>D10Rat91-D10Rat135</i>)/IbmmUniversite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, BelgiumcongenicUnknownRRID:RGD_2303116SPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm.2303117SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)(<i>D18Rat102-D18Rat44</i>)/IbmmUniversite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, BelgiumcongenicUnknownRRID:RGD_2303117Double congenic strain generated by intercrossing SPRD.WKY-(<i>D5Rat190-D5Rat114</i>)/Ibmm and SPRD.WKY-(<i>D18Rat102-D18Rat44</i>)/Ibmm; F<sub>1</sub> animals were intercrossed and F<sub>2</sub> screened for heterozygousity by markers2303148SS.SHR-(<i>D9Wox16-D9Rat76</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2303148This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2303149SS.SHR-(<i>D9Wox16-D9Mco73</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2303149This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region.2303150SS.SHR-(<i>D9Mco74-D9Rat64</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2303150This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2303151SS.SHR-(<i>D9Wox16-D9Mco77</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2303151This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2303152SS.SHR-(<i>D9Mco72-D9Mco93</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2303152This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2303153SS.SHR-(<i>D9Rat7-D9Mco93</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2303153This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2303154SS.SHR-(<i>D9Wox16-D9Mco85</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2303154This is a congenic substrain developed by crossing SS.SHR-(<i>D9Wox16-D9Rat64</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2303504LEW/JmsNgscongenital hydrocephalus rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=192 > National BioResource Project for the Rat in Japan</ainbredLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiology; OphthalmologyRRID:RGD_2303504Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding.2303610SD/HsdCwrCase Western Reserve University School of Medicine, Cleveland, OhioinbredUnknownRRID:RGD_2303610derived from SD/Hsd by cousin-cousin mating for more than 20 generations2303611BN/HsdMcwiCwrCase Western Reserve University School of Medicine, Cleveland, OhioinbredUnknownRRID:RGD_2303611derived from BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating2303640WAG/RijCmcrCenter for Medical Countermeasures Against Radiological Terrorism, Medical College of WisconsininbredUnknownRRID:RGD_2303640Substrain of WAG/Rij, separated from the Rijswijk colony in about 1975, now maintained at Medical College of Wisconsin2303739RDW/UmeSlcmutantUnknown (as of 2022-06-09)MetabolismRRID:RGD_2303739From Tohoku University to Slc (1999)2303759WT/Jttwhitish teeth rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=476 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermDentistryRRID:RGD_2303759In 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating.2303761SD-Tg(CAG-EGFP)4OsbGreen rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=559> National BioResource Project for the Rat in Japan</a>transgenicLive AnimalsRRID:RGD_2303761This transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc.2303779OLETF-Chr 14<sup>F344</sup>/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=500 > National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303779Chromosome 14 from F344 is introgressed in OLETF background2303784SHR-Chr 4<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=606> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2303784Chromosome 3 from WKY is introgressed into the genomic background of SHR2303785SHRSP-Chr 3<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=605> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2303785Chromosome 3 from WKY is introgressed into the genomic background of SHRSP2303792WTC.ZI-<i>Atrn<sup>zi</sup></i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=22> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyAtrn<sup><i>zi</i></sup>40902832RRID:RGD_2303792Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University2303793WTC.DMY-<i>dmy</i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=19> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermNeurobiologyRRID:RGD_2303793Congenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University2303971OLETF.F344-(<i>D7Mgh16-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=82> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303971Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.2303972BN-Chr 13<sup>SS</sup>/McwiPhysGenconsomicUnknownRRID:RGD_2303972A cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed2303973OLETF.F344-(<i>D10Wox7-D10Wox6</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=78> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303973Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating.2303976F344-<i>Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Cyp7b1<sup>Tn(sb-T2/Bart3)2.306Mcwi</sup>2303974RRID:RRRC_00472These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene.2303977F344-<i>Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Ano3<sup>Tn(sb-T2/Bart3)2.307Mcwi</sup>2303975RRID:RRRC_00477These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene.2303978F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=83> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303978Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303979F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=84> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303979Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303986WKAH.LEC-<i>Atp7b<sup>hts</sup></i>/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=106> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-11)CancerAtp7b<sup>hts</sup>11532742RRID:RGD_2303986A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.2303987F344.OLETF-(<i>D17Mgh4-Edn1</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=104> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityEdn12532RRID:RGD_2303987Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303988F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D8Rat54-D8Mgh17</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=88> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303988Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303989F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=96> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303989Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303990F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=92> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303990Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303991F344.OLETF-(<i>D7Rat31-D7Rat35</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=103 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303991Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303992F344.OLETF-(<i>D5Mgh29-D5Mgh22</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=102 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303992Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303993OLETF.F344-(<i>D9Mgh8-D9Mit2</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=97 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303993Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.2303994F344.OLETF-(<i>D5Mgh4-D5Rat21</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=95> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303994Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303995F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=90> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303995Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303996F344.Cg-<i>Foxn1<sup>rnu</sup></i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=541> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermImmunology; CancerFoxn13970RRID:RGD_2303996This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University.2303997F344.OLETF-(<i>D7Mgh8-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=86> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303997Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2303998WKAH.LEC-<i>Ptprk<sup>thid</sup></i>/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=107> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCancerPtprk619706RRID:RGD_2303998A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989.2303999F344.OLETF-(<i>D14Rat8-D14Rat26</i>)(<i>D14Rat18-D14Rat22</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=100> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2303999Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304000F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=98 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304000Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304001F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=89> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304001Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304002F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=91> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304002Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304003F344.OLETF-(<i>D16Rat19-D16Rat13</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=101 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304003Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304004F344.OLETF-(<i>D7Mit2-D7Mgh16</i>)(<i>D14Rat23-D14Rat26</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=85> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304004Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304016BUF.ACI-(<i>D4Rat192-D4Rat66</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=165> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2304016This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.2304017F344.CVD-<i>Unc5c<sup>cvd</sup></i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=153> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-05)NeurobiologyUnc5c|Unc5c<sup>cvd</sup>735109|12802355RRID:RGD_2304017CVD ( Cerebellar vermis defect) rat originated from spontanious mutation of LEW inbred at Osaka Prefecture University in 1992. A mutation in Unc5c has been identified in CVD rats. A congenic strain was produced by backcrossing CVD to F344/NSlc strain at Kyoto University.2304018BUF.ACI-(<i>D4Rat226-D4Rat109</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=166> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2304018This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method.2304019BUF.ACI-(<i>D15Rat68-D15Rat29</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=168> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2304019This congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method.2304020ACI.BUF-(<i>D15Rat97-D15Rat29</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=169> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2304020This congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method.2304037DDI/Ddiadokkyo diabetes insipidus rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=282> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermMetabolism; UrologyRRID:RGD_2304037Strain developed at Dokkyo University, School of Medicine, Tochigi, Japan2304038OP/JttOpacitas<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=181> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermOphthalmologyRRID:RGD_2304038Maintained in sib mating between opacitas rats (heterozygoutes) and normal rats.2304039WIC-<i>Tg<sup>rdw</sup></i>/KtsSchool of Medicine, Kitasato UniversitymutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21)MetabolismTg<sup>rdw</sup>12879860RRID:RGD_2304039Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. This strain has a spontaneous missense mutation, G2320R, in the thyroglobul gene.2304040F344.OP-<i>Op</i>/Jtt<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=182> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermOphthalmologyRRID:RGD_2304040Opacitas rats (heterozygtes) are backcorssed with F344/DuCrj.2304041SD-Tg(CAG-Rgn)Slc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=389> National BioResource Project for the Rat in Japan</a>transgenicLive AnimalsOsteosisRgn3560RRID:RGD_2304041Transgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and the rat Rgn gene2304045F344.ZUC-<i>Lepr<sup>fa</sup></i>(<i>D14Rat23-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=392> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304045Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.2304046F344.ZUC-(<i>Lepr<sup>fa</sup></i>)(<i>D7Rat16-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=391> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304046Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating.2304047F344.ZUC-<i>Lepr<sup>fa</sup></i>/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=390> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermDiabetes ObesityLepr|Lepr<sup>fa</sup>3001|13432153RRID:RGD_2304047Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating.2304050F344.OLETF-(<i>D14Rat23-D14Rat55</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=396 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304050Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304051F344.OLETF-(<i>D14Rat8-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=399 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304051Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304052F344.OLETF-(<i>D14Rat55-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=400 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304052Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304053F344.OLETF-(<i>D14Rat23-D14Rat5</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=394 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304053Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304054F344.OLETF-(<i>D14Rat23-D14Rat10</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=397 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304054Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304055F344.OLETF-(<i>D14Wox1-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=404> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304055Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304056F344.OLETF-(<i>D14Rat23-D14Wox14</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=395 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304056Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304057F344.OLETF-(<i>D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=398 > National BioResource Project for the Rat in Japan</acongenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304057Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304058F344.OLETF-(<i>D14Rat143-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=402> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304058Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304059F344.OLETF-(<i>D14Rat5-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=403> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304059Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304060F344.OLETF-(<i>D14Wox14-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=401> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304060Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating.2304061F344.OLETF-(<i>D14Rat23</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=393 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2304061Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating.2304063KDP-Tg(H2Kd-Cblb)2Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=451> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb620535RRID:RGD_2304063Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).2304064KDP-Tg(H2Kd-Cblb)1Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=450> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb620535RRID:RGD_2304064Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).2304065KDP-Tg(INS-Cblb)1Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=452> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb620535RRID:RGD_2304065Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).2304066KDP-Tg(CAG-Cblb)1Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=453> National BioResource Project for the Rat in Japan</a>transgenicUnknownCblb620535RRID:RGD_2304066Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).2304074WKY.BUF-<i>Tsr1d</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=465> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCancerRRID:RGD_2304074This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred.2304075ACI.BUF-<i>Pur1</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=467> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoUrologyRRID:RGD_2304075This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred.2304076WKY.BUF-<i>Thym1, Thym2</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=464> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo (as of 2018-03-14)CancerRRID:RGD_2304076This double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (Thym1) (on chr.1) and Ten2 (Thym2)(on chr. 13) has been transferred.2304077WKY.BUF-<i>Pur1s</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=462> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoUrologyRRID:RGD_2304077This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.2304078ACI.BUF-<i>Ten1</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=468> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoRRID:RGD_2304078This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.2304079WKY.BUF-<i>Ten1</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=471> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoRRID:RGD_2304079This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred.2304080ACI.BUF-<i>Aftm1</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=469> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermRRID:RGD_2304080This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.2304081WKY.BUF-<i>Pur1w</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=463> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoUrologyRRID:RGD_2304081This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred.2304082WKY.BUF-<i>Ten2</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=466> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoUrologyRRID:RGD_2304082This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.2304083ACI.BUF-<i>Ten2</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=470> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoRRID:RGD_2304083This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred.2304093SHRSP.WKY-(<i>D1Rat106-D1Arb21</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=484 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304093Developed by the depositor2304094SHRSP.WKY-(<i>D1Smu12-D1Rat44</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=447 > National BioResource Project for the Rat in Japan</a>congenicUnknownCardio HypertensionRRID:RGD_2304094This is a congenic strain developed by the depositor.2304095W-Tg(Plcb2-WGA-EGFP)F1Abek<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=455 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoRRID:RGD_2304095This is a transgenic strain developed by the depositor.2304096SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/1Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=486 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304096Developed by the depositor2304097SHRSP.WKY-(<i>D1Rat49-D1Arb21</i>)/2Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=448> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304097This is a congenic strain developed by the depositor.2304098SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=487 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304098Developed by the depositor2304099SHRSP.WKY-(<i>D1Smu12-D1Arb21</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=482 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304099This is a congenic strain developed by the depositor.2304100SHRSP.WKY-(<i>D1Rat39-D1Arb21</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=481 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304100This is a congenic strain developed by the depositor.2304101SHRSP.WKY-(<i>D1Rat43-D1Arb21</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=483 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304101This is a congenic strain developed by the depositor.2304102SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=445> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2304102This is a congenic strain developed by the depositor.2304104W-Tg(Plcb2-WGA-EGFP)M1Abek<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=456> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoRRID:RGD_2304104This is a transgenic strain developed by the depositor.2304120SHRSP/2Ta<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=417> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_2304120Kyo > Ta (1972)2304121DA.WF-(<i>D1Mit1-D1Mit3</i>)/Kop<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=522> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCancerRRID:RGD_2304121This congenic strain in the DA background by introgressing a segment from WF2304122DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)/Kop<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=523> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCancerRRID:RGD_2304122This congenic strain in the DA background by introgressing a segment from WF2304123DA.WF-(<i>D4Mit11-Nos3</i>)/Kop<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=524> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCancerNos33186RRID:RGD_2304123This congenic strain in the DA background by introgressing a segment from WF2304124DA.WF-(<i>D1Mgh21-D1Mgh10</i>)(<i>D4Mit11-Nos3</i>)(<i>D1Mit1-D1Mit3</i>)/Kop<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=520> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCancerRRID:RGD_2304124This congenic strain in the DA background by introgressing a segment from WF2304125DRH.F344-(<i>D1Mgh8-D1Mgh12</i>)/Shigm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=492> National BioResource Project for the Rat in Japan</a>, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, JapancongenicCryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; CancerRRID:RGD_2304125desired fragment from F344 was introgressed into DRH background2304200W-Tg(CAG-ABO*A)32Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=535 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoHematologyAbo3628609RRID:RGD_2304200This transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.2304201F344-<i>Galntl6<sup>Tn(sb-T2/Bart3)2.311McwiRrrc</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Galntl6<sup>Tn(sb-T2/Bart3)2.311Mcwi</sup>2304194RRID:RRRC_00450These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene.2304202F344-<i>RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup></i>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)RGD1565323<sup>Tn(sb-T2/Bart3)2.312Mcwi</sup>2304193RRID:RRRC_00437These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323.2304203W-Tg(CAG-DsRed2/GFP)1Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=532> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDevelopmentRRID:RGD_2304203DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.2304204W-Tg(CAG-ABO*B)13Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=527> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoHematologyAbo3628609RRID:RGD_2304204This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.2304205W-Tg(Alb-DsRed2)34Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=528> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermDevelopmentRRID:RGD_2304205This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.2304206W-Tg(CAG-DsRed2/GFP)15Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=533> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=300>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermDevelopmentRRID:RRRC_00300DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School.2304207F344-<i>Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Lzic<sup>Tn(sb-T2/Bart3)2.309Mcwi</sup>2304196RRID:RRRC_00434These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene.2304208F344-<i>Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Rapgef4<sup>Tn(sb-T2/Bart3)2.314Mcwi</sup>2304197RRID:RRRC_00479These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene.2304209F344-<i>Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Rorb<sup>Tn(sb-T2/Bart3)2.304Mcwi</sup>2304199RRID:RGD_2304209These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene.2304210W-Tg(Alb-DsRed2)42Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=529> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=260>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermDevelopmentRRID:RRRC_00260This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School.2304211W-Tg(CAG-cre)81Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=534> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=301>Rat Resource and Research Center</a>transgenicLive Animals; Cryopreserved Embryo (as of 2018-07-16)DevelopmentRRID:RRRC_00301This strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School.2304212F344-<i>RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)RGD1563503<sup>Tn(sb-T2/Bart3)2.313Mcwi</sup>2304198RRID:RRRC_00453These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503.2304213F344-<i>P3h3<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)P3h3<sup>Tn(sb-T2/Bart3)2.310Mcwi</sup>2304195RRID:RRRC_00433These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene.2304214W-Tg(CAG-ABO*B)2Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=526 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoHematologyAbo3628609RRID:RGD_2304214This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School.2304215F344-Tg(XPO1)1Hik<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=575> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermCancer; InfectiousRRID:RGD_2304215F344/DuCrj Tg rat inoculated with human crm1 genome (BAC)2304221WTC-<i>swh</i>/KyoKyoto UniversitymutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-11)DermatologyEdaradd<sup><i>swhKyo</i></sup>14398765RRID:RGD_2304221The rat showed abnormal hair texture and mammary gland hypoplasia which occurred in the WTC.ZI-<i>Atrn<sup>zi</sup></i> colony at the National Cancer Center Research Institute in 1998. After elimination of <i>zi</i> allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. In 2011, Kuramoto et al. (RGD:14398762) identified a missense mutation in the Edaradd gene.2304222WIAR/IarInbred Wistar-Imamichi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=536> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21)Metabolism; DevelopmentRRID:RGD_2304222Strain developed by the depositor. This strain was established by inbreeding of Wistar-Imamichi rats by sib-mating. Strain characteristic is same as that of Wistar-Imamichi. (Nov 6, 2009)2304241F344-Tg(CXCR4)1Hik<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=560> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermInfectiousCXCR4732176RRID:RGD_2304241Transgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj.2304242WTC-<i>Kcnq1<sup>dfk</sup></i>Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=548> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2017-04-05)Otorhinology; Internal OrganKcnq1|Kcnq1<sup>dfk</sup>621503|12802344RRID:RGD_2304242Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-<i>Kcnq1<sup>dfk</sup></i>/Kyo rat is a mutant for circling behavior. although the Atrn<sup>zi</sup> allele of WTC.ZI-<i>Atrn<sup>zi</sup></i> congenic rats was eliminated, the circling behavior remained.2304277SHRSP.WKY-(<i>D1Rat36-D1Rat106</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=619> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304277Developed by the DEPOSITOR2304278DA-Tg(Alb-HSVtk)5Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=651> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDevelopmentRRID:RGD_2304278This strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in these transgenic rats causes hepatitis.2304279W-Tg(MT2A-Myc)1Ys<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=699> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoReproduction; DevelopmentMyc3130RRID:RGD_2304279This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).2304280SHR/Shi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=666> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_2304280Developed by the DEPOSITOR2304281SERC/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=657> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiologyRRID:RGD_2304281Developed by the DEPOSITOR2304282IEW/Ihr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=733> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoNeurobiology; OphthalmologyRRID:RGD_2304282mutant of Ihara epileptic rat.2304283SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=614> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304283Developed by the DEPOSITOR2304284SHRSP.WKY-(<i>D1Mgh5-D1Rat116</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=609> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304284Developed by the DEPOSITOR2304285BDIX/NemOda<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=579> National BioResource Project for the Rat in Japan</a>inbredUnknownCancerRRID:RGD_2304285This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992.2304286DMYC/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=624> National BioResource Project for the Rat in Japan</a>coisogenicCryopreserved SpermRRID:RGD_2304286Developed by the DEPOSITOR2304287ACI.F344-(<i>D16Rat17-D16Rat15</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=621> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCancerRRID:RGD_2304287F344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain.2304288ACI.BUF-(<i>D20Img2-D20Rat5</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=595> National BioResource Project for the Rat in Japan</a>congenicUnknownCancerRRID:RGD_2304288Developed by the DEPOSITOR2304289SHRSP.WKY-(<i>D1Mgh5-D1Rat349</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=617> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304289Developed by the DEPOSITOR2304290BUF.ACI-(<i>D20Img2-D20Rat5</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=594> National BioResource Project for the Rat in Japan</a>congenicUnknownCancerRRID:RGD_2304290Developed by the DEPOSITOR2304291LEW-Tg(CAG-EGFP)1Ys<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=647> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermDevelopmentRRID:RGD_2304291This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.2304292LEW-Tg((ROSA)26Sor-luc)21Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=650> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo (as of 2017-08-08)DevelopmentRRID:RGD_2304292This strain expresses luciferase ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.2304293F344.LEC-<i>xhs1</i>/1Nrs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=592> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2304293LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay2304294MPOD/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=622> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermCancer; ImmunologyRRID:RGD_2304294Myeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait.2304295SHRSP.WKY-(<i>Igf1r-D1Rat36</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=616> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionIgf1r2869RRID:RGD_2304295Developed by the DEPOSITOR2304296KB/Oda<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=581> National BioResource Project for the Rat in Japan</a>segregating_inbredCryopreserved EmbryoRRID:RGD_2304296Maintained by crossing heterozygotes of the albino locus (segregating inbred strain).2304297TM.KDP-<i>Cblb</i>/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=608> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; ImmunologyCblb620535RRID:RGD_2304297Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain).2304298SD-Tg(Tuba1a-EYFP)Okn<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=603> National BioResource Project for the Rat in Japan</a>transgenicUnknownRRID:RGD_2304298This strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter.2304299LEW-Tg(Alb-GFP)6Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=652> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDevelopmentRRID:RGD_2304299This strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School.2304300W-Tg(S100b-EGFP)Scell<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=673> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermNeurobiology; MetabolismRRID:RGD_2304300Developed by microinjecting the transgene into Wistar rats2304301SHRSP.WKY-(<i>Slco3a1-D1Rat106</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=618> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionSlco3a1620227RRID:RGD_2304301Developed by the DEPOSITOR2304302SHRSP.WKY-(<i>D1Rat44-D1Arb21</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=612> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304302Developed by the DEPOSITOR2304303W-Tg(MT2A-Myc)2Ys<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=698> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoReproduction; DevelopmentMyc3130RRID:RGD_2304303This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.).2304304SHRSP.WKY-(<i>D1Rat209-D1Arb21</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=613> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304304Developed by the DEPOSITOR2304305DOB/Oda<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=582> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoRRID:RGD_2304305This strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000.2304306BUF.ACI-(<i>D20Img2-Cdkn1a</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=599> National BioResource Project for the Rat in Japan</a>congenicUnknownCancerCdkn1a69328RRID:RGD_2304306Developed by the DEPOSITOR2304307ACI.BUF-(<i>D20Img2-Cdkn1a</i>)/Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=598> National BioResource Project for the Rat in Japan</a>congenicUnknownCancerCdkn1a69328RRID:RGD_2304307Developed by the DEPOSITOR2304308ICR/Ihr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=731> National BioResource Project for the Rat in Japan</a>inbredLive Animals (as of 2019-08-05)Neurobiology; OphthalmologyRRID:RGD_2304308A new rat strain has been developed, in which a spontaneous cataract occurs without exception at 3-4 months after birth and matures completely at 4-6 months of age, indicating that this strain possesses a maturity-onset cataract.2304309SHRSP.WKY-(<i>D1Mgh5-D1Rat106</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=611> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304309Developed by the DEPOSITOR2304310SD-Tg(Nes/Hspa1b-EGFP)Okn<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=602> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermNeurobiologyRRID:RGD_2304310This strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter.2304311LEW-Tg((ROSA)26Sor-lacZ)44JmskRrrc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=648> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=298>Rat Resource and Research Center</a>transgenicCryopreserved Embryo (as of 2017-08-08)DevelopmentRRID:RRRC_00298This strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School.2304312SHRSP.WKY-(<i>D1Mgh5-D1Rat36</i>)(<i>D1Rat44-D1Arb21</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=610> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304312Developed by the DEPOSITOR2304313SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=615> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2304313Developed by the DEPOSITOR2304314BDIX.Cg-<i>Tal</i>/NemOda<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=607> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermOsteosisRRID:RGD_2304314Mating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain).2304315SHRSP.WKY-(<i>Calca-D1Arb21</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=620> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionCalca2254RRID:RGD_2304315Developed by the DEPOSITOR2304316F344.LEC-<i>xhs1</i>/2Nrs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=593> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2304316LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay2304329WKY/Ezo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=568> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoCardio HypertensionRRID:RGD_2304329Deposited by the DEPOSITOR2304330SD-Tg(HRAS)128Ncc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=668> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2021-04-30)CancerRRID:RGD_2304330This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region.2304331F344-Tg(CCR5)1Hik<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=674> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermInfectiousRRID:RGD_2304331Deposited by the DEPOSITOR2304332HER/Wkmt<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=697> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsNeurobiologyRRID:RGD_2304332Developed by the DEPOSITOR2305934F344-<i>Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Spta1<sup>Tn(sb-T2/Bart3)2.315Mcwi</sup>2305932RRID:RRRC_00439These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene.2305935F344-<i>Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Rtn4<sup>Tn(sb-T2/Bart3)2.316Mcwi</sup>2305933RRID:RRRC_00476These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene.2305939SHRSP.WKY-(<i>D9Mit6-D9Rat83</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=690> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305939Developed by the DEPOSITOR2305940SHRSP-Chr 7<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=688> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305940Chromosome 7 from WKY is introgressed into the genomic background of SHRSP2305941SHR-Chr 15<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=695> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305941Chromosome 15 from WKY is introgressed into the genomic background of SHR2305942SHR-Chr 3<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=694> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305942Chromosome 3 from WKY is introgressed into the genomic background of SHR2305943SHRSP-Chr 15<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=692> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305943Chromosome 15 from WKY is introgressed into the genomic background of SHRSP2305944SHRSP-Chr 4<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=687> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305944Chromosome 4 from WKY is introgressed into the genomic background of SHRSP2305945SHRSP-Chr 13<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=691> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305945Chromosome 13 from WKY is introgressed into the genomic background of SHRSP2305946SHR-Chr 1<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=693> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305946Chromosome 1 from WKY is introgressed into the genomic background of SHR2305947SHR-Chr 19<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=696> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305947Chromosome 19 from WKY is introgressed into the genomic background of SHR2305948SHRSP.WKY-(<i>D8Rat77-D8Rat16</i>)(<i>D8Tkyo10</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=689> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305948Developed by the DEPOSITOR2305949SHRSP-Chr 1<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=686> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2305949Chromosome 1 from WKY is introgressed into the genomic background of SHRSP2305966SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=864> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved SpermDiabetes ObesityRRID:RGD_2305966Developed by the DEPOSITOR2305967SHR.SHRSP-(<i>D18Rat73-D18Rat11</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=866> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved SpermDiabetes ObesityRRID:RGD_2305967Developed by the DEPOSITOR2305968SHRSP.WKY-(<i>D1Wox18-D1Rat39</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=862> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_2305968Developed by the DEPOSITOR2305969SHRSP.WKY-(<i>D1Mgh5-D1Rat178</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=861> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_2305969Developed by the DEPOSITOR2305970DA-Tg(Alb-TTR*V30M)7Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=703> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDevelopmentRRID:RGD_2305970This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.2305971SHRSP.SHR-(<i>D18Rat73-D18Rat11</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=865> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved SpermDiabetes ObesityRRID:RGD_2305971Developed by the DEPOSITOR2305972WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)(<i>Bcl2-D13Mgh7</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=838> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305972Developed by the DEPOSITOR2305973SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=863> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved SpermDiabetes ObesityRRID:RGD_2305973Developed by the DEPOSITOR2305974WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>D9Mit6-D9Wox4</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=858> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305974Developed by the DEPOSITOR2305975SHRSP.WKY-(<i>D1Mgh5-D1Wox18</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=860> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_2305975Developed by the DEPOSITOR2305976DA-Tg(Alb-TTR*V30M)9Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=705> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=339>Rat Resource & Research Center</a>transgenicCryopreserved EmbryoDevelopmentRRID:RRRC_00339This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School.2305977ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=702> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2305977F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals.2305978LEW-Tg((ROSA)26Sor-DsRed*)7Jmsk<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=706> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo (as of 2017-08-08)DevelopmentRRID:RGD_2305978This strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School.2305979WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)(<i>Bcl2-D13Mgh7</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=859> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305979Developed by the DEPOSITOR2305987F344.OLETF-(<i>D7Mgh16-D7Wox46</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=844> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305987Developed by the DEPOSITOR2305988(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=841> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305988Developed by the DEPOSITOR2305989(F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj x F344.Z-Lepr<sup><i>fa</i></sup>/Tj</i>)F1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=842> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305989Developed by the DEPOSITOR2305990F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=836> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305990Developed by the DEPOSITOR2305991(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)/Tj X F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=839> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305991Developed by the DEPOSITOR2305992F344.OLETF-(<i>D7Mit16-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=820> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305992Developed by the DEPOSITOR2305993F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=834> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305993Developed by the DEPOSITOR2305994F344.OLETF-(<i>D14Rat23-D14Rat23</i>)(<i>D14Rat8-D14Rat12</i>)/1Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=835> National BioResource Project for the Rat in Japan</a>congenicUnknownDiabetes ObesityRRID:RGD_2305994Developed by the DEPOSITOR2305995F344.OLETF-(<i>D7Got130-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=837> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305995Developed by the DEPOSITOR2305996F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Rat18-D7Mit2</i>)(<i>D14Rat23-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=843> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305996Developed by the DEPOSITOR2305997(F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>)/2Tj x F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj)F1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=840> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305997Developed by the DEPOSITOR2305998F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D8Rat54-D8Mgh17</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=809> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305998Developed by the DEPOSITOR2305999F344.OLETF-(<i>D7Mgh16-D7Rat70</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=830> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2305999Developed by the DEPOSITOR2306000F344.OLETF-(<i>D7Rat70-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=831> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306000Developed by the DEPOSITOR2306001F344.OLETF-(<i>D7Rat176-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=832> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306001Developed by the DEPOSITOR2306002F344.OLETF-(<i>D14Rat23</i>)(<i>D14Rat12</i>)/1Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=833> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306002Developed by the DEPOSITOR2306003F344.OLETF-(<i>D7Wox46-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=845> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306003Developed by the DEPOSITOR2306004F344.OLETF-(<i>D7Mgh16-D7Mit16</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=821> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306004Developed by the DEPOSITOR2306013F344.OLETF-(<i>D14Rat8-D14Rat26</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=853> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306013Developed by the DEPOSITOR2306014F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=848> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306014Developed by the DEPOSITOR2306015F344.OLETF-(<i>D12Wox5-D12Rat21</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=852> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306015Developed by the DEPOSITOR2306016F344.OLETF-(<i>D11Mgh4-D11Mgh1</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=849> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306016Developed by the DEPOSITOR2306017(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D14Rat23-D14Rat12</i>))F1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=856> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306017Developed by the DEPOSITOR2306018F344.OLETF-(<i>D9Mgh8-D9Mit2</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=851> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306018Developed by the DEPOSITOR2306019F344.OLETF-(<i>D1Mit20-D1Mgh26</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=850> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306019Developed by the DEPOSITOR2306020(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat23-D14Rat12</i>))F1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=857> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306020Developed by the DEPOSITOR2306021SHR-Chr 2<sup>WKY</sup>/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=713> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes Obesity; Cardio HypertensionRRID:RGD_2306021Developed by the DEPOSITOR2306022KCI/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=630> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiologyPcdh151590969RRID:RGD_2306022Rats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003.2306023F344-Tg(CCNT1)1Hik<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=712> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermInfectiousCCNT11322457RRID:RGD_2306023Developed by the DEPOSITOR2306024FOK/NcuFuruyama rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=759> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RGD_2306024These are resistant to hot environment.2306025WMN/Nrs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=675> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoCancer; MetabolismRRID:RGD_2306025Developed by the DEPOSITOR2306026F344.OLETF-(<i>D16Wox4-D16Rat13</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=854> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306026Developed by the DEPOSITOR2306027WM/Nrs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=676> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoCancer; MetabolismRRID:RGD_2306027Developed by the DEPOSITOR2306028F344.OLETF-(<i>D14Rat23-D14Rat12</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=847> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306028Developed by the DEPOSITOR2306029(F344.OLETF-(<i>D8Rat54-D8Mgh17</i>)/2Tj x F344.Cg-Lepr<sup><i>fa</i></sup>(<i>D7Mgh16-D7Mgh20</i>))F1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=855> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306029Developed by the DEPOSITOR2306030F344.OLETF-(<i>D7Mgh16-D7Mgh20</i>)(<i>D14Rat8-D14Rat26</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=846> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2306030Developed by the DEPOSITOR2306033SHR.Cg-<i>Lepr<sup>cp</sup></i>/NDmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=734> National BioResource Project for the Rat in Japan</a>congenicLive AnimalsDiabetes Obesity; Cardio HypertensionLepr<sup>cp</sup>11570565RRID:RGD_2306033Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999.2306034NER.F344-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Rat100-D5Rat234</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=729> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermNeurobiologyRRID:RGD_2306034Developed by the DEPOSITOR2306035F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=727> National BioResource Project for the Rat in Japan</a>congenicLive AnimalsNeurobiologyRRID:RGD_2306035This double congenic strain was established by crossing F344.NER-(<i>D1Mgh6-D1Rat73</i>)/Kyo and F344.NER-(<i>D5Mgh4-D5Rat36</i>)/Kyo2306036F344-<i>Apc<sup>m1</i>Kyo</sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=714> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2017-03-14)CancerApc|Apc<sup>m1Kyo</sup>2123|12792252RRID:RGD_2306036F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven).2306037F344-Tg(CD4)1Hik<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=700> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermInfectiousRRID:RGD_2306037Developed by the DEPOSITOR2306041F344-<i>Scn1a<sup>m2Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=715> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiologyScn1a<sup>m2Kyo</sup>12792284RRID:RGD_2306041Established by ENU mutagenesis. A point mutation in Scn1a gene.2306042F344-<i>Scn1a<sup>m1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=716> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2017-05-04)NeurobiologyScn1a<sup>m1Kyo</sup>12792283RRID:RGD_2306042Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model.2306043SHR/4Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=566> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd362301RRID:RGD_2306043Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure2306044SHRSP/3Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=567> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd362301RRID:RGD_2306044Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line2306045SHR/2Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=564> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd362301RRID:RGD_2306045Developed by the DEPOSITOR, one of the SHR substrains from B2 line2306046W-Tg(CAG-EGFP)3Ys<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=741> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved EmbryoRRID:RGD_2306046This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter.2306047W-Tg(Gnrh1-EGFP)Nphy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=704> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermGnrh12720RRID:RGD_2306047This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence.2306048SHR/3Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=565> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd362301RRID:RGD_2306048Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure2306049SHRSP/4Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=736> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd362301RRID:RGD_2306049Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis2306050SHRSP/5Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=737> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd362301RRID:RGD_2306050Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis2306051SHRSP/2Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=563> National BioResource Project for the Rat in Japan</a>inbredLive AnimalsCardio HypertensionCd362301RRID:RGD_2306051Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line2306058LEC.W-Tg(CAG-Zfml)30Ncms/Ncms<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=782> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306058Developed by the DEPOSITOR2306059DA.Cg-<i>Foxn1<sup>rnu</sup> Lyst<sup>bg</sup></i>/Slc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=760> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermImmunology; HematologyFoxn1|Lyst3970|621837RRID:RGD_2306059Developed by the DEPOSITOR2306060LEC.W-Tg(CAG-Zfml)26Ncms/Ncms<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=781> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306060Developed by the DEPOSITOR2306061ACI.BUF-<i>Pur1, Thym2</i>/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=739> National BioResource Project for the Rat in Japan</a>congenicUnknownMetabolismRRID:RGD_2306061The proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (Thym2) (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002.2306062W-Tg(Per1-luc)1Oa<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=740> National BioResource Project for the Rat in Japan</a>, <a href=http://www.rrrc.us/Strain/?x=273>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00273Developed by the DEPOSITOR2306063LEC.W-Tg(CAG-Zfml)21Ncms/Ncms<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=738> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306063Developed by the DEPOSITOR2306064MPR/Iar<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=745> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermMetabolism; OsteosisArsb|Arsb<sup>MPR</sup>2158|12792967RRID:RGD_2306064Developed by the DEPOSITOR2306070WIC-Tg(Wap-GH1)1Mni<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=789> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-04-21)Diabetes Obesity; MetabolismRRID:RGD_2306070Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491).2306071F344-Tg(CAG-EGFP)Ncco<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=576> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermDiabetes Obesity; Cancer; MetabolismRRID:RGD_2306071Transgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method2306072ACI.F344-(<i>D16Nkg74</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=768> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2306072A sub congenic strain of ACI/N.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg2306073WIC-Tg(Wap-GH1)2Mni<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=788> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-04-21)Diabetes Obesity; MetabolismRRID:RGD_2306073Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491).2306076ACI.F344-(<i>D16Nkg9-D16Nkg38</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=793> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2306076This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals.2306077ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=791> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2306077This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating.2306078KFRS4A/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=801> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiology; BehaviorRRID:RGD_2306078Developed by the DEPOSITOR2306079ACI.F344-(<i>D16Nkg87-D16Nkg105</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=792> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCancerRRID:RGD_2306079This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat64-D16Nkg105</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals.2306085TCR/IbuToyoda Circling Rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=800> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiology; BehaviorRRID:RGD_2306085A male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007.2306089ACI.BUF-(<i>D7Wox16-D7Rat69</i>)/Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=803> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCancerRRID:RGD_2306089The thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing.2306090ExHC/TaExogenously hypercholesterolemic rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=804> National BioResource Project for the Rat in Japan</a>inbredLive Animals (as of 2017-04-19)MetabolismRRID:RGD_2306090Developed by the DEPOSITOR2306098ACI.F344-(<i>D16Nkg30-D16Mgh6</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=828> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306098This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.2306099SHR.WKY-(<i>D15Tkyo3-D15Rat68</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=807> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306099This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306100SHR.WKY-(<i>D3Tkyo7-D3Rat1</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=815> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306100This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306101LEC.BN-(<i>D4Mgh16-D4Rat233</i>)/Hkv<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=875> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306101Developed by the DEPOSITOR2306102BN.LEC-(<i>D4Rat128-D4Rat106</i>)/Hkv<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=879> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306102Developed by the DEPOSITOR2306103SHRSP/Sums<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=873> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_2306103Developed by the DEPOSITOR2306104BN.LEC-(<i>D4Rat184-D4Rat238</i>)/Hkv<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=878> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306104Developed by the DEPOSITOR2306105BN.LEC-(<i>D4Rat128-D4Rat238</i>)/Hkv<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=877> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306105Developed by the DEPOSITOR2306106CLX/TaCircling behavior linked to the X-chromosome (CLX)<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=813> National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoBehaviorRRID:RGD_2306106Developed by the DEPOSITOR2306107SD-Tg(Sp6)58Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=868> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-08-22)Dentistry; DevelopmentSp61306768RRID:RGD_2306107The transgenic construct carrying rat Sp6 coding region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.2306108SHR.WKY-(<i>D3Mit9-D3Wox16</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=814> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306108This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306109SHR.WKY-(<i>D3Mgh6-D3Rat1</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=817> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306109This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306110IER/Sums<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=870> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoNeurobiologyRRID:RGD_2306110Developed by the DEPOSITOR2306111LEC.BN-(<i>D4Mgh16-D4Rat233</i>)(<i>D4Rat271-D4Rat238</i>)/Hkv<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=876> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306111Developed by the DEPOSITOR2306112ZDF-<i>Lepr<sup>fa</i>CrlCrlj</sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=778> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved EmbryoDiabetes ObesityLepr3001RRID:RGD_2306112Developed by the DEPOSITOR2306113SD-Tg(Sp6)6Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=867> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermDentistry; DevelopmentSp61306768RRID:RGD_2306113Developed by the DEPOSITOR2306114SHR.WKY-(<i>D3Mgh16-D3Rat110</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=806> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306114This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306115SHR.WKY-(<i>D3Mgh16-D3Rat166</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=816> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306115This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306116SD-Tg(Sp6)5Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=819> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermDentistry; DevelopmentSp61306768RRID:RGD_2306116The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima.2306117ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=827> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2306117This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals.2306118SHR.WKY-(<i>D15Rat95-D15Rat106</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=808> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306118This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306119F344-Tg(CD4,CCNT1)1Hik<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=805> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermInfectiousRRID:RGD_2306119Developed by the DEPOSITOR2306120SHR.WKY-(<i>D4Wox27-D4Rat15</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=818> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes Obesity; Cardio HypertensionRRID:RGD_2306120This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005.2306276F344-<i>Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Exoc4<sup>Tn(sb-T2/Bart3)2.317Mcwi</sup>2306273RRID:RRRC_00456These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene.2306277F344-<i>Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Gng12<sup>Tn(sb-T2/Bart3)2.320Mcwi</sup>2306274RRID:RRRC_00454These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene.2306278F344-AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>PhysGenmutantCryopreserved Sperm (as of 2017-01-31)AW915325<sup>Tn(sb-T2/Bart3)2.319Mcwi</sup>2306272RRID:RRRC_00448These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325.2306279F344-<i>Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Diaph3<sup>Tn(sb-T2/Bart3)2.318Mcwi</sup>2306275RRID:RRRC_00446These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene.2306529BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306529Parental strain BBDR.BBDP-(<I>D4Rhw17-ss99306861</i>)(<I>D4Rhw11-D4Rhw10</I>)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenic2306532BBDR.F344-(<i>D4Rat27-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306532Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA2306533BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/2RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RRRC_00469Congenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw2306534BBDR.F344-(<i>D4Rat102-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306534Congenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw2306535BBDR.F344-(<i>D4Rat253-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306535Congenic substrains identified in F2 crosses of BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR/Rhw with BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw2306536BBDR.F344-(<i>D4Arb11-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306536Congenic substrains generated by intercrossing male BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/Rhw and female BBDR/Rhw2306537BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/1RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306537Congenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw2306538BBDR.F344-(<i>D4Rat153-D4Rat27</i>),BBDP-(<i>D4Rhw11-D4Rhw10</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306538Congenic substrains generated by intercrossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw and BBDR.BBDP-(<I>D4Rhw11-D4Rhw10</I>)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutation2306539BBDR.F344-(<i>D4Rat102-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/3RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306539Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA2306540BBDR.F344-(<i>D4Got33-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306540Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA2306541BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RRRC_00457BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed2306542BBDR.F344-(<i>D4Rat253-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306542Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA2306543BBDR.F344-(<i>D4Got59-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306543BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed2306544BBDR.F344-(<i>D4Rat26-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306544Congenic substrains developed by crossing BBDR.F344-(<i>D4Rat153-D4Rhw8</i>),BBDP-(<i>D4Rhw6-D4Rat62</i>)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA2306709BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/3RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306709This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.2306710F344-<i>Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Lmln<sup>Tn(sb-T2/Bart3)2.322Mcwi</sup>2306701RRID:RRRC_00447These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene.2306711F344-<i>FM117003<sup>Tn(sb-T2/Bart3)2.321McwiRrrc</sup></i>PhysGenmutantCryopreserved SpermFM117003<sup>Tn(sb-T2/Bart3)2.321Mcwi</sup>2306703RRID:RRRC_00475this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb2306712BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/2RhwDepartment of Medicine, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_2306712This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene.2306717BBDP/WorSunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadainbredCryopreserved Sperm; Cryorecovery (as of 2018-11-12)RRID:RRRC_00787These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada.2306784Kini:DA,PVG-G12Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Swedenadvanced_intercross_lineUnknownRRID:RGD_2306784Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1<sup>a</sup> MHC haplotype were bred to create F<sub>1</sub> generation, 7 couples of F<sub>1</sub> with DA/Han and PVG/OlaHsd females founders generated F<sub>2</sub>. F<sub>3</sub> generation originated from breeding 50 random couples2306815SS.SR-(<I>D7Rat67-D7Mco7</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2306815Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped2306816SS.SR-(<I>D7Mco19-D7Mco7</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2306816Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped2306817SS.SR-(<I>D7Uia1-D7Mco19</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2306817Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped2306818SS.SR-(<I>D7Rat131-D7Mco7</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2306818Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped2306819SS.SR-(<I>D7Uia1-D7Rat131</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2306819Congenic substrain developed by crossing SS.SR-(<I>D7Uia1-D7Mco7</I>)/Jr to SS/Jr to produce F<sub>1</sub> which were intercrossed and genotyped2306820SS.SR-(<i>D3Arb14-D3Mco36</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2306820SS.SR-(<i>D3Mco19-D3Mco5</i>)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome2306823SS.SR-(<i>D3Arb14-D3Mco36</i>)(<i>D7Mco19-D7Mco7</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2306823SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco were crossed with SS.SR-(<i>D7Mco19-D7Mco7</i>)/Jr and then F<sub>1</sub> rats were backcrossed with SS.SR-(<i>D3Arb14-D3Mco36</i>)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bred2306840E3.DA-(<i>D4Wox22-D4Got132</i>)(<i>D12Wox5-D12Rat26</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_2306840This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers2306841E3.DA-(<i>D12Wox5-D12Rat26</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_2306841This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers2306842E3.DA-(<i>D20Rat45-D20Rat47</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_2306842This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers2306874F344-<i>Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Intu<sup>Tn(sb-T2/Bart3)2.324Mcwi</sup>2306873RRID:RRRC_00441These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene.2306875F344-<i>Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Faslg<sup>Tn(sb-T2/Bart3)2.325Mcwi</sup>2306872RRID:RGD_2306875These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene.2306892SHR.BN-(<i>D2Rat114-D2Rat123</i>)/JkHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil.congenicUnknownRRID:RGD_2306892Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals2306893SHR.BN-(<i>D16Rat87-D16Mgh1</i>)/JkHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil.congenicUnknownRRID:RGD_2306893Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals2306894SHR.BN-(<i>D4Rat33-D4Rat54</i>)/JkHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil.congenicUnknownRRID:RGD_2306894Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals2306895SHR.BN-(<i>D2Rat226-D2Rat294</i>)/JkHeart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. congenicUnknownRRID:RGD_2306895Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals2306961RLA/VerhRoman low avoidanceLaboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, BelgiuminbredUnknownRRID:RGD_2306961Bignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium2306962RHA/VerhRoman high avoidanceLaboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, BelgiuminbredUnknownRRID:RGD_2306962Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium2307077HXB4/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307077Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307078HXB27/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307078Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307079HXB3/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307079Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307080HXB20/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307080Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307081HXB31/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307081Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307082HXB18/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307082Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307083HXB10/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307083Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307084HXB24/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307084Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307085HXB17/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307085Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307086HXB7/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307086Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307087SHR.BN-(<i>D18Rat32-D18Rat12</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_2307087A segment of chr 18 from BN was introgressed into the SHR background2307088HXB22/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307088Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307089HXB29/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307089Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307090SHR.BN10/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_2307090A segment of chr 10 from BN was introgressed into the SHR background2307091HXB13/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307091Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307092HXB14/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307092Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307093HXB23/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307093Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307094HXB1/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307094Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307095HXB15/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307095Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307096HXB2/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307096Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307097HXB21/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307097Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307098HXB25/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307098Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307099HXB5/IpcvCzech Academy of Sciences, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307099Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub2307115BXH5/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307115Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307116PXO3-2/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307116Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307117PXO5-2/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307117Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307118PXO9/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307118Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307119PXO7-1/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307119Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307120PXO7-2/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307120Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307121BXH2/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307121Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307122PXO8-1/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307122Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307123BXH13/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307123Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307124BXH10/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307124Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307125PXO6-2/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307125Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307126BXH8/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307126Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307127BXH11/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307127Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307128PXO5-1/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307128Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307129BXH9/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307129Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307130PXO6-3/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307130Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307131PXO8-2/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307131Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307132PXO10/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307132Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307134BXH3/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307134Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307135PXO4/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307135Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307136BXH6/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307136Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307137PXO6-1/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307137Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307138PXO1/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307138Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307139BXH12/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307139Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv2307155SHR/1NCrlMRC Clinical Sciences Centre, College School of Medicine, London, UKinbredUnknownRRID:RGD_2307155To Charles River from NIH in 1973 at F32.2307156DA/ZtmKiniCenter for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, SwedeninbredUnknownRRID:RGD_2307156Substrain of DA, to Hannover after 1965, now at Stockholm, Sweden.2307157PVG.1AV1/KiniCenter for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2307157Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden.2307159SHRSR.SHRSP-(<i>Klk1-Mt1-ps1</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownMt1-ps1|Klk1c123118|1303192RRID:RGD_2307159SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest2307160SHRSR.SHRSP-(<i>Klk1-D1Mit3</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownKlk1c121303192RRID:RGD_2307160SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest2307161SHRSR.SHRSP-(<i>D1Rat134-Mt1-ps1</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownMt1-ps13118RRID:RGD_2307161SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest2307166SHRSP.SHRSR-(<i>Klk1-Mt1-ps1</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownMt1-ps1|Klk1c123118|1303192RRID:RGD_2307166SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest2307167SHRSP.SHRSR-(<i>Klk1-D1Mit3</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownKlk1c121303192RRID:RGD_2307167SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest2307168SHRSR/BbbSpontaneously Hypertensive Rat, Stroke ResistantMax-Delbruck-Center for Molecular Medicine, Berlin, GermanyinbredUnknownRRID:RGD_2307168This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany.2307169SHRSP.SHRSR-(<i>D1Rat134-Mt1-ps1</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownMt1-ps13118RRID:RGD_2307169SHRSP were crossed with SHRSR to give heterozygous F<sub>2</sub> animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest2307298BN/HanKiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedeninbredUnknownRRID:RGD_2307298Substrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany)2307299ACI/ZtmKiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedeninbredUnknownRRID:RGD_2307299substrain of ACI derived from ACI/Ztm2307300LEW.1AV1/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2307300Substrain of LEW.1AV12307301DA.LEW.RT1f-(<i>D20Wox15-D20Wox13</i>)/RhdSection for Medical Inflammation Research, Biomedical Center, Lund University, SwedencongenicUnknownRRID:RGD_2307301RT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markers2307317MHSMilan Hypertensive StrainDepartment of Sciences and Biomedical Technologies, University of Milan, Milan, ItalyoutbredUnknownRRID:RGD_2307317Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure2307318BDIX/IfzDuisburg-Essen University Medical School, Essen, GermanyinbredUnknownRRID:RGD_2307318derived from Berlin-Druckrey strain BDIX2307319MNS/NMilan normotensive strain<a href=http://www.rrrc.us/Strain/?x=171>Rat Resource and Research Center</a>inbredCryopreserved EmbryoRRID:RRRC_00171Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.2307355PXO3-1/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307355Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307356PXO2/CubCharles University, Department of Biology, Prague, Czech Republicrecombinant_inbredUnknownRRID:RGD_2307356Derived from polydactylous (P) SHR.<i>Lx</i> congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the <i>Lx</i> allele.2307357BDV/ZtmZentralinstitut fur Versuchstierzucht, Hannover, GermanyinbredUnknownRRID:RGD_2307357Developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles.2307358LUDW/OlaHsdLudwig<a href =http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/ludw-inbred-rat/> Envigo</a>inbredCryorecoveryRRID:RGD_2307358Wistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979.2307359BUF/SimRijHsdinbredUnknownRRID:RGD_2307359Developed by Heston in 1946 from a Buffalo2307360DA.BI.RT1i-(<i>D20Rat42-D20Rat31</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_2307360RT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han.2307441F344-<i>Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Cyyr1<sup>Tn(sb-T2/Bart3)2.328Mcwi</sup>2307440RRID:RRRC_00452These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene.2307442F344-<i>Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Robo1<sup>Tn(sb-T2/Bart3)2.327Mcwi</sup>2307439RRID:RRRC_00451These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene.2308816Crl:WI(Han)<a href=https://www.criver.com/products-services/find-model/wistar-han-igs-rat?region=3611> Charles River Laboratories</a>outbredUnknownRRID:RGD_2308816Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL (under structural changed to RCC). Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system.2308851Crl:OP(CD)Obese Prone Rats<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbredUnknownRRID:RGD_2308851Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD).2308852Crl:LELong-Evans Rats<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2308852Originated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978.2308853Crl:OR(CD)Obese Resistant Rats<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbredUnknownRRID:RGD_2308853Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets.2308885GK/CskCrljCrl<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbredUnknownRRID:RGD_2308885The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006.2308886SS/HsdMcwiCrl<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbredUnknownRRID:RGD_2308886Inbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001.2311049SHROB/KolGmiCrl-<i>Lepr<sup>cp</i></sup>/Crl<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>coisogenicUnknownLepr<sup>cp</sup>11570565RRID:RGD_2311049This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001.2311051SHRSP/A3NCrlStroke Prone Rats<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbredUnknownRRID:RGD_2311051The Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002.2311070BUF/CrCrlBuffalo Rat<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2311070Heston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).2311071ZDF-<i>Lepr<sup>fa</sup></i>/Crl<a href=https://www.criver.com/products-services/find-model/zdf-rat-obese?region=3611>Charles River Laboratories </a>coisogenicUnknownLepr3001RRID:RGD_2311071A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001.2311072FHH/EurMcwiCrl<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2311072An outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001.2311073NBL/CrCrl<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2311073Bogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998.2311074BDIX/CrCrl<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2311074Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).2311078Crl:CD-<i>Hr<sup>hr</i></sup>CD hairless rats<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2311078This spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic.2311079WF/CrCrl<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2311079J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr).2311082SS-Chr 13<sup>BN</sup>/McwiCrl<a href=http://www.criver.com/>Charles River Laboratories </a>consomicUnknownRRID:RGD_2311082Developed at the Medical College of Wisconsin. To Charles River in 2003.2311692F344-<i>Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Myo1d<sup>Tn(sb-T2/Bart3)2.334Mcwi</sup>2311691RRID:RRRC_00478These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene.2311693F344-<i>Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup></i>PhysGen, TransposagenmutantExtinct (as of 2017-01-26)Tmem22<sup>Tn(sb-T2/Bart3)2.332Mcwi</sup>2311689RRID:RGD_2311693These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene.2311694F344-<i>Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup></i>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Fam227a<sup>Tn(sb-T2/Bart3)2.333Mcwi</sup>2311687RRID:RRRC_00484These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene.2312352LEW.1NZentralinstitut fur Versuchstierzucht, Hannover, GermanycongenicUnknownRRID:RGD_2312352These congenic rats carry the RTl<sup>n</sup> haplotype on the LEW strain genetic background.2312447SD-Tg(Pmp22)KanMax Planck Institute for Experimental Medicine, Gottingen, GermanytransgenicUnknownPmp2211125RRID:RGD_2312447This transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid library2312466Crl:LISLister Hooded Rat<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2312466These rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance.2312471Crl:ZUC(Orl)-<i>Lepr</i><sup>fa</sup><a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownLepr<sup>fa</sup>13432153RRID:RGD_2312471The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991.2312472Crl:WI(WU)Wistar Wu Rat<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2312472Selection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987.2312473BDIX/OrlCrlBDIX Rats<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2312473Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991.2312474Crl:OFA(SD)<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2312474The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968.2312498WAG/RijCrlWAG Rats<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2312498A.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993.2312499Crl:NIH-<i>Foxn1</i><sup>rnu</sup>Nude Rats<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2312499The NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs.2312504Crlj:WI<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2312504Wistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981)2312511WF/IcoCrlWistar Rats<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_2312511Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970.2312512ZSF1-<i>Lepr<sup>fa</sup></i>, <i>Lepr<sup>cp</sup></i>/CrlGenetic Models International, Indianapolis.hybridUnknownRRID:RGD_2312512This F1 model was developed by crossing rat strains with two separate leptin receptor mutations (fa and cp), the lean female ZDF rat (+/fa) and the lean male SHHF rat (+/facp) ( RGD:401901201). Offspringcarring both mutations (fa:facp) are obese and develop insulin resistance, hyperglycaemia, and mild hypertension (ZSF1 obese). The heterozygous or wild type offspring (ZSF1 lean) are lean and exhibit no signs of obesity and diabetes. This model was developed at Genetic Models International, Indianapolis. To Charles River in 2001. The progeny that are heterozygous for leptin receptor or wild type are lean and are used as control for the obese counter part.2312513Crlj:DON<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2312513Dr. Sato(1952) to Nippon Rat to CRLJ(1990)2312514Crlj:LEC<a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownRRID:RGD_2312514Hokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991).2312518Crlj:ZUC-<i>Lepr</i><sup>fa</sup><a href=http://www.criver.com/>Charles River Laboratories </a>outbredUnknownLepr<sup>fa</sup>13432153RRID:RGD_2312518Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000)2312577SHR.BN-(<i>D18Rat99-D18Rat82</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_2312577F<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity2312578SHR.BN-(<i>D18Rat82</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_2312578F<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity2312579SHR.BN-(<i>D18Rat40-D18Rat82</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_2312579F<sub>2</sub> rats from SHR x SHR.BN-(<i>D18Rat113-D18Rat82</i>)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity2312580SHR.BN-(<i>D18Rat113-D18Rat82</i>)/IpcvCzech Academy of Sciences, Prague, Czech RepubliccongenicUnknownRRID:RGD_2312580SHR/OlaIpcv were crossed with BN/Crl, F<sub>1</sub> animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes2312609MWF-Chr 8<sup>SHR</sup>/RkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, GermanyconsomicUnknownRRID:RGD_2312609MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing2312644DA.WOKW-(<i>D3Mit10-D3Rat189</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownRRID:RGD_2312644A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background2312645DA.WOKW-(<i>D16Rat88-D16Wox7</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownRRID:RGD_2312645A cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K background2312646DA.WOKW-(<i>D5Mgh6-D5Mit5</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownRRID:RGD_2312646A cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K background2312647DA.WOKW-(<i>D3Mgh5-D3Rat1</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownRRID:RGD_2312647A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background2312648DA.WOKW-(<i>D10Mgh2-D10Rat4</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownRRID:RGD_2312648A cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K background2312733BN-Chr 13<sup>SS</sup> Chr 18<sup>SS</sup>/McwiPhysGenconsomicCryopreserved SpermRRID:RGD_2312733A cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed2313181LEW.1WR1/WorBrm<a href=http://www.biomere.com/type1diabetes.php>Biomedical Research Models, Inc.</a>congenicUnknownRRID:RGD_2313181Obtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc.2313209WF.ART2/WorUniverstiy of Massachusetts, Worcester, MAcongenicUnknownRRID:RGD_2313209developed at the Universtiy of Massachusetts, Medical School2313221SHHF-<i>Lepr<sup>cp</i></sup>/Crl<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>congenicUnknownLepr<sup>cp</sup>11570565RRID:RGD_2313221Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001.2313222BN/HsdMcwiCrl<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>inbredUnknownRRID:RGD_2313222BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River2313231LEWBNF1/Crl<a href=http://www.criver.com/>Charles River Laboratories </a>hybridUnknownRRID:RGD_2313231This hybrid rat is a cross between a LEW female and a BN male rat.2313232WFF344F1/Crl<a href=http://www.criver.com/>Charles River Laboratories </a>hybridUnknownRRID:RGD_2313232This hybrid rat is a cross between a WF female and a F344 male rat.2313342BN-Chr 17<sup>LH</sup>/MavLaboratoire de Physiologie, Lyon Cedex , FranceconsomicUnknownRRID:RGD_2313342Chr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped2313343LH-Chr 13<sup>BN</sup>/MavLaboratoire de Physiologie, Lyon Cedex , FranceconsomicUnknownRRID:RGD_2313343Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped2313384Wild/NovInstitute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, RussiawildUnknownRRID:RGD_2313384These are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia2313463F344-<i>Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Ppfia2<sup>Tn(sb-T2/Bart3)2.339Mcwi</sup>2313459RRID:RRRC_00474These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene.2313464F344-<i>Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup></i>PhysGen, TransposagenmutantExtinct (as of 2017-01-26)Large<sup>Tn(sb-T2/Bart3)2.336Mcwi</sup>2313460RRID:RGD_2313464These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene.2313465F344-<i>Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Pld5<sup>Tn(sb-T2/Bart3)2.340Mcwi</sup>2313462RRID:RRRC_00483These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene.2313466F344-<i>Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup></i>PhysGen, TransposagenmutantCryopreserved Sperm (as of 2017-01-26)Agbl4<sup>Tn(sb-T2/Bart3)2.337Mcwi</sup>2313461RRID:RRRC_00473These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene.2313588SD-Tg(Ins2-IAPP)SoelPfizer, Inc, Groton, ConnecticuttransgenicUnknownRRID:RGD_2313588Crl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoter2313693SHR-Tg(PEPCK-SREBF1)2IpcvInstitute of Physiology, Czech Academy of Sciences, Prague, Czech RepublictransgenicUnknownSREBF169473RRID:RGD_2313693SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal2313734SD-Tg(H1/tetO-RNAi:Insr)29BdrMax-Delbruck Center for Molecular Medicine, Berlin, GermanytransgenicUnknownRRID:RGD_2313734Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter2313735SD-Tg(H1/tetO-RNAi:Insr)14BdrMax-Delbruck Center for Molecular Medicine, Berlin, GermanytransgenicUnknownRRID:RGD_2313735Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter2313922F344-Tg(Cyp1a1-Ren2)10.LEW-(<i>D10Rat142-D10Rat15</i>)/JmulMolecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UKcongenicUnknownRRID:RGD_2313922F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to F344 females to produce BC-F344. After 12 backcross nerations, males and females heterozygous for F344/Lew in the reduced MOD QTLregion were brother-sister mated to generate aimals that were homozygous Lew/Lew for the MOD QTL region but homozygous F344/F344 for the rest of the genome.2313923LEW-Chr YF344-Tg(Cyp1a1-Ren2)10.F344-(<i>D10Rat99-D10Rat11</i>)/JmulMolecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UKcongenicUnknownRRID:RGD_2313923F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to Lew females to produce BC-Lew. After 12 backcross generations, males and females heterozygous for F344/Lew in the MOD QTLregion were brother-sister mated to generate aimals that were homozygous F344/F344 for the MOD QTL region but homozygous LEW/LEW for the rest of the genome.2313924LEW-Chr YF344-Tg(Cyp1a1-Ren2)10/JmulMolecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UKconsomicUnknownRRID:RGD_2313924F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markers2314001N:HSHeterogeneous stockDept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, SpainoutbredUnknownRRID:RGD_2314001Originated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsin2314009NMcwi:HSHeterogeneous stockDepartment of Pediatrics, Medical College of Wisconsin, Milwaukee, WisconsinoutbredUnknownRRID:RGD_231400925 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. A rotational delay of 1 is used, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc.2314027SDT.Cg-<i>Lepr<sup>fa</sup></i>/JttSDT fattyJapan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, JapancongenicUnknownRRID:RGD_2314027<i>Lepr<sup>fa</sup></i> allele from ZDF was introgressed into SDT rats using the speed congenic method2314161F344-<i>Kuru1</i>/KyoKuru1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=720> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermRRID:RGD_2314161A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).2314162F344-<i>Oune</i>/KyoOune<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=718> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved SpermTbx61307716RRID:RGD_2314162A mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).2314163F344-<i>Kcna1<sup>Adms</sup></i>/KyoADMS (autosomal dominant myokymia and seizures) ratThe University of Tokyo, The Institute of Medical SciencemutantLive Animals; Cryopreserved Sperm (as of 2017-05-04)Kcna1<sup>Adms</sup>12880383RRID:RGD_2314163This strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model.2314164F344-<i>Kuru2</i>/KyoKuru2<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=721> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermRRID:RGD_2314164A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).2314165ACI-<i>Chib</i>/KyoChibi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=717> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermDermatologyRRID:RGD_2314165This strain was established by phenotype-driven ENU mutagenesis.2314166F344-<i>Tbr2</i>/KyoTsubura2<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=723> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermRRID:RGD_2314166A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).2314167F344-<i>Kmch</i>/KyoKomachi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=719> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved SpermRRID:RGD_2314167This strain was established by phenotype-driven ENU mutagenesis.2314168F344-<i>Tbr1</i>/KyoTsubura1<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=722> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermRRID:RGD_2314168A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).2314169WTC.F344-<i>Scn1a<sup>m1Kyo</sup></i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=754> National BioResource Project for the Rat in Japan</a>congenicLive Animals; Cryopreserved SpermScn1a<sup>m1Kyo</sup>12792283RRID:RGD_2314169This congenic strain was established by backcrossing F344-<i>Scn1a<sup>m1Kyo</sup></i> onto WTC/Kyo.2314170F344-<i>Egr<sup>m1Kyo</i></sup>EGR (Excessive Grooming Rat), Kaikai, Kyo1897<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=725> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermRRID:RGD_2314170This strain was established by phenotype-driven ENU mutagenesis.2314224F344.OLETF-(<i>D1Rat166-D1Rat90</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=910> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2314224Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals.2314225F344-Chr 15<sup>OLETF</sup>/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=914> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2314225Developed by the depositor2314226WI-Tg(WSCD2)3Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=881> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermWSCD21605710RRID:RGD_2314226A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.2314227WI-Tg(WSCD2)4Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=882> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermWSCD21605710RRID:RGD_2314227A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.2314228WI-Tg(WSCD2)5Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=883> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermWSCD21605710RRID:RGD_2314228A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.2314229F344.OLETF-(<i>D7Uwm22-D7Mgh20</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=916> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2314229Developed by the DEPOSITOR2314230F344-<i>Hr<sup>krh</i></sup>/KyoHairless Kyoto, Hanako<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=757> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermDermatology; UrologyRRID:RGD_2314230A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven).2314231F344.OLETF-(<i>D5Mgh5-D5Mgh23</i>)/2Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=911> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2314231Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred.2314232WI-Tg(WSCD2)1Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=880> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermWSCD21605710RRID:RGD_2314232A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.2314243SHR.WKY-(<i>D1Mgh2-D1Wox10</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=907> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCardio HypertensionRRID:RGD_2314243Developed by the depositor2314244BCR/Nn<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=887> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiologyRRID:RGD_2314244In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene).2314245WI-Tg(WSCD2)6Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=884> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermWSCD21605710RRID:RGD_2314245A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.2314246SHRSP.WKY-(<i>D1Rat117-D1Rat90</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=906> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoCardio HypertensionRRID:RGD_2314246Developed by the Depositor2314247WI-Tg(Prl-EGFP)Yamp<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=904> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermMetabolism; DevelopmentRRID:RGD_2314247A transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats2314313NER.F344-(<i>D5Rat100-D5Rat234</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=893> National BioResource Project for the Rat in Japan</a>congenicUnknownNeurobiologyRRID:RGD_2314313The Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.2314314NER.F344-(<i>D1Mgh6-D1Rat132</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=892> National BioResource Project for the Rat in Japan</a>congenicUnknownNeurobiologyRRID:RGD_2314314The Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding.2314315F344.NER-(<i>D5Mgh4-D5Rat36</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=891> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermNeurobiologyRRID:RGD_2314315The Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.2314316F344.NER-(<i>D1Mgh6-D1Rat73</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=890> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermNeurobiologyRRID:RGD_2314316The Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding.2314317WTC.GRY-<i>Cacna1a<sup>gry</sup></i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=894> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2017-05-04)NeurobiologyCacna1a|Cacna1a<sup>gry</sup>2244|12880382RRID:RGD_2314317Developed by the depositor2314339F344-<i>Patj<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup></i>PhysGenmutantCryopreserved Sperm (as of 2017-01-26)Patj<sup>Tn(sb-T2/Bart3)2.343Mcwi</sup>2314335RRID:RRRC_00480These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene.2314340F344-<i>Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup></i>PhysGenmutantExtinct (as of 2016-10-24)Acoxl<sup>Tn(sb-T2/Bart3)2.342Mcwi</sup>2314337RRID:RGD_2314340These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene.2314341F344-<i>Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup></i>PhysGenmutantExtinct (as of 2016-10-24)Auts2<sup>Tn(sb-T2/Bart3)2.344Mcwi</sup>2314338RRID:RGD_2314341These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene.2314342F344-<i>Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup></i>PhysGenmutantExtinct (as of 2017-01-26)Palld<sup>Tn(sb-T2/Bart3)2.341Mcwi</sup>2314336RRID:RGD_2314342These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene.2314360ACI.F344-(<i>D16Mit5-D16Nkg27</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=871> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCancerRRID:RGD_2314360This congenic strain was established by backcrossing ACI.F344-(<i>D16Rat12-D16Mco2</i>)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals.2314361W-Tg(Slc32a1-YFP*)1Yyan<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=905> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved SpermNeurobiology; DevelopmentRRID:RGD_2314361This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.2314362F344-<i>Hrdk</i>/KyoHairless dominant Kyoto<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=899> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermRRID:RGD_2314362Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven).2314363W-Tg(Slc32a1-YFP*)2Yyan<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=908> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved SpermNeurobiology; DevelopmentRRID:RGD_2314363This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006.2314364ACI.F344-(<i>D16Nkg112-D16Nkg27</i>)/Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=902> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCancerRRID:RGD_2314364This congenic strain was established by backcrossing ACI.F344-(<i>D16Nkg9-D16Nkg27</i>)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals.2314365KFRS2/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=901> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermOphthalmology; DermatologyTyr|Tyr<sup>siaKyo</sup>1589755|13207345RRID:RGD_2314365A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.2314368F344-<i>Kcnn2<sup>Trdk</sup></i>/KyoTremor dominant KyotoThe University of Tokyo, The Institute of Medical SciencemutantCryopreserved Sperm (as of 2021-07-15)NeurobiologyKcnn2<sup>Trdk</sup>149735330RRID:RGD_2314368Tremor dominant Kyoto (Trdk) mutation is an autosomal dominant mutation that appeared in 2008 in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU) (Mashimo et al., 2008). Rats heterozygous for Trdk (Trdk/+) exhibited tremor behavior that was evident around weaning. To remove latent ENU-induced mutations, the laboratory established an F344-Trdk/+ congenic strain by nine rounds of backcrossing. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2.2314375LE.AR-<i>Ednrb<sup>sl</i></sup>/Okkm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=823> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2017-03-28)Internal OrganEdnrb|Ednrb<sup>sl</sup>2536|10755424RRID:RGD_2314375AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008).2314376KFRS4/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=919> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Embryo (as of 2021-10-05)Ophthalmology; DermatologyRRID:RGD_2314376A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14.2314377KFRS3B/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=918> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermOphthalmology; DermatologyRRID:RGD_2314377A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding.2314378AR-<i>Ednrb<sup>sl</i></sup>/OkkmAganglionosis rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=822> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2016-10-31)Internal OrganEdnrb|Ednrb<sup>sl</sup>2536|10755424RRID:RGD_2314378Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR)2314379KFRS6/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=921> National BioResource Project for the Rat in Japan</a>mutantLive AnimalsDermatologyRRID:RGD_2314379A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo.2314380SD-Tg(CAG-lacZ)541Htsu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=903> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_2314380Developed by the depositor2314381KFRS5A/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=920> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermDermatologyKrt71<sup>Rex</sup>11570416RRID:RGD_2314381A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo.2314382SD-Tg(CAG-HRAS*G12V)250Htsu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=790> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermCancerHRAS730881RRID:RGD_2314382This transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter2314383KFRS3A/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=917> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermOphthalmology; DermatologyRRID:RGD_2314383A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.2314396LCR/McoLow-capacity runnersMedical College of Ohio, Toledo, Ohio, USAinbredUnknownRRID:RGD_2314396Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill.2314397HCR/McoHigh-capacity runnersMedical College of Ohio, Toledo, Ohio, USAinbredUnknownRRID:RGD_2314397Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill.2314414LEW-Tg(H1/tetO-RNAi:Insr)87HrjbDepartment of Cellular and Molecular Immunology, University of Gottingen, Gottingen, GermanytransgenicUnknownInsr2917RRID:RGD_2314414LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter2314415LEW-Tg(H1/tetO-RNAi:Insr)4HrjbDepartment of Cellular and Molecular Immunology, University of Gottingen, Gottingen, GermanytransgenicUnknownInsr2917RRID:RGD_2314415LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter2314477LEW-<i>RT1<sup>DA</i></sup>/Rrrc<a href=http://www.rrrc.us/Strain/?x=391>Rat Resource and Research Center</a>congenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00391Sprague-Dawley RT1<sup>u</sup> haplotype backcrossed onto Lewis inbred strain.2314478LEW-<i>RT1.B<sup>m1Trg</i></sup>/RrrcRT1.B<a href=http://www.rrrc.us/Strain/?x=392>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00392ENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain.2314492SBN.SBH-(<i>D1Rat148-D1Rat89</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314492Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl2314493SBH.SBN-(<i>D1Mgh2-D1Rat74</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314493Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl2314494SBH.SBN-(<i>D1Rat137-D1Rat123</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314494Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl2314495SBN.SBH-(<i>D1Rat27-D1Mit7</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314495Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl2314496SBH.SBN-(<i>D1Mgh2-D1Mgh11</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314496Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl2314497SBN.SBH-(<i>D1Rat101-D1Rat74</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314497Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl2314498SBH.SBN-(<i>D1Rat137-D1Rat83</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314498Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl2314499SBN.SBH-(<i>D1Mgh17-D1Mgh14</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314499Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl2314500SBH.SBN-(<i>D1Mgh2-D1Rat101</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314500Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl2314501SBH.SBN-(<i>D1Wox11-D1Rat137</i>)/YglBen Gurion University Barzilai Medical Center, Ashkelon, IsraelcongenicUnknownRRID:RGD_2314501Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl2314530SS.SHR-(<i>D8Uia1-D8Rat90</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2314530SS/Jr females were bred with SHR/NHsd males and their female F<sub>1</sub> were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markers2314531SHR.SS-(<i>D13Rat1-D13Mgh6</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2314531SS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers2314532SHR.SS-(<i>D8Uia1-D8Rat90</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2314532SS/Jr females were bred with SHR/NHsd males and their male F<sub>1</sub> were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers2314655BRAT-<i>Avp<sup>di</i></sup>/BluHsdBrattleboromutantCryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21)Avp<sup>di</sup>13627261RRID:RGD_2314655Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988.2314861WAG/RijYcb<a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>inbredUnknownRRID:RGD_2314861Substrain of WAG/Rij; from Netherlands to Yale University.2314904WAG-<i>F8<sup>m1Ycb</sup></i><a href=http://medfaculty.yale.edu/directory/public/profile.asp?pictID=58633&nameSearch=&department=&keyword=booth> Comparative Medicine, Yale University, Connecticut</a>mutantUnknownF8<i><sup>m1Ycb</sup></i>2314903RRID:RGD_2314904This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline.2314928Slc:WSlc: Wistar<a href=http://www.labanimal.co.kr/product/slc03.html> SLC, Japan</a>outbredUnknownRRID:RGD_2314928Institute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain.2314934WST.F344-<i>Ker</i>/KyoWistar/ST-Boo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=755> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2314934This congenic strain was established by backcrossing F344-<i>Ker</i>/Kyo (NBRP No.0458) onto Slc:WST2314935WST.F344-<i>Kmch</i>/KyoWistar/ST-Komachi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=756> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermRRID:RGD_2314935This congenic strain was established by backcrossing F344-<i>Kmch</i>/Kyo (NBRP No.0458) onto Slc:WST.2314936WI-Tg(WSCD2)Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=874> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-08-24)RRID:RGD_2314936A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos.2314937F344.OLETF-(<i>D5Mgh20-D5Mgh22</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=915> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityRRID:RGD_2314937Developed by the depositor2316631F344.GK-(<i>D1Swe8-D1Gpam-1</i>)/SweKarolinska Institutet, Stockholm, SwedencongenicUnknownAdra2a|Pdcd4|Shoc22056|620816|1308146RRID:RGD_2316631This sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe2316632NEDH/KSimNew England Deaconess Hospital<a href=http://www.simlab.com/>Simonsen Laboratories</a>inbredUnknownRRID:RGD_2316632Inbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman2316633F344.GK-(<i>D1Got251-D1Gpam-1</i>)/SweKarolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2316633This sub-congenic strain is generated from an F<sub>2</sub>- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe2316653SS.LEW-(<i>D1Mco102-D1Got46</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2316653A sub-congenic strain derived from SS.LEW-(<i>D1Uia8-D1Rat18<i>)/Mco contributing to the introgressed LEW allele2316654SS.LEW-(<i>D1Mco102-D1Mco129</i>)/1McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2316654A sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2316655SS.LEW-(<i>D1Mco102-D1Mco129</i>)/2McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_2316655A sub-congenic strain derived from SS.LEW-(<i>D1Mco102-D1Got46</i>)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region2316925SHR.BN-(<i>D3Rat159-D3Rat1</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_231692550.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd2316927SHR.BN-(<i>D6Rat40-D6Rat170</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_231692745.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd2316928SHR.BN-(<i>D3Rat159-D3Rat1</i>)(<i>D6Rat40-D6Rat170</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_2316928this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele2317196DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>)Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317196Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interest2317197DA.PVG.1AV1-(<i>D8Rat41-D8Rat24</i>)Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317197Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interest2317201DA.PVG.1AV1-(<i>D8Rat24-D8Got145</i>)Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317201DA.PVG.1AV1-(<i>D8Rat146-D8Got145</i>) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locus2317278Taiep/DunDept of Medical Sciences, University of Wisconsin-Madison, Madison, WisconsinmutantUnknownRRID:RGD_2317278These mutants were found in Sprague-Dawley rats at University of Puebla in 19892317590DA.PVG.1AV1-(<i>D4Rat23-D4Rat108</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317590Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini2317595DA.PVG.1AV1-(<i>D4Rat23-D4Mit12</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317595Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini2317596DA.PVG.1AV1-(<i>D4Rat103-D4Mit12</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317596Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini2317598DA.PVG.1AV1-(<i>D4Rat231-D4Mit12</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317598Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini2317599DA.PVG.1AV1-(<i>D4Got211-D4Mit12</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317599Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini2317791DA.PVG.1AV1-(<i>D4Got60-D4Kini1</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_2317791Congenic substrain established by intercrossing DA.PVG.1AV1-(<i>D4Rat155-Spr</i>) with parental DA/Kini2317812AT.ANT-(<i>D1Uia12-D1Rat288</i>)/RarUniversity of Colorado Denver, ColoradocongenicCryopreserved Sperm (as of 2019-02-26)RRID:RRRC_00728F<sub>2</sub> males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were tested2317813AT.ANT-(<i>D1Rat234-D1Rat47</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317813This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT2317814AT.ANT-(<i>D1Rat273-D1Rat158</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317814This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT2317815AT.ANT-(<i>D1Rat35-D1Rat47</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317815This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT2317816AT.ANT-(<i>D1Rat234-D1Rat158</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317816This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT2317817AT.ANT-(<i>D1Rat183-D1Rat288</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317817This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT2317818AT.ANT-(<i>D1Rat273-D1Rat288</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317818This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT2317819AT.ANT-(<i>D1Rat35-D1Rat288</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317819This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT2317820AT.ANT-(<i>D1Rat158-D1Rat288</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317820This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat288</i>)/Rar with AT2317822AT.ANT-(<i>D1Rat35-D1Rat38</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317822This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT2317825AT.ANT-(<i>D1Rat234-D1Rat35</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317825This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT2317827AT.ANT-(<i>D1Rat234-D1Rat38</i>)/RarUniversity of Colorado Denver, ColoradocongenicUnknownRRID:RGD_2317827This sub-congenic was developed by crossing AT.ANT-(<i>D1Rat234-D1Rat228</i>)/Rar with AT2317891SHR-Chr 6<sup>MWF</sup>/RkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, GermanyconsomicUnknownRRID:RGD_2317891SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing2324631DA.E3-(<i>D4Wox49-D4Got136</i>)/RhdMedical Inflammation Research, Karolinska Institutet, Stockholm, Sweden.congenicUnknownClec4a31359528RRID:RGD_2324631This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers.2325143SHR/NHsdMcoSpontaneously Hypertensive RatUniversity of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbredUnknownRRID:RGD_2325143SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.2325145LEW/CrlMcoLewisUniversity of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbredUnknownRRID:RGD_2325145These were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.2325146MNS/NMcoMilan normotensive strainUniversity of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.inbredUnknownRRID:RGD_2325146These were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio.2325202SS/JrSeacDahl Salt-Sensitive<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1041> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio- HypertensionRRID:RGD_2325202Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP2325206LEW/SeacSeac Yoshitomi, LTD JapaninbredUnknownRRID:RGD_2325206Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan2325209SHRSP/HosSankyo Lab Service, Japan.inbredUnknownRRID:RGD_2325209Substrain of SHRSP purchased from Sankyo Lab Service, Japan.2325724PVG.LEW-(<i>D1Rat270-D1Rat68</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_232572463-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV12325754SD-<i>Pax6<sup>Sey</sup></i>/MceDepartment of Ophthalmology, Okayama University Medical School, Okayama, JapanmutantUnknownPax6|Pax6<sup>Sey</sup>3258|737688RRID:RGD_2325754Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA.2325773WKY.LEW-(<i>D13Arb15-D13Rat58</i>)/TjaImperial College, London, UKcongenicUnknownRRID:RGD_2325773Segment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrl2325774WKY.LEW-(<i>D13Arb10-D13Arb15</i>)(<i>D16Rat88-D16Rat40</i>)/TjaImperial College, London, UKcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00707WKY.LEW-(<i>D13Arb10-D13Arb15</i>) were crossed with WKY.LEW-(<i>D16Rat88-D16Rat40</i>), the F<sub>1</sub> were backcrossed to WKY.LEW-(<i>D13Arb10-D13Arb15</i>) and then the offsprings were intercrossed2325796SS.LEW-(<i>D3Rat52-D3Chm57</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_2325796A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Rat130</i>)/Ayd2325798SS.LEW-(<i>D10Got112-Igfbp4</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownIgfbp42875RRID:RGD_2325798A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat27-Igfbp4</i>)/Ayd2325801SS.LEW-(<i>D16Chm36-D16Mit2</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_2325801A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/Ayd2325803SS.LEW-(<i>D16Rat112-D16Chm60</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_2325803A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D16Rat12-D16Chm23</i>)/Ayd4107048SS.SR-(<I>D7Rat16-D7Rat189</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_4107048Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment4107052SS.SR-(<I>D7Rat16-D7Mgh5</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_4107052Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment4107055SS.SR-(<I>D7Rat16-D7Rat176</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_4107055Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment4107057SS.SR-(<I>D7Mco7-D7Rat81</I>)/JrMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_4107057Congenic substrain derived by crossing the congenic strain SS.SR-<I>Cyp11b1</I>/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment4107063SS.LEW-(<i>D1Uia8-D1Rat124</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_4107063A sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allele4107065SS.LEW-(<i>D1Uia8-D1Rat213</i>)/McoDepartment of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_4107065A sub-congenic strain derived from SS.LEW-(<i>D1Rat268-D1Got35</i>)/Jr contributing to the introgressed LEW allele4139872SS-<i>Nckap5<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Nckap5<sup>em2Mcwi</sup>4139862RRID:RGD_4139872This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6.4139873SS-<i>Rag1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Rag1<sup>em2Mcwi</sup>4139866RRID:RGD_4139873This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1.4139874SS-<i>Ets1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ets1<sup>em1Mcwi</sup>4139856RRID:RGD_4139874This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.4139875FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Sorcs1<sup>em1Mcwi</sup>4139864RRID:RGD_4139875This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.4139876SS-<i>Mmp2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Mmp2<sup>em1Mcwi</sup>4139860RRID:RGD_4139876This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.4139877FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Rab38<sup>em1Mcwi</sup>4139867RRID:RGD_4139877This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.4139878SS-<i>Mmp2<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Mmp2<sup>em2Mcwi</sup>4139869RRID:RGD_4139878This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.4139879SS-<i>Nckap5<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinctNckap5<sup>em1Mcwi</sup>4139859RRID:RGD_4139879This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.4139880SS-<i>Ren<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Ren<sup>em1Mcwi</sup>4139863RRID:RGD_4139880This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.4139881SS-<i>Nckap5<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Nckap5<sup>em3Mcwi</sup>4139861RRID:RGD_4139881This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.4139882SS-<i>Nppa<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Nppa<sup>em4Mcwi</sup>4139857RRID:RGD_4139882This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.4139883SS-<i>Nox4<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Nox4<sup>em2Mcwi</sup>4139868RRID:RGD_4139883This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.4139884SS-<i>Rag1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Rag1<sup>em1Mcwi</sup>4139865RRID:RGD_4139884This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.4139885SS-<i>Sh2b3<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Sh2b3<sup>em1Mcwi</sup>4139858RRID:RGD_4139885This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.4139889BHD/DspeBirt-Hogg-Dube rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=927> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo (as of 2018-06-06)Flcn735088RRID:RGD_4139889A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd.4139890TT/Sgn<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=928> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermFkbp61308926RRID:RGD_4139890Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats.4139891F344-Chr 3<sup>SDT</sup>/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=896> National BioResource Project for the Rat in Japan</a>consomicCryopreserved EmbryoDiabetes ObesityRRID:RGD_4139891This consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background.4139892ALD/Hyoacid lipase deficiency rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=926> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoMetabolismLipa<sup>m1Hyo</sup>150519893RRID:RGD_4139892In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far.4140402W-Tg(Gh1as)Nibs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=956> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_4140402The construct which contains of rat growth hormone (<i>Gh1</i>) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat <i>Gh1</i> cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science.4140403SD-Tg(Eno2-ATXN3*64Q)29Kakiz<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=949> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermNeurobiologyRRID:RGD_4140403Background strain is Slc:SD.4140404ODS-<i>Gulo<sup>od/od</sup>/ShiJclOsteogenic disorder Shionagi rat<a href =https://www.clea-japan.com/en/products/other_disease/item_a0250> CLEA Japan, Inc</a>inbredLive Animals (as of 2021-04-29)Gulo<sup>od</sup>126848761RRID:RGD_4140404Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.4140405LEXF6A/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=960> National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoRRID:RGD_4140405The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.4140406SHRSP.WKY-(<i>D1Wox29-D1Arb21</i>)/IzmDmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=964> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoRRID:RGD_4140406To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.4140407SDT.BN-<i>Gluco13</i>/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=958> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermDiabetes ObesityRRID:RGD_4140407The <i>Gluco13</i> (<i>Gisdt1</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-<i>Gluco14</i>/Nyo (NBRP No. 0602).4140408LEXF8C/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=959> National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoRRID:RGD_4140408The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.4140409COP-Chr 16<sup>DA</sup>/McoRrrcUniversity of Toledo College of Medicine, Toledo, OhioconsomicUnknownRRID:RGD_4140409Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background4140410SD-Tg(Eno2-ATXN3*64Q)16Kakiz<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=950> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermNeurobiologyRRID:RGD_4140410Background strain is Slc:SD.4140411SDT.BN-<i>Gluco14</i>/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=957> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermDiabetes ObesityRRID:RGD_4140411The <i>Gluco14</i> (<i>Gisdt2</i>) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN-<i> Gluco13</i>/Nyo (NBRP No. 0601).4140412LEXF1D/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=961> National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoRRID:RGD_4140412The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.4140413LEXF1B/Stm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=962> National BioResource Project for the Rat in Japan</a>recombinant_inbredCryopreserved EmbryoRRID:RGD_4140413The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985.4140414WKY.SHRSP-(<i>D1Wox29-D1Arb21</i>)/IzmDmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=965> National BioResource Project for the Rat in Japan</a>congenicUnknownRRID:RGD_4140414To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21.4140415TRMRC/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=963> National BioResource Project for the Rat in Japan</a>coisogenicLive Animals; Cryopreserved SpermRRID:RGD_4140415The coisogenic control strain for the TRMR strain (NBRP No.0016).4140416SD-Tg(Eno2-Vcp)16Kakiz<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=948> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermNeurobiologyRRID:RGD_4140416This transgenic strain was generated by microinjection into Slc:SD fertilized eggs.4140469F344-<i>Kmch</i>/NSlcKomachi<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=726> National BioResource Project for the Rat in Japan</a>mutantUnknownRRID:RGD_4140469from NBRP4142540SHR.WKY-(<i>D4Rat10-D4Rat15</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=941> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio HypertensionRRID:RGD_4142540This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.4142541W-Tg(Tek-GFP)1Soh<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=943> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RGD_4142541This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion.4142542BN.SDT-<i>Gluco14</i>/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=945> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermDiabetes ObesityRRID:RGD_4142542The Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo.4142543BN.SDT-<i>Gluco13</i>/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=944> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermDiabetes ObesityRRID:RGD_4142543The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo.4142544WKY/Kiha<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=930> National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoRRID:RGD_4142544A WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University.4142545SHR.WKY-(<i>D3Rat108-D3Rat166</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=937> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio HypertensionRRID:RGD_4142545This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.4142546AMI/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=929> National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoDentistryRRID:RGD_4142546Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003.4142547SHR.WKY-(<i>D4Wox27-D4Rat11</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=940> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio HypertensionRRID:RGD_4142547This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.4142548SHR.WKY-(<i>D4Wox27-D4Rat10</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=939> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio HypertensionRRID:RGD_4142548This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.4142549SHR.WKY-(<i>D4Wox27-D4Rat4</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=938> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio HypertensionRRID:RGD_4142549This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.4142550SHR.WKY-(<i>D4Rat101-D4Rat15</i>)/IzmTkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=942> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio HypertensionRRID:RGD_4142550This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009.4142799LEW.SS-(<i>D2Uia5-D2Rat143</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_4142799LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain4142800LEW.SS-(<i>D18Chm31-D18Mit8</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_4142800LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain4143165SD-Tg(Aqp5-GFP)ZboroRrrcAqp5EGFP<a href=http://www.rrrc.us/Strain/?x=427>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermAqp52144RRID:RRRC_00427This rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained.4143456BN.GK-(<i>D2Wox30-D2Wox68</i>)/OxThe Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenicUnknownRRID:RGD_4143456This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.4143457BN.GK-(<i>D2Rat40-D2Wox35</i>)/OxThe Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenicUnknownRRID:RGD_4143457This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.4143458BN.GK-(<i>D2Wox49-D2Rat70</i>)/OxThe Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenicUnknownRRID:RGD_4143458This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.4143459BN.GK-(<i>D2Rat40-D2Got149</i>)/OxThe Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKcongenicUnknownRRID:RGD_4143459This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK.4145088SS.BN-(<i>D6Rat119-D6Arb3</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_4145088SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain4145089SS.BN-(<i>D6Rat149-D6Rat18</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_4145089SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain4145090SS.BN-(<i>D6Rat149-D6Got171</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_4145090SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain4145091SS.BN-(<i>D6Rat149-D6Arb3</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_4145091SS/JrHsdMcwi were crossed with SS-6<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain4145374ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Rat98-D14Hmgc18</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_4145374Congenic strain developed by crossing ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/Eur (Rf-1a) males to ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi (Rf-1a+4) double congenic females4889411SHRSP.WKY-(<i>D1Smu13-D1Wox33</i>)/IzmDepartment of Functional Pathology, Shimane University School of Medicine, Izumo, JapancongenicCryopreserved SpermCardio- HypertensionRRID:RGD_4889411About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(<i>D1Smu13-D1Arb21</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain4889414WKY.SHRSP-(<i>D1Rat171-D1Wox33</i>)/IzmDepartment of Functional Pathology, Shimane University School of Medicine, Izumo, JapancongenicCryopreserved SpermCardio-HypertensionRRID:RGD_4889414About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(<i>D1Smu13-D1Smu11</i>)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain4889450DA.PVG.1AV1-(<i>D1Rat248-D1Rat10</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_4889450DA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb)4889464GK/OxThe Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UKinbredUnknownRRID:RGD_4889464Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK4889499CDS-Chr 4<sup>CDR</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889499Homozygous male CDS/Ygl were bred with CDR/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixed4889817SBN-Chr 1<sup>SBH</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889817Homozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed4889820SBH-Chr 1<sup>SBN</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889820Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed4889822SBN-Chr 17<sup>SBH</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889822Homozygous male SBN/Ygl were bred with SBH/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed4889875SBH-Chr 2<sup>SBN</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889875Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed4889877SBH-Chr 20<sup>SBN</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889877Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed4889879SBH-Chr X<sup>SBN</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889879Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed4889882SBH-Chr 17<sup>SBN</sup>/YglHebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, IsraelconsomicUnknownRRID:RGD_4889882Homozygous male SBH/Ygl were bred with SBN/Ygl females; F<sub>1</sub> heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed4889890DA.PVG.1AV1-(<i>D17Rat8-D17Rat37</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermImmunologyRRID:RGD_4889890DA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat374891048SS.LEW-(<i>D7Rat73-D7Rat128</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|727886RRID:RGD_4891048SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain4891051LEW.SS-(<i>D7Rat73-D7Rat128</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownAvpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b32185|2453|2454|3809|3904|620616|621264|621525|628723|727886RRID:RGD_4891051LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain4891103WMI/EerRrrcWKY most immobileDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, IllinoisinbredUnknownRRID:RRRC_009733 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated.4891107WLI/EerRrrcWKY least immobileDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, IllinoisinbredUnknownRRID:RRRC_009673 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated.4891165Wig/YmaswigglingHuman Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, JapancongenicUnknownRRID:RGD_4891165These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain4891380SS.SR-(<i>D9Mco95-D9Mco98</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_4891380SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891383SS.SR-(<i>D9Mco98-Resp18</i>)/1McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_4891383SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891386SS.SR-(<i>D9Mco98-Resp18</i>)/2McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_4891386SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891388SS.SR-(<i>D9Mco95-D9Mco100</i>)/1McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_4891388SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891390SS.SR-(<i>D9Mco95-D9Mco100</i>)/2McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_4891390SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891392SS.SR-(<i>D9Mco95-D9Mco102</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_4891392SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891394SS.SR-(<i>D9Mco101-Resp18</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_4891394SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891396SS.SR-(<i>D9Mco72-Resp18</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_4891396SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891400SS.SR-(<i>D9Mco14-Resp18</i>)/1McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_4891400SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891402SS.SR-(<i>D9Mco14-Resp18</i>)/2McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_4891402SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4891404SS.SR-(<i>D9Mco14-Resp18</i>)/3McoMedical College of Ohio, Toledo, OhiocongenicUnknownResp183555RRID:RGD_4891404SS.SR-(<i>D9Mco95-Resp18</i>)/Mco was crossed with SS/Jr to generate F<sub>1</sub> which were intercrossed to generate F<sub>2</sub>, these were genotyped using markers throughout 73140156-74554694 region4892563WF.WKY-(<i>D5Rat26-D5Uwm42</i>)/UwmUniversity of Wisconsin-MadisoncongenicUnknownRRID:RGD_4892563WKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region.5130721HXB1/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5130721Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131094BN-<i>Lx</i>/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, CaliforniamutantUnknownRRID:RGD_5131094Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131095BXH13/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131095Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131097BXH12/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131097Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131099BXH11/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131099Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131101BXH10/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131101Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131104BXH9/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131104Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131106BXH8/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131106Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131108BXH6/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131108Embryo-rederived from breeder stock BXH6/Cub provided by Dr. Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131110BXH5/CubPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131110Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131113HXB31/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131113Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131115HXB29/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131115Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131118HXB27/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131118Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131120HXB26/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131120Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131122HXB25/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131122Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131124HXB23/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131124Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131126HXB20/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131126Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131128HXB17/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131128Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131130HXB15/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131130Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131132HXB13/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131132Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131134HXB10/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131134Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained by Printz laboratory for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131136HXB7/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131136Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131138HXB4/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131138Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131140HXB3/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131140Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131142HXB2/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131142Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131144HXB18/IpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, Californiarecombinant_inbredUnknownRRID:RGD_5131144Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping.5131910SS-<i>Acad10<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Acad10<sup>em2Mcwi</sup>5131905RRID:RGD_5131910This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2.5131911SS-<i>Alms1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Alms1<sup>em1Mcwi</sup>5131906RRID:RGD_5131911This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1.5131912SS-<i>Aldh2<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Aldh2<sup>em2Mcwi</sup>5131907RRID:RGD_5131912This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4.5131920SS-<i>Apoe<sup>em8Mcwi</sup></i>PhysGen KnockoutsmutantExtinctApoe<sup>em8Mcwi</sup>5131915RRID:RGD_5131920This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2.5131921SS-<i>Apoe<sup>em7Mcwi</sup></i>PhysGen KnockoutsmutantExtinctApoe<sup>em7Mcwi</sup>5131918RRID:RGD_5131921This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.5131922SS-<i>Cdh13<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Cdh13<sup>em1Mcwi</sup>5131919RRID:RGD_5131922This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.5131932SS-<i>Cyp1a1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Cyp1a1<sup>em1Mcwi</sup>5131928RRID:RGD_5131932This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.5131933SS-<i>Cyba<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Cyba<sup>em1Mcwi</sup>5131930RRID:RGD_5131933This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.5131934SS-<i>Cyp1a1<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Cyp1a1<sup>em5Mcwi</sup>5131929RRID:RGD_5131934This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 4.5131950SS-<i>Msra<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Msra<sup>em3Mcwi</sup>5131945RRID:RGD_5131950This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 1.5131951SS-<i>Prokr1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Prokr1<sup>em2Mcwi</sup>5131947RRID:RGD_5131951This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 126-bp frameshift deletion in exon 2.5131952SS-<i>Mas1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Mas1<sup>em1Mcwi</sup>5131946RRID:RGD_5131952This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.5131953SS-<i>Prokr1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Prokr1<sup>em1Mcwi</sup>5131948RRID:RGD_5131953This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2.5131954SS-<i>Mstn<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Mstn<sup>em2Mcwi</sup>5131949RRID:RGD_5131954This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2.5131963SS-<i>Nox4<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Nox4<sup>em1Mcwi</sup>5131428RRID:RGD_5131963This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.5131964SS-<i>Mstn<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Mstn<sup>em3Mcwi</sup>5131962RRID:RGD_5131964This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.5131965SS-<i>Mthfr<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Mthfr<sup>em1Mcwi</sup>5131961RRID:RGD_5131965This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2.5131966SS-<i>Plod1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2017-01-26)Plod1<sup>em1Mcwi</sup>5131960RRID:RGD_5131966This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.5131974SS-<i>Rasgrp3<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Rasgrp3<sup>em1Mcwi</sup>5131968RRID:RGD_5131974This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12.5131975SS-<i>Ptpn11<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ptpn11<sup>em1Mcwi</sup>5131970RRID:RGD_5131975This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4.5131976SS-<i>Ptpn11<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Ptpn11<sup>em4Mcwi</sup>5131969RRID:RGD_5131976This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp frameshift deletion in exon 4.5131987SS-<i>Tgfb1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Tgfb1<sup>em1Mcwi</sup>5131986RRID:RGD_5131987This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 3.5131988SS-<i>Wdr72<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Wdr72<sup>em2Mcwi</sup>5131978RRID:RGD_5131988This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 5-bp frameshift deletion in exon 3.5131989SS-<i>Tgfb1<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Tgfb1<sup>em3Mcwi</sup>5131980RRID:RGD_5131989This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3.5131990SS-<i>Slc30a8<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Slc30a8<sup>em2Mcwi</sup>5131981RRID:RGD_5131990This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.5131991SS-<i>Slc30a8<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Slc30a8<sup>em1Mcwi</sup>5131979RRID:RGD_5131991This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.5134683WF.WKY-(<i>D7Rat171-D7Rat128</i>)/1UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_5134683Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background5134685WF.WKY-(<i>D7Rat171-D7Rat128</i>)/2UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_5134685Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background5134687WF.WKY-(<i>D7Rat51-D7Rat128</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_5134687Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background5134689WF.WKY-(<i>D7Uwm25-D7Rat128</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_5134689Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background5134692WF.WKY-(<i>D7Rat171-D7Rat45</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_5134692Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background5134951WF.COP-(<i>D7Rat39-D7Uwm12</i>)/1UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_5134951Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background5134953WF.COP-(<i>D7Rat39-D7Uwm12</i>)/2UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_5134953Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background5135031BN.MES-<i>Cyba</i>/SnaDepartment of Aging Biology, Institute on Aging and Adaptation, Shinshu University, Matsumoto, JapancongenicUnknownRRID:RGD_5135031mutant Cyba gene from the MES/Slc strain is introduced into the background of BN/SsNSlc by standard procedures with seven backcrosses to BN/SsNSlc5135472ACI.BN-(<I>D5Uwm70-D5Rat32</I>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5135472This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5135473ACI.BN-(<I>D5Uwm70-D5Got42</I>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5135473This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5135475ACI.BN-(<I>D5Rat60-D5Rat115</I>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5135475This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5135477ACI.BN-(<I>D5Uwm70-D5Mgh15</I>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5135477This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5135479ACI.BN-(<I>D5Rat113-D5Rat36</I>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5135479This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5135481ACI.BN-(<I>D5Mgh17-D5Rat98</I>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5135481This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5143940ACI.FHH-(<i>D1Rat74-D1Rat90</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_5143940Congenic substrain that originated from ACI.FHH-(<i>D1Rat298-D1Rat90</i>)/Eur5143941ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_5143941Triple congenic ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur from Erasmus Medical Center, Rotterdam, Netherlands now bred and housed at Medical College of Wisconsin5143942ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_5143942Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain.5143943ACI.FHH-(<i>D14Mit11-D14Rat82</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicCryopreserved SpermRRID:RGD_5143943Congenic strain generated by using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf4 QTL region of chr 14 is introgressed in this strain.5143984SS-<i>Plekha7<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Plekha7<sup>em1Mcwi</sup>5143978RRID:RGD_5143984This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.5143985SS-<i>Mstn<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Mstn<sup>em1Mcwi</sup>5143964RRID:RGD_5143985This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation deletes part of exon 2 and its splice acceptor.5143986SS-<i>Ulk3<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ulk3<sup>em1Mcwi</sup>5143968RRID:RGD_5143986This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.5143987SS-<i>Gpr183<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Gpr183<sup>em3Mcwi</sup>5143961RRID:RGD_5143987This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2.5143988SS-<i>Gpr183<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Gpr183<sup>em2Mcwi</sup>5143955RRID:RGD_5143988This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.5143989SS-<i>Agtrap<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Agtrap<sup>em4Mcwi</sup>5143963RRID:RGD_5143989This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor.5143990SS-<i>Ulk3<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ulk3<sup>em4Mcwi</sup>5143971RRID:RGD_5143990This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 88-bp frameshift deletion in exon 5.5143991SS-<i>Gpr183<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Gpr183<sup>em1Mcwi</sup>5143957RRID:RGD_5143991This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 2.5143992SS-<i>Rasgrp3<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Rasgrp3<sup>em3Mcwi</sup>5143946RRID:RGD_5143992This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 20-bp frameshift deletion in exon 12.5143993SS-<i>Plcd3<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Plcd3<sup>em4Mcwi</sup>5143954RRID:RGD_5143993This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor5143994SS-<i>Plcd3<sup>em7Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Plcd3<sup>em7Mcwi</sup>5143976RRID:RGD_5143994This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon5143995SS-<i>Plekha7<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Plekha7<sup>em4Mcwi</sup>5143979RRID:RGD_5143995This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 8.5143996SS-<i>Agtrap<sup>em8Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Agtrap<sup>em8Mcwi</sup>5143970RRID:RGD_5143996This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor.5144101SS-<i>Kcnq1<sup>em14Mcwi</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2017-01-26)Kcnq1<sup>em14Mcwi</sup>5144083RRID:RGD_5144101This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3.5144102ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi-<i>Asip<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Asip<sup>em1Mcwi</sup>5144099RRID:RGD_5144102This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.5144103SS-<i>Ldlr<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ldlr<sup>em1Mcwi</sup>5144090RRID:RGD_5144103This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.5144104SS-<i>Ncf2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Ncf2<sup>em1Mcwi</sup>5144089RRID:RGD_5144104This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 2.5144105SS-<i>Hexim2<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Hexim2<sup>em4Mcwi</sup>5144095RRID:RGD_5144105This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3.5144106SS-<i>Kcnq1<sup>em9Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Kcnq1<sup>em9Mcwi</sup>5144076RRID:RGD_5144106This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 3.5144107SS-<i>Itga9<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Itga9<sup>em1Mcwi</sup>5144077RRID:RGD_5144107This strain was produced by injecting ZFNs targeting the sequence GTCGGAGCCTTCCTGTCCgacagcGTGGTTCTCCTCAGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor.5144108SS-<i>Ldlr<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ldlr<sup>em4Mcwi</sup>5144075RRID:RGD_5144108This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4.5144110ACI.BN-(<i>D5Mgh17-D5Mgh15</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5144110This congenic strain is developed by further genotyping ACI.BN-(<i>D5Mgh17-D5Rat205</i>)/Shul.5147594FHH.PCK-(<i>D9Rat35-D9Rat70</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownPkhd1<sup>pck</sup>11535943RRID:RGD_5147594A FHH/EurMcwi male was crossed with a PCK/CrljCrl-<i>Pkhd1<sup>pck</i></sup>/Crl female, and the male progeny were backcrossed to FHH/EurMcwi females for five generations by marker assisted breeding. In each generation, males were genotyped by fluorescent genotyping for three markers within the Pkhd1 gene, and 98 markers evenly spaced throughout the genome.5490515FHH.BN(<i>D1Rat265-D1Rat76</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicExtinctRRID:RGD_5490515desired segments from BN were introgressed in FHH background5490516FHH.BN(<i>D14Rat80-D14Hmgc4</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicLive Animals; Cryopreserved SpermRRID:RGD_5490516desired segments from BN were introgressed in FHH background5490517FHH.BN(<i>D14Rat78-D14Hmgc4</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicLive Animals; Cryopreserved SpermRRID:RGD_5490517desired segments from BN were introgressed in FHH background5508304WUN-<i>Abcc2<sup>TR-</i></sup>/HsdRrrcUnilever maintained at the Amsterdam Academic Medical Center (AMC).mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2019-08-02)Abcc2|Abcc2<sup>TR-</sup>2366|12792941RRID:RRRC_00442Spontaneous 1-bp deletion mutation occurred on a Wistar This mutation at amino acid 393 resulting a frameshift and premature stop at position 401.5508305F344-<i>Dpp4<sup>DPPIV-</i></sup>/DchcHsdRrrc<a href=http://www.rrrc.us/Strain/?x=443>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-16)Dpp4<sup>DPPIV</sup>12792942RRID:RRRC_00443The DPP4 mutant rat was a spontaneous mutation in Fischer 344 rats, which caused a deficiency in DPPIV, was identified by Dr. Douglas C. Hixson at Rhode Island Hospital.5508356SS-<i>Gucy1a3<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinctGucy1a3<sup>em1Mcwi</sup>5508351RRID:RGD_5508356This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5.5508357SS-<i>Tfdp2<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Tfdp2<sup>em2Mcwi</sup>5508332RRID:RGD_5508357This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6.5508358SS-<i>Wdr72<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Wdr72<sup>em1Mcwi</sup>5508327RRID:RGD_5508358This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 3 and intron 35508359SS-<i>Prune<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Prune<sup>em3Mcwi</sup>5508348RRID:RGD_5508359This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 130-bp frameshift deletion in exon 1.5508360SS-<i>Dguok<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Dguok<sup>em4Mcwi</sup>5508323RRID:RGD_5508360This strain was produced by injecting ZFNs targeting the sequence GTCGGTTCCTTCTGCgtagacTCCGAGCGTCTTTCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp frameshift deletion in exon 1.5508361SS-<i>Bcas3<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Bcas3<sup>em4Mcwi</sup>5508329RRID:RGD_5508361This strain was produced by injecting ZFNs targeting the sequence TGGATCTGTACTCACttcgtACGGGGGAGATGGTCAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 9.5508362SS-<i>Ncf2<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ncf2<sup>em4Mcwi</sup>5508342RRID:RGD_5508362This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2.5508363SS-<i>Sorcs2<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Sorcs2<sup>em4Mcwi</sup>5508326RRID:RGD_5508363This strain was produced by injecting ZFNs targeting the sequence CACATCAGCTTCCGCTCTgactggGAGCTGGTCAAGGTGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 15.5508364SS-<i>Prune<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Prune<sup>em1Mcwi</sup>5508341RRID:RGD_5508364This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1.5508365SS-<i>Agtr1a<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Agtr1a<sup>em5Mcwi</sup>5508318RRID:RGD_5508365This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 3.5508366SS-<i>Tfdp2<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantExtinctTfdp2<sup>em5Mcwi</sup>5508334RRID:RGD_5508366This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6.5508367SS-<i>Ulk4<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ulk4<sup>em3Mcwi</sup>5508340RRID:RGD_5508367This strain was produced by injecting ZFNs targeting the sequence CTACCTTGTAGCTACccaggtGAGGCTGTCTGATGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 15 and intron 155508368SS-<i>Trafd1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Trafd1<sup>em1Mcwi</sup>5508352RRID:RGD_5508368This strain was produced by injecting ZFNs targeting the sequence CTGTGGTGCCCGGACagagcTGTGTGGCAGCTGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 5.5508369SS-<i>Myadml2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Myadml2<sup>em1Mcwi</sup>5508317RRID:RGD_5508369This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.5508370SS-<i>Nppb<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Nppb<sup>em2Mcwi</sup>5508324RRID:RGD_5508370This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2.5508371SS-<i>Mylip<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantExtinctMylip<sup>em3Mcwi</sup>5508336RRID:RGD_5508371This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.5508380SS-TgTn(T2ONC)2McwiPhysGen KnockoutstransgenicCryopreserved SpermRRID:RGD_5508380These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.5508381SS-TgTn(T2ONC)1McwiPhysGen KnockoutstransgenicCryopreserved SpermRRID:RGD_5508381These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands.5508392HsdHlr:ZUC-<i>Lepr</i><sup>fa</sup><a href =https://www.envigo.com/model/hsdhlr-zucker-leprfa/>Envigo</a>outbredUnknownLepr<sup>fa</sup>13432153RRID:RGD_5508392Derived from a colony obtained in 1992 from Hoffmann-la-Roche, Nutley, New Jersey.5508393BN/RijHsd<a href =http://www.envigo.com/model/bn-rijhsd/>Envigo</a>inbredUnknownRRID:RGD_5508393These were derived from a nucleus colony obtained directly from the TNO Institute, the Netherlands now available at Envigo.5508394F344BNF1/HsdhybridUnknownRRID:RGD_5508394Offspring of a cross between the F344/NHsd inbred female and a BN male rat.5508395Hsd:RH-<i>Foxn1</i><sup>rnu</sup>Athymic Nude<a href =https://www.envigo.com/model/hsd-rh-foxn1rnu/>Envigo</a>outbredUnknownRRID:RGD_5508395Derived from animals obtained from the Rowett Research Institute, Aberdeen, Scotland.5508396HsdRccHan:WISToutbredUnknownRRID:RGD_5508396Derived at Biological Research Laboratories Limited (BRL), formerly RCC, now Harlan Laboratories Ltd., Fullinsdorf, Switzerland from original colony at Zentralinstitute fur Versuchstierzucht, Hannover in 1989. Transferred to Harlan Sprague-Dawley, Inc. in 1993 (nomenclature HsdHan:WIST). Harlan became Envigo in 2015.
In 2004 Envigo acquired RCC Ltd. and new breeding stock was transferred in 2008 (nomenclature RccHan:WIST). Unlike competitive models, the RccHan:WIST rat has been maintained from the original nucleus of 156 breeding pairs in Hannover, Germany.5508397HotHsd:SDSprague Dawley<a href =https://www.envigo.com/model/hsdhot-holtzman-sd-> Envigo</a>outbredUnknownRRID:RGD_5508397Originally developed by the Holtzman Company in Madison, Wisconsin, from Sprague Dawley stock in 1947; to Harlan through acquisition in 1986.5508398BluHsd:LELong Evans (Blue Spruce)outbredUnknownRRID:RGD_5508398From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988. Harlan became Envigo in 2015.5509086ACI.BN-(<i>D5Rat72-D5Rat36</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5509086This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5509087ACI.BN-(<i>D5Rat113-D5Rat159</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5509087This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background5509988SS-<i>Nppb<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Nppb<sup>em4Mcwi</sup>5509979RRID:RGD_5509988This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2.5509989SS-<i>Msra<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Msra<sup>em4Mcwi</sup>5509977RRID:RGD_5509989This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 1-bp frameshift deletion in exon 1.5509990SS-<i>Cyp1a1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Cyp1a1<sup>em2Mcwi</sup>5509976RRID:RGD_5509990This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 188-bp deletion encompassing exon 45509991SS-<i>Mylip<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Mylip<sup>em2Mcwi</sup>5508333RRID:RGD_5509991This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp deletion and one G insertion causing frameshift deletion in exon 1.5509992SS-<i>Ube2q2<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ube2q2<sup>em3Mcwi</sup>5509987RRID:RGD_5509992This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7.5509993SS-<i>Tcf7l2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Tcf7l2<sup>em1Mcwi</sup>5509981RRID:RGD_5509993This strain was produced by injecting ZFNs targeting the sequence GGAAGCCTCCAGAGCagacaaGCCCTCAAGGATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 169-bp deletion of exon5 and intron 5.5509994SS-<i>Sh2b3<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Sh2b3<sup>em2Mcwi</sup>5509982RRID:RGD_5509994This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.5509995SS-<i>Adra2a<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Adra2a<sup>em1Mcwi</sup>5509986RRID:RGD_5509995This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2.5509996SS-<i>Stk39<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantExtinctStk39<sup>em2Mcwi</sup>5509978RRID:RGD_5509996This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7.5509997SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantExtinctNckap5<sup>em4Mcwi</sup>5509975RRID:RGD_5509997This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.5529230ACI.FHH-(<i>D1Hmgc16-D1Rat225</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicCryopreserved SpermRRID:RGD_5529230desired segments from FHH/EurMcwi were introgressed in ACI/Eur background5529529ACI.FHH-(<i>D1Hmgc1-D1Hmgc19</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicCryopreserved SpermRRID:RGD_5529529desired segments from FHH/EurMcwi were introgressed in ACI/Eur background5529731ACI.FHH-(<i>D1Hmgc20-D1Hmgc21</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicCryopreserved SpermRRID:RGD_5529731desired segments from FHH/EurMcwi were introgressed in ACI/Eur background5683886SS-Chr 12<sup>BN</sup>.SS-(<i>D12Arb13-D12Mit2</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_5683886These were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.5683888SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Rat79</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_5683888These were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.5683890SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_5683890These were generated by crossing SS/JrHsdMcwi with SS-Chr 12<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.5685369SS-<i>Agtr1a<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Agtr1a<sup>em1Mcwi</sup>5508331RRID:RGD_5685369This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3.5686300SS-<i>Adra2a<sup>em1Mcwi-/-</sup></i>SS-<i>Adra2a<sup>em1Mcwi-</sup>/Adra2a<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2019-07-26)Adra2a<sup>em1Mcwi</sup>5509986RRID:RGD_5686300ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686302SS-<i>Adra2a<sup>em1Mcwi+/+</sup></i>SS-<i>Adra2a<sup>em1Mcwi+</sup>/Adra2a<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686302ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686304SS-<i>Agtrap<sup>em4Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em4Mcwi-</sup>/Agtrap<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Embryo (as of 2018-09-05)RRID:RGD_5686304ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686306SS-<i>Agtrap<sup>em4Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em4Mcwi+</sup>/Agtrap<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686306ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686308SS-<i>Hexim2<sup>em4Mcwi-/-</sup></i>SS-<i>Hexim2<sup>em4Mcwi-</sup>/Hexim2<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686308ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686311SS-<i>Hexim2<sup>em4Mcwi+/+</sup></i>SS-<i>Hexim2<sup>em4Mcwi+</sup>/Hexim2<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686311ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686314SS-<i>Rasgrp3<sup>em1Mcwi-/-</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi-</sup>/Rasgrp3<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686314ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686316SS-<i>Rasgrp3<sup>em1Mcwi+/+</sup></i>SS-<i>Rasgrp3<sup>em1Mcwi+</sup>/Rasgrp3<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686316ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686318SS-<i>Sh2b3<sup>em1Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Sh2b3<sup>em1Mcwi</sup>4139858RRID:RGD_5686318ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 .5686320SS-<i>Sh2b3<sup>em1Mcwi+/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi+</sup>/Sh2b3<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686320ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686322SS-<i>Sh2b3<sup>em1Mcwi-/+</sup></i>SS-<i>Sh2b3<sup>em1Mcwi-</sup>/Sh2b3<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Sh2b3<sup>em1Mcwi</sup>4139858RRID:RGD_5686322ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686326SS-<i>Ulk3<sup>em4Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686326ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686328SS-<i>Ulk3<sup>em4Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi+</sup>/Ulk3<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686328ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686330SS-<i>Ulk3<sup>em4Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em4Mcwi-</sup>/Ulk3<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686330ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686332SS-<i>Wdr72<sup>em2Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em2Mcwi-</sup>/Wdr72<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686332ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686335SS-<i>Wdr72<sup>em2Mcwi+/+</sup></i>SS-<i>Wdr72<sup>em2Mcwi+</sup>/Wdr72<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686335ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686652SS-<i>Agtr1a<sup>em1Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em1Mcwi-</sup>/Agtr1a<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686652ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686654SS-<i>Agtr1a<sup>em1Mcwi+/+</sup></i>SS-<i>Agtr1a<sup>em1Mcwi+</sup>/Agtr1a<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686654ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686657SS-<i>Agtr1a<sup>em5Mcwi-/-</sup></i>SS-<i>Agtr1a<sup>em5Mcwi-</sup>/Agtr1a<sup>em5Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686657ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686659SS-<i>Agtrap<sup>em8Mcwi-/-</sup></i>SS-<i>Agtrap<sup>em8Mcwi-</sup>/Agtrap<sup>em8Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686659ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686662SS-<i>Agtrap<sup>em8Mcwi+/+</sup></i>SS-<i>Agtrap<sup>em8Mcwi+</sup>/Agtrap<sup>em8Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686662ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686664SS-<i>Aldh2<sup>em2Mcwi-/-</sup></i>SS-<i>Aldh2<sup>em2Mcwi-</sup>/Aldh2<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686664ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686666SS-<i>Aldh2<sup>em2Mcwi+/+</sup></i>SS-<i>Aldh2<sup>em2Mcwi+</sup>/Aldh2<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686666ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686668SS-<i>Cdh13<sup>em1Mcwi-/-</sup></i>SS-<i>Cdh13<sup>em1Mcwi-</sup>/Cdh13<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2018-09-05)RRID:RGD_5686668ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686670SS-<i>Cdh13<sup>em1Mcwi+/+</sup></i>SS-<i>Cdh13<sup>em1Mcwi+</sup>/Cdh13<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686670ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686672SS-<i>Cyp1a1<sup>em1Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi-</sup>/Cyp1a1<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2019-11-06)RRID:RGD_5686672ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686676SS-<i>Cyp1a1<sup>em1Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em1Mcwi+</sup>/Cyp1a1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686676ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686678SS-<i>Cyp1a1<sup>em2Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi-</sup>/Cyp1a1<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686678ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686680SS-<i>Cyp1a1<sup>em2Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em2Mcwi+</sup>/Cyp1a1<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686680ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686684SS-<i>Cyp1a1<sup>em5Mcwi-/-</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi-</sup>/Cyp1a1<sup>em5Mcwi-</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)RRID:RGD_5686684ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686687SS-<i>Cyp1a1<sup>em5Mcwi+/+</sup></i>SS-<i>Cyp1a1<sup>em5Mcwi+</sup>/Cyp1a1<sup>em5Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686687ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686689SS-<i>Prokr1<sup>em1Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em1Mcwi-</sup>/Prokr1<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)RRID:RGD_5686689ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686692SS-<i>Prokr1<sup>em1Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em1Mcwi+</sup>/Prokr1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686692ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686695SS-<i>Prokr1<sup>em2Mcwi-/-</sup></i>SS-<i>Prokr1<sup>em2Mcwi-</sup>/Prokr1<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)RRID:RGD_5686695ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686697SS-<i>Prokr1<sup>em2Mcwi+/+</sup></i>SS-<i>Prokr1<sup>em2Mcwi+</sup>/Prokr1<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686697ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686700SS-<i>Kcnq1<sup>em14Mcwi-/-</sup></i>SS-<i>Kcnq1<sup>em14Mcwi-</sup>/Kcnq1<sup>em14Mcwi-</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2018-09-05)RRID:RGD_5686700ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686702SS-<i>Kcnq1<sup>em14Mcwi+/+</sup></i>SS-<i>Kcnq1<sup>em14Mcwi+</sup>/Kcnq1<sup>em14Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686702ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686704SS-<i>Msra<sup>em3Mcwi-/-</sup></i>SS-<i>Msra<sup>em3Mcwi-</sup>/Msra<sup>em3Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686704ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686706SS-<i>Msra<sup>em3Mcwi+/+</sup></i>SS-<i>Msra<sup>em3Mcwi+</sup>/Msra<sup>em3Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686706ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686708SS-<i>Msra<sup>em4Mcwi-/-</sup></i>SS-<i>Msra<sup>em4Mcwi-</sup>/Msra<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686708ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686710SS-<i>Msra<sup>em4Mcwi+/+</sup></i>SS-<i>Msra<sup>em4Mcwi+</sup>/Msra<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686710ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686713SS-<i>Mstn<sup>em1Mcwi-/-</sup></i>SS-<i>Mstn<sup>em1Mcwi-</sup>/Mstn<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2019-07-26)Mstn<sup>em1Mcwi</sup>5143964RRID:RGD_5686713ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686715SS-<i>Mstn<sup>em1Mcwi+/+</sup></i>SS-<i>Mstn<sup>em1Mcwi+</sup>/Mstn<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686715ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686718SS-<i>Mstn<sup>em3Mcwi-/-</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2019-07-26)Mstn<sup>em3Mcwi</sup>5131962RRID:RGD_5686718ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686721SS-<i>Mstn<sup>em3Mcwi+/+</sup></i>SS-<i>Mstn<sup>em3Mcwi+</sup>/Mstn<sup>em3Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686721ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686723SS-<i>Mstn<sup>em3Mcwi-/+</sup></i>SS-<i>Mstn<sup>em3Mcwi-</sup>/Mstn<sup>em3Mcwi+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686723ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686725SS-<i>Nppa<sup>em4Mcwi-/-</sup></i>SS-<i>Nppa<sup>em4Mcwi-</sup>/Nppa<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686725ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686728SS-<i>Nppa<sup>em4Mcwi+/+</sup></i>SS-<i>Nppa<sup>em4Mcwi+</sup></i>/<i>Nppa<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686728ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686730SS-<i>Nppb<sup>em2Mcwi-/-</sup></i>SS-<i>Nppb<sup>em2Mcwi-</sup></i>/<i>Nppb<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantUnknownNppb<sup>em2Mcwi</sup>5508324RRID:RGD_5686730ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686732SS-<i>Nppb<sup>em2Mcwi+/+</sup></i>SS-<i>Nppb<sup>em2Mcwi+</sup></i>/<i>Nppb<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686732ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686734SS-<i>Nppb<sup>em4Mcwi-/-</sup></i>SS-<i>Nppb<sup>em4Mcwi-</sup>/Nppb<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2018-09-05)RRID:RGD_5686734ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686736SS-<i>Nppb<sup>em4Mcwi+/+</sup></i>SS-<i>Nppb<sup>em4Mcwi+</sup>/Nppb<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686736ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686738SS-<i>Plcd3<sup>em4Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em4Mcwi-</sup>/Plcd3<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686738ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686740SS-<i>Plcd3<sup>em4Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em4Mcwi+</sup>/Plcd3<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686740ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686742SS-<i>Plcd3<sup>em7Mcwi-/-</sup></i>SS-<i>Plcd3<sup>em7Mcwi-</sup>/Plcd3<sup>em7Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686742ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686744SS-<i>Plcd3<sup>em7Mcwi+/+</sup></i>SS-<i>Plcd3<sup>em7Mcwi+</sup>/Plcd3<sup>em7Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686744ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686747SS-<i>Plekha7<sup>em1Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em1Mcwi-</sup>/Plekha7<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686747ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686749SS-<i>Plekha7<sup>em1Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em1Mcwi+</sup>/Plekha7<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686749ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686758SS-<i>Plekha7<sup>em4Mcwi-/-</sup></i>SS-<i>Plekha7<sup>em4Mcwi-</sup>/Plekha7<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Plekha7<sup>em4Mcwi</sup>5143979RRID:RGD_5686758ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686760SS-<i>Plekha7<sup>em4Mcwi+/+</sup></i>SS-<i>Plekha7<sup>em4Mcwi+</sup>/Plekha7<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686760ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686762SS-<i>Plod1<sup>em1Mcwi-/-</sup></i>SS-<i>Plod1<sup>em1Mcwi-</sup>/Plod1<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2018-09-05)RRID:RGD_5686762ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686764SS-<i>Plod1<sup>em1Mcwi+/+</sup></i>SS-<i>Plod1<sup>em1Mcwi+</sup>/Plod1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686764ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686766SS-<i>Sh2b3<sup>em2Mcwi-/-</sup></i>SS-<i>Sh2b3<sup>em2Mcwi-</sup>/Sh2b3<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Sh2b3<sup>em2Mcwi</sup>5509982RRID:RGD_5686766ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686768SS-<i>Slc30a8<sup>em1Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em1Mcwi-</sup>/Slc30a8<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686768ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686770SS-<i>Slc30a8<sup>em1Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em1Mcwi+</sup>/Slc30a8<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686770ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686772SS-<i>Slc30a8<sup>em2Mcwi-/-</sup></i>SS-<i>Slc30a8<sup>em2Mcwi-</sup>/Slc30a8<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686772ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686776SS-<i>Slc30a8<sup>em2Mcwi+/+</sup></i>SS-<i>Slc30a8<sup>em2Mcwi+</sup>/Slc30a8<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686776ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686778SS-<i>Stk39<sup>em2Mcwi-/-</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)Stk39<sup>em2Mcwi</sup>5509978RRID:RGD_5686778ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686780SS-<i>Stk39<sup>em2Mcwi+/+</sup></i>SS-<i>Stk39<sup>em2Mcwi+</sup>/Stk39<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686780ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686782SS-<i>Stk39<sup>em2Mcwi-/+</sup></i>SS-<i>Stk39<sup>em2Mcwi-</sup>/Stk39<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)Stk39<sup>em2Mcwi</sup>5509978RRID:RGD_5686782ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686784SS-<i>Tcf7l2<sup>em1Mcwi-/-</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)Tcf7l2<sup>em1Mcwi</sup>5509981RRID:RGD_5686784ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686786SS-<i>Tcf7l2<sup>em1Mcwi+/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi+</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686786ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686788SS-<i>Tcf7l2<sup>em1Mcwi-/+</sup></i>SS-<i>Tcf7l2<sup>em1Mcwi-</sup>/Tcf7l2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)Tcf7l2<sup>em1Mcwi</sup>5509981RRID:RGD_5686788ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686790SS-<i>Ulk3<sup>em1Mcwi-/-</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686790ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686792SS-<i>Ulk3<sup>em1Mcwi+/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi+</sup>/Ulk3<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686792ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686794SS-<i>Ulk3<sup>em1Mcwi-/+</sup></i>SS-<i>Ulk3<sup>em1Mcwi-</sup>/Ulk3<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686794ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686797SS-<i>Wdr72<sup>em1Mcwi-/-</sup></i>SS-<i>Wdr72<sup>em1Mcwi-</sup>/Wdr72<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5686797ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686799SS-<i>Wdr72<sup>em1Mcwi+/+</sup></i>SS-<i>Wdr72<sup>em1Mcwi+</sup>/Wdr72<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5686799ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5686826ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurDepartment of Pediatric Surgery, Erasmus Medical Center, Rotterdam, NetherlandscongenicUnknownRRID:RGD_5686826Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1, Rf-3 QTL region of chr 3, and Rf4 QTL region of chr 14 are introgressed in this strain.5686829ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat6-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_5686829Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.5686832ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Got102-D3Got149</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_5686832Multicongenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D3Rat84-D3Rat59</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/Eur and ACI.FHH-(<i>D1Mit18-D1Rat90</i>)(<i>D14Mit11-D14Rat33</i>)(<i>D14Rat65-D14Rat90</i>)/EurMcwi.5687688FHH-Tg(CAG-Rab38)1McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_5687688A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion mapped to chromosome 14, roughly 13.2-Mbp, and was more than 100-kbp away from the nearest gene (downstream of Antrx2).5687689FHH-Tg(CAG-Rab38)2McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_5687689A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion in line 2 was found to be within a long interspersed nuclear element (LINE) sequence and could not be unambiguously mapped to a specific chromosome location.5687969ACI.BN-(<i>D2Rat251-D2Mgh3</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5687969This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.5687971ACI.BN-(<i>D2Rat10-D2Rat202</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5687971This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background.5687973ACI.BN-(<i>D18Rat30-D18Rat89</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5687973This congenic strain contains a region of BN/SsNHsd chromosome 18 transferred to the ACI/SegHsd strain background.5687974SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinctCyp4a2<sup>em1Mcwi</sup>5687724RRID:RGD_5687974This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.5687975SS-<i>Prex1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Prex1<sup>em2Mcwi</sup>5687719RRID:RGD_5687975This strain was produced by injecting ZFNs targeting the sequence CAGTACTTCCGCTTCcatgcgGACGAGGAGATGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 16.5687977SS-<i>Acad10<sup>em2Mcwi+/+</sup></i>SS-<i>Acad10<sup>em2Mcwi+</sup>/Acad10<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5687977ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687979SS-<i>Acad10<sup>em2Mcwi-/-</sup></i>SS-<i>Acad10<sup>em2Mcwi-</sup>/Acad10<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-07-18)Acad10<sup>em2Mcwi</sup>5131905RRID:RGD_5687979ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The homozygous mutant carries a 10-bp frameshift deletion in exon 2.5687981SS-<i>Alms1<sup>em1Mcwi-/-</sup></i>SS-<i>Alms1<sup>em1Mcwi-</sup>/Alms1<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)Alms1<sup>em1Mcwi</sup>5131906RRID:RGD_5687981ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687983SS-<i>Alms1<sup>em1Mcwi+/+</sup></i>SS-<i>Alms1<sup>em1Mcwi+</sup>/Alms1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5687983ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687985SS-<i>Apoe<sup>em7Mcwi+/+</sup></i>SS-<i>Apoe<sup>em7Mcwi+</sup>/Apoe<sup>em7Mcwi+</sup></i>PhysGen KnockoutsmutantExtinctRRID:RGD_5687985ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687987SS-<i>Apoe<sup>em7Mcwi-/-</sup></i>SS-<i>Apoe<sup>em7Mcwi-</sup>/Apoe<sup>em7Mcwi-</sup></i>PhysGen KnockoutsmutantExtinctRRID:RGD_5687987ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687989SS-<i>Apoe<sup>em8Mcwi-/-</sup></i>SS-<i>Apoe<sup>em8Mcwi-</sup>/Apoe<sup>em8Mcwi-</sup></i>PhysGen KnockoutsmutantExtinctRRID:RGD_5687989ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687992SS-<i>Apoe<sup>em8Mcwi+/+</sup></i>SS-<i>Apoe<sup>em8Mcwi+</sup>/Apoe<sup>em8Mcwi+</sup></i>PhysGen KnockoutsmutantExtinctRRID:RGD_5687992ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687994SS-<i>Bcas3<sup>em4Mcwi+/+</sup></i>SS-<i>Bcas3<sup>em4Mcwi+</sup>/Bcas3<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5687994ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687996SS-<i>Bcas3<sup>em4Mcwi-/-</sup></i>SS-<i>Bcas3<sup>em4Mcwi-</sup>/Bcas3<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5687996ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5687998SS-<i>Cyba<sup>em1Mcwi-/-</sup></i>SS-<i>Cyba<sup>em1Mcwi-</sup>/Cyba<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)RRID:RGD_5687998ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688000SS-<i>Cyba<sup>em1Mcwi+/+</sup></i>SS-<i>Cyba<sup>em1Mcwi+</sup>/Cyba<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688000ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688002SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi+</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantExtinctRRID:RGD_5688002ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688004SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/-</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantExtinctRRID:RGD_5688004ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688006SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-/+</sup></i>SS-Chr 5<sup>BN</sup>-<i>Cyp4a2<sup>em1Mcwi-</sup>/Cyp4a2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantExtinctRRID:RGD_5688006ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688008SS-<i>Ets1<sup>em1Mcwi+/+</sup></i>SS-<i>Ets1<sup>em1Mcwi+</sup>/Ets1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688008ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688010SS-<i>Ets1<sup>em1Mcwi-/+</sup></i>SS-<i>Ets1<sup>em1Mcwi-</sup>/Ets1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)Ets1<sup>em1Mcwi</sup>4139856RRID:RGD_5688010ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688012SS-<i>Gpr183<sup>em1Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em1Mcwi-</sup>/Gpr183<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688012ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688014SS-<i>Gpr183<sup>em1Mcwi+/+</sup>SS-<i>Gpr183<sup>em1Mcwi+</sup>/Gpr183<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688014ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688016SS-<i>Gpr183<sup>em2Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em2Mcwi-</sup>/Gpr183<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688016ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688018SS-<i>Gpr183<sup>em2Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em2Mcwi+</sup>/Gpr183<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688018ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688020SS-<i>Gpr183<sup>em3Mcwi-/-</sup></i>SS-<i>Gpr183<sup>em3Mcwi-</sup>/Gpr183<sup>em3Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688020ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688022SS-<i>Gpr183<sup>em3Mcwi+/+</sup></i>SS-<i>Gpr183<sup>em3Mcwi+</sup>/Gpr183<sup>em3Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688022ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688024SS-<i>Itga9<sup>em1Mcwi+/+</sup></i>SS-<i>Itga9<sup>em1Mcwi+</sup>/Itga9<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688024ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688026SS-<i>Mas1<sup>em1Mcwi+/+</sup></i>SS-<i>Mas1<sup>em1Mcwi+</sup>/Mas1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688026ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688028SS-<i>Mas1<sup>em1Mcwi-/-</sup></i>SS-<i>Mas1<sup>em1Mcwi-</sup>/Mas1<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2017-07-18)RRID:RGD_5688028ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688030SS-<i>Mmp2<sup>em1Mcwi-/-</sup></i>SS-<i>Mmp2<sup>em1Mcwi-</sup>/Mmp2<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantUnknownMmp2<sup>em2Mcwi</sup>4139869RRID:RGD_5688030ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.5688032SS-<i>Mmp2<sup>em1Mcwi+/+</sup></i>SS-<i>Mmp2<sup>em1Mcwi+</sup>/Mmp2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688032ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688034SS-<i>Mmp2<sup>em2Mcwi-/-</sup></i>SS-<i>Mmp2<sup>em2Mcwi-</sup>/Mmp2<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals (as of 2017-07-18)RRID:RGD_5688034ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688037SS-<i>Mmp2<sup>em2Mcwi+/+</sup></i>SS-<i>Mmp2<sup>em2Mcwi+</sup>/Mmp2<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688037ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688039SS-<i>Mthfr<sup>em1Mcwi+/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi+</sup>/Mthfr<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688039ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688041SS-<i>Mthfr<sup>em1Mcwi-/+</sup></i>SS-<i>Mthfr<sup>em1Mcwi-</sup>/Mthfr<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688041ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688043SS-<i>Nckap5<sup>em1Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em1Mcwi-</sup>/Nckap5<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)Nckap5<sup>em1Mcwi</sup>4139859RRID:RGD_5688043ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688045SS-<i>Nckap5<sup>em1Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em1Mcwi+</sup>/Nckap5<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688045ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688047SS-<i>Nckap5<sup>em2Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em2Mcwi-</sup>/Nckap5<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)Nckap5<sup>em2Mcwi</sup>4139862RRID:RGD_5688047ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688049SS-<i>Nckap5<sup>em2Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em2Mcwi+</sup>/Nckap5<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688049ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688051SS-<i>Nckap5<sup>em3Mcwi-/-</sup></i>SS-<i>Nckap5<sup>em3Mcwi-</sup>/Nckap5<sup>em3Mcwi-</sup></i>PhysGen KnockoutsmutantExtinct (as of 2018-09-05)Nckap5<sup>em3Mcwi</sup>4139861RRID:RGD_5688051ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688053SS-<i>Nckap5<sup>em3Mcwi+/+</sup></i>SS-<i>Nckap5<sup>em3Mcwi+</sup>/Nckap5<sup>em3Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688053ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688059SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/-</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi-</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688059ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688061SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi+</sup>/Nckap5<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688061ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688063SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-/+</sup></i>SS.BN-(<i>D13Rat20-D13Got22</i>)/Mcwi-<i>Nckap5<sup>em4Mcwi-</sup>/Nckap5<sup>em4Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688063ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688066SS-<i>Ncf2<sup>em1Mcwi-/-</sup></i>SS-<i>Ncf2<sup>em1Mcwi-</sup>/Ncf2<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Ncf2<sup>em1Mcwi</sup>5144089RRID:RGD_5688066ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688069SS-<i>Ncf2<sup>em1Mcwi+/+</sup></i>SS-<i>Ncf2<sup>em1Mcwi+</sup>/Ncf2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688069ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688074SS-<i>Nox4<sup>em2Mcwi-/-</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2019-01-03)Nox4<sup>em2Mcwi</sup>4139868RRID:RGD_5688074ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. This homozygous mutant carries an 8-bp frameshift deletion in exon 7 of rat Nox4.5688077SS-<i>Nox4<sup>em2Mcwi+/+</sup></i>SS-<i>Nox4<sup>em2Mcwi+</sup>/Nox4<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688077ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688080SS-<i>Nox4<sup>em2Mcwi-/+</sup></i>SS-<i>Nox4<sup>em2Mcwi-</sup>/Nox4<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2019-07-26)Nox4<sup>em2Mcwi</sup>4139868RRID:RGD_5688080ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688083SS-<i>Prex1<sup>em2Mcwi-/-</sup></i>SS-<i>Prex1<sup>em2Mcwi-</sup>/Prex1<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688083ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688087FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-/-</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi-</sup>/Rab38<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Rab38<sup>em1Mcwi</sup>4139867RRID:RGD_5688087ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.5688090FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+/+</sup></i>FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi-<i>Rab38<sup>em1Mcwi+</sup>/Rab38<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRab38628752RRID:RGD_5688090ZFN mutant founders were backcrossed with FHH.BN-(<i>D1Hmgc14-D1Hmgc15</i>)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688092SS-<i>Rag1<sup>em1Mcwi-/-</sup></i>SS-<i>Rag1<sup>em1Mcwi-</sup>/Rag1<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688092ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688094SS-<i>Rag1<sup>em1Mcwi+/+</sup></i>SS-<i>Rag1<sup>em1Mcwi+</sup>/Rag1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688094ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688096SS-<i>Rag1<sup>em2Mcwi-/-</sup></i>SS-<i>Rag1<sup>em2Mcwi-</sup>/Rag1<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688096ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688098SS-<i>Rag1<sup>em2Mcwi+/+</sup></i>SS-<i>Rag1<sup>em2Mcwi+</sup>/Rag1<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688098ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688100SS-<i>Ren<sup>em1Mcwi+/+</sup></i>SS-<i>Ren<sup>em1Mcwi+</sup>/Ren<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688100ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688102SS-<i>Ren<sup>em1Mcwi-/-</sup></i>SS-<i>Ren<sup>em1Mcwi-</sup>/Ren<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Ren<sup>em1Mcwi</sup>4139863RRID:RGD_5688102ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688107FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-/-</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi-</sup>/Sorcs1<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Sorcs1<sup>em1Mcwi</sup>4139864RRID:RGD_5688107ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is a 14-bp frameshift deletion mutation in exon 7.5688109FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+/+</sup></i>FHH-Chr 1<sup>BN</sup>-<i>Sorcs1<sup>em1Mcwi+</sup>/Sorcs1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688109ZFN mutant founders were backcrossed with FHH-Chr 1<sup>BN</sup>/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688111SS-<i>Tfdp2<sup>em2Mcwi-/-</sup></i>SS-<i>Tfdp2<sup>em2Mcwi-</sup>/Tfdp2<sup>em2Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688111ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688113SS-<i>Tfdp2<sup>em2Mcwi+/+</sup></i>SS-<i>Tfdp2<sup>em2Mcwi+</sup>/Tfdp2<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688113ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688116SS-<i>Tgfb1<sup>em1Mcwi+/+</sup></i>SS-<i>Tgfb1<sup>em1Mcwi+</sup>/Tgfb1<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688116ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.5688119SS-<i>Tgfb1<sup>em3Mcwi+/-</sup></i>SS-<i>Tgfb1<sup>em3Mcwi+</sup>/Tgfb1<sup>em3Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-08-24)RRID:RGD_5688119ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained heterozygous breeders.5688121SS-<i>Ube2q2<sup>em3Mcwi-/-</sup></i>SS-<i>Ube2q2<sup>em3Mcwi-</sup>/Ube2q2<sup>em3Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688121ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688123SS-<i>Ube2q2<sup>em3Mcwi+/+</sup></i>SS-<i>Ube2q2<sup>em3Mcwi+</sup>/Ube2q2<sup>em3Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_5688123ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688125SS-<i>Ulk4<sup>em3Mcwi-/-</sup></i>SS-<i>Ulk4<sup>em3Mcwi-</sup>/Ulk4<sup>em3Mcwi-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2018-09-05)RRID:RGD_5688125ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.5688396ACI.BN-(<i>D3Rat80-D3Rat3</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5688396This congenic strain contains a region of BN/SsNHsd chromosome 3 transferred to the ACI/SegHsd strain background.5688400ACI.BN-(<i>D4Rat5-D4Got131</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5688400This congenic strain contains a region of BN/SsNHsd chromosome 4 transferred to the ACI/SegHsd strain background.5688402ACI.BN-(<i>D6Rat148-D6Rat109</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5688402This congenic strain contains a region of BN/SsNHsd chromosome 6 transferred to the ACI/SegHsd strain background.5688405ACI.COP-(<i>D5Rat12-D5Rat205</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5688405This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.5688407ACI.COP-(<i>D5Rat28-D5Rat205</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5688407This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.5688409ACI.COP-(<i>D5Rat28-D5Rat36</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_5688409This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background.6218997SHR/NCrlAnraBehavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, BrazilinbredUnknownRRID:RGD_6218997These were originally from Harvard University, Boston MA, then at UNESP, Botucatu, SP, Brazil, now maintained at Behavior Genetics Laboratory, SC, Brazil6219002LEW/HsdUnibAnraBehavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, BrazilinbredUnknownRRID:RGD_6219002LEW rats originally from Harlan Sprague Dawley, IN then bred at UNICAMP (Campinas, SP Brazil) now maintained at Behavior Genetics Laboratory, SC, Brazil6478788STOCK-<i>Tp53<sup>tm1(EGFP-Pac)Qly</sup></i>/Rrrcp53 knockout rat<a href=http://www.rrrc.us/Strain/?x=485>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01)Tp53|Tp53<sup>tm1(EGFP-Pac)Qly</sup>3889|12792957RRID:RRRC_00485This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5 prime and 1.6- kb 3 prime homology arms and a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting F344 blastocysts. Founder animals were mated with SD rats.6478789LEW-Tg(CAG-EGFP)YsRrrc<a href=http://www.rrrc.us/Strain/?x=296>Rat Resource and Research Center</a>transgenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2018-07-16)RRID:RRRC_00296Transgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegalovirus enhancer, chicken b-actin enhancer-promoter and rabbit b-globin poly(A) signal.6478791F344-Tg(UBC-EGFP)F455Rrrc<a href=http://www.rrrc.us/Strain/?x=307>Rat Resource and Research Center</a>transgenicLive Animals; Cryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00307This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. Animals that exhibited fluorescence of tails were mated. Offspring were bred with Lewis wild-type mates to map transgene location. Animals were backcrossed 10 generations onto F344.6480190NAft:HSHeterogeneous stockPsychiatry and Forensic Medicine, Institute of Neurosciences, School of Medicine, Autonomous University of Barcelona, Barcelona, SpainoutbredUnknownRRID:RGD_6480190From Dr. Eva Redei, Center for Comparative Medicine, Northwestern University to Dr. Alberto Fernandez-Teruel, Barcelona6480205MWF-Chr 6<sup>SHR</sup> Chr 8<sup>SHR</sup>/RkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, GermanyconsomicUnknownRRID:RGD_6480205Chr 8 and chr 6 were introgressed from albuminuria-resistant SHR/FubRkb into the sensitive isogenic background of MWF/FubRkb6480210SHR-Chr 8<sup>MWF</sup>/RkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, GermanyconsomicUnknownRRID:RGD_6480210SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing6480218AR-<i>Ednrb<sup>sl</i></sup>/HkvAganglionosis ratDepartment of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, JapanmutantUnknownEdnrb<sup>sl</sup>10755424RRID:RGD_6480218Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR), provided to Dr. Takashi Agui by Dr. Ozaki, National Institute for Physiological Sciences, Okazaki, Japan6480220LEH/HkvAganglionosis ratDepartment of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, JapanmutantCryopreserved Embryo (as of 2016-11-15)Internal MedicineEdnrb<sup>sl</sup>10755424RRID:RGD_6480220This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. AR-derived Ednrb<sup>sl</sup> was introduced into Long-Evans by Dr. Ozaki (NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm), and this rat was provided to Dr. Agui at Hokkaido University and inbred line was established by sib mating.6480223F344.AR-<i>Ednrb<sup>sl</sup></i>/HkvAganglionosis ratDepartment of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, JapanmutantCryopreserved Embryo (as of 2016-10-28)Ednrb<sup>sl</sup>10755424RRID:RGD_6480223This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. This congenic strain was established by backcrossing (over 10 generations) of AR rat to F344/NSlc.6480863BBDR/RhwRrrc<a href=http://www.rrrc.us/Strain/?x=463>Rat Resource & Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00463BBDR/Rhw from R. H. William Laboratory, University of Washington, Seattle, Washington to Rat Resource & Research Center6480866BN-Chr 13<sup>LH</sup>/MavRrrcLaboratoire de Physiologie, Lyon Cedex , FranceconsomicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00395Chr 13 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped6480868BN-Chr 2<sup>LH</sup>/MavRrrcLaboratoire de Physiologie, Lyon Cedex , FranceconsomicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00396Chr 2 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped6480874COP.DA-(<I>D16Rat12-D16Rat90</I>)/McoRrrc<a href=http://www.rrrc.us/Strain/?x=444>Rat Resource & Research Center</a>congenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00444Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. Transferred from Medical College of Toledo to Rat Resource & Research Center6482243WI-<i>Cit<sup>fhJjlo</sup></i>/Rrrcflathead ratDepartment of Physiology and Neurobiology, University of ConnecticutmutantCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-07-21)Cit<sup>fhJjlo</sup>13204831RRID:RRRC_00322Flathead rat was discovered at University of Connecticut in an inbred colony of Wistar rats. Spontaneous single G deletion in exon 1 of citron kinase (Cit) confers a premature stop codon and lack of citron kinase protein.6482244SS-Tg(APOA1)116OpazRrrcWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00282SS/JrHsd embryos were microinjected with human APOA1 C3 promoter6482245SS-Tg(Atp1a1)24OpazRrrcWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24)RRID:RRRC_00280SS/JrHsd embryos were microinjected with rat alpha1 Na,K-ATPase promoter (-1288 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase6482247FDIO/Rrrc<a href=http://www.rrrc.us/Strain/?x=60>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2022-10-18)RRID:RRRC_00060Cross between F344 (lean phenotype) and SDDIO (diet-induced obese phenotype) then inbred for 6 generations with maintenance of obese phenotype.6482252F344-Tg(Pgk1-EGFP)/Rrrc<a href=http://www.rrrc.us/Strain/?x=53>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00053Multiple random integration of EGFP gene under the control of the PGK promoter.6482254Gunn-<i>Ugt1a1<sup>j</i></sup>/BluHsdRrrcGunn rat<a href=http://www.rrrc.us/Strain/?x=341&log=yes>Rat Resource and Research Center</a>mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-09-15)Ugt1a1<sup>j</sup>13432064RRID:RRRC_00341This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life.6482256HS/RrrcHigh Self-Administration<a href=http://www.rrrc.us/Strain/?x=537>Rat Resource and Research Center</a>inbredCryorecovery (as of 2019-02-01)RRID:RRRC_00537Developed from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.6482259LS/RrrcLow Self-Administration<a href=http://www.rrrc.us/Strain/?x=536>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-01-13)RRID:RRRC_00536Developed from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations.6482268BRAT-<i>Avp<sup>di</i></sup>/BluHsdRrrcBrattleboromutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21)Avp<sup>di</sup>13627261RRID:RRRC_00445Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Brattleboro rats transferred to the RRRC in 2009.6482271LEW.Cg-<i>Foxn1</i><sup>rnu</sup>/NRrrc<a href=http://www.rrrc.us/Strain/?x=363>Rat Resource and Research Center</a>congenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00363The NIH nude rat was developed in 1979-1980 at the NIH through a series of matings involving the following inbred rat strains: BN/SsN, MR/N, BUF/N, WN/N, ACI/N, WKY/N, M520/N, and F344/N. Received from the National Institute of Health by NCI in 1983. The nude mutation was subsequently backcrossed 17 generations to the Lewis inbred strain.6482282LEW-Tg(EGFP)463-5RrrcLewis- GFP transgenic<a href=http://www.rrrc.us/Strain/?x=83>Rat Resource and Research Center</a>transgenicCryopreserved SpermRRID:RRRC_00083insertion of EGFP transgene with Ubiquitin C promoter6482284LEW-Tg(EGFP)456-9RrrcLewis- GFP transgenic<a href=http://www.rrrc.us/Strain/?x=84>Rat Resource and Research Center</a>transgenicCryopreserved SpermRRID:RRRC_00084insertion of EGFP transgene with Ubiquitin C promoter6482286LEW-Tg(EGFP)458-7RrrcLewis- GFP transgenic<a href=http://www.rrrc.us/Strain/?x=86>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00086insertion of EGFP transgene with Ubiquitin C promoter6482288LEW-Tg(EGFP)463-1RrrcLewis- GFP transgenic<a href=http://www.rrrc.us/Strain/?x=85>Rat Resource and Research Center</a>transgenicCryopreserved SpermRRID:RRRC_00085insertion of EGFP transgene with Ubiquitin C promoter6482290LEW-Tg(EGFP)455RrrcLewis- GFP transgenic<a href=http://www.rrrc.us/Strain/?x=62>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00062This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos.6482292LEW-Tg((ROSA)26Sor-lacZ)15Jmsk<a href=http://www.rrrc.us/Strain/?x=297>Rat Resource and Research Center</a>transgenicCryopreserved Embryo (as of 2017-08-08)RRID:RRRC_00297This strain expresses LacZ ubiquitously driven by the ROSA26 promoter established at Jichi Medical School.6482294LH-Chr 13<sup>BN</sup>/MavRrrc<a href=http://www.rrrc.us/Strain/?x=393>Rat Resource and Research Center</a>consomicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00393Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped6482296LH-Chr 17<sup>BN</sup>/MavRrrc<a href=http://www.rrrc.us/Strain/?x=394>Rat Resource and Research Center</a>consomicCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00394Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped6482298MWF/ZtmRrrcMunich Wistar Fromter<a href=http://www.rrrc.us/Strain/?x=482>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01)RRID:RRRC_00482From outbred Wistar rats selected for large numbers of superficial glomeruli.6482643WIN/RhwRrrc<a href=http://www.rrrc.us/Strain/?x=481>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00481Submitted to Rat Resource & Research Center6482645SD-Tg(Rho-S334X)3LavRrrc<a href=http://www.rrrc.us/Strain/?x=539>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-08-17)RRID:RRRC_00539This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated rhodopsin protein. Submitted to Rat Resource & Research Center6482654ACI.BN-(<i>D7Rat36-D7Rat11</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_6482654This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.6482674HIS/NdkRrrcHigh-Saccharin-Consuming (HiS) Rat<a href=http://www.rrrc.us/Strain/?x=366>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00366The Occidental HiS (high-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that voluntarily consumed high levels of saccharin.This male was mated to several Holtzman Sprague-Dawley females and offspring displaying high saccharin consumption were selected. Selective breeding was continued in which offspring with high saccharin consumption were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.6482676LOS/NdkRrrcLow-Saccharin-Consuming (HiS) Rat<a href=http://www.rrrc.us/Strain/?x=440>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved SpermRRID:RRRC_00440The Occidental LoS (low-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that did not voluntarily consume saccharin. This male was mated to several Holtzman Sprague-Dawley females and offspring displaying low saccharin consumption were selected. Selective breeding was continued in which offspring with low saccharin consumption (see phenotyping protocol) were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations.6482680SD-Tg(MMTV-Erbb2)1UwmRrrc<a href=http://www.rrrc.us/Strain/?x=365>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-12)Erbb22561RRID:RRRC_00365Hsd:SD background carrying a transgene which produces over-expression of the rat Erbb2 proto-oncogene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat.6483453SS-<i>Dguok<sup>em2Mcwi</sup></i>Medical College of Wisconsin, Milwaukee WImutantCryopreserved Sperm (as of 2021-11-03)Dguok<sup>em2Mcwi</sup>5508354RRID:RGD_6483453This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)6483454SS-<i>Dguok<sup>em1Mcwi</sup></i>Medical College of Wisconsin, Milwaukee WImutantCryopreserved Sperm (as of 2017-01-26)Dguok<sup>em1Mcwi</sup>5508345RRID:RGD_6483454This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105)6483455SS-<i>Dguok<sup>em3Mcwi</sup></i>Medical College of Wisconsin, Milwaukee WImutantCryopreserved SpermDguok<sup>em3Mcwi</sup>5508325RRID:RGD_6483455This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc)6483846HsdFcen:WIWistarBuenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, ArgentinaoutbredUnknownRRID:RGD_6483846Descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan and now maintained at School of Science, Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, Argentina6484519SS-<i>ROSA26<sup>em1(SB11)Mcwi</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2017-08-08)ROSA26<sup>em1(SB11)Mcwi</sup>6484518RRID:RGD_6484519This strain was produced by ZFN-stimulated knockin in the rat ROSA26 locus. ZFNs targeting the sequence CCTTCCCCCTTCTTCcctcgtGATCTGCAACTGGAGTCT were injected into SS/JrHsdMcwi rat embryos along with a plasmid template incorporating the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA, and SV40 polyadenylation signal to integrate the transgene by homologous recombination. The resulting animal was confirmed by sequencing both junctions to harbor the SB11 gene knocked into the rat locus and expresses SB11 transposase in every cell by immunohistochemistry. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.6484559SS-<i>Slc34a1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Slc34a1<sup>em1Mcwi</sup>5687699RRID:RGD_6484559This strain was produced by injecting ZFNs targeting the sequence CGTGCTCAGCTCTGCCTTccaactGGCCGGAGGTAGGGCCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp deletion in exon 4.6484560SS-<i>Pdc<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Pdc<sup>em2Mcwi</sup>5687695RRID:RGD_6484560This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 5.6484561SS-<i>Comt<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Comt<sup>em1Mcwi</sup>5687725RRID:RGD_6484561This strain was produced by injecting ZFNs targeting the sequence CTGTTCCAGGTCACCATCctcaatGGGGCATCCCAGGATCTT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 4.6484562SS-<i>Fgf5<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Fgf5<sup>em1Mcwi</sup>5687720RRID:RGD_6484562This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.6484563SS-<i>Cst3<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Cst3<sup>em3Mcwi</sup>5687738RRID:RGD_6484563This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 1.6484564SS-<i>Cd247<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Cd247<sup>em3Mcwi</sup>5687730RRID:RGD_6484564This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.6484565SS-<i>Ldlr<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Ldlr<sup>em3Mcwi</sup>5144082RRID:RGD_6484565This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 4.6484566SS-<i>Slc6a12<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Slc6a12<sup>em1Mcwi</sup>5687736RRID:RGD_6484566This strain was produced by injecting ZFNs targeting the sequence GTCTCCCTCTCCAGTatggacAGAAAGGTTACAGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion overlapping exon 26484567FHH-Chr 1<sup>BN</sup>-<i>Sorcs3<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Sorcs3<sup>em1Mcwi</sup>5687731RRID:RGD_6484567This strain was produced by injecting ZFNs targeting the sequence TGCCCGCTCCATTGAcatcagtTCCCTGGTCGTCCAGGAT into FHH-Chr 1BN/Mcwi rat embryos. The resulting mutation is a 33-bp insertion in exon 76484568SS-<i>Cd247<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantExtinctCd247<sup>em5Mcwi</sup>5687713RRID:RGD_6484568This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.6484569SS-<i>Adora2b<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Adora2b<sup>em1Mcwi</sup>5687729RRID:RGD_6484569This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 114-bp deletion in exon 16484570SS-<i>Stc1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Stc1<sup>em2Mcwi</sup>5687722RRID:RGD_6484570This strain was produced by injecting ZFNs targeting the sequence CAGCTGCCCAATCACttctccAACAGGTATCCTGAGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 3.6484571SS-<i>Myadml2<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Myadml2<sup>em5Mcwi</sup>5687726RRID:RGD_6484571This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp frameshift deletion in exon 1.6484572SS-<i>Fgf5<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Fgf5<sup>em5Mcwi</sup>5687727RRID:RGD_6484572This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in exon 1.6484573SS-<i>Clcn6<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Clcn6<sup>em2Mcwi</sup>5687740RRID:RGD_6484573This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13.6484574SS-<i>Umod<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinctUmod<sup>em1Mcwi</sup>5687697RRID:RGD_6484574This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2.6484575SS-<i>Resp18<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Resp18<sup>em3Mcwi</sup>5687714RRID:RGD_6484575This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp substitution in exon 3.6484576SS-<i>Adipoq<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-13)Adipoq<sup>em1Mcwi</sup>5687709RRID:RGD_6484576This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.6484577SS-<i>Gnb3<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Gnb3<sup>em1Mcwi</sup>5687696RRID:RGD_6484577This strain was produced by injecting ZFNs targeting the sequence GGCTCCCTCTCTCCTGGCagtccTTGTGGGACATTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 111-bp deletion overlapping exon 7.6484578SS-<i>Mylip<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Mylip<sup>em1Mcwi</sup>5508347RRID:RGD_6484578This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.6484579SS-Chr 5<sup>BN</sup>-<i>Cyp4a3<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantExtinctCyp4a3<sup>em3Mcwi</sup>5687737RRID:RGD_6484579This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5<sup>BN</sup>/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2.6484580SS-<i>Ldlr<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantExtinct (as of 2017-01-26)Ldlr<sup>em2Mcwi</sup>5144094RRID:RGD_6484580This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 123-bp frameshift deletion in exon 4.6484581SS-<i>Resp18<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Resp18<sup>em2Mcwi</sup>5687705RRID:RGD_6484581This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 3.6484582SS-<i>Cd247<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Cd247<sup>em1Mcwi</sup>5687703RRID:RGD_6484582This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.6484583SS-<i>Nr2f2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Nr2f2<sup>em1Mcwi</sup>5687721RRID:RGD_6484583This strain was produced by injecting ZFNs targeting the sequence CCTTCTTCCCTGACCTGCagatcACGGACCAGGTGGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2.6484584SS-<i>Adipoq<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-13)Adipoq<sup>em2Mcwi</sup>5687716RRID:RGD_6484584This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 1.6484585SS-<i>Slc7a9<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Slc7a9<sup>em2Mcwi</sup>5687701RRID:RGD_6484585This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.6484711SS-<i>Atp2b1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Atp2b1<sup>em2Mcwi</sup>6484707RRID:RGD_6484711This strain was produced by injecting ZFNs targeting the sequence TACCTTCTGGGTTCAgaagagGCCGTGGCTTGCTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 117-bp deletion in intron 8 and exon 9.6484712SS-<i>Lpin1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Lpin1<sup>em1Mcwi</sup>6484709RRID:RGD_6484712This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in exon 3.6484713SS-<i>Cubn<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Cubn<sup>em1Mcwi</sup>6484705RRID:RGD_6484713This strain was produced by injecting ZFNs targeting the sequence CGGGAGTACCTTCAGATTcatgatGGAGACTCCTCAGCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 14.6484714SS-<i>Lss<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Lss<sup>em2Mcwi</sup>6484706RRID:RGD_6484714This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 12-bp deletion in exon 2.6484715SS-<i>Adora2b<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Adora2b<sup>em2Mcwi</sup>5687698RRID:RGD_6484715This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 162-bp deletion in exon 16484716SS-<i>Bcat1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Bcat1<sup>em2Mcwi</sup>6484708RRID:RGD_6484716This strain was produced by injecting ZFNs targeting the sequence CAGTCTGTACATCCGCCCCacattCATCGGGATTGAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is 15-bp deletion in exon 56484717SS-<i>Cacna1h<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Cacna1h<sup>em2Mcwi</sup>6484703RRID:RGD_6484717This strain was produced by injecting ZFNs targeting the sequence CCGACCCACAGTGTCtgggagATCGTGGGGCAGGCAGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 11.6484718SS-<i>Ace<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2017-01-13)Ace<sup>em2Mcwi</sup>6484704RRID:RGD_6484718This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 6.6484719SS-<i>Lepr<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Lepr<sup>em2Mcwi</sup>6484701RRID:RGD_6484719This strain was produced by injecting ZFNs targeting the sequence AGCATCGTACTGCCCacaatgGGACATGGTCACAAG into SS/JrHsdMcwi rat embryos. The resulting mutation was a 16-bp deletion in exon 11, predicted nonsense stop codon 30.6484720SS-<i>Lep<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Lep<sup>em5Mcwi</sup>6484700RRID:RGD_6484720This strain was produced by injecting ZFNs targeting the sequence CTGTGCCTATCCacaaaGTCCAGGATGACACC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.6484721SS-<i>Ace<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-11-12)Ace<sup>em1Mcwi</sup>6484702RRID:RGD_6484721This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 6.6766770BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_6766770This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene; maintained at Medical College of Wisconsin6893382BBDR.BBDP-(<I>D4Mit6-D4Mit7</I>)/RhwMcwi-<i>Il1r1<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2017-01-26)Il1r1<sup>em3Mcwi</sup>6893378RRID:RGD_6893382This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 5.6893383SS-<i>Fyn<sup>em6Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Fyn<sup>em6Mcwi</sup>6893380RRID:RGD_6893383This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp deletion in exon 4.6893384SS-<i>Kcnj11<sup>em9Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Kcnj11<sup>em9Mcwi</sup>6893381RRID:RGD_6893384This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1.6893385SS-<i>Kcnj11<sup>em5Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Kcnj11<sup>em5Mcwi</sup>6893379RRID:RGD_6893385This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 1.6893429SS-<i>Nos3<sup>em8Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Nos3<sup>em8Mcwi</sup>6893421RRID:RGD_6893429This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 109-bp deletion in exon 3.6893430SS-<i>Nat8<sup>em4Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Nat8<sup>em4Mcwi</sup>6893413RRID:RGD_6893430This strain was produced by injecting ZFNs targeting the sequence CACATCCGCCAGTTCCAGgagaggGACTATGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 1.6893431SS-<i>Nos3<sup>em13Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Nos3<sup>em13Mcwi</sup>6893422RRID:RGD_6893431This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 46893432SS-<i>Hvcn1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Hvcn1<sup>em1Mcwi</sup>6893410RRID:RGD_6893432This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.6893433SS-<i>Nos3<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Nos3<sup>em2Mcwi</sup>6893418RRID:RGD_6893433This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3.6893434SS-<i>Kcnj16<sup>em1Mcwi-/-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Kcnj16<sup>em1Mcwi</sup>6893423RRID:RGD_6893434This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.6893435SS-<i>Tfdp2<sup>em6Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Tfdp2<sup>em6Mcwi</sup>6893417RRID:RGD_6893435This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 6.6893436SS-<i>Kcnmb1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Kcnmb1<sup>em1Mcwi</sup>6893415RRID:RGD_6893436This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a net 4-bp deletion in exon 2.6893437BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinctIl1r1<sup>em1Mcwi</sup>6893425RRID:RGD_6893437This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5.6893438SS-<i>Fgf1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Fgf1<sup>em2Mcwi</sup>6893412RRID:RGD_6893438This strain was produced by injecting ZFNs targeting the sequence TTCCAGTTCAGCTGCAGCtcagtGCGGAAAGCGCGGGCGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion in exon 3.6893439SS-<i>Hvcn1<sup>em2Mcwi-/-</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Hvcn1<sup>em2Mcwi</sup>6893419RRID:RGD_6893439This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5.6893440SS-<i>Fyn<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantExtinctFyn<sup>em1Mcwi</sup>6893411RRID:RGD_6893440This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4.6893441SS-<i>Grm7<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Grm7<sup>em2Mcwi</sup>6893416RRID:RGD_6893441This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3.6893442SS-<i>Pparg<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Pparg<sup>em1Mcwi</sup>6893424RRID:RGD_6893442This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.36893443BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi-<i>Il1r1<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantExtinctIl1r1<sup>em2Mcwi</sup>6893414RRID:RGD_6893443This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5.6893444SS-<i>Kcnmb1<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Kcnmb1<sup>em3Mcwi</sup>6893420RRID:RGD_6893444This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2.6893530BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/RhwR. H. William Laboratory, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_6893530Koletsky rat leptin receptor mutant (lepr) from the LA/N-<i>cp</i> was introgressed into the BBDR/Rhw rats by marker-assisted breeding. This was initiated in 2001 by Dr. Hansen and completed in 2007 at the University of Washington, Seattle.6893535BBDR.LA-(<i>D5Rat98-D5Rat233</i>), BBDP-(<i>D4Mit6-D4Mit7</i>)/RhwR. H. William Laboratory, University of Washington, Seattle, WashingtoncongenicUnknownRRID:RGD_6893535Heterozygous BBDR.LA-(<i>D5Rat98-D5Rat233</i>)/Rhw (DR.<sup><i>lepr</sup></i>) were crossed with homozygous BBDR.BBDP-(-(<i>D4Mit6-D4Mit7</i>)/Rhw (DR.<sup><i>Gimap5</sup></i>), to geenrate teh double congenic rats that had mutations for Gimap5 and lepr genes.6893551DA.PVG.1AV1-(<i>D1Rat32-D1Rat51</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_6893551DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.6893554DA.PVG.1AV1-(<i>D1Rat193-D1Rat68</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_6893554DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.6893599SS-<i>Pdc<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Pdc<sup>em3Mcwi</sup>5687712RRID:RGD_6893599This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 47-bp deletion in exon 5.6893600SS-<i>Abcb1b<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-07-24)Abcb1b<sup>em2Mcwi</sup>6893598RRID:RGD_6893600This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4.6902893BB.SHR-(<i>Acsm3-Igf2</i>)/KDept. of Laboratory Animal Science, University of Greifswald, Karlsburg, GermanycongenicUnknownIgf2|Acsm32870|62086RRID:RGD_6902893Congenics extablished as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats6903879SS/NEisSlcinbredUnknownRRID:RGD_69038791962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan6903881SR/NEisSlcinbredUnknownRRID:RGD_69038811962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan6903902WF.COP-(<i>D2Uwm14-D2Uwm13</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_6903902A segment of chromosome 2 was transferred from COP into the WF background.6903904WF.COP-(<i>D2Uwm17-D2Rat16</i>)/UwmUniversity of Wisconsin, Madison, Wisconsin, USAcongenicUnknownRRID:RGD_6903904A segment of chromosome 2 was transferred from COP into the WF background.6903912SS.SHR-(<i>D9Mco72-D9Rat89</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903912This is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903914SS.SHR-(<i>D9Mco72-D9Rat55</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903914This is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903917SS.SHR-(<i>D9Mco72-D9Mco109</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903917This is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903920SS.SHR-(<i>D9Mco72-D9Uia4</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903920This is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903922SS.SHR-(<i>D9Mco72-D9Mco106</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903922This is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903925SS.SHR-(<i>D9Mco72-D9Mco105</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903925This is a congenic substrain developed by crossing SS.SHR-(<i>D9Mco72-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903928SS.SHR-(<i>D9Rat7-D9Got111</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903928This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903932SS.SHR-(<i>D9Rat7-D9Rat52</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903932This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903934SS.SHR-(<i>D9Rat7-D9Mco91</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903934This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6903936SS.SHR-(<i>D9Rat7-D9Rat84</i>)/McoMedical College of Ohio, Toledo, OhiocongenicUnknownRRID:RGD_6903936This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Mco93</i>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region6907047WF.WKY-(<i>D5Uwm63-D5Uwm60</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907047A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Wox7-D5Uwm37</i>).6907054WF.WKY-(<i>D5Uwm67-D5Uwm98</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907054A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907057WF.WKY-(<i>D5Uwm76-D5Uwm61</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907057A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907059WF.WKY-(<i>D5Uwm76-D5Uwm98</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907059A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907061WF.WKY-(<i>D5Uwm67-D5Uwm78</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907061A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907063WF.WKY-(<i>D5Uwm76-D5Got18</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907063A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907076WF.WKY-(<i>D5Uwm78-D5Uwm98</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907076A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907078WF.WKY-(<i>D5Uwm95-D5Uwm98</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907078A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907080WF.WKY-(<i>D5Uwm67-D5Uwm81</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907080A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907084WF.WKY-(<i>D5Uwm76-D5Uwm92</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907084A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907087WF.WKY-(<i>D5Uwm78-D5Uwm84</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907087A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907090WF.WKY-(<i>D5Uwm78-D5Uwm93</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907090A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907092WF.WKY-(<i>D5Uwm88-D5Uwm92</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907092A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907094WF.WKY-(<i>D5Uwm87-D5Uwm92</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907094A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907096WF.WKY-(<i>D5Uwm85-D5Uwm92</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907096A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907098WF.WKY-(<i>D5Uwm82-D5Uwm92</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907098A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907100WF.WKY-(<i>D5Uwm82-D5Uwm91</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907100A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907104WF.WKY-(<i>D5Uwm77-D5Uwm91</i>)/UwmUniversity of Wisconsin School of Medicine, Madison, WisconsincongenicUnknownRRID:RGD_6907104A sub congenic strain derived from the progenitor strain WF.WKY-(<i>D5Uwm68-D5Mit4</i>)/Uwm.6907436SS.BN-(<i>D13Hmgc41-D13Hmgc23</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_6907436These were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.6907438SS.BN-(<i>D13Rat77-D13Rat105</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_6907438These were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.6907445SS.BN-(<i>D13Rat124-D13Rat101</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_6907445These were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.7204133LEW-<i>Rag1<sup>em1Ztm</sup></i>Zentrales Tierlaboratorium, Medizinische Hochschule Hannover, GermanymutantUnknownRag1<sup>em1Ztm</sup>7204132RRID:RGD_7204133This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.7204136SD-<i>Rag1<sup>em1Ang</sup></i>Institut National de la Sante et de la Recherche Medicale (INSERM)mutantUnknownRag1<sup>em1Ang</sup>7204135RRID:RGD_7204136This strain was produced by injecting ZFNs into Sprague-Dawley rat embryos. The resulting mutation is a 5-bp frameshift deletion in the Rag1 gene that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751.7207880LEW.WKY-(<i>D13Arb15-D13Rat58</i>)/TjaImperial College, London, UKcongenicUnknownRRID:RGD_7207880Segment of interest from chr 13 of WKY/NCrl was introgressed into LEW/SsNHsd7240510DA.PVG.1AV1-(<i>D4Rat113-D4Kiru96</i>)/KiruDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, SwedencongenicUnknownRRID:RGD_7240510congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini7240512DA.PVG.1AV1-(<i>D4Rat113-D4Kiru80</i>)/KiruDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, SwedencongenicUnknownRRID:RGD_7240512congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini7240513DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/KiruDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, SwedencongenicUnknownRRID:RGD_7240513congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini7240514DA.PVG.1AV1-(<i>D4Kiru12-D4Kiru55</i>)/KiruDepartment of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, SwedencongenicUnknownRRID:RGD_7240514Congenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(<i>D4Kiru90-D4Kiru111</i>)/Kiru onto the genetic background of DA/ZtmKini7240521DA.PVG.1AV1-(<i>D4Kini3-D4Rat177</i>)/KiniDepartment of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, SwedencongenicUnknownRRID:RGD_7240521DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain7240522DA.PVG.1AV1-(<i>D4Kini3-D4Mgh14</i>)/KiniDepartment of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden, <a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1118> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermViral encephalitis (HSE)RRID:RGD_7240522DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain7241047LE-<i>Lrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/lrrk1-lrrk2-knockout-rat-tgrl6720>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-06-06)Lrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>7241043RRID:RGD_7241047This strain was produced by crossing LE-Lrrk1<sup>em1Sage</sup> with LE-Lrrk2<sup>em1Sage</sup>7241048LE-<i>Park7<sup>em1Sage</sup></i><a href=http://www.sageresearchmodels.com/research-models/knockout-rats/park7-dj-1-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantUnknownPark7<sup>em1Sage</sup>7241042RRID:RGD_7241048This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 57241049LE-<i>Pink1<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com/pink1-park6-knockout-rat-tgrl4690> Horizon Discovery</a>mutantLive Animals (as of 2017-05-08)Pink1<sup>em1Sage</sup>7241046RRID:RGD_7241049ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC).7241050LE-<i>Lrrk2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/lrrk2-knockout-rat-tgrl4620> Horizon Discovery</a>mutantLive Animals (as of 2017-06-06)Lrrk2<sup>em1Sage</sup>7241045RRID:RGD_7241050This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30.7241051LE-<i>Lrrk1<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/lrrk1-knockout-rat-tgrl5880> Horizon Discovery</a>mutantUnknownLrrk1<sup>em1Sage</sup>7241044RRID:RGD_7241051This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4.7241052LE-<i>Prkn<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com/park2-parkin-knockout-rat-tgrl4760> Horizon Discovery</a>mutantUnknownPrkn<sup>em1Sage</sup>7241041RRID:RGD_7241052ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT).7241053LE-<i>Lrrk1<sup>em1Sage-/-</sup>Lrrk2<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com/lrrk1-lrrk2-knockout-rat-tgrl6720>Horizon Discovery</a>mutantUnknownLrrk1<sup>em1Sage</sup>Lrrk2<sup>em1Sage</sup>7241043RRID:RGD_7241053ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous7241054LE-<i>Pink1<sup>em1Sage</sup></i><a href=http://www.sageresearchmodels.com/research-models/knockout-rats/pink1-park6-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantUnknownPink1<sup>em1Sage</sup>7241046RRID:RGD_7241054This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4.7241055LE-<i>Park7<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com/park7-dj-1-knockout-rat-tgrl4830> Horizon Discovery</a>mutantLive Animals (as of 2017-05-08)Park7<sup>em1Sage</sup>7241042RRID:RGD_7241055ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA).7241056LE-<i>Lrrk2<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com/lrrk2-knockout-rat-tgrl4620> Sigma Advanced Genetic Engineering Labs</a>mutantLive Animals (as of 2018-08-24)Lrrk2<sup>em1Sage</sup>7241045RRID:RGD_7241056ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offsprings maintained as homozygous7241057LE-<i>Lrrk1<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com/lrrk1-knockout-rat-tgrl5880> Horizon Discovery</a>mutantUnknownLrrk1<sup>em1Sage</sup>7241044RRID:RGD_7241057ZFN mutant founders carrying a 19-bp frameshift deletion in exon 4 were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous.7241058LE-<i>Prkn<sup>em1Sage</sup></i><a href=http://www.sageresearchmodels.com/research-models/knockout-rats/park2-knockout-rat> Sigma Advanced Genetic Engineering Labs</a>mutantUnknownPrkn<sup>em1Sage</sup>7241041RRID:RGD_7241058This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4.7241239DA.BN-(<i>D9Wox18-D9Rat20</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241239DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241240DA.BN-(<i>D9Mit6-D9Rat29</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241240DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241241DA.BN-(<i>D9Mit6-D9Got15</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241241DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241242DA.BN-(<i>D9Got8-D9Rat139</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241242DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241243DA.BN-(<i>D9Wox24-D9Rat20</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_7241243DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241244DA.BN-(<i>D9Wox24-D9Wox18</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241244DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241245DA.BN-(<i>D9Wox24-D9Rat139</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241245DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241246DA.BN-(<i>D9Wox24-D9Rat44</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241246DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241247LEW.BN-(<i>D9Got8-D9Got22</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241247LEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241248LEW.BN-(<i>D9Wox24-D9Got22</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_7241248LEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats7241265SHR-Chr Y<sup>WKY</sup>/AkrUniversityof Akron breeding colonies, The University of Akron, Akron, OhioconsomicUnknownRRID:RGD_7241265WKY/NHsd males were crosssed with SHR/NHsd females to get F1 animals, the hybrid animals were backcrossed with female SHR/NHsd to transfer the Y chromosome7241267WKY-Chr Y<sup>SHR</sup>/AkrUniversity of Akron breeding colonies, The University of Akron, Akron, OhioconsomicUnknownRRID:RGD_7241267SHR/NHsd males were crosssed with WKY/NHsd females to get F1 animals, the hybrid animals were backcrossed with female WKY/NHsd to transfer the Y chromosome7241271SHR.BN-(<i>D10Mit4-D10Wox11</i>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownRRID:RGD_7241271Segment of chromosome 10 from BN.<i>Lx</i>/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic7241594(SDxF344)F1-<i>Rbm20<sup>m1Mlgw</i></sup>University of Wisconsin, MadisonmutantCryopreserved Sperm (as of 2017-01-25)Rbm20<i><sup>m1Mlgw</sup></i>7241593RRID:RGD_7241594This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.7241595(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw+/+</i></sup>University of Wisconsin, MadisonmutantCryopreserved SpermRbm20<i><sup>m1Mlgw</sup></i>7241593RRID:RGD_7241595Heterozygous offspring were intercrossed and maintained as wild type7241596(SDxF344)F1-<i>Rbm20<sup>m1Mlgw+/+</i></sup>University of Wisconsin, MadisonmutantCryopreserved SpermRbm20<i><sup>m1Mlgw</sup></i>7241593RRID:RGD_7241596Heterozygous offsprings were intercrossed and maintained as wild type7241597(SDxF344)F1xBN-<i>Rbm20<sup>m1Mlgw</i></sup>University of Wisconsin, MadisonmutantCryopreserved Sperm (as of 2017-01-25)Rbm20<i><sup>m1Mlgw</sup></i>7241593RRID:RGD_7241597This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd.7241794SHR/BbbMax-Delbruck Center for Molecular Medicine, GermanyinbredUnknownRRID:RGD_7241794This SHR colony is maintained at Max-Delbruck Center for Molecular Medicine, Germany7241811BBDP.WF-(<i>D8Rat73-D8Sunn1467</i>)(<i>D13Rat124-D13Mgh5</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_7241811a double congenic strain which has more than 38.74 Mb of chr 8 and more than 16.78 Mb of chr 13 of Wistar Furth introgressed into the gentic background of BBDP/WorSunn7243955DA.F344-(<i>D4Got44-D4Arb21</i>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_7243955Congenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity7243960DA.F344-(<i>D4Got44-D4Rat128</i>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_7243960Congenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity7243963DA.F344-(<i>D4Uia2-D4Wox21</i>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_7243963Congenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity7243965DA.F344-(<i>D4Arb21-D4Arb4</i>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_7243965Congenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity7243966DA.F344-(<i>D4Arb5-D4Arb4</i>)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_7243966Congenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity7244374FXLE/StmSaitama Cancer Center Research Institute, 818 Komuro Saitama, Japanadvanced_intercross_lineUnknownRRID:RGD_7244374Recombinant inbred strain derived from Le/Stm (from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/DuCrlj (from Charles River Japan) and then maintained by brother-sister mating.7244380DA.F344(Cia3c)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_7244380Congenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity7244381DA.F344(Cia3e)/ArbThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MarylandcongenicUnknownRRID:RGD_7244381Congenic substrain derived from backcrossing DA.F344-(<i>D4Got44-D4Arb4</i>)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity7245481SD-Tg(hsMt-LacZ)Reh<a href=http://www.rrrc.us/Strain/?x=540>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05)RRID:RRRC_00540presses LacZ under the transcriptional control of the mouse metallothionein regulatory sequences. Transgene expression in germ cells is constitutive; expression of the transgene can be induced in liver by zinc or cadmium.7245482SD-Tg((ROSA)26-EGFP)RehRrrc<a href=http://www.rrrc.us/Strain/?x=541>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05)RRID:RRRC_00541Strain carries a 1.8kb transgene consisting of the mouse ROSA26 regulatory sequences driving EGFP. FISH was used to localize the transgene insertion to Chromosome 11q11-q12, proximal to Grik1 and near Ncam2. The transgene is expressed exclusively in male and female germ cells throughtout development.7245488SD-Tg(Chat-tTA)<a href=http://www.rrrc.us/Strain/?x=632>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-02-05)RRID:RRRC_00632Rats express a mouse tetracycline-controlled transactivator (tTA) driven by the mouse choline acetyltransferase (Chat) promotor. When mated to a second transgenic strain (RRRC:00633) that carries a target gene (TDP43) under the regulation of a tetracycline response element (TRE), the expression of TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.7245494SD-Tg(TRE-TARDBP-M337V)<a href=http://www.rrrc.us/Strain/?x=633>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-02-05)TARDBP1322081RRID:RRRC_00633Strain carries a transgene expressing human TDP43 with the M337V mutation under control of a tTA-dependent promoter (TRE). When mated to a second transgenic strain (RRRC:632) that carries a tetracycline-controlled transactivator driven by the mouse choline acetyltransferase (Chat) promoter, the expression of mutant TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline.7245521SD-Tg(Th-SNCA<sup>*</sup>)3Ins<a href=http://www.rrrc.us/Strain/?x=634>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00634the transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines7245523SD-Tg(Th-SNCA<sup>*</sup>)4Ins<a href=http://www.rrrc.us/Strain/?x=635>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00635the transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines7245527WKHA/Edh<a href=http://www.rrrc.us/Strain/?x=663>Rat Resource and Research Center</a>inbredUnknownRRID:RRRC_00663derived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressure7245556WKHT/Edh<a href=http://www.rrrc.us/Strain/?x=664>Rat Resource and Research Center</a>inbredUnknownRRID:RRRC_00664WKHT rats are derived from a cross between SHR and WKY. Brother/sister inbreeding of the hybrids and successive generations was performed, selecting for the hypertension, but not the behavioral hyperactivity, of the SHR.7246924HanTacFcfiq:WHWistar Hannover<a href=http://www.usp.br/bioterio/Animais_Tipo_Linhagem.asp>Universidade de Sao Paulo</a>outbredUnknownRRID:RGD_7246924Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.7246927NTacFcfiq:SDSprague Dawley<a href=http://www.usp.br/bioterio/Animais_Tipo_Linhagem.asp>Universidade de Sao Paulo</a>outbredUnknownRRID:RGD_7246927Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating.7246928NTac:NIH-<i>Foxn1</i><sup>rnu</sup>nudeoutbredUnknownRRID:RGD_7246928The NIH nude Spontaneous mutant model was developed by NIH in 1979-1980 by intercrossing eight strains of rats. Taconic received stock from NIH Animal Genetic Resource in 1981. The rats were derived by hysterectomy in 1987 and again in 1998. Animals are randomly bred at Taconic without selection for coat color or pigmentation.7246929NTacFcfiq:NIH-<i>Foxn1</i><sup>rnu</sup>nude<a href=http://www.usp.br/bioterio/Animais_Tipo_Linhagem.asp>Universidade de Sao Paulo</a>outbredUnknownRRID:RGD_7246929Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating between homozygous male x heterozygous female.7247278SD-Tg(Camk2a-tTA)Xgx<a href=http://www.rrrc.us/Strain/?x=655>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-02-18)RRID:RRRC_00655Camk2a-tTA transgenic rats expressing tTA under regulatory control of the forebrain promotor Camk2a. Transgene expression can be blocked by administration of doxycycline to drinking water.7247279SD-Tg(TRE-FUS-R521C)Xgx<a href=http://www.rrrc.us/Strain/?x=656>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-02-18)FUS1318882RRID:RRRC_00656Overexpression of R521C mutant form of human FUS (Fused in Sarcoma) transgene is under regulatory control of tetracycline-responsive promoter element.7247280SD-Tg(TRE-LacZ)Xgx<a href=http://www.rrrc.us/Strain/?x=657>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-02-18)RRID:RRRC_00657LacZ gene was assembled downstream of the TRE (tetracycline-responsive promoter elements) promoter, allowing inducible gene expression.7247286F344-Tg(APP)21Besey<a href=http://www.rrrc.us/Strain/?x=636>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-02-05)APP736021RRID:RRRC_00636F344/NHsd embryos were microinjected with a DNA construct containing human beta amyloid precursor protein (APP), Swedish (Swe) double mutation (K670N-M671L) and Indiana (Ind) single autosomal dominant mutation (V642F). The transgene is driven by an ubiquitin-C promoter. Homozygous transgenic rats exhibit approximately 2.9-fold more expression of APP mRNA than wild-type rats.7247289SD-Tg(TETRA-EGFP)Besey<a href=http://www.rrrc.us/Strain/?x=650>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-02-18)RRID:RRRC_00650SD embryos were microinjected with a DNA construct containing the GFP gene downstream of a miniCMV promoter under the control of tetracycline response element (TRE). The pLV-Tet-GFP was generated by co-transfection of pLV-Tet-GFP, pÎ8.9 and pVSV-G into a 293FT packaging cell line7247290SD-Tg(Ubc-P2ry2)Besey<a href=http://www.rrrc.us/Strain/?x=627>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2017-08-22)P2ry262088RRID:RRRC_00627SD embryos were microinjected with a lentiviral construct containing the rat P2ry2 gene (G protein-coupled purinergic receptor P2Y2) under control of an ubiquitin-C promoter. Results in over-expression of P2ry2 mRNA.7247594WKY.SHR-(<i>D1Rat90-D1Mit18</i>)/IwaiShiga University of Medical Science, Otsu, JapancongenicUnknownRRID:RGD_7247594Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY7248453SS.BN-(<i>D12Hmgc3-AU047911</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_7248453Subcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.7248454SS.BN-(<i>D12Hmgc7-D12Hmgc6</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_7248454Subcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.7248456SS.BN-(<i>D12Hmgc3-D12Got29</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_7248456Subcongenic strain generated by backcrossing SS-Chr 12<sup>BN</sup>.SS-(<i>D12Hmgc3-D12Hmgc6</i>)/Mcwi to SS-Chr 12<sup>BN</sup>/Mcwi, intercrossing the F<sub>1</sub> generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12<sup>BN</sup>/Mcwi and bred to homozygosity.7248716NAK/NokhNodai aphakiaFaculty of Bioindustry, Tokyo University of Agriculture in JapaninbredLive AnimalsRRID:RGD_7248716This is an inbred anophthalmic rat strain derived from a Sprague-Dawley (SD) colony and designated it as Nodai aphakia (NAK) by Dr.Ryoichi Hashizume in Tokyo University of Agriculture. The NAK rats have decreased body size than wild-type rats and do not have both eyes.7248725ACI.BN-(<i>D7Rat164-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_7248725This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248727ACI.BN-(<i>D7Rat164-D7Uwm30</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_7248727This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248729ACI.BN-(<i>D7Rat206-D7Uwm30</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownmammary cancerRRID:RGD_7248729This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248731ACI.BN-(<i>D7Rat164-D7Uwm31</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownmammary cancerRRID:RGD_7248731This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248733ACI.BN-(<i>D7Rat164-D7Uwm33</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownmammary cancerRRID:RGD_7248733This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248736ACI.BN-(<i>D7Uwm32-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_7248736This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248738ACI.BN-(<i>D7Uwm36-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_7248738This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248740ACI.BN-(<i>D7Uwm38-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_7248740This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248742ACI.BN-(<i>D7Uwm33-D7Mit27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_7248742This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248744ACI.BN-(<i>D7Uwm33-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryopreserved Sperm (as of 2017-09-07)mammary cancerRRID:RGD_7248744This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248746ACI.BN-(<i>D7Uwm41-D7Mit16</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_7248746This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7248748ACI.BN-(<i>D7Uwm28-D7Mit16</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryopreserved Sperm (as of 2017-09-07)mammary cancerRRID:RGD_7248748This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7257663WI-<i>Tlr4<sup>em1Geh</i></sup>University of PittsburghmutantUnknownalcohol action, immune system function, septic shockTlr4<sup>em1Geh</sup>7257661RRID:RRRC_00694This strain was produced by TALEN mediated 13 bp deletion in Exon 1 in the rat Tlr4 gene; background strain is Crl:WI7257722WKY.SHR-(<i>D1Mgh14-D1Rat77</i>)/IwaiShiga University of Medical Science, Otsu, JapancongenicUnknownRRID:RGD_7257722Fragment of the chromosome 1 derived from SHR/NCrlj and repeated backcross to WKY/NCrlCrlj7349321LEXF2D/StmSaitama Cancer Center Research Institute, Saitama, Japanrecombinant_inbredUnknownRRID:RGD_7349321This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.7349322LEXF8B/StmSaitama Cancer Center Research Institute, Saitama, Japanrecombinant_inbredUnknownRRID:RGD_7349322This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.7349357DA.PVG.1AV1-(<i>D4Got128-D4Got136</i>)Center for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_7349357Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain.7364879SS-<i>Apoe<sup>em9Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Apoe<sup>em9Mcwi</sup>7364878RRID:RGD_7364879This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 37364880SS-<i>Cst3<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Cst3<sup>em1Mcwi</sup>5687708RRID:RGD_7364880This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1.7364881SS-<i>Slc7a9<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Slc7a9<sup>em1Mcwi</sup>5687700RRID:RGD_7364881This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6.7364882SS-<i>Sorcs2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Sorcs2<sup>em1Mcwi</sup>5508343RRID:RGD_7364882This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15.7364902SS-Chr 2<sup>BN</sup>/1McwiAek<a href=http://www.rrrc.us/Strain/?x=683>Rat Resource and Research Center</a>consomicCryopreserved Embryo (as of 2019-02-19)Studies of ischemia reperfusion injury or hypertensionRRID:RRRC_00683Compared to the current SS-Chr 2<sup>BN</sup>/Mcwi colony at the Medical College of Wisconsin (where this strain originated) it is a more complete consomic strain (a smaller piece of distal Chromosome 2 is of the SS genotype compared to the SS-Chr 2<sup>BN</sup>/Mcwi strain).7364919SS.BN-(<i>rs64114288-rs107464428</i>)/Aek<a href=http://www.rrrc.us/Strain/?x=686>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2019-02-19)cardiac ischemiaRRID:RRRC_00686This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from the top to ~227 Mb transferred to the SS/JrHsdMcwi strain background.7364923SS.BN-(<i>rs106982173-rs65057186</i>)/Aek<a href=http://www.rrrc.us/Strain/?x=685>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2019-02-19)cardiac ischemiaRRID:RRRC_00685This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.7364927SS.BN-(<i>rs13453786-rs66377062</i>)/Aek<a href=http://www.rrrc.us/Strain/?x=684>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2019-02-19)cardiac ischemiaRRID:RRRC_00684This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2<sup>BN</sup>/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background.7364932ACI.BN-(<i>D7Rat42-D7Uwm33</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryopreserved Sperm (as of 2017-09-07)mammary cancerRRID:RGD_7364932This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7364934ACI.BN-(<i>rs199006987-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_7364934This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7364936ACI.BN-(<i>D7Arb15-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryopreserved Sperm (as of 2017-09-07)mammary cancerRRID:RGD_7364936This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.7364938(LE x RCS-<i>p</i><sup>+</sup>/LavRrrc)F1<a href=http://www.rrrc.us/Strain/?x=662>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2019-02-18)Retinal ResearchMertk69283RRID:RRRC_00662RCS-<i>p</i><sup>+</sup>/LavRrrc males were mated to LE females.7364940F344-<i>Tp53<sup>tm1(EGFP-Pac)Qly</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=661>Rat Resource and Research Center</a>mutantUnknowntumorigenesis modelRRID:RRRC_00661Backcrossed STOCK-<i>Tp53<sup>tm1(EGFP-Pac)Qly</sup></i>Rrrc with F344 using speed congenic approach to move mutation onto F344 genetic background.7364954DA.ACI-(<i>D2Mit12-D2Got121</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studiesRRID:RRRC_00668Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 7 times then brother-sister mating to maintain in the homozygous state7364956DA.ACI-(<i>D2Wox20-D2Mit14</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studiesRRID:RRRC_00669Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 10 times then brother-sister mating to maintain in the homozygous state7364959DA.ACI-(<i>D2Uwm24-D2Rat54</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studiesRRID:RRRC_00670Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 8 times then brother-sister mating to maintain in the homozygous state7364970DA.ACI-(<i>D12Mit2-D12Got49</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-18)arthritis/autoimmunity studiesRRID:RRRC_00671Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 12 times then brother-sister mating to maintain in the homozygous state7364974DA.F344-(<i>D10Rat195-D10Rat92</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studiesRRID:RRRC_00676Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state7364976DA.F344-(<i>D10Rat195-D10Arb27</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studiesRRID:RRRC_00677Congenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state7364978DA.F344-(<i>D10Arb27-D10Rat92</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studiesRRID:RRRC_00678Congenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state7364981DA.F344-(<i>D7Rat22-D7Rat15</i>)/NsiThe National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland.congenicCryopreserved Sperm (as of 2019-02-19)arthritis/autoimmunity studiesRRID:RRRC_00680Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 11 times then brother-sister mating to maintain in the homozygous state7364991ACI/EurMcwiACI (August × Copenhagen Irish)Medical College of WisconsininbredCryopreserved Embryo; Cryopreserved SpermRenal diseaseRRID:RRRC_00284substrain of ACI derived from ACI/Eur7365040SS.SR-(<i>rs65785750-rs13452155</i>)/OpazWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenicCryopreserved Sperm (as of 2021-05-07)RRID:RGD_7365040Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains7365043SS.SR-(<i>rs65785750-rs106808193</i>)/OpazWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenicCryopreserved Sperm (as of 2019-02-05)RRID:RGD_7365043Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains7394698ZUC.BN-(<i>D1Rat42-D1Rat90</i>)/SteUniversity of California Davis, Davis, CAcongenicUnknownRRID:RGD_7394698homozygous lean wild-type ZUC-<I>Lepr</I><sup>+Ste</sup> were crossed with BN/Crl to get F<sub>1</sub>; these were backcrossed to lean ZUC males; congenics were selected by genotyping with markers7394818P.NP-(<i>D4Mgh16-D4Rat173</i>)/IusmDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianacongenicUnknownRRID:RGD_7394818P.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and iP rats were crossed to get F1 animals which were further backcrossed to iP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection7394821P.NP-(<i>Snca-D4Rat35</i>)/IusmDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianacongenicUnknownSnca3729RRID:RGD_7394821P.NP-(<i>D4Rat119-D4Rat55</i>)/Iusm and iP rats were crossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection7401201SS.SR-(<i>D17Rat24-rs106534785</i>)/OpazWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenicCryopreserved Sperm (as of 2019-02-05)RRID:RRRC_00615Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains7401203SS.SR-(<i>rs105019230-D17Rat44</i>)/OpazWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenicCryopreserved Sperm (as of 2021-05-07)RRID:RRRC_00616Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. <a href=http://www.rrrc.us/Strain/?x=616>Rat Resource and Research Center</a>7401261LOU/NimrOlaHsdLouvaininbredCryorecovery (as of 2023-12-14)RRID:RGD_7401261LOU/C was selected for high immunocytoma incidence; to National Institute of Medical Research, Mill Hill; in 1985 from Nimr to Harlan7411634WDB/NipsinbredUnknownRRID:RGD_7411634Crlj:WI females were bred to DA/Slc males to generate F<sub>1</sub> pups which were bred by brother-sister mating; only black (non-agouti) pups were picked for breeding. (The genotype of the pups was checked by backcrossing to BN (for BB or Bb) and Hooded strains (for HH or Hh) genotype.) When the aaBBCCHH genotype of F2 was confirmed then the strain was maintained by brother-sister mating.7411676SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownRRID:RGD_7411676Congenic strain created by speed congenic strategy where the desired region from Chromosome 3 of WKY/Gcrc was introgressed into the SHRSP/Gcrc background.7411679SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)(<i>D3Mgh16-D3Rat114</i>)/GcrcUniversity of Glasgow, Western Infirmary, Glasgow, UKcongenicUnknownRRID:RGD_7411679F<sub>1</sub> rats generated by crossing SHRSP.WKY-(<i>D3Mgh16-D3Rat114</i>)/Gcrc and SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc were backcrossed to SHRSP.WKY-(<i>D2Rat13-D2Rat157</i>)/Gcrc; heterozygous animals for chr 3 fragment were crossed with homozygous animals for chr 2; animals that were homozygous for both fragments were intercrossed to get the desired bicongenic strain7411703SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/IzmDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, JapancongenicCryopreserved SpermCardio-HypertensionRRID:RGD_7411703constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments7411705SHR.SHRSP-(<i>D1Rat93-D1Rat269</i>)(<i>D18Rat73-D18Rat11</i>)/IzmDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, JapancongenicCryopreserved Embryo; Cryopreserved SpermCardio-HypertensionRRID:RGD_7411705constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments7411707SHRSP.SHR-(<i>D1Mgh5-D1Got87</i>)/IzmDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, JapancongenicCryopreserved SpermCardio-HypertensionRRID:RGD_7411707male SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm7411709SHRSP.SHR-(<i>D1Mit30-D1Rat269</i>)/IzmDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, JapancongenicCryopreserved SpermCardio-HypertensionRRID:RGD_7411709male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm7421599SS.LEW-(<i>D1Chm64-D1Rat19</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421599A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421603SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421603A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421606SS.LEW-(<i>D1Uia4-D1Rat320</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421606A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421610SS.LEW-(<i>D5Mit5-D5M4Mit14</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421610A segment of chromosome 5 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421612SS.LEW-(<i>D16Chm48-D16Chm60</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421612A segment of chromosome 16 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421617SS.LEW-(<i>D17Chm14-D17Rat65</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421617A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421619SS.LEW-(<i>D17Chm85-D17Chm71</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421619A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421621SS.LEW-(<i>D17Chm131-D17Chm93</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421621A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421623SS.LEW-(<i>D17Rat84-D17Chm17</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421623A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421634SS.MNS-(<i>D2Got93-D2Rat222</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421634A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421636SS.MNS-(<i>D2Chm90-D2Rat38</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421636A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421638SS.MNS-(<i>D2Chm381-D2Chm225</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421638A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421640SS.MNS-(<i>D2Rat155-D2Chm161</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421640Congenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421643SS.MNS-(<i>D2Chm254-D2Chm161</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421643Congenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421645SS.MNS-(<i>D2Rat155-D2Chm419</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421645Congenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421647SS.MNS-(<i>D2Chm161-D2Chm410</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421647Congenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421649SS.MNS-(<i>D2Chm153-D2Chm410</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421649Congenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421651SS.MNS-(<i>D2Chm442-D2Chm410</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421651Congenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7421654SS.MNS-(<i>D2Chm366-D2Rat52</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_7421654Congenic substrain created by backcrossing congenic strain SS.MNS-(<i>D2Chm25-D2Mit14</i>)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.7771589SS.SR-(<i>D2Rat352-rs63922710</i>)/OpazBoston University School of Medicine, Boston, MassachusettscongenicCryopreserved Sperm (as of 2019-02-05)RRID:RRRC_00610Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains7771600SS.SR-(<i>rs106870553-rs63922710</i>)/OpazBoston University School of Medicine, Boston, MassachusettscongenicCryopreserved Sperm (as of 2019-02-05)RRID:RRRC_00611Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains7771610SHRSP-Chr 1<sup>F344</sup>/RkbDepartment of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, GermanyconsomicUnknownRRID:RGD_7771610SHRSP/Bbb male was crossed with female F344/Crl to get F1 animals which in turn were backcrossed with female SHRSP, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing7777135SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7777135SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7777138SS.LEW-(<i>D5Mco41-D5Mco47</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7777138SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7777140SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco41-D5Mco47</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7777140male and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/1Mco and SS.LEW-(<i>D5Mco41-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenics7777143SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7777143SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7777180SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7777180SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7794691SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco42-D5Mco47</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7794691male and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/2Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/1Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenics7794694SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7794694SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7794696SS.LEW-(<i>D5Mco43-D5Mco47</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7794696SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7794698SS.LEW-(<i>D5Mco39-D5Mco57</i>)(<i>D5Mco43-D5Mco47</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7794698male and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco57</i>)/3Mco and SS.LEW-(<i>D5Mco413-D5Mco47</i>)/Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenics7794700SS.LEW-(<i>D5Mco39-D5Mco41</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7794700SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7794704SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7794704SS.LEW-(<i>D5Mco34-D5Rat108</i>)/Jr was selectively backcrossed with the SS/Jr strain7794706SS.LEW-(<i>D5Mco39-D5Mco41</i>)(<i>D5Mco42-D5Mco47</i>)/McoMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_7794706male and female pairs of the monocongenic SS.LEW-(<i>D5Mco39-D5Mco41</i>)/Mco and SS.LEW-(<i>D5Mco42-D5Mco47</i>)/2Mco were randomly selected and intercrossed to get F<sub>1</sub>; the heterozygous animals for the desired region were intercrossed to get the bicongenics7800659F344.Cg-<i>Du, Tyr<sup>C</sup></i>/Kyodownunder rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1057> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2016-11-10)DevelopmentRRID:RGD_7800659Developed by the DEPOSITOR7800661F344.Cg-<i>Du, Tyr<sup>CKyo+/+</i></sup>downunder rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1053> National BioResource Project for the Rat in Japan</a>mutantUnknownRRID:RGD_7800661Developed by the DEPOSITOR7800667F344.Cg-<i>Foxn1<sup>rnuKyo-/+</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=152> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved SpermImmunology; CancerFoxn13970RRID:RGD_7800667Jic N13 to Kyo (1988)7800671F344-<i>Sv2a<sup>m1Kyo</sup></i>Graduate School of Medicine, Kyoto UniversitymutantUnknownSv2a|Sv2a<sup>m1Kyo</sup>619715|12792962RRID:RGD_7800671Established by ENU mutagenesis. A missense mutation (L174Q) mutation in Sv2a: synaptic vesicle glycoprotein 2a, was identified.7800673KFRS2/Kyo<sup>-/+</sup>KFRS2<sup>-/+</sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1002> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved SpermOphthalmology; DermatologyTyr|Tyr<sup>siaKyo</sup>1589755|13207345RRID:RGD_7800673A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac.7800676KFRS3A/Kyo<sup>+/+</sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1059> National BioResource Project for the Rat in Japan</a>mutantUnknownRRID:RGD_7800676A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding.7800692MKO/TamiMinko Rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=974> National BioResource Project for the Rat in Japan</a>inbredLive Animals; Cryopreserved EmbryoRRID:RGD_7800692MKO rat is derived from Wistar male rat which exhibited large-size and abnormal lipid metabolism.7800694NER.F344-(<i>D1Rat132</i>)(<i>D5Rat100</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1051> National BioResource Project for the Rat in Japan</a>congenicUnknownRRID:RGD_7800694Developed by the DEPOSITOR7800702KHR/Kyo<sup>-/-</sup>kaken hairless rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=678 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermDermatologyOca22318412RRID:RGD_7800702Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).7800705KHR/Kyo<sup>-/+</sup>kaken hairless rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=413 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermDermatologyOca22318412RRID:RGD_7800705Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36).8142383SHRSP/BbbUtxUniversity of Texas, Houston, TXinbredUnknownRRID:RGD_8142383Animals transferred from Harvard University/Brigham (Dr Klaus Lindpaintner) originating from SHRSP colony at University of Heidelberg8142385SHR/UtxUniversity of Texas, Houston, TXinbredUnknownRRID:RGD_8142385Animals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 19748547938CrljJcl:SD<a href =https://www.clea-japan.com/en/products/outbred/item_a0350> CLEA Japan, Inc</a>outbredLive Animals (as of 2021-04-22)RRID:RGD_8547938Sprague-Dawley from Charles River Laboratory Japan, to CLEA Japan, Inc.8548794F344-Tg(NC1-269B17)1Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=970 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermCasp32275RRID:RGD_8548794BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.8548809F344-Tg(NC1-269B17)2Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=971 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermCasp32275RRID:RGD_8548809BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.8548812F344-Tg(NC1-269B17)3Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=972 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermCasp32275RRID:RGD_8548812BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.8548815F344-Tg(NC1-269B17)4Nkg<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=973 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermCasp32275RRID:RGD_8548815BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived <i>Casp3</i> (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain.8548817KDP.PVG-RT1<sup>a/u</sup>/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=993 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_8548817MHC haplotype (RT1.B<i>a</i>D<i>a</i>) of PVG.R23 was transferred onto the genetic background of KDP/Tky strain (RT1.B<i>u</i>D<i>u</i>). This allele has been maintained in heterozygous condition. Backcrossing has started since 2003 and afterwards maintained by sib mating8549599BN.LEW-(<i>D10Rat32-D10Rat133</i>)/CimlInstitut National de la Sante et de la Recherche Medicale, Toulouse, FrancecongenicUnknownRRID:RGD_8549599Congenic strain created from parental BN/Rj and LEW/Rj strains.8549776F344-<i>Lep<sup>m1Kyo</sup></i>F344 OB rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=995> National BioResource Project for the Rat in Japan</a>mutantLive Animals (as of 2017-03-17)Diabetes ObesityLep|Lep<sup>m1Kyo</sup>3000|12792963RRID:RGD_8549776Established by ENU mutagenesis in F344/NSlc rats. This strain has Lep missense mutation (Q92X).8549778PVG.KDP-<i>Cblb<i>/NyoPVG.KDP-Cblb congenic<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1010> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoDiabetes ObesityCblb620535RRID:RGD_8549778Developed by the DEPOSITOR8549779DRU/Uubc<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=991> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_8549779The mutant rat showing microphthalmia was found in the colony of Donryu rats at Central Institute for Experimental Animals in 1974. A pair of F3 rats was transferred to The Third Department for Anatomy, School of Medicine, Chiba University in 1975 and maintained by sib mating. F50 rats were transferred to Faculty of Agriculture, Utsunomiya University by Dr. S Sugita in 19918549782SD.Gunn-<i>Ugt1a1<sup>j</sup></i>/Aon<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=975 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2017-09-15)Neurobiology; MetabolismUgt1a1|Ugt1a1<sup>j</sup>3935|13432064RRID:RGD_8549782Developed by the DEPOSITOR8549785W.Gunn-<i>Ugt1a1<sup>j</i></sup>/Aon<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=976 > National BioResource Project for the Rat in Japan</a>congenicUnknownNeurobiology; MetabolismUgt1a1|Ugt1a1<sup>j</sup>3935|13432064RRID:RGD_8549785Developed by the DEPOSITOR8549798WMS/SimNcpDepartment of cellular physiology, Institute of Nephrology, Niigata University, Niigata, JapaninbredCryopreserved EmbryoRRID:RGD_8549798Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Simonsen Labs, CA via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Transferred at Nigata University from Simonsen Laboratory in 2005. at Niigata University8551711SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551711A double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551714SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D10Chm246-D10Chm257</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551714A double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D10Chm246-D10Chm257</i>)/Ayd8551716SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D16Chm48-D16Chm60</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551716A double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd8551718SS.LEW-(<i>D10Chm10-D10Rat11</i>)(<i>D16Chm48-D16Chm60</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551718A double congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd8551721SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551721A double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551723SS.LEW-(<i>D8Rat58-D8Chm12</i>)(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551723A double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Rat58-D8Chm12</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8551725SS.LEW-(<i>D8Chm12-D8Rat15</i>)(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551725A double congenic strain derived from the progenitor strain SS.LEW-(<i>D8Chm12-D8Rat15</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8551727SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551727A double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8551730SS.LEW-(<i>D3Rat2-D3Chm79</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551730A double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551732SS.LEW-(<i>D17Chm131-D17Chm93</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551732A double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551734SS.LEW-(<i>D17Chm131-D17Chm93</i>)(<i>D17Rat84-D17Chm17</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551734A double congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd and SS.LEW-(<i>D17Rat84-D17Chm17</i>)/Ayd8551737SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551737A double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551739SS.LEW-(<i>D2Uia5-D2Mit6</i>)(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551739A double congenic strain derived from the progenitor strain SS.LEW-(<i>D2Uia5-D2Mit6</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8551742SS.LEW-(<i>D16Chm48-D16Chm60</i>)(<i>D18Rat101-D18Rat92</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_8551742A double congenic strain derived from the progenitor strain SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat101-D18Rat92</i>)/Ayd8551748SS.LEW-(<i>D3Rat17-D3Mco80</i>)(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551748A double congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat17-D3Mco80</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8551750SS.LEW-(<i>D1Uia4-D1Rat320</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551750A double congenic strain derived from the progenitor strain SS.LEW-(<i>D1Uia4-D1Rat320</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551752SS.LEW-(<i>D1Rat320-D1Mgh32</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551752A triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Rat320-D1Mgh32</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Ayd8551755SS.LEW-(<i>D1Chm64-D1Rat19</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551755A triple congenic strain derived from the progenitor strain SS.LEW-(<i>D1Chm64-D1Rat19</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Ayd8551757SS.LEW-(<i>D7Uia3-D7Mgh1</i>)(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551757A triple congenic strain derived from the progenitor strain SS.LEW-(<i>D7Uia3-D7Mgh1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Ayd8551759SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551759A double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551761SS.MNS-(<i>D2Chm90-D2Rat38</i>),LEW-(<i>D10Got112-Igfbp4</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551761A double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm90-D2Rat38</i>)/Ayd and SS.LEW-(<i>D10Got112-Igfbp4</i>)/Ayd8551763SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551763A double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8551766SS.MNS-(<i>D2Rat155-D2Chm419</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551766A double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Rat155-D2Chm419</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551772SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551772A triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)(<i>D10Chm10-D10Rat11</i>)/Ayd8551774SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Chm10-D10Rat11</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551774A double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Chm10-D10Rat11</i>)/Ayd8551776SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551776A double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8551778SS.MNS-(<i>D2Chm33-Tm2sf1</i>),LEW-(<i>D3Rat2-D3Chm79</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551778A double congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm33-Tm2sf1</i>)/Ayd and SS.LEW-(<i>D3Rat2-D3Chm79</i>)/Ayd8551782SS.LEW-(<i>D18Chm90-D18Chm4</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551782SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain8551785SS.LEW-(<i>D18Wox7-D18Rat67</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551785SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain8551787SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551787SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain8551789SS.LEW-(<i>D18Chm59-D18Rat1</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8551789SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain8551864DA.LEW.1AV1-(<i>D4Mgh17-D4Mgh21</i>)/KiruDepartment of Medicine, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_8551864LEW.1AV1/Kini allele is introgressed into the DA/ZtmKini rats.8551866LEW.1AV1.DA-(<i>D4Mgh17-D4Rat203</i>)/KiruDepartment of Medicine, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_8551866DA/ZtmKini allele is introgressed into the LEW.1AV1/kini rats.8551868PVG.1AV1.DA-(<i>D4Mgh17-D4Rat84</i>)/KiruDepartment of Medicine, Karolinska Institutet, Stockholm, SwedencongenicUnknownRRID:RGD_8551868DA/ZtmKini allele is introgressed into the PVG.1AV1/Kini rats.8551872DA.PVG.1AV1-(<i>D4Rat155-D4Rat113</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551872Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551874DA.PVG.1AV1-(<i>D4Rat63-D4Rat84</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551874Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551876DA.PVG.1AV1-(<i>D4Rat203-D4Got130</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551876Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551880DA.PVG.1AV1-(<i>D4Rat63-D4Rat203</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551880Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551882DA.PVG.1AV1-(<i>D4Rat203-D4Mit22</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551882Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551885DA.PVG.1AV1-(<i>D4Mit22-D4Rat84</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551885Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551887DA.PVG.1AV1-(<i>D4Got126-D4Rat203</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551887Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551889DA.PVG.1AV1-(<i>D4Rat62-D4Got136</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551889Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8551892DA.PVG.1AV1-(<i>D4Rat113-D4Rat62</i>)/KiruCenter for Molecular Medicine, Karolinska Institute, Stockholm, SwedencongenicUnknownRRID:RGD_8551892Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain.8552235SD-Tg(Pbsn-TAg)1Obs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=998 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-08-17)Pbsn708571RRID:RGD_8552235SV40 Large T Antigen along with Rat probasin promoter8552237WI-Tg(Nanog-GFP-PuroR)22Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1011 > National BioResource Project for the Rat in Japan</a>transgenicLive AnimalsRRID:RGD_8552237mouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performance8552239F344.WI-Tg(Nanog-GFP-PuroR)Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1012 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_8552239WI-Tg(Nanog-GFP-puro-R)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic background8552242ETR/EisEisai Turning Rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1013 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoBehaviorRRID:RGD_8552242Developed by the DEPOSITOR8552244SD-Tg(Dsp-mCherry-DTR)Jfln<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1018 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_8552244This rat carries a transgene consisting of the Dsp promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. Red fluorescence can be detected from the skin of the animals but not the brain.8552247SD-Tg(Neurod6-mCherry-DTR)Jfln<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1019 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-08-17)RRID:RGD_8552247This rat carries a transgene consisting of the NeuroD6 promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. This model is yet to be validated.8552249SD-Tg(Camk2a-FLPo)Jfln<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1020 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-08-16)RRID:RGD_8552249This transgene consists of approximately 6kb of the CamK2a promoter followed by a gene encoding FLP, optimised for mamalian exprssion (FLPo). This rat remains unvalidated.8552252ACI.BUF-<i>Aftm1</i>/2Mna<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=977> National BioResource Project for the Rat in Japan</a>congenicCryopreserved EmbryoRRID:RGD_8552252This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred.8552255LAP/Hshyolow alcohol preference rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1009> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_8552255Developed by the DEPOSITOR8552257HAP/Hshyohigh alcohol preference rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1008> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_8552257Developed by the DEPOSITOR8552259F344-<i>Ldlr<sup>m1Kyo</i></sup>/Ta<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1030> National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoRRID:RGD_8552259Developed by the DEPOSITOR8552261WIAR.MPR-<i>Arsb<sup>abd</i></sup>/Ncchd<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=992> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2023-03-07)Osteology; MetabolismArsb|Arsb<sup>MPR</sup>2158|12792967RRID:RGD_8552261Developed by the DEPOSITOR. This congenic strain was established by backcrossing MPR/Iar (RGD:2306064) (provided by Dr. Kunieda, Okayama University) to WIAR/Iar (RGD:2304222)8552267SHRSP.WKY-(<i>D1Rat116-D1Wox10</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1031> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_8552267Developed by the DEPOSITOR8552269SHRSP.WKY-(<i>D1Tkyo58-D1Rat90</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1032> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_8552269Developed by the DEPOSITOR8552271SHRSP.WKY-(<i>D1Rat27-D1Wox18</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1033> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_8552271Developed by the DEPOSITOR8552273SHRSP.WKY-(<i>D1Tkyo57-D1Wox18</i>)/Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1034> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_8552273Developed by the DEPOSITOR8552275F344-<i>Lgi1<sup>m1Kyo</sup></i>The University of Tokyo, The Institute of Medical SciencemutantCryopreserved Sperm (as of 2017-03-17)Lgi1|Lgi1<sup>m1Kyo</sup>628742|12792970RRID:RGD_8552275Developed by gene driven ENU mutagenesis in F344/NSlc rats. Lgi1-mutant rats carrying a missense mutation (c.1154 T > G)(L385R).8552279WI-Tg(Per1-luc)Ylab<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1004> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_8552279The original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase8552285F344.WI-Tg(Per1-luc)Ylab<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1005> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_8552285The original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase8552287F344.WIC-Tg<i><sup>rdw</i>Kts</sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1037> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2017-04-27)MetabolismRRID:RGD_8552287This is a F344 congenic carrying Tgrdw derived from WIC-Tgrdw/Kts. WIC-Tgrdw/Kts was established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive.8552289A5M/Khos<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1039> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoMetabolismRRID:RGD_8552289Developed by the DEPOSITOR8552293SR/JrSeacDahl Salt-Resistant<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1042> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio- HypertensionRRID:RGD_8552293Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP8552296UPL/CasTakeu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1040> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoOphthalmologyRRID:RGD_8552296Substrain of UPL8552298DA-<i>Tyr<sup>em1Kyo</i></sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1092> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2017-03-17)Behavior; DermatologyTyr|Tyr<sup>em1Kyo</sup>1589755|12792972RRID:RGD_8552298The strain having a Endonuclease-induced 29-bp deletion mutation in Tyr gene was established by TALENs combined with Exonuclease 1.8552303DA-<i>Tyr<sup>em2Kyo</i></sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1093> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved SpermBehavior; DermatologyRRID:RGD_8552303Developed by the DEPOSITOR8552309ODUS/Odu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1067> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_8552309The mutant rat showing spontaneous gingivitis was found in the colony of WKY rats in 1972. The inbred strain was established in 1991.8552311ODUR/Odu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1066> National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoRRID:RGD_8552311This inbred strain was established from WKY rats as a control for ODUS/Odu.8552313DA.PVG.1AV1-(<i>D10Rat81-D10Rat238</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_8552313DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program.8552315W-Tg(Thy1-COP4/YFP*)4Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1072> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermOphthalmology; OtorhinologyRRID:RGD_8552315The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.8552317W-Tg(Thy1-COP4/YFP*)5Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1077> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermOphthalmology; OtorhinologyRRID:RGD_8552317The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.8552319W-Tg(Thy1-COP4/YFP*)6Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1078> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermOphthalmology; OtorhinologyRRID:RGD_8552319The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs.8552321SHR-Tg(APOC3-CETP)1Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1095> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDiabetes Obesity; NeurobiologyRRID:RGD_8552321The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC3 promoter into SHR/Izm rat fertile eggs.8552323SHR-Tg(APOC3-CETP)2Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1114> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermDiabetes Obesity; NeurobiologyRRID:RGD_8552323The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.8552325SHR-Tg(APOC3-CETP)3Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1115> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermDiabetes Obesity; NeurobiologyRRID:RGD_8552325The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC5 promoter into SHR/Izm rat fertile eggs.8552327SHR-Tg(APOC3-CETP)4Tkyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1116> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermDiabetes Obesity; NeurobiologyRRID:RGD_8552327The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs.8552329W-Tg(Nqo1)Kop<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1107> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermOncology; MetabolismRRID:RGD_8552329The transgenic rats were established by injection of transgene consisting of NAD(P)H quinone oxidoreductase 1 gene derived from a DA/Slc rat strain into Wistar rat fertile eggs.8552331F344-<i>Il2rg<sup>em7Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1099> National BioResource Project for the Rat in Japan</a>mutantUnknownHematology; ImmunologyIl2rg<sup>em7Kyo</sup>13628732RRID:RGD_8552331The strain having a Endonuclease-induced 7 bp deletion mutation in the 2nd exon of the rat Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University.8552337DA.PVG.1AV1-(<i>D10Got406-D10Rat93</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_8552337Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Animals for congenic breeding were selected from the 10th generation of an advanced intercross line (AIL) originating from the EAE-susceptible DA and EAE-resistant PVG.1AV1 rat strains. Selected males containing a PVG.1AV1 fragment in the Eae18b region (from OT24.18 to D10Rat93 marker, at 68.36 Mb and 81.9 Mb, respectively) were backcrossed with DA females for 8 generations, and offspring was genotyped using microsatellite markers in each generation. In the 8th generation, heterozygous males and females were crossed to obtain the experimental population of homozygous congenic rats and littermate controls.8552341DA.PVG.1AV1-(<i>D10Got6-D10Rat184</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_8552341Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by transfer of the defined Vra4 segment selected from male donors of G8 generation of a DAxPVG1.AV1 andvanced intercross line. Subsequential backcrossing for 9 generations.8552346DA.PVG.1AV1-(<i>D4Rat107-D4Got132</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_8552346Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by selective transferring of PVG alleles in the interval between D4Rat137 and D4Kiru157 onto DA background in minimum of 13 backcross generations.8552348DA.PVG.1AV1-(<i>D13Rat105-D13Rat131</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_8552348Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). The congenic line was established from DA and MHC-identical PVG.A rats using a speed-congenic approach with marker assisted selection. DA females were mated with male offspring selected from F2 (DAxPVG.A) with heterozygote alleles within chromosome 13 and Eae34 QTL interval and with the lowest PVG.A background contamination using 96 microsatellite markers equally spaced throughout the genome (at 20 centimorgan cM intervals). A breeding pair selected from the N7 generation were crossed for two generations to produce homozygous DA.PVG-Eae34 congenic rats.8552351DA.PVG.1AV1-(<i>D9Wox24-D9Rat44</i>)/KiniCenter for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, SwedencongenicCryopreserved SpermNeurobiologyRRID:RGD_8552351Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Briefly, in each backcross generation, rats for further breeding were selected on the basis of genotyping of 8 microsatellite markers in the congenic region, from marker D9Wox24 to D9Rat20. The genetic background of rats was also screened with 100 markers. After the complete removal of the donor genome outside the congenic fragment, two heterozygous rats were intercrossed to produce the homozygous strains DA.BN-Eae4(N7F1). Subsequently, interval-specific recombinants were bred from an F2 breeding. R25 recombinant was established in 2003.8552364WI-Tg(L2-Venus)NipstransgenicUnknownRRID:RGD_8552364The construct contains CAG--lox P--Neo-pA--lox P--Venus--pA (4.3 kb) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes8552366WI-Tg(CAG-cre)NipstransgenicUnknownRRID:RGD_8552366The construct contains CAG--NLS-Cre--pA (3.3 kb)which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes8552368WI-Tg(CAG-Venus)NipstransgenicUnknownRRID:RGD_8552368The construct contains L2-Venus ÿ CAG-Cre (CAG--lox P--Venus--pA (3.1 kb)) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes8552371WDB-<i>ROSA26<sup>em1(RT2)Nips</sup></i>mutantUnknownRRID:RGD_8552371This strain was produced by knock-in in the rat ROSA26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.8552996F344/Arc<a href=http://www.arc.wa.gov.au/?page_id=1517> Animal Resources Centre, Australia</a>inbredUnknownRRID:RGD_8552996substrain of F344 bred at Animal Resources Centre Australia8553001ArcCrl:CD(SD)<a href=http://www.arc.wa.gov.au/?page_id=1469> Animal Resources Centre, Australia</a>outbredUnknownRRID:RGD_8553001substrain derived from Crl:CD(SD); IGS refers to animals bred using the CRL International Genetic Standard system.8553003ArcCrl:WIWistar rats<a href=http://www.arc.wa.gov.au/?page_id=1473> Animal Resources Centre, Australia</a>outbredUnknownRRID:RGD_8553003From Charles River to Animal Resources Centre, Australia8553005BN/RijHsdArcinbredUnknownRRID:RGD_8553005To Animal Resources Centre, Australia from Harlan.8553006DA/Arc<a href=http://www.arc.wa.gov.au/?page_id=1515> Animal Resources Centre, Australia</a>inbredUnknownRRID:RGD_8553006substrain of DA bred at Animal Resources Centre, Australia8553008LEW/CrlArcLewis<a href=http://www.arc.wa.gov.au/?page_id=1519> Animal Resources Centre, Australia</a>inbredUnknownRRID:RGD_8553008Developed by Dr. Lewis from Wistar stock in the early 1950s. To Animal Resources Centre, Australia from Charles River8553010PVG/Arc<a href=http://www.arc.wa.gov.au/?page_id=1521> Animal Resources Centre, Australia</a>inbredUnknownRRID:RGD_8553010substrain of PVG maintained at Animal Resources Centre8553013SHR/NCrlArc<a href=http://www.arc.wa.gov.au/?page_id=1523> Animal Resources Centre, Australia</a>inbredUnknownRRID:RGD_8553013To Animal Resources Centre from Charles River8553015WKY/NCrlArc<a href=http://www.arc.wa.gov.au/?page_id=1511> Animal Resources Centre, Australia</a>inbredUnknownRRID:RGD_8553015To Animal Resources Centre from Charles River8553187FHH.BN(<i>D14Rat98-D14Hmgc4</i>)/McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_8553187desired segments from BN were introgressed in FHH background8655639WAG/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, RussiainbredUnknownRRID:RGD_8655639Substrain of WAG, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk)8655660WAG.OXYS-(<i>D1Rat30-D1Rat219</i>)/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, RussiacongenicUnknownCic|Arhgap331310706|2318374RRID:RGD_8655660desired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Nov8655663WAG.OXYS-(<i>D1Rat219-D1Rat81</i>)/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, RussiacongenicUnknownSnurf|Ifit1|Zp2|Gtf3c1|Col17a169269|620599|620605|621048|1311130RRID:RGD_8655663desired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Nov8655977W-<i>Lepr</i><sup>+/+</sup>/NinWistar NIN leanNational Institute of Nutrition (NIN), Hyderabad, IndiainbredUnknownRRID:RGD_8655977The lean litter mates of WNIN-Ob (W-LeprfaNin, RGD:8655992). Both are derived from the inbred stock of Wistar rats (W/NIN) dating back to 1920 at National Institute of Nutrition (NIN), Hyderabad, India.8655992W-<i>Lepr</i><sup>faNin</sup>National Institute of Nutrition (NIN), Hyderabad, IndiamutantUnknownRRID:RGD_8655992The spontaneously developed obese rat was derived from the colony of inbred W/Nin by selective breeding. Its lean litter mate ( W-Lepr+/+/Nin, RGD:8655977) was used as a control strain in obesity related study.8657051F344/NinNational Institute of Nutrition (NIN), Hyderabad, IndiainbredUnknownRRID:RGD_8657051Substrain of F344 maintained at National Institute of Nutrition (NIN), Hyderabad, India.8657079SS.LEW-(<i>D18Chm124-D18Chm126</i>)/AydResearch Centre-CHUM, Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8657079SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain8657135SS.LEW-(<i>D10Chm280-D10Chm216</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_8657135A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd8657348SS.LEW-(<i>D17Chm131-D17Chm93</i>),MNS-(<i>D2Rat155-D2Chm161</i>),LEW-(<i>D18Chm41-D18Rat92</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8657348A triple congenic strain derived from the progenitor strain SS.LEW-(<i>D17Chm31-D17Chm93</i>)/Ayd, SS.MNS-(<i>D2Rat155-D2Chm161</i>)/Ayd and SS.LEW-(<i>D18Chm41-D18Rat92</i>)/Ayd8657351SS.MNS-(<i>D2Chm366-D2Rat52</i>),LEW-(<i>D18Rat61-D18Rat45</i>),LEW-(<i>D10Chm128-D10Chm121</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8657351A triple congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm366-D2Rat52</i>)/Ayd, SS.LEW-(<i>D18Rat61-D18Rat45</i>)/Ayd and SS.LEW-(<i>D10Chm128-D10Chm121</i>)/Ayd8657361SS.MNS-(<i>D2Chm254-D2Chm161</i>),LEW-(<i>D10Chm246-D10Chm257</i>),LEW-(<i>D16Chm48-D16Chm60</i>),LEW-(<i>D18Rat55-D18Mgh2</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8657361A congenic strain derived from the progenitor strain SS.MNS-(<i>D2Chm254-D2Chm161</i>)/Ayd, SS.LEW-(<i>D10Chm246-D10Chm257</i>)/Ayd and SS.LEW-(<i>D16Chm48-D16Chm60</i>)/Ayd and SS.LEW-(<i>D18Rat55-D18Mgh2</i>)/Ayd8657392SS.LEW-(<i>D10Rat155-D10Chm171</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8657392A sub congenic strain derived from the progenitor strain SS.LEW-(<i>D10Chm224-D10Chm6</i>)/Ayd.8657399SS.MNS-(<i>D2Chm214-D2Chm302</i>)/AydCentre Hospitalier de Universite de Montreal (CRCHUM), Quebec, CanadacongenicUnknownRRID:RGD_8657399Congenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F<sub>2</sub> rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment.8657402SS.LEW-(<i>D3Rat52-D3Chm57</i>),MNS-(<i>D2Chm214-D2Chm302</i>),LEW-(<i>D10Rat194-D10Chm243</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, CanadacongenicUnknownRRID:RGD_8657402A triple congenic strain derived from the progenitor strain SS.LEW-(<i>D3Rat52-D3Chm57</i>)/Ayd, SS.MNS-(<i>D2Chm214-D2Chm302</i>)/Ayd and SS.LEW-(<i>D10Rat194-D10Chm243</i>)/Ayd8661233SS-TgTn(T2GFP)53McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_8661233This strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 15 near 35.6 Mb (rn4)8661234SS-TgTn(T2ePet-eGFP)11McwiMedical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRRID:RGD_8661234This strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a serotonergic neuron-specific ePet1 promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 7 near 123.8Mb (rn4)8661235FHH-TgTn(T2/Rab38)1McwiHuman and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, WisconsintransgenicUnknownRab38628752RRID:RGD_8661235This strain was made by pronuclear microinjection of a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving the Brown Norway allele cDNA for Rab38 along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 14 near 13.2 Mb (rn4)8662449LOU/MBbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanyinbredUnknownRRID:RGD_8662449LOU/M strain maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany8662861LOU.BN-(<i>D5Rat59-D5Rat133</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_8662861the desired chromosomal segment from BN/Rj was introgressed into the genetic background of LOU/MBbb8662874LOU.BN-(<i>D5Rat59-D5Rat127</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_8662874this congenic strain is produced by backcrossing LOU.BN-(<i>D5Rat59-D5Rat133</i>)/Bbb to LOU/MBbb8662878LOU.BN-(<i>D5Rat59-D5Rat125</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_8662878this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb8662925LOU.BN-(<i>D5Rat59-rs13448399</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_8662925this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb8662933LOU.BN-(<i>rs65016308-D5Rat133</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_8662933this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb8662955LOU.BN-(<i>rs13448399-D5Rat133</i>)/BbbMax-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_8662955this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb8662958LOU.BN-(<i>D5Rat59-rs13448399</i>)/Bbb-/+Max-Delbruck-Center for Molecular Medicine, Berlin, GermanycongenicUnknownRRID:RGD_8662958this heterozygous congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb8663453BN.ACI-(<i>D14Uwm4-D14Rat39</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_8663453This congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.8663455BN.ACI-(<i>D14Uwm1-D14Uwm5</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownRRID:RGD_8663455This congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background.8663458ACI.BN-(<i>D7Rat164-D7Rat142</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryopreserved Sperm (as of 2017-09-07)mammary cancerRRID:RGD_8663458This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.8663462ACI.BN-(<i>D7Uwm32-D7Uwm43</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryopreserved Sperm (as of 2017-09-07)mammary cancerRRID:RGD_8663462This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.8663464ACI.BN-(<i>D7Uwm33-D7Uwm43</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicLive Animals (as of 2017-09-07)mammary cancerRRID:RGD_8663464This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.8693598LE-Tg(DIO-mCherry)2OttcRrrc<a href=http://www.rrrc.us/Strain/?x=687>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; CryorecoveryRRID:RRRC_00687The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter.9586448SHR/NCrlPrinDept. of Pharmacology, University of California, San Diego, La Jolla, CaliforniainbredUnknownRRID:RGD_9586448Substrain of SHR originally from Charles River now maintained at University of California9586450SHR/OlaIpcvPrinDept. of Pharmacology, University of California, San Diego, La Jolla, CaliforniainbredUnknownRRID:RGD_9586450These are substrains of SHR from Czech Academy of Sciences now maintained at University of California9587464SD-Tg(UBC-DsRedT3-emGFP)18NarlSD-Tg(UBC-DsRedT3-emGFP)18<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23001> National Laboratory Animal Center, Taiwan </a>transgenicLive AnimalsUBC1346853RRID:RGD_9587464This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.9587466SD-Tg(UBC-cre/ERT2)7Narl<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23002> National Laboratory Animal Center, Taiwan </a>transgenicCryopreserved Embryo (as of 2017-05-31)UBC1346853RRID:RGD_9587466This strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter.9587470SD-Tg(UBC-DsRedT3-emGFP)26Narl<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23003> National Laboratory Animal Center, Taiwan </a>transgenicCryopreserved EmbryoUBC1346853RRID:RGD_9587470This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter.9587473SD-Tg(UBC-emGFP)18Narl<a href=http://www.nlac.org.tw/rmrc/webc/html/data/show.aspx?ix=1&page=1&kw=23004> National Laboratory Animal Center, Taiwan </a>transgenicLive AnimalsUBC1346853RRID:RGD_9587473This strain was produced by microinjection of UBC-cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)18Narl9587475SD-Tg(UBC-DsRed-GFP)(Col1a(5A)-cre)NarlNational Laboratory Animal Center, TaiwantransgenicUnknownRRID:RGD_9587475This strain was produced by microinjection of Col1a(5A)-Cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)26Narl. As loxP-flanked DsRed is removed by Col1a(5A) promoter-driven Cre recombinase9587825BN/SsNNarl<a href=http://www.nlac.org.tw/p3_animal2_detail.asp?cid=3&nid=13&ppage=0&type=4> National Laboratory Animal Center, Taiwan </a>inbredLive Animals (as of 2018-03-28)RRID:RGD_9587825Imported from NIH, now maintained at National Laboratory Animal Center, Taiwan9587827F344/NNarl<a href=http://www.nlac.org.tw/p3_animal2_detail.asp?cid=3&nid=14&ppage=0&type=4> National Laboratory Animal Center, Taiwan </a>inbredLive Animals (as of 2018-03-28)RRID:RGD_9587827Imported from NIH, now maintained at National Laboratory Animal Center, Taiwan9587829LEW/SsNNarl<a href=http://www.nlac.org.tw/p3_animal2_detail.asp?cid=3&nid=15&ppage=0&type=4> National Laboratory Animal Center, Taiwan </a>inbredLive Animals (as of 2018-03-28)RRID:RGD_9587829Imported from NIH in 1995, now maintained at National Laboratory Animal Center, Taiwan9587831SHR/NCrlNarl<a href=http://www.nlac.org.tw/p3_animal2_detail.asp?cid=3&nid=16&ppage=0&type=4> National Laboratory Animal Center, Taiwan </a>inbredLive Animals (as of 2018-03-28)RRID:RGD_9587831Imported from NIH in 2000, now maintained at National Laboratory Animal Center, Taiwan9587833WKY/NCrlNarl<a href=http://www.nlac.org.tw/p3_animal2_detail.asp?cid=3&nid=19&ppage=0&type=4> National Laboratory Animal Center, Taiwan </a>inbredLive Animals (as of 2018-03-28)RRID:RGD_9587833Imported from NIH in 2000, now maintained at National Laboratory Animal Center, Taiwan9587835CrlNarl:LE<a href=http://www.nlac.org.tw/p3_animal2_detail.asp?cid=3&nid=20&ppage=0&type=4> National Laboratory Animal Center, Taiwan </a>outbredLive Animals (as of 2018-03-28)RRID:RGD_9587835Imported from Charles River in 1997, now maintained at National Laboratory Animal Center, Taiwan9588294CrljKwl:SD<a href="https://kwl-a.co.jp/rat/">Kiwa Laboratory Animals Co., Ltd. Japan</a>outbredUnknownRRID:RGD_9588294Sprague-Dawley from Charles River Laboratory Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1985; these were turned into SPF by caesarean section9588298Kwl:LEKiwa Laboratory Animals Co.Ltd. JapanoutbredUnknownRRID:RGD_9588298Long Evans from Sasaki Institute, Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1971; these were turned into SPF by caesarean section9588544SHR-<i>Ndufc2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ndufc2<sup>em1Mcwi</sup>9588537RRID:RGD_9588544This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1.9588546SHR-<i>Ndufc2<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-01-26)Ndufc2<sup>em2Mcwi</sup>9588541RRID:RGD_9588546This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1.9588552SD-<i>Nfe2l2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals (as of 2017-01-26)Nfe2l2<sup>em1Mcwi</sup>9588549RRID:RGD_9588552This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.9588559LE-Tg(DIO-iRFP)3Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=747>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; CryorecoveryRRID:RRRC_00747The transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter.9588570LE-Tg(cFos-eGFP)2Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=766>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00766The transgene contains reporter rat expressing eGFP in cFos expressing cells9588572LE-Tg(Slc6a3-icre)1Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=730>Rat Resource and Research Center</a>transgenicUnknowndopamine neurons in drug abuse or neurodegenerationRRID:RRRC_00730The transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neurons9588576LE-Tg(Slc6a3-icre)5Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>transgenicUnknownRRID:RGD_9588576The transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neurons9588578LE-Tg(Slc6a3-icre)6Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=758>Rat Resource and Research Center</a>transgenicLive Animals (as of 2017-05-31)neurodegenerationRRID:RRRC_00758The transgene contains BAC transgenic using rat dopamine transporterSlc6a3 (DAT) promoter to express Cre recombinase in dopaminergic neurons9588581LE-Tg(cFos-LacZ)1Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=759>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00759The transgene contains reporter rat expressing beta-galactosidase in cFos expressing cells9588583LE-Tg(cFos-TetO-iCre)4Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=760>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00760The transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressor9588585LE-Tg(cFos-TetO-iCre)6Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=736>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00736The transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressor9588587LE-Tg(EEF1A1-TetR)1Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=761>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00761The transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectors9588589LE-Tg(EEF1A1-TetR)2Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=735>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00735The transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectors9588591LE-Tg(Gad1-iCre)2Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>transgenicExtinct (as of 2019-02-01)RRID:RGD_9588591The transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neurons9588593LE-Tg(Gad1-icre)3Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=751>Rat Resource and Research Center</a>transgenicLive Animals (as of 2019-02-28)RRID:RRRC_00751The transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neurons9588595LE-Tg(Slc6a5-icre)1Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=750>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00750The transgene expresses BAC transgenic using rat GlyT2 (Slc6a5) promoter to express Cre recombinase in glycinergic neurons9589088ACI.COP-(<i>D3Rat130-D3Rat114</i>)(<i>D6Rat80-D6Rat146</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryorecovery (as of 2019-02-26)RRID:RRRC_00743This congenic strain contains regions of COP/CrCrl chromosome 3 and COP/CrCrl chromosome 6 transferred to the ACI/SegHsd strain background.9590284SS-Tg(ApoC3-CETP)25OpazWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. transgenicCryopreserved Sperm (as of 2019-02-05)RRID:RRRC_00637SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter9685623SD-<i>Pax6<sup>Sey2</sup></i>/MceDepartment of Ophthalmology, Okayama University Medical School, Okayama, JapanmutantCryopreserved Sperm (as of 2017-02-23)Pax6<sup>Sey2</sup>12790970RRID:RGD_9685623This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.)Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift.9685625F344-<i>Il2rg<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=978&s_References=> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2017-03-27)ImmunologyIl2rg<sup>em1Kyo</sup>12798560RRID:RGD_9685625The strain having a zinc finger nuclease-induced 660-bp deletion mutation in Il2rg gene shows severe combined immunodeficiency and grows normally under SPF condition.9685748F344-<i>Il2rg<sup>em2Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=979> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-27)ImmunologyIl2rg<sup>em2Kyo</sup>12798561RRID:RGD_9685748The severe combined immunodeficiency strain carries a zinc finger induced 1097-bp deletion mutation of Il2rg gene created in the F344/Stm embryos.9685750F344-<i>Il2rg<sup>em3Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=980> National BioResource Project for the Rat in Japan</a>mutantUnknownImmunologyIl2rg<sup>em3Kyo</sup>13464340RRID:RGD_9685750This strain shows severe combined immunodeficiency caused by a 332 bp deletion in Il2rg gene and grow normally under SPF condition.9685752TM-<i>Il2rg<sup>em4Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=981> National BioResource Project for the Rat in Japan</a>mutantUnknownImmunologyIl2rg<sup>em4Kyo</sup>13464339RRID:RGD_9685752The severe combined immunodeficiency strain carries a zinc finger nuclease-induced 162-bp deletion mutation in rat Il2rg gene. Grows normally under SPF condition.9685754TM-<i>Il2rg<sup>em5Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=982> National BioResource Project for the Rat in Japan</a>mutantUnknownImmunologyIl2rg<sup>em5Kyo</sup>12910099RRID:RGD_9685754This strain shows severe combined immunodeficiency caused by a zinc finger nuclease induced 653-bp deletion in Il2rg gene of TM/Kyo embryo. The rats grow normally under SPF condition.9685755W-Tg(tetO-Pou5f1,-Klf4,-Sox2,Ubc-rtTA,-EGFP)T1-3Hina<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1103> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoDevelopmentRRID:RGD_9685755Doxycycline induced mouse Oct3/4, Klf4, Sox2/ Ubc-promoter EGFP was introduced into embryonic fibroblast of Wistar rat (Slc:Wistar)by replication incompetent type lentivirus vector and iPS cells were induced. Chimeric rats (male) were generated from this iPS cells, and crossed with the wild-type Wistar rat (female).9685757W-<i>Il2rg<sup>em1Hina</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1110> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2017-03-27)ImmunologyIl2rg<sup>em1Hina</sup>12798562RRID:RGD_9685757This strain was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar)9685759LEW.WKY-(<i>D13Arb15-D13Rat77</i>)(<i>D16Rat40-D16Rat88</i>)/TjaImperial College, London, UKcongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00709Segment of interest from chr 13 and chr 16 of WKY/NCrl were introgressed into LEW/SsNHsd9685785SS.LEW-(<i>D1Mco36-D1Mco54</i>)/BjMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_9685785This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region9685787SS.LEW-(<i>D1Mco36-D1Rat200</i>)/BjMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_9685787This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region9685791SS.LEW-(<i>D1Mco36-D1Mco61</i>)/BjMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_9685791This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region9685793SS.LEW-(<i>D1Rat200-D1Mco136</i>)/BjMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_9685793This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region9685795SS.LEW-(<i>D1Mco55-D1Wox6</i>)/BjMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_9685795This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region9685797SS.LEW-(<i>D1Mco134-D1Wox6</i>)/BjMedical College of Ohio, Toledo, Ohio, USAcongenicUnknownRRID:RGD_9685797This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(<I>D1Mco36-D1Mco101</I>)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region9831158Y59/ZgdUniversity of Zagreb, Republic of CroatiainbredLive Animals (as of 2020-10-05)Immunology and transplantational researchRRID:RGD_9831158Strain developed by Prof. Borislav Nakic, Prof. Silobrcic and Prof. Andrija Kastelan from outbred Wistar rats during 1960s, maintained at Department of Animal Physiology,Faculty of Science, University of Zagreb, Republic of Croatia9835401ZDF-<i>Lepr<sup>m1Rll</sup></i>Laboratory of Human Behavior and Metabolism, Rockefeller University, New YorkmutantUnknownLepr<sup>m1Rll</sup>9835400RRID:RGD_9835401The Zucker rats from Charles River (ZDF-<i>Lepr<sup>fa</sup></i>/Crl) carry the Lepr<sup>m1Rll</sup> allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 2699835403WDF-<i>Lepr<sup>m1Rll</sup></i>Laboratory of Human Behavior and Metabolism, Rockefeller University, New YorkmutantUnknownLepr<sup>m1Rll</sup>9835400RRID:RGD_9835403The WDF colony at Vassar College (WDF/Vc) carry the Lepr<sup>m1Rll</sup> allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 2699854707SHR.WKY-(<i>D4Rat143-D4Rat10</i>)/TjaMRC Clinical Centre, London, UKcongenicUnknownInsulin ResistanceRRID:RRRC_00737This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk9854709SHR.WKY-(<i>D12Rat1-D12Mit3</i>)/TjaMRC Clinical Centre, London, UKcongenicUnknownInsulin Resistance, HypertensionRRID:RRRC_00738This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk9854711SHR.WKY-(<i>D16Rat88-D16Rat15</i>)/TjaMRC Clinical Centre, London, UKcongenicUnknownInsulin ResistanceRRID:RRRC_00739This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk9999141IRL/NCrNational Cancer Institute, Animal Production PrograminbredUnknownPulmonary hypertensionRRID:RRRC_00732The IRL/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production program9999143LOU/MNCrNational Cancer Institute, Animal Production PrograminbredExtinct (as of 2023-12-28)RRID:RRRC_00733The NCI Animal Production Program received this rat strain from NIH in 1987 for production and distribution of the LOU/MNCr rat strain9999145F344/NCrNational Cancer Institute, Animal Production PrograminbredUnknownPhenylketonuriaRRID:RRRC_00734The F344/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production program10002743DA.E3-(<i>D20Rat42-D20Rat49</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_10002743A fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd.10002745DA.E3-(<i>D20Rat47-AA858870</i>)/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownRRID:RGD_10002745A fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd.10002782SHR-<i>Sbf1<sup>m1Ipcv</i></sup>Institute of Biology and Medical Genetics, Charles University, PraguemutantUnknownSbf1<i><sup>m1Ipcv</sup></i>10002755RRID:RGD_10002782Spontaneous mutation in the colony of SHR/OlaIpcv in Prague.10002787SD-<i>Krt71<sup>m1Yuyi</i></sup>Laboratory Animal Center of Zhengzhou University, Henan Province, ChinamutantUnknownKrt71<i><sup>m1Yuyi</sup></i>10002785RRID:RGD_10002787Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified.10002791SD-<i>Fah<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Embryo; Cryopreserved Sperm (as of 2021-11-03)Fah<sup>em3Mcwi</sup>10002790RRID:RGD_10002791This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3.10002794SD-<i>Il2rg<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Il2rg<sup>em2Mcwi</sup>10002792RRID:RGD_10002794This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2.10043120BBDP.ACI-(<i>D2Mit8-D2Rat69</i>)/SunnSunnybrook Research Institute, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_10043120104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm3210043122BBDP.ACI-(<i>D2Mit8-D2Arb16</i>)(<i>D2Rat354-D2Rat69</i>)/SunnSunnybrook Research Institute, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_10043122104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>)(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm32 the region from D2Rat99 and D2Rat354 is from the background ACI strain10043124BBDP.ACI-(<i>D2Mit8-D2Arb16</i>)/SunnSunnybrook Research Institute, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_10043124104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm3210043127BBDP.ACI-(<i>D2Mit8-D2Rat354</i>)/SunnSunnybrook Research Institute, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_10043127104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm3210043129BBDP.ACI-(<i>D2Arb16-D2Rat63</i>)/SunnSunnybrook Research Institute, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_10043129104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm2610043132BBDP.ACI-(<i>D2Rat50-D2Rat63</i>)/SunnSunnybrook Research Institute, Toronto, Ontario, CanadacongenicUnknownRRID:RGD_10043132104 Mb region from ACI.BBDP-(<i>RT1<sup>u</sup></i>),(<i>Gimap5</i>)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm2610043368NER.F344-(<i>D3M2Mit327-D3Arb10</i>)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1065> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermNeurobiologyRRID:RGD_10043368The chromosome 3 region (D3M2Mit327-D3Arb10) was introgressed from F344/NSlc to NER/Kyo by backcrossing.(Sep 12, 2012)10043382F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)<i>Lgi1<sup>m1</sup></i>/KyoGraduate School of Medicine, Kyoto UniversitycongenicCryopreserved Sperm (as of 2023-12-29)NeurobiologyLgi1628742RRID:RGD_10043382Triple congenic rat made by mating F344.NER-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Mgh4-D5Rat36</i>)/Kyo and F344-Lgi1m1Kyo.10043385F344.NER-(<i>D1Mgh6-D1Rat73</i>)(<i>D5Mgh4-D5Rat36</i>)<i>Scn1a<sup>m1</sup></i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1070> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermNeurobiologyScn1a69364RRID:RGD_10043385Triple congenic rat made by mating F344.NER-(<i>D1Mgh6-D1Rat132</i>)(<i>D5Mgh4-D5Rat36</i>)/Kyo and F344-LScn1am1Kyo.10043617SPRD-<i>Anks6<sup>PKD</sup></i>/Fsn<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1094> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2018-04-20)Anks6<sup>PKD</sup>11534996RRID:RGD_10043617This strain rats was provided to University of Kansas from Central Institute for Laboratory Animal Breeding (Hanover, Germany), and then was introduced to Fujita Health University.10043620SHRSP.WKY-(<i>D1Smu13</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1080 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio HypertensionRRID:RGD_10043620This congenic strain was made by introducing chromosome 1 region (D1Smu13) of WKY into SHRSP/Izm.10043791SHRSP.SHR-(<i>D1Mgh5-D1Rat213</i>)/IzmDepartment of Functional Pathology, Shimane University Faculty of Medicine, Izumo, JapancongenicCryopreserved SpermCardio-HypertensionRRID:RGD_10043791male SHRSP.SHR-(<i>D1Rat93-D1Rat269</i>)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm10043794WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1087> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio-HypertensionRRID:RGD_10043794A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm.10043808WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)(<i>D4Mgh7-D4Rat68</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1089> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermCardio-HypertensionRRID:RGD_10043808A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm.10043811SHRSP.MES-<i>Cyba<sup>MES</sup></i>/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1108> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermCardio-HypertensionRRID:RGD_10043811A congenic strain made by introducing a genetic locus of Cyba from Matsumoto Eosinophilic Shinshu (MES/Slc) rat into SHRSP/Izm rat.10043813SHR/HktIzm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1091> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio-HypertensionRRID:RGD_10043813SHR/Kyushu rat (Kyushu University) was delivered to Shimane University in 2000 and maintained as inbred.10043816LEA-Tg(Pou5f1-YFP*)3Ncco<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1129> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermOncology, DevelopmentRRID:RGD_10043816Provided from Kyoto Bioresource center.10043826SHR/Kpo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1126 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermCardio-HypertensionRRID:RGD_10043826Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963.10043828SHR/2Kpo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1125 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermCardio-HypertensionRRID:RGD_10043828Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963.10044232SHRSP/Kpo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1147 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio-HypertensionRRID:RGD_10044232Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat.10045545CDS/SaszCohen diabetic-sensitive ratHebrew University-Hadassah Medical School, Jerusalem, IsraelinbredUnknownRRID:RGD_10045545Original breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony.10045548CDR/SaszCohen diabetic-rssistant ratHebrew University-Hadassah Medical School, Jerusalem, IsraelinbredUnknownRRID:RGD_10045548Original breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony.10045576SHRSP/2Kpo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1148 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo; Cryopreserved SpermCardio-HypertensionRRID:RGD_10045576Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat.10045578MSHRSP/Kpo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1149 > National BioResource Project for the Rat in Japan</a>inbredCryopreserved EmbryoCardio-HypertensionRRID:RGD_10045578Okamoto et al. found that a few rats developed higher blood pressure (over 230 mmHg) at 10 weeks old. They selected SHRSP rats that show severe hypertension from young age and M-SHRSP (malignant or precocious SHRSP) rat was established in 1985.10045580LE-Tg((ROSA)26Sor-CAG-tdTomato)24Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1139 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-15)RRID:RGD_10045580Background strain: Long Evans | Transgene: CAG-loxP-flanked Neo/STOP cassette-tdTomato was inserted into mouse ROSA26 BAC (RP23 244D9).10045582ODURM/Odu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1162> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved SpermDentistryRRID:RGD_10045582This strain shows malocclusion.10045584SD-Tg(CAG-HRAS*G12V)218Htsu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1146> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoOncologyRRID:RGD_10045584The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V(HrasV12)was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc.10045589SD-Tg(CAG-HRAS*G12V)246Htsu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1168> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved EmbryoOncologyRRID:RGD_10045589The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V(HrasV12)was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc.10045590LEA.F344-(<i>D20Rat47-D20Mgh4</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1163 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityRRID:RGD_10045590Long-Evans Agouti (LEA), type 2 diabetes model, dies from lymphocytic insulitis induced by radiation (4 Gy). This LEA.F344-(D20Rat47-D20Mgh4) strain is a congenic strain made by introducing a segment of chromosome 20 (D20Rat47-D20Mgh4) from F344 strain into LEA strain.10045591F344-<i>Cacna1a<sup>gry</sup></i><i>Scn1a<sup>m1Kyo</sup></i>/Okym<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1144 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2017-05-05)NeurobiologyCacna1a|Scn1a<sup>m1Kyo</sup>|Cacna1a<sup>gry</sup>2244|12792283|12880382RRID:RGD_10045591GRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) was backcrossed to F344/NSlc, and then crossed to HISS rat (HISS rat has the N1417H mutation in the Scn1a gene) to generate Scn1a/Cacna1a double mutant rats.10045593W-<i>Dmd<sup>em1Kykn</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1189 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2016-12-08)NeurobiologyDmd<sup>em1Kykn</sup>10045592RRID:RGD_10045593By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat. The resulting mutation is a 329-bp deletion around exon 3 and 2-bp substitution in exon16.10045597F344-<i>Nfe2l2<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1185 > National BioResource Project for the Rat in Japan</a>mutantUnknownNeurobiology; Diabetes ObesityNfe2l2<sup>em1Kyo</sup>10045594RRID:RGD_10045597Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 7-bp deletion in Nfe2l2 (Nrf2) gene.10045600F344-<i>Nfe2l2<sup>em2Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1191 > National BioResource Project for the Rat in Japan</a>mutantUnknownNeurobiology; Diabetes ObesityNfe2l2<sup>em2Kyo</sup>10045598RRID:RGD_10045600Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nfe2l2 gene.10045602W-Tg(CMV-Ddx54)19Tsuy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1193 > National BioResource Project for the Rat in Japan</a>transgenicUnknownNeurobiologyRRID:RGD_10045602This transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007.10045606W-Tg(CMV-Ddx54)37Tsuy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1195 > National BioResource Project for the Rat in Japan</a>transgenicUnknownNeurobiologyRRID:RGD_10045606This transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007.10046035SS.SR-(<i>D13Arb5-D13Arb8</i>)/McwiDepartment of Physiology, Medical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_10046035A region of chromosome 13 containing the renin gene from the Dahl salt-resistant (Dahl R; SR/JrHsd) strain into the SS genetic background (SS/JrHsdMcwi)10047085SD-<i>Fus<sup>em1Ionsz</sup></i><a href=http://www.ion.ac.cn/index.asp> Institute of Neuroscience, Chinese Academy of Sciences</a>mutantUnknownFus<sup>em1Ionsz</sup>10047084RRID:RGD_10047085CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C).10047391LE/OrlBarthLong-Evans/CryptorchidA.I. duPont Hospital for Children Life Science Center, Wilmington, DelawareinbredUnknownRRID:RGD_10047391Obtained from Centre Nationale de la Researche Scientifique, Orleans, France; then bred at A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware10047393SDLEF7/BarthA.I. duPont Hospital for Children Life Science Center, Wilmington, DelawarehybridUnknownRRID:RGD_10047393This hybrid strain was created by interbreeding Crl:SD and Crl:LE for F7 generation.10053598WI-<i>Foxn1<sup>em1Nips</sup></i>mutantUnknownFoxn1<sup>em1Nips</sup>10053596RRID:RGD_10053598Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97).10053601WI-<i>Foxn1<sup>em2Nips</sup></i>mutantUnknownFoxn1<sup>em2Nips</sup>10053599RRID:RGD_10053601Foxn1 mutation was induced by injecting pX330 expressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105).10053603WI-<i>Foxn1<sup>em1Nips</sup>, <i>Foxn1<sup>em2Nips</sup></i>F1hybridUnknownRRID:RGD_10053603This strain is a hybrid of WI-Foxn1<sup>em1Nips</sup> and WI-Foxn1<sup>em2Nips</sup>10054231HFJ/HblacHebei Medical University, Shijiazhuang, Hebei, ChinainbredUnknownRRID:RGD_10054231bred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China)10054233MIJ/HblacHebei Medical University, Shijiazhuang, Hebei, ChinainbredUnknownRRID:RGD_10054233bred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China)10054235MIJN/HblacHebei Medical University, Shijiazhuang, Hebei, ChinacoisogenicUnknownRRID:RGD_10054235this strain is derived from MIJ/Hblac, they do not carry the infertile gene10054239DA-<i>Abcd1<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Abcd1<sup>em2Mcwi</sup>10054237RRID:RGD_10054239CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in the exon1 of the Abcd1 gene of DA/OlaHsd rat embryos.10054242DA-<i>Abcd1<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantExtinct (as of 2016-10-24)Abcd1<sup>em4Mcwi</sup>10054240RRID:RGD_10054242CRISPR/Cas9 system was used to introduce a mutation in the Abcd1 gene of DA/OlaHsd rat embryos.10054245SS-<i>Adora1<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Adora1<sup>em3Mcwi</sup>10054243RRID:RGD_10054245CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Adora1 gene.10054276SD-<i>Vcp<sup>em1Ionsz</sup></i><a href=http://www.ion.ac.cn/index.asp> Institute of Neuroscience, Chinese Academy of Sciences</a>mutantUnknownVcp<sup>em1Ionsz</sup>10054274RRID:RGD_10054276CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into His10054279SD-<i>Gfap<sup>em1(2A-Chr2-EYFP)Ionsz</sup></i><a href=http://www.ion.ac.cn/index.asp> Institute of Neuroscience, Chinese Academy of Sciences</a>mutantUnknownGfap<sup>em1Ionsz</sup>10054277RRID:RGD_10054279CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap.10054284SS-<i>Adora1<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Adora1<sup>em4Mcwi</sup>10054282RRID:RGD_10054284CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp deletion in the Adora1 gene.10054287SS-<i>Adora2a<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2017-01-26)Adora2a<sup>em3Mcwi</sup>10054285RRID:RGD_10054287CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp deletion in the Adora2a gene.10054292SS-<i>Arhgef11<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Arhgef11<sup>em4Mcwi</sup>10054289RRID:RGD_10054292CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in the Arhgef11 gene.10054296SS-<i>Arhgef11<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Arhgef11<sup>em5Mcwi</sup>10054293RRID:RGD_10054296CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene.10054299SS.BN-(<i>D13Rat25-rs106935835</i>)-<i>Btg2<sup>em11Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Btg2<sup>em11Mcwi</sup>10054297RRID:RGD_10054299CRISPR/Cas9 system was used to introduce a 16-bp deletion in the Btg2 gene of SS.BN-(<i>D13Rat25-rs106935835</i>)/Mcwi rat embryos.10054304SS.BN-(<i>D13Rat25-rs106935835</i>)-<i>Btg2<sup>em13Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Btg2<sup>em13Mcwi</sup>10054302RRID:RGD_10054304CRISPR/Cas9 system was used to introduce a 2-bp deletion in the Btg2 gene of SS.BN-(<i>D13Rat25-rs106935835</i>)/Mcwi rat embryos10054307SS.BN-(<i>D13Rat25-rs106935835</i>)-<i>Btg2<sup>em7Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Btg2<sup>em7Mcwi</sup>10054305RRID:RGD_10054307The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(<i>D13Rat25-rs106935835</i>)/Mcwi rat embryos.10054310SS-<i>Casr<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Casr<sup>em1Mcwi</sup>10054308RRID:RGD_10054310CRISPR/Cas9 system was used to introduce a mutation in the Casr gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp (T) insertion in the Casr gene.10054373LEW-<i>Chrna3<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknown (as of 2018-10-22)Chrna3<sup>em1Mcwi</sup>10054371RRID:RGD_10054373CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene.10054376LEW-<i>Chrna3<sup>em9Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-11-26)Chrna3<sup>em9Mcwi</sup>10054374RRID:RGD_10054376CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene.10054379LEW-<i>Chrna4<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-11-26)Chrna4<sup>em4Mcwi</sup>10054377RRID:RGD_10054379CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 5-bp deletion in the Chrna4 gene.10054383LEW-<i>Chrna4<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-11-26)Chrna4<sup>em3Mcwi</sup>10054380RRID:RGD_10054383CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 16-bp deletion in the Chrna4 gene.10054386LEW-<i>Chrna5<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-11-26)Chrna5<sup>em1Mcwi</sup>10054384RRID:RGD_10054386CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene.10054389LEW-<i>Chrna5<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-11-26)Chrna5<sup>em2Mcwi</sup>10054387RRID:RGD_10054389CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 20-bp deletion in the Chrna5 gene.10054398DA-<i>Gla<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Gla<sup>em2Mcwi</sup>10054395RRID:RGD_10054398CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene.10054401FHH-Chr 3<sup>BN</sup>-<i>Helz2<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Helz2<sup>em3Mcwi</sup>10054399RRID:RGD_10054401CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3<sup>BN</sup>/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene.10054405FHH-Chr 3<sup>BN</sup>-<i>Helz2<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Helz2<sup>em4Mcwi</sup>10054402RRID:RGD_10054405CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3<sup>BN</sup>/Mcwi rat embryos.The resulting mutation is a 1-bp insertion in the Helz2 gene.10054408SS-<i>Kcnj10<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Kcnj10<sup>em1Mcwi</sup>10054406RRID:RGD_10054408CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Kcnj10 gene.10054411SS-<i>Kcnj10<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Kcnj10<sup>em3Mcwi</sup>10054409RRID:RGD_10054411CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp deletion in the Kcnj10 gene.10054414SS-<i>Mmp9<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Mmp9<sup>em4Mcwi</sup>12743378RRID:RGD_10054414CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos.10054417SS-<i>Mmp9<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Mmp9<sup>em6Mcwi</sup>10054415RRID:RGD_10054417CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Mmp9 gene.10054420LEW-<i>Mrpl28<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Mrpl28<sup>em1Mcwi</sup>10054418RRID:RGD_10054420CRISPR/Cas9 system was used to introduce a mutation in the Mprl28 gene of LEW/NCrl rat embryos. The resulting mutation is a 7-bp insertion in the 2-bp deletion site in the Mrpl28 gene.10054430LEW-<i>Pkd1<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Pkd1<sup>em2Mcwi</sup>10054428RRID:RGD_10054430CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene.10054433LEW-<i>Pkd1<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Pkd1<sup>em3Mcwi</sup>10054431RRID:RGD_10054433CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene.10054436LEW-<i>Pkd1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantExtinct (as of 2017-01-26)Pkd1<sup>em1Mcwi</sup>10054434RRID:RGD_10054436CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/Crl rat embryos. The resulting mutation is a 16-bp deletion in the Pkd1 gene.10054439LEW-<i>Pkd1<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2018-10-22)Pkd1<sup>em6Mcwi</sup>10054437RRID:RGD_10054439CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene.10054444LEW-<i>Rorc<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Rorc<sup>em3Mcwi</sup>10054442RRID:RGD_10054444CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Rorc gene.10054447LEW-<i>Rorc<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Rorc<sup>em5Mcwi</sup>10054445RRID:RGD_10054447CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 59-bp deletion in the Rorc gene.10054450SS-<i>Sirt3<sup>em25Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Sirt3<sup>em25Mcwi</sup>10054448RRID:RGD_10054450CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene.10054453SS-<i>Sirt3<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Sirt3<sup>em4Mcwi</sup>10054451RRID:RGD_10054453CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene.10054456T2DN-<i>Sirt3<sup>em35Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-22)Sirt3<sup>em35Mcwi</sup>10054454RRID:RGD_10054456CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene.10054459T2DN-<i>Sirt3<sup>em30Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Sirt3<sup>em30Mcwi</sup>10054457RRID:RGD_10054459CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 31-bp deletion in the Sirt3 gene.10054462SS-<i>Stk39<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Stk39<sup>em5Mcwi</sup>10054460RRID:RGD_10054462CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene.10054465SS-<i>Stk39<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Stk39<sup>em6Mcwi</sup>10054463RRID:RGD_10054465CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Stk39 gene.10054473SS.BN-(<i>D13Rat124-D13Hmgc3694</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_10054473SS/JrHsdMcwi were crossed with SS-13<sup>BN</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain10059570WI;WDB-<i>Kiss1<sup>tm1Nips</i></sup>National Institute for Physiological Sciences, Okazaki Aichi, JAPAN, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, JapanmutantUnknownKiss1<sup>tm1Nips</sup>40902862RRID:RGD_10059570This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide. Founder animals were backcrossed to Crlj:WI.10059573SS-<i>Adora2a<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Adora2a<sup>em5Mcwi</sup>10059571RRID:RGD_10059573CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene.10059576WKY-<i>Sik2<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Sik2<sup>em4Mcwi</sup>10059574RRID:RGD_10059576CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene.10059635W-Tg(GnRH-GFP)MniDepartment of Veterinary Physiology, Veterinary Medical Science, The University of Tokyo, Tokyo JapantransgenicUnknownRRID:RGD_10059635generated by Dr. Masugi Nishihara's group10395226Sim:LELong Evans<a href=http://www.simlab.com/products.html>Simonsen Laboratories</a>outbredUnknownRRID:RGD_10395226Received from Dr. Evans, University of California, Berkeley - Experimental Institute of Biology in 1949. Caesarean rederived in 1997. Selection is based on the black-hooded phenotype.10395228Sim:WIWistar<a href=http://www.simlab.com/products.html>Simonsen Laboratories</a>outbredUnknownRRID:RGD_10395228Received from the Lobund Institute, University of Notre Dame in 1957. Caesarean rederived in 1997.10395233Sim:SDSprague-Dawley Derived<a href=http://www.simlab.com/products.html>Simonsen Laboratories</a>outbredUnknownRRID:RGD_10395233Received Sprague-Dawley derived breeding stock from Charles River Laboratory in 1958 and crossed with Sprague-Dawley rats received from ARS/Sprague-Dawley in 1975. Caesarean rederived in 1997.10395235F344/NSimFISCHER 344<a href=http://www.simlab.com/products.html>Simonsen Laboratories</a>inbredUnknownRRID:RGD_10395235Gnotobiotic pedigreed breeders received from the NIH repository colony in 2005. Most widely used inbred rat strain, particularly for toxicology and teratology.10395249FHH.FHH.3<sup>BN</sup>-(<i>3p-D3Rat98</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_10395249(FHH X FHH-3<sup>BN</sup>/Mcwi) F<sub>2</sub> males were backcrossed with FHH-3<sup>BN</sup>/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line10395251FHH.FHH.3<sup>BN</sup>-(<i>D3Hmgc24-3q</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_10395251(FHH X FHH-3<sup>BN</sup>/Mcwi) F<sub>2</sub> males were backcrossed with FHH-3<sup>BN</sup>/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line10395253FHH.FHH.3<sup>BN</sup>-(<i>D3Hmgc24-3q</i>)(<i>3p-D3Rat98</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_10395253(FHH X FHH-3<sup>BN</sup>/Mcwi) F<sub>2</sub> males were backcrossed with FHH-3<sup>BN</sup>/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line10395297GK/FarMcwiGoto-KakizakiMedical College of Wisconsin, Milwaukee, WisconsininbredUnknownRRID:RGD_10395297Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. Now bred and maintained at Medical College of Wisconsin10401195SD-Tg(CAG.LoxP.EGFP)Zi<a href=http://www.rrrc.us/Strain/?x=689>Rat Resource and Research Center</a>transgenicLive Animals; Cryopreserved Sperm; CryorecoveryRRID:RRRC_00689Random insertion of a Cre inducible expression cassette, controlled by the CAG promoter. LacZ is expressed constitutively, GFP only after Cre mediated recombination10401201LE-Tg(Th-cre)3.1DeisStanford UniversitytransgenicLive Animals; Cryopreserved Sperm (as of 2017-05-31)RRID:RRRC_00659Cre gene was introduced immediately before the ATG of the mouse tyrosine hydroxylase (Th) gene on BAC RP23-350E1310401204LE-Tg(ChAT-cre)5.1DeisRrrc<a href=http://www.rrrc.us/Strain/?x=658>Rat Resource and Research Center</a>transgenicLive Animals; Cryopreserved Sperm (as of 2017-05-31)RRID:RRRC_00658Cre gene was introduced immediately before the ATG of the mouse choline acetyltransferase (Chat) gene in BAC RP23-246B12. This strain is estimated to carry 6 copies of the transgene at the integration site.10401208F344-Tg(Prp-APP,Prp-PS1)19/Rrrc<a href=http://www.rrrc.us/Strain/?x=699>Rat Resource and Research Center</a>transgenicLive Animals; Cryopreserved Sperm (as of 2019-02-20)RRID:RRRC_00699The strain was coinjected with two transgenes: one contains the human amyloid beta (A4) precursor protein (hAPP) gene with the Swedish mutation (K595N/M596L) driven by mouse prion promoter (Prp). The other contains the human presenilin 1 gene (PS1) with a deletion of exon 9, also driven by the mouse prion promoter (Prp). Based on segregation patterns, it is believed that the two transgenes have integrated at the same chromosomal site.10401212SD-Tg(Thy1.2-NIPA1)<a href=http://www.rrrc.us/Strain/?x=700>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; CryorecoveryRRID:RRRC_00700Human NIPA1G106R mutation is made by site-directed mutagenesis and then inserted into Thy1.2-promotor cassette. Transgenic vector is injected into fertilized eggs to produce 2 independent lines (A, B)10401835WKY.F344-(<i>D17Got91-D17Rat51</i>)/TjaMRC Clinical Centre, London, UKcongenicUnknownRRID:RGD_10401835A congenic strain made by introducing a 15 Mbp segment of chromosome 17 from F344/NHsd into WKY/Cruk, this region has the distal end of Cm15 QTL10401837WKY.F344-(<i>D17Got91-D17Rat47</i>)/TjaMRC Clinical Centre, London, UKcongenicUnknownRRID:RGD_10401837A congenic substrain derived from the progenitor strain WKY.F344-(<i>D17Got91-D17Rat51</i>)/Tja10401839WKY.F344-(<i>D17Rat47-D17Rat51</i>)/TjaMRC Clinical Centre, London, UKcongenicUnknownRRID:RGD_10401839A congenic substrain derived from the progenitor strain WKY.F344-(<i>D17Got91-D17Rat51</i>)/Tja10401841WKY.F344-(<i>D17Rat131-D17Rat51</i>)/TjaMRC Clinical Centre, London, UKcongenicUnknownRRID:RGD_10401841A congenic substrain derived from the progenitor strain WKY.F344-(<i>D17Got91-D17Rat51</i>)/Tja10401843WKY-<i>Slc39a12<sup>em77Tja</sup></i>MRC Clinical Centre, London, UKmutantUnknownSlc39a12<sup>em77Tja</sup>10401842RRID:RGD_10401843This strain was produced by injecting ZFNs targeted sequence into WKY/Cruk rat embryos. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.10401845WKY-<i>Slc39a12<sup>em77Tja+/-</sup></i>WKY-<i>Slc39a12<sup>em77Tja+</sup></i>/WKY-<i>Slc39a12<sup>em77Tja-</sup></i>MRC Clinical Centre, London, UKmutantUnknownSlc39a12<sup>em77Tja</sup>10401842RRID:RGD_10401845ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.10401848WKY-<i>Slc39a12<sup>em77Tja-/-</sup></i>WKY-<i>Slc39a12<sup>em77Tja-</sup></i>/WKY-<i>Slc39a12<sup>em77Tja-</sup></i>MRC Clinical Centre, London, UKmutantUnknownSlc39a12<sup>em77Tja</sup>10401842RRID:RGD_10401848ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.10401851SD-<i>Lep<sup>em1Narl</sup></i>National Laboratory Animal Center, TaiwanmutantUnknownLep3000RRID:RGD_10401851CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermates10401918BDIX/HanHsd<a href=http://www.envigo.com/products-services/research-models-services/find-a-model/research-models/rats/inbred/bdix-inbred-rat/>Envigo</a>inbredCryorecoveryRRID:RGD_10401918BDIX/Han maintained at Envigo (Harlan)10402160HCR/1McoHigh-capacity runners; generation 5Medical College of Ohio, Toledo, Ohio, USAinbredUnknownRRID:RGD_10402160HCR/Mco bred till the fifth generation10402163HCR/2McoHigh-capacity runners; generation 26Medical College of Ohio, Toledo, Ohio, USAinbredUnknownRRID:RGD_10402163HCR/Mco bred till the twenty-sixth generation10402165LCR/1McoLow-capacity runners; generation 5Medical College of Ohio, Toledo, Ohio, USAinbredUnknownRRID:RGD_10402165LCR/Mco bred till the fifth generation10402167LCR/2McoLow-capacity runners; generation 26Medical College of Ohio, Toledo, Ohio, USAinbredUnknownRRID:RGD_10402167LCR/Mco bred till the twenty-sixth generation10402390BNW/JerBrown Norway-wildAgricultural Omega Solutions LLC, Milwaukee, WisconsininbredUnknownRRID:RGD_10402390This is a wild caught strain, characterized by Charles River Laboratories and has been bred brother x sister10402393HPE/JerHairless pink eye diluteAgricultural Omega Solutions LLC, Milwaukee, WisconsininbredUnknownRRID:RGD_10402393This is a strain of unknown background, and has been bred brother x sister10402395HBLS/JerHairless black skin pigmentedAgricultural Omega Solutions LLC, Milwaukee, WisconsininbredUnknownRRID:RGD_10402395This is a result of a cross of the BNW and HPE, this spontaneous hairless black skin mutation was selected from the F2 offspring for the black hairless quality and subsequently bred brother x sister10402819DA-<i>Tph2<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Tph2<sup>em2Mcwi</sup>10402817RRID:RGD_10402819This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.10402822DA-<i>Tph2<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryorecovery (as of 2017-01-26)Tph2<sup>em3Mcwi</sup>10402820RRID:RGD_10402822This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.10402834LEW.SS-(<i>D7Rat27-D7Mgh1</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_10402834LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain10402836LEW.SS-(<i>D8Chm12-D8Rat15</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_10402836LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain10402839LEW.SS-(<i>D10Mgh6-D10Mgh1</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_10402839LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain10402842LEW.SS-(<i>D17Rat15-D17Rat51</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_10402842LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain10402850LEW.SS-(<i>D7Rat27-D7Mgh1</i>)(<i>D17Rat15-D17Rat51</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_10402850double congenic strain was generated by combining the two separate congenic strains10402852LEW.SS-(<i>D7Rat27-D7Mgh1</i>)(<i>D17Rat15-D17Rat51</i>)(<i>D10Mgh6-D10Mgh1</i>)/AydResearch Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, CanadacongenicUnknownRRID:RGD_10402852multiple congenic strain was generated by combining the three separate congenic strains10412325LE-Tg(Drd1-icre)3Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=767>Rat Resource and Research Center</a>transgenicLive Animals (as of 2019-03-18)Drd12518RRID:RRRC_00767The transgene expresses BAC transgenic using rat dopamine receptor 1 promoter to express Cre recombinase in D1R neurons10412327LE-Tg(Drd2-iCre)1Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=768>Rat Resource and Research Center</a>transgenicLive Animals (as of 2019-03-18)Drd12518RRID:RRRC_00768The transgene expresses BAC transgenic using rat dopamine receptor 2 promoter to express Cre recombinase in D2R neurons10412329LE-Tg(Pvalb-icre)2Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=773>Rat Resource and Research Center</a>transgenicLive Animals (as of 2019-03-18)Pvalb3457RRID:RRRC_00773The transgene expresses BAC transgenic using rat parvalbumin promoter to express Cre recombinase in parvalbumin expressing neurons10413850SD-<i>Abcc6<sup>em1Qlju-/-</sup></i>Thomas Jefferson University, PhiladelphiamutantUnknownAbcc6<sup>em1Qlju</sup>10413843RRID:RGD_10413850This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.10413852SD-<i>Abcc6<sup>em2Qlju-/-</sup></i>Thomas Jefferson University, PhiladelphiamutantUnknownAbcc6<sup>em2Qlju</sup>10413846RRID:RGD_10413852This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.10413854SD-<i>Abcc6<sup>em3Qlju-/-</sup></i>Thomas Jefferson University, PhiladelphiamutantUnknownAbcc6<sup>em3Qlju</sup>10413847RRID:RGD_10413854This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.10413856SD-<i>Abcc6<sup>em4Qlju-/-</sup></i>Thomas Jefferson University, PhiladelphiamutantUnknownAbcc6<sup>em4Qlju</sup>10413848RRID:RGD_10413856This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.10413858SD-<i>Abcc6<sup>em5Qlju-/-</sup></i>Thomas Jefferson University, PhiladelphiamutantUnknownAbcc6<sup>em5Qlju</sup>10413849RRID:RGD_10413858This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.10450489SD-<i>Bsn<sup>em1Ionsz</sup></i><a href=http://www.ion.ac.cn/index.asp> Institute of Neuroscience, Chinese Academy of Sciences</a>mutantUnknownBsn<sup>em1Ionsz</sup>10450488RRID:RGD_10450489CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn10755350F344.ZUC-(<i>Lepr<sup>fa</sup></i>),OLETF-(<i>D14Rat23-D14Rat12</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=390> National BioResource Project for the Rat in Japan</a>congenicUnknownDiabetes ObesityLepr3001RRID:RGD_10755350The F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-<i>Lepr<sup>fa</sup></i> with F344.OLETF-(<i> D14Rat23-D14Rat12</i>) and then selecting Lepr<sup>fa</sup> -Niddm20 (fa/fa-Nidd2/of) homozygotes10755352LH/MavRrrcAekLyon HypertensiveDepartment of Pharmacology, University of Iowa, IowainbredLive Animals (as of 2023-10-25)RRID:RGD_10755352Lyon Hypertensive rats maintained at Department of Pharmacology, University of Iowa10755354LN/MavRrrcAeklyon normotensiveDepartment of Pharmacology, University of Iowa, IowainbredUnknownRRID:RGD_10755354Lyon normotensive rats maintained at Department of Pharmacology, University of Iowa10759544SD-<i>Gcdh<sup>em1Dba</sup></i>Center of Molecular Diseases, CHUV, SwitzerlandmutantUnknownGcdh<sup>em1Dba</sup>10758636RRID:RGD_10759544this strain was produced by CRISPR/Cas9 system. The resulting knock-in mutation is R411W in exon 11 of the GCDH gene.11040455SHR.BN-(<i>D16Rat88-D16Rat9</i>)/CubInstitute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech RepubliccongenicUnknownRRID:RGD_11040455Segment of chromosome 16 from BN.<i>Lx</i>/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic11040519SHR-<i>Ndufc2<sup>em1Mcwi-/+</sup></i>SHR-<i>Ndufc2<sup>em1Mcwi-</sup></i>/<i>Ndufc2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownNdufc2<sup>em1Mcwi</sup>9588537RRID:RGD_11040519ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.11040521SHR-<i>Ndufc2<sup>em2Mcwi-/+</sup></i>SHR-<i>Ndufc2<sup>em2Mcwi-</sup></i>/<i>Ndufc2<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_11040521ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.11040525SHR-<i>Ndufc2<sup>em1Mcwi+/+</sup></i>SHR-<i>Ndufc2<sup>em1Mcwi+</sup></i>/<i>Ndufc2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_11040525ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.11040527SHR-<i>Ndufc2<sup>em2Mcwi+/+</sup></i>SHR-<i>Ndufc2<sup>em2Mcwi+</sup></i>/<i>Ndufc2<sup>em2Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_11040527ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.11040548CrlCembe:WIWistar ratsCenter for Biological Model Research (CeMBE), Pontifical Catholic University from Rio Grande do Sul (PUCRS), BraziloutbredUnknownRRID:RGD_11040548CeMBE received breeding stock from Charles River (Crl:WI, strain code 003) in 2014, these are bred according to the Poiley rotation (1960) with permanent monogamous mating.11040561WI-<i>Htr7<sup>em1Geh</sup></i><a href=http://www.rrrc.us/Strain/?x=745>Rat Resource and Research Center</a>mutantCryopreserved Sperm; CryorecoveryHtr7<sup>em1Geh</sup>14696714RRID:RRRC_00745CRISPR/Cas9 system was used to generate this mutant; this induced 89 base pair deletion in exon 1 of the Htr7 gene.11040563SD-Tg(Adra1a)Vccr<a href=http://www.rrrc.us/Strain/?x=756>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00756Cardiac specific overexpression of the alpha 1A adrenergic receptor, 40 fold overexpression of the receptor11040565LEW-Tg(CAG-OFP)Pic<a href=http://www.rrrc.us/Strain/?x=746>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; CryorecoveryRRID:RRRC_00746random insertion of a transgene carrying orange fluorescent protein (OFP) driven by the CAG promoter11040568W-Tg(RNB1-116K03-EGFP-mRFP)3Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=931> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermAtrn69063RRID:RGD_11040568The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.11040570W-Tg(RNB1-116K03-EGFP-mRFP)20Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=932> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermAtrn69063RRID:RGD_11040570The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.11040572W-Tg(RNB1-116K03-EGFP-mRFP)21Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=933> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermAtrn69063RRID:RGD_11040572The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.11040574W-Tg(RNB1-116K03-EGFP-mRFP)22Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=934> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermAtrn69063RRID:RGD_11040574The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.11040577W-Tg(RNB1-116K03-EGFP-mRFP)41Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=935> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermAtrn69063RRID:RGD_11040577The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.11040579W-Tg(RNB1-116K03-EGFP-mRFP)104Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=936> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermAtrn69063RRID:RGD_11040579The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon.11040581TRM.W-Tg(RNB1-186G14)51Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1104> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040581F344/Stm rat BAC clone RNB1-186G14 was microinjected into embryos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.11040675TRM.W-Tg(RNB1-186G14)33Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1102> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040675F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.11040678TRMR.W-Tg(RNB1-186G14)51Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1106> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040678F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.11040681TRMR.W-Tg(RNB1-186G14)33Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1105> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved SpermRRID:RGD_11040681F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes.11040683SER.TRMR.W-Tg(RNB1-186G14)51Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1152> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040683The sperms from N2 generation rat (ID#252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) were microinjected into SER embyos. The offspring with transgese was backcrossed with SER rats.11040916F344-<i>Zeb2<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1169> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiology; DevelopmentZeb21307272RRID:RGD_11040916Zinc-finger nucleases (ZFNs) method taregting exon 5 of Zeb2 gene (AGCCAAAGCTTGCCTCCA and GACTACTGACTCAAG) was used; This strain has a 5-bp deletion (cagag) and a 2-bp insertion (tc) in exon7 of Nrf2 gene, resulting in a deletion of Glutamine(Q)541. Background strain: F344/Stm11040918WTC-<i>furue</i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=550> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermNeurobiologyRRID:RGD_11040918WTC-furue rat was found in a colony of WTC.ZI-Atrn<zi> congenic strain at national cancer research center in 2000. The tremor phenotype is controlled by an autosomal recessive mutation ("furue")11040920WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)39Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=909> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040920CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #13111040922WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)15Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=900> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040922CHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #13111040934WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)92Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=912> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040934CHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #13111040936WTC.Cg-<i>dmy</i>Tg(Mrs2-EGFP)131Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=913> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040936CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #13111040939STOCK.<i>dmy</i>Tg(CMV-Mrs2)Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=947> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermMrs2708529RRID:RGD_11040939A transgene containing the CMV promoter and MRS2 gene was microinjected into the pronuclei of fertilized oocytes collected from Wistar rats. Transgenic offspring founder rats were backcrossed with WTC.DMy-dmy rats to obtain dmy/dmy homozygous and also hemizygous for the transgede (dmy/dmy, tg/+).11040941SD-Tg(Gfap-Tk1)JogSD-Tg(Gfap-Tk1)transgenicCryopreserved Embryo (as of 2023-12-14)Gfap|Tk12679|621014RRID:RGD_11040941The rats were originally generated by the University of Michigan Transgenic Animal Model Core, University of Michigan. They used a Crl:CD(SD) sub strain of Sprague-Dawley rats, obtained from Charles River Laboratory (Wilmington, MA, USA). The F1 rats have been bred in the UK with Hsd:Sprague Dawley (Harlan laboratories, UK), which are direct descendants of the original 1925 SD-company colony (Madison, Wisconsin, USA). The GFAP-TK rat was generated by pronuclear injection of a Gfap-Tk Bacterial Artificial Chromosome (BAC) construct, engineered using RedET-mediated homologous recombination methods.11040946F344-<i>Prkdc<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1021> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2017-06-08)Prkdc|Prkdc<sup>em1Kyo</sup>1308982|12910095RRID:RGD_11040946This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene, resulting a 46-deletion. Background strain: F344/Stm11040948F344-<i>Prkdc<sup>em2Kyo</sup>Il2rg<sup>em6Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1022> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2017-06-08)Il2rg|Prkdc|Prkdc<sup>em2Kyo</sup>|Il2rg<sup>em6Kyo</sup>621466|1308982|12910096|12910097RRID:RGD_11040948This strain was established by Zinc-finger nucleases (ZFNs) method taregting rat Prkdc gene (227-bp deletion) and Il2rg gene (332-bp deletion). Background strain: F344/Stm11040950TM-<i>Prkdc<sup>em4Kyo</sup>Il2rg<sup>em5Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1023> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2017-07-12)Il2rg|Prkdc|Prkdc<sup>em4Kyo</sup>|Il2rg<sup>em5Kyo</sup>621466|1308982|12910098|12910099RRID:RGD_11040950This strain was established by Zinc-finger nucleases (ZFNs) method causing 20-bp deletion in the exon1 of Prkdc gene and a 653-bp deletion Il2rg gene. Background strain: TM/Kyo11040952WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)(<i>D3Mgh16-D3Rat144</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1088> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo; Cryopreserved SpermRRID:RGD_11040952A congenic strain made by introducing a segments of chromosome 1 and 3 from SHRSP/Izm into WKY/Izm.11040954LEA-<i>Tp53<sup>tm1(AmCyan1)Ncco</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1130> National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoRRID:RGD_11040954LEA rats were provided from Kyoto Bioresource Center in 2006. Then LEA rat ES cells having Oct4-Venus gene and Oct4-Venus Tg rat strain (LEA-Tg(Pou5f1-YFP*)3Ncco) were established.11040957F344-<i>Tp53<sup>m1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1138> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermTp53|Tp53<sup>m1Kyo</sup>3889|12792955RRID:RGD_11040957This strain was established by ENU mutagenesis (gene-driven) using F344/NSlc and has a missense mutation(R271C).11040959SER.TRMR.W-<i>tm<sup>TRM</sup>Atrn<sup>zi</sup></i>Tg(RNB1-186G14)/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1152> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11040959The sperms from N2 generation rat (NBRP Rat No:252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP Rat No:0677) were microinjected into SER embryos. The offspring with transgene was backcrossed with SER rats.11040962F344-<i>Bscl2<sup>m1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1178> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2019-01-09)Bscl2|Bscl2<sup>m1Kyo</sup>1308135|13838727RRID:RGD_11040962T239A mutation was found by screening of 4608DNA sample from ENU mutagenesis library KURMA. This strain has a T239A (L80X) nonsense mutation in Bscl2 gene.11040969DWH/IetDwarfism derived from Wistar Hannover GALAS rats<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1181> National BioResource Project for the Rat in Japan</a>mutantCryopreserved EmbryoMetabolismTg3848RRID:RGD_11040969derived from Wistar Hannover GALAS rats11040971F344-<i>Tyr<sup>C</sup>Kit<sup>H</sup>/Kyo</i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1183> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2017-07-17)Kit|Tyr620568|1589755RRID:RGD_110409711) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to black. Background strain: F344/Stm11040974F344-<i>Asip<sup>A</sup>Tyr<sup>C</sup>Kit<sup>H</sup>/Kyo</i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1184> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved SpermAsip|Kit|Tyr2003|620568|1589755RRID:RGD_110409741) point mutation in the exon 2 of Tyrosinase (Tyr) gene (albino phenotype), 2) 19-bp deletion in Asip gene (Agouti phenotype), and 3) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to Agouti. Background strain: F344/Stm11040977WI-<i>ROSA26<sup>em1(CAG-EGFP)Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1186> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2017-08-08)RRID:RGD_11040977CAG-GFP vector was knock-in into the rat ROSA26 locus by CRISPR/Cas9 system. Background strain: Crlj:WI. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.11040980W-<i>Dmd<sup>em2Kykn</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1190> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2017-05-02)Dmd2507RRID:RGD_11040980By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon1611040985W-<i>Dmd<sup>em3Kykn</sup></i>Keitaro Yamanouchi, The University of TokyomutantExtinct (as of 2017-05-02)Dmd2507RRID:RGD_11040985By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: Deletion of exon3 to exon16 (a part of intron 3 remain). This straindied out in 2015.11040987WIC-Tg(Nanog-YFP*)1Utr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1202> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-04-21)Nanog1303178RRID:RGD_11040987BAC (containing rat Nanog gene) vector was injected into Iar:Wistar-Imamichi rats. The construct is as follows: Venus-IRES-puromycin resistance gene.11041106LE-Tg(Pvalb-tTA)15Hio<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1203> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermRRID:RGD_11041106background strain #65306; Long-Evans rat #65288; Iar:Long-Evans #65289; Transgene #65306; (1) Parvalbumin (PV) promoter #65306; mouse derived (MGI:97821). PV is calcium-binding protein. (2) tetracycline transactivator (tTA) #65306; Fusion protein of tetracycline repressor (Escherichia coli-derived) and VP16 (Herpes simplex virus-derived). In the absence of Doxycycline (Dox), tTA binds to tetracycline-responsive element (TRE) and expression of TRE-controlled genes can be induced. Vector #65306; pBlueScript (Stratagene), pBACe3.6 (CHORI)11041108CV/Iet<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1222> National BioResource Project for the Rat in Japan</a>mutantCryopreserved SpermRRID:RGD_11041108The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started.11041128TM.KDP-<i>Cblb</i>(<i>D9Rat13-D9Rat4</i>)(<i>D12Rat5-D12Rat45</i>)(<i>D18Mit9-D18Rat44</i>)/Nyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1211> National BioResource Project for the Rat in Japan</a>congenicCryopreserved SpermDiabetes ObesityCblb620535RRID:RGD_11041128The Cblb mutation, one of the causative gene in type 1 diabetes of KDP/Tky and KDP alleles in other modifier genes were transferred onto the genetic background of TM:Kyo strain.11041139F344-Tg(Dct-lacZ)9Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1218> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved SpermDevelopmentDct1564975RRID:RGD_11041139The construct was made by connecting a 3,659 bp DNA fragment of rat Dct (dopachrome tautomerase) gene (5'-3237 to 422) with the upstream of lacZ gene. Dct gene was derived from F344/Stm. Background strain: F344/NSlc, plasmid: pLacZ-Basic (Clontech Laboratories)11041143PL/Iet<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1223> National BioResource Project for the Rat in Japan</a>inbredCryopreserved SpermDevelopmentRRID:RGD_11041143A new mutant gene that causes preaxial polydactyl in the hindlimbs was found in the Jcl:Wistar -derived strain of rats with fused pulmonary lobes (FRL) at the Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology . Genetic analysis has revealed that the new mutation is not closely linked with the fpl gene. This strain was established by sib mating (over 20 generations).11049145SD-<i>Crh<sup>em1Ionsz</sup></i><a href=http://www.ion.ac.cn/index.asp> Institute of Neuroscience, Chinese Academy of Sciences</a>mutantUnknownCrh<sup>em1Ionsz</sup>11049142RRID:RGD_11049145CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh.11073612SS-Chr 13<sup>BN</sup>-<i>Mir29b<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Mir29b1<sup>em1Mcwi</sup>11073608RRID:RGD_11073612This strain was produced by injecting TALENs targeting the sequence TTTAAATAGTGATTGTCtagcaccatttgaaaTCAGTGTTCTTGGTGGA into SS-Chr 13BN/mcwi rat embryos. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequence11073719SD-<i>Drd1<sup>em1Ionsz</sup></i><a href=http://www.ion.ac.cn/index.asp> Institute of Neuroscience, Chinese Academy of Sciences</a>mutantUnknownDrd1<sup>em1Ionsz</sup>11073717RRID:RGD_11073719CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1.11081142SD-<i>Pgr<sup>em1Soar</sup></i>University of Kansas Medical CentermutantUnknownreproduction, neurobiology, and cancerPgr3317RRID:RRRC_00741Crispr/Cas9 targeting of Exon 3 of rat Pgr gene resulting in a deletion of Exon311081149SD-<i>Esr2<sup>em1Soar</sup></i><a href=http://www.rrrc.us/Strain/?x=742>Rat Resource and Research Center</a>mutantUnknownreproductionEsr2<sup><i>em1Soar</i></sup>40902840RRID:RRRC_00742Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 411081151WI-<i>Grm8<sup>em1Geh</sup></i><a href=http://www.rrrc.us/Strain/?x=744>Rat Resource and Research Center</a>mutantUnknownneurologic medications, neurologic diseases, normal brain functionsGrm8619858RRID:RRRC_00744CRISPR/Cas9 induced 29 base pair deletion in exon 111081153SD-Tg(DIO--iRFP)9Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=748>Rat Resource and Research Center</a>transgenicLive Animals (as of 2019-02-26)RRID:RRRC_00748The transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter.11081177F344<i><sup>tl</sup></i>toothless (tl)University of Massachusetts Medical School.mutantUnknownskeletal and osteoclast biologyCsf1<sup>tl</sup>12910954RRID:RRRC_00749A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon.11084925SD-Tg(CD59-HBA1)Bryd<a href=http://www.rrrc.us/Strain/?x=754>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2017-01-26)intravascular hemolysis and related sequelae of anemia, hemoglobinemia, and hemoglobinuriaCD59736600RRID:RRRC_00754Transgene: human CD59 gene (cDNA) under control of alpha-globin regulatory elements (alpha-globin promoter and alpha hemoglobin locus control region). Upon administration of intermedilysin (ILY), cells expressing human CD59 will be selectively ablated11084928WKY-<i>Jund<sup>em1Tja</sup></i>Institute of Genetics & Molecular Medicine, University of EdinburghmutantCryopreserved Sperm (as of 2017-01-26)leukemia, breast cancerJund<sup>em1Tja</sup>11084926RRID:RRRC_00755The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation.11084931SD-Tg(RIP7-RLuc-YFP)Vpoit<a href=http://www.rrrc.us/Strain/?x=757>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00757Transgene: RIP7-RLuc-YFP. This transgene expresses a renilla luciferase-YFP fusion protein under control of the rat insulin 2 gene promoter (RIP7).11087549LE-Tg(GFAP-TK)Hcam<a href=http://www.rrrc.us/Strain/?x=764>Rat Resource and Research Center</a>transgenicUnknownneurogenesisRRID:RRRC_00764random insertion of human GFAP promoter driving herpes simples virus thymidine kinase11087551SD-<i>Il15<sup>em1Soar</sup></i>University of Kansas Medical CentermutantUnknownIl15|Il15<sup>em1Soar</sup>2887|12910491RRID:RRRC_00769Zinc finger nuclease mediated 7bp deletion within exon 2 of the Il15 gene, resulting in a frameshift and premature stop codon.11087553SD-<i>Mmp12<sup>em1Soar</sup></i><a href=http://www.rrrc.us/Strain/?x=770>Rat Resource and Research Center</a>mutantCryopreserved Sperm; Cryorecovery (as of 2017-08-10)allergy and lung responses and blood coagulationMmp12|Mmp12<sup>em1Soar</sup>620195|12910500RRID:RRRC_00770TALEN mediated 664 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon11354901SS.SHR-(<i>D9Mco110-D9Mco124</i>)/BjUniversity of Toledo College of Medicine and Life SciencescongenicUnknownRRID:RGD_11354901This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.11354903SS.SHR-(<i>D9Mco110-D9Mco121</i>)/BjUniversity of Toledo College of Medicine and Life SciencescongenicUnknownRRID:RGD_11354903This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.11354924SS.SHR-(<i>D9Mco113-D9Mco124</i>)/BjUniversity of Toledo College of Medicine and Life SciencescongenicUnknownRRID:RGD_11354924This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.11354926SS.SHR-(<i>D9Mco110-D9Got111</i>)/BjUniversity of Toledo College of Medicine and Life SciencescongenicUnknownRRID:RGD_11354926This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.11354928SS.SHR-(<i>D9Mco110-D9Mco114</i>)/BjUniversity of Toledo College of Medicine and Life SciencescongenicUnknownRRID:RGD_11354928This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.11354930SS.SHR-(<i>D9Mco115-D9Mco124</i>)/BjUniversity of Toledo College of Medicine and Life SciencescongenicUnknownRRID:RGD_11354930This is a congenic substrain developed by crossing SS.SHR-(<i>D9Rat7-D9Rat84</i>)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region.11528524LE-Tg(Slc17a6-icre)3Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>transgenicExtinct (as of 2019-02-01)RRID:RGD_11528524The BAC-based transgene contains Cre recombinase is expressed from rat Slc17a6 promoter.11528588SHR.LEW-(<i>D4Rat76-D4Mgh11</i>)/AnraLaboratorio de Genetica do Comportamento, Departamento de Biologia Celular, Embriologia e Genetica, Centro de Ciencias Biologicas, Universidade Federal de Santa Catarina, Florianopolis, Santa Catarina, BrazilcongenicUnknownRRID:RGD_11528588This congenic strain contains a LEW chromosome 4 segment containing a QTL affecting anxiety-related response transferred to the SHR background.11530008CDS.CDR-(D4Rat9-D4Rat153)/YglLaboratory for Molecular Medicine and
Israeli Rat Genome Center
Barzilai University Med Ctr Campus
2 Hahistadrut St
Ashkelon 78278, IsraelcongenicUnknownRRID:RGD_11530008This CDS congenic containing genomic elements from CDR was created by crossing the consomic strain CDS-Chr 4CDR/Ygl(RGD:4889499) with CDS. The congenic carries QTL affecting diabeties initation.11530011CDS.SBN-(D13Rat85-D13Mit4)/YglLaboratory for Molecular Medicine and
Israeli Rat Genome Center
Barzilai University Med Ctr Campus
2 Hahistadrut St
Ashkelon 78278, IsraelcongenicUnknownRRID:RGD_11530011This CDS congenic containing the genomic element from SBN/Ygl was created by crossing the SBN/Ygl with CDS. The congenic carries QTL affecting diabeties development.11530028iNP-<i>Npy<sup>em6Sage</sup></i>/IusmDepartment of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USAmutantUnknownNpy<sup>em6Sage</sup>11530022RRID:RGD_11530028These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Npy into iNP/Iusm embryos. A 26-bp deletion, including 6 bp in intron 1 and 20 bp in exon 2 in rat Npy was created in the mutant founders. These mutant founders were backcrossed with iNP/Iusm to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring.11531089SD-<i>F8<sup>em1Sage+/-</sup></i>/NovoNovo Nordisk, Maaloev, DenmarkmutantUnknownF8<i><sup>em1Sage</sup></i>11531096RRID:RGD_11531089The heterozygous ZFN mutant rats were produced by backcrossing mutant founders (SD/Novo-<i>F8<sup>em1Sage</sup></i>) with Sprague Dawley. Genotyping of the offspring was carried out by PCR amplification of the deletion fragment which caused a premature translation stop.11531091SD-<i>F8<sup>em1Sage-/-</sup></i>/NovoNovo Nordisk, Maaloev, DenmarkmutantUnknownF8<i><sup>em1Sage</sup></i>11531096RRID:RGD_11531091The homozygous F8 mutant rats were produced by intercrossing the heterozygous ZFN mutants (SD-<i>F8<sup>em1Sage+/-</sup></i>/Novo) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of the deletion fragment which caused a premature translation stop.11531094SD-<i>F8<sup>em1Sage</sup></i>/NovoNovo Nordisk, Maaloev, DenmarkmutantUnknownF8<i><sup>em1Sage</sup></i>11531096RRID:RGD_11531094These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat F8 into Sprague Dawley embryos. A premature translation stop in rat F8 was created in the mutant founders carrying a 13-bp deletion in exon 16. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring.11531104iNP-<i>Npy<sup>em6Sage+/-</sup></i>/IusmDepartment of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USAmutantUnknownNpy<sup>em6Sage</sup>11530022RRID:RGD_11531104The heterozygous ZFN mutant rats were produced by backcrossing mutant founders with iNP/Iusm. Genotyping of the offspring was carried out by PCR amplification of a 26-bp deleted fragment, including 6 bp in intron 1 and 20 bp in exon 2.11531106iNP-<i>Npy<sup>em6Sage-/-</sup></i>/IusmDepartment of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USAmutantUnknownNpy<sup>em6Sage</sup>11530022RRID:RGD_11531106The homozygous Npy mutant rats were produced by intercrossing the heterozygous ZFN mutants (iNP-<i>Npy<sup>em6Sage+/- </sup></i>/Iusm) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of a 26-bp deleted fragment, including
6 bp in intron 1 and 20 bp in exon 2.11532753F344.ZUC-(<i>Lepr<sup>fa</sup></i>),OLETF-(<i>D5Rat166-D5Rat90</i>)/Tj<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=390> National BioResource Project for the Rat in Japan</a>congenicUnknownDiabetes ObesityRRID:RGD_11532753The F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-<i>Lepr<sup>fa</sup></i> with F344.OLETF-(<i> D5Rat166-D5Rat90</i>) and then selecting Lepr<sup>fa</sup> -Niddm24 (fa/fa-Nidd6/of) homozygotes11535000PKD/MhmPKDMedical Research Centre, Klinikum Mannheim, University of Heidelberg, Mannheim, GermanyinbredUnknown (as of 2016-11-29)Anks6<sup>PKD</sup>11534996RRID:RGD_11535000The colony of inbred PKD/Mhm rats was established in the laboratory in Mannheim after 18 additional generations of inbreeding of the Han:SPRD (cy/+).The mutation was a C to T transition that replaces an arginine by a tryptophan at amino acid 823 in the protein sequence.11535031SD-Tg(hCMV-Anks6<sup>PKD</sup>)MhmMedical Research Centre, Klinikum Mannheim, University of Heidelberg, Mannheim, GermanytransgenicUnknown (as of 2016-11-29)Anks6<sup>PKD</sup>11534996RRID:RGD_11535031This transgenic strain was derived by pronuclear microinjection of fertilized Sprague Dawley oocytes with a 2.8-kb mutated Anks6<sup>PKD</sup> cloned between a human cytomegalovirus promoter upstream and an intron as well as a polyadenylation signal of SV40 downstream.11535955Crlj:CD(SD)<a href=http://www.criver.com/en-US/Pages/home.aspx> Charles River Laboratories</a>outbredUnknownRRID:RGD_11535955A colony of outbred CD(SD) (RGD: 734476) maintained in the Charles River Laboratories Japan.11553848WKY-<i>Trpv4<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Trpv4<sup>em5Mcwi</sup>11553847RRID:RGD_11553848CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene.11553850WKY-<i>Trpv4<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Trpv4<sup>em4Mcwi</sup>11553851RRID:RGD_11553850CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene.11553852SS-<i>Vnn1<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Vnn1<sup>em2Mcwi</sup>11553853RRID:RGD_11553852CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos11553855SS-<i>Vnn1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Vnn1<sup>em1Mcwi</sup>11553856RRID:RGD_11553855CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos11553858SS-<i>Rbm20<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Rbm20<sup>em5Mcwi</sup>11553857RRID:RGD_11553858ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene.11553860DA-<i>Scn5a<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Scn5a<sup>em2Mcwi</sup>11553859RRID:RGD_11553860ZFN system was used to introduce a mutation in the Scn5a gene of DA/MolTac rat embryos. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene.11553862SS-<i>Shc1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Shc1<sup>em1Mcwi</sup>11553854RRID:RGD_11553862ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene.11553873LE-<i>Fmr1<sup>em2Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/FMR1>SFARI GENE</a>)Fmr1<sup>em2Mcwi</sup>11553872RRID:RGD_11553873CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp insertion in exon 8 of the Fmr1 gene.11553875LE-<i>Fmr1<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Fmr1<sup>em4Mcwi</sup>11553874RRID:RGD_11553875CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp deletion in exon 8 of the Fmr1 gene.11553877SS-<i>P2rx1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantExtinct (as of 2017-07-18)P2rx1<sup>em1Mcwi</sup>11553876RRID:RGD_11553877CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene.11553881SS-<i>Rbm20<sup>em10Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Rbm20<sup>em10Mcwi</sup>11553880RRID:RGD_11553881ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene.11553883SS-<i>Rbm20<sup>em8Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Rbm20<sup>em8Mcwi</sup>11553882RRID:RGD_11553883ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene.11553886SD-<i>Tp53<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Tp53<sup>em3Mcwi</sup>11553885RRID:RGD_11553886ZFN system was used to introduce a mutation in the Trp53 gene of Crl:SD rat embryos.The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene.11553889SS-<i>Trpc3<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm; Cryorecovery (as of 2018-10-10)Trpc3<sup>em2Mcwi</sup>11553887RRID:RGD_11553889CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene.11553892SS-<i>Trpc3<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-10)Trpc3<sup>em1Mcwi</sup>11553891RRID:RGD_11553892CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene.11553894SS-<i>Tpcn2<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Tpcn2<sup>em1Mcwi</sup>11553893RRID:RGD_11553894ZFN system was used to introduce a mutation in the Tpcn2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene.11553896SHRSP-<i>Spp1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Spp1<sup>em1Mcwi</sup>11553895RRID:RGD_11553896CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene.11553899WKY-<i>Trpv2<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Trpv2<sup>em1Mcwi</sup>11553898RRID:RGD_11553899CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene.11553902SS-<i>Trpc6<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Trpc6<sup>em3Mcwi</sup>11553901RRID:RGD_11553902CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene.11553904SS-<i>Shc1<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Shc1<sup>em3Mcwi</sup>11553903RRID:RGD_11553904ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene.11553908SS-<i>Trpc6<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Trpc6<sup>em4Mcwi</sup>11553907RRID:RGD_11553908CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene.11553912SS-<i>Trpc6<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Trpc6<sup>em1Mcwi</sup>11553911RRID:RGD_11553912CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene.11553914SS-<i>Shc1<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2017-01-26)Shc1<sup>em4Mcwi</sup>11553913RRID:RGD_11553914ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of theShc1 gene.11553916SS-<i>Shc1<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals (as of 2017-01-25)Shc1<sup>em5Mcwi</sup>11553915RRID:RGD_11553916ZFN system was used to introduce a T>G transversion mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a substitution to generate S36A in Exon 2 of theShc1 gene.11554327BDIX.BDIV-<i>D10Mit3-D10Mgh16</i>/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicLive Animals (as of 2016-10-26)RRID:RGD_11554327The BDIX.BDIV-<i>D10Mit3-D10Mgh16</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.11554329BDIX.BDIV-<i>D10Got1-D10Rat45</i>/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicLive Animals (as of 2016-10-26)RRID:RGD_11554329The BDIX.BDIV-<i>D10Got1-D10Rat45</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.11556280ACI.Cg-<i>Du</i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1252> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2016-11-10)DevelopmentRRID:RGD_11556280Downunder (Du) mutation is introduced into ACI/Kyo strain.11556282WKY-Tg(UBC-sb10)3Wmukf<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1170> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2016-11-10)RRID:RGD_11556282This strtain has transgene that express SleepingBeauty transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown)11561897Crl:WI-<i>Lrap<sup>em1Geh</sup></i>University of ColoradomutantUnknownbehavior, addictionLrap<sup>em1Geh</sup>11561896RRID:RGD_11561897The CRISPR/Cas9 genome editing system was used to generate this knockout mutant rat strain. It created a 618-bp deletion in rat Lrap gene. The recipient zygotes were the Wistar rats from Charles River.11561902WKY-Tg(UBC-pb)5Wmukf<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1170> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2016-11-10)RRID:RGD_11561902This strtain has transgene that expresses piggyBac transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown)11561905WKY-Tg(Gabrb1<sup>Tn(pb-Bhr2)1Wmukf</sup>)<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1172> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2016-11-10)Gabrb1|Gabrb1<sup>Tn(pb-Bhr2)1Wmukf</sup>2649|11561925RRID:RGD_11561905Transposed "Bhr2" was inserted into intron 4 of Gabrb1 gene by piggyBac (pb) transposon system.11561909WKY-Tg(Samt4<sup>Tn(pb-Bhr7)1Wmukf</sup>)<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1170> National BioResource Project for the Rat in Japan</a>transgenicExtinct (as of 2016-11-10)Samt4<sup>Tn(pb-Bhr7)1Wmukf</sup>11561928RRID:RGD_11561909Transposed "Bhr7" was inserted into the first Met-coding exon region of rat Samt4 gene by piggyBac (pb) transposon system.11561970WKY-Tg(Zbtb20<sup>Tn(pb-Bhr7)1Wmukf</sup>)<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1170> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2016-11-15)Zbtb20<sup>Tn(pb-Bhr7)1Wmukf</sup>11561972RRID:RGD_11561970Transposed "Bhr7" was inserted into the Intron 3 of Zbtb20 gene by piggyBac (pb) transposon system.11561976WKY-Tg(Plcb1<sup>Tn(pb-Bhr2)1Wmukf</sup>)<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1170> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2016-11-15)Plcb1<sup>Tn(pb-Bhr2)1Wmukf</sup>11561974RRID:RGD_11561976Transposed "Bhr2" was inserted into into Plcb1 gene by piggyBac (pb) transposon system.11561979LE-Tg((ROSA)26Sor-CAG-tdTomato)9Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1139 > National BioResource Project for the Rat in Japan</a>transgenicUnknown (as of 2016-11-16)RRID:RGD_11561979Background strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien(UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato(Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9)11564343LE-Tg((ROSA)26Sor-CAG-tdTomato)14Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1139 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-16)RRID:RGD_11564343Background strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien (UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato (Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9)11564346F344-<i>Aspa<sup>em31Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1099> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2016-11-16)Aspa<sup>em31Kyo</sup>11564344RRID:RGD_11564346The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord.11564349F344-<i>Aspa<sup>em34Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1099> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2016-11-16)Aspa<sup>em34Kyo</sup>11564348RRID:RGD_11564349The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord.11564350SCR/SscrShumiya Cataract RatcongenicCryopreserved Embryo (as of 2016-11-16)Fdft1|Lss61834|620955RRID:RGD_11564350Genetic Cataract rat SCR(Shumiya Cataract Rat)was segrigated from a SHR-fa strain colony that developed nuclear cataract at adult stage. This strain is a double mutant caused by recessive gene (ctr1) and dominant lethal gene (Ctr2l) and established by Dr. Shumiya at Tokyo Metropolitan Institute of Gerontology. In 2003, this strain was introduced to Kyoritsu College of Pharmacy (keio University Faculty of Pharmacy). ctr1 is lanosterol synthase (Lss) and Ctr2 is farnesyl diphosphate farnesyl transferase 1 (Fdft1).11565091F344-<i>Ccdc85c<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=27 > National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2016-11-18)Ccdc85c<sup>em1Kyo</sup>11565090RRID:RGD_11565091TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo. Rats developed hydrocephalus and Subcortical heterotopia. Homozygous rats die within 1 month of hydrocephalus.11565094F344.LEC-(<i>D4Nirs8-D4Nirs2</i>)/Nrs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=592> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2016-11-18)RRID:RGD_11565094This strain was established by crossing F344.LEC-xhs1/1Nrs (NBR-rat #0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is similar to F344.LEC-xhs1/1Nrs.11565097F344.LEC-(<i>D4Rat54-D4Got87</i>)/Nrs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=592> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2016-11-18)RRID:RGD_11565097This strain was established by crossing F344.LEC-xhs1/1Nrs (NBRrat NO: 0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is different from F344.LEC-xhs1/1Nrs.11565100NMC/Nrs<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=592> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2016-11-18)RRID:RGD_11565100This strain was found in a colony of F344.LEC-xhs1/1Nrs (NBRP Rat No: 0293). As to radiosensitivity gene, D4Nirs8-D4Rat45 region is LEC type. Affected females with dominant gene on Chr10 develop mammary gland cancer after pregnancy (histological type is undetermined). In many cases, this neoplastis lesion resolve spontaneously after delivery. No homozygous female is obtained at this time. Affected male rats don't show any phenotype.11565116LE-Tg(Chat-tdTomato)3Yyan<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1236 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2016-11-21)RRID:RGD_11565116Chat-tdToamto-polyA-FRT sequence was inserted into fertilized egg of Long Evans strain (Japan SLC). vector: BAC clone (RP23-246B12) from a C57BL/6J mouse genomic BAC library (BACPAC Resource Center, Oakland, CA, USA)11565122SHR.Cg-<i>Lepr<sup>cp</sup></i>-Tg(APOB)110/Dmcr<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1139 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo (as of 2016-11-21)Lepr<sup>cp</sup>11570565RRID:RGD_11565122A BAC clone (CTD-2257F14) containing whole human APOB gene was maicroinjected into fertilized eggs of Wistar rats (Takeda Pharmaceutical Company). Then this Tg rats were backcrossed 9 times with SHR/NDmcr-cp rats (NBRP No.0446, SHR.Cg-Leprcp/NDmcr)(RGD: 2306033)11565125SHRSP.SHR-(<i>D18Rat87-D18Got66</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=865> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2016-11-21)RRID:RGD_11565125A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm.11565128SHRSP.SHR-(<i>D18Rat73-D18Rat52</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=865> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2016-11-21)RRID:RGD_11565128A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm.11565130SHRSP.SHR-(<i>D1Rat23-D1Rat213</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=863> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2016-11-21)Diabetes ObesityRRID:RGD_11565130A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm11565132SHRSP.SHR-(<i>D1Rat95-D1Got87</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=863> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2016-11-21)Diabetes ObesityRRID:RGD_11565132A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm11565135WKY.SHRSP-(<i>D1Rat25-St8sia2</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=863> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicUnknown (as of 2016-11-21)St8sia2621843RRID:RGD_11565135A congenic strain established by introducing segments of chromosome 1 from SHRSP/Izm into WKY/Izm.11565826F344-<i>Ttn<sup>em1Sage</sup></i>Duke-National University of Singapore, SingaporemutantUnknown (as of 2016-11-28)Ttn<sup>em1Sage</sup>11565825RRID:RGD_11565826These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence.11565829F344-<i>Ttn<sup>em2Sage</sup></i>Duke-National University of Singapore, SingaporemutantUnknown (as of 2016-11-28)Ttn<sup>em2Sage</sup>11565827RRID:RGD_11565829These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0).11567272SD-<i>Mecp2<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/mecp2-knockout-rat-tgra6090> Horizon Discovery</a>mutantLive Animals (as of 2016-12-13)Autism, Rett syndrome, CognitionMecp2<sup>em1Sage</sup>11568035RRID:RGD_11567272The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2).11568040SD-<i>Fmr1<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/fmr1-knockout-rat-tgrs5390> Horizon Discovery</a>mutantLive Animals (as of 2017-05-09)Autism, Fragile X syndromeFmr1<sup>em1Sage</sup>11568041RRID:RGD_11568040The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp. This mutant rat has a knockout of Fmr1.11568058SD-<i>Nrxn1<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/neurexin1-nrxn1-knockout-rat-tgra6160> Horizon Discovery</a>mutantLive Animals (as of 2018-03-22)Autism, SchizophreniaNrxn1<sup>em1</sup>11568059RRID:RGD_11568058The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in exon1 resulting in knockout of Nrxn1.11568062SD-<i>Pten<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/pten-knockout-rat-tgrs5810> Horizon Discovery</a>mutantLive Animals (as of 2016-12-13)Autism, cancerPten<sup>em1Sage</sup>11568063RRID:RGD_11568062The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten.11568067SD-<i>Grm5<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/mglur5-knockout-rat-tgra6020> Horizon Discovery</a>mutantLive Animals; Cryopreserved Embryo (as of 2016-12-13)Autism, Fragile X syndrome, Cognition, Schizophrenia, Anxiety, PainGrm5<sup>em1Sage</sup>11568068RRID:RGD_11568067The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot.11568071SD-<i>Met<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/met-knockout-rat-tgrs8750> Horizon Discovery</a>mutantCryopreserved Embryo (as of 2016-12-07)Autism Spectrum Disorders, Synaptic Plasticity, Autoimmune disordersMet<sup>em1Sage</sup>11568072RRID:RGD_11568071The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met.11568646SD-<i>Cntnap2<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/cntnap2-knockout-rat-tgrs8820> Horizon Discovery</a>mutantLive Animals (as of 2017-05-05)Autism Spectrum Disorders, Synaptic Plasticity, Language disordersCntnap2<sup>em1Sage</sup>11568647RRID:RGD_11568646The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot.11568700SD-<i>Nlgn3<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/neuroligin-3-nlgn3-knockout-rat-tgrs6650> Horizon Discovery</a>mutantLive Animals; Cryopreserved Embryo (as of 2016-12-13)Autism, Asperger's syndrome, Synaptic plasticityNlgn3<sup>em1Sage</sup>11568701RRID:RGD_11568700The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot.11568703SD-<i>Cacna1c<sup>em1Sage</sup></i><a href=http://www.horizondiscovery.com/cacna1c-knockout-rat-tgra6930> Horizon Discovery</a>mutantCryopreserved Embryo (as of 2016-12-13)Autism, Timothy syndrome, Long QT syndrome, Schizophrenia,Bipolar disorderCacna1c<sup>em1Sage</sup>11568704RRID:RGD_11568703The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. This model contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an early stop codon in exon 6.11667072Sway/Rrrc<a href=http://www.rrrc.us/Strain/?x=538>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00538This phenotype arose spontaneously during the third generation of selective breeding for decreased intravenous drug self-administration in Wistar rats (see RGD:6482259). After 10 weeks of age no drug administration is needed to see phenotype in which animals exhibits motor abnormalities with degenerative changes in cerebellar Purkinje cells. It appears to be transmitted in an autosomal recessive pattern. Animals have an abnormal swaying gait, which is readily identified as a slow (2 to 3 cycles per second) tremor.11667077SD-<i>Esr2<sup>em2Soar</sup></i><a href=http://www.rrrc.us/Strain/?x=719>Rat Resource and Research Center</a>mutantCryopreserved Sperm (as of 2017-01-26)reproduction, neu7roscience, environmental healthg, cardiovascularRRID:RRRC_00719Zinc finger nuclease targeting of exon 3 of the rat estrogen receptor-2 gene resulting in the deletion of exon 3.11667079SD-<i>Pgr<sup>em2Soar</sup></i><a href=http://www.rrrc.us/Strain/?x=720>Rat Resource and Research Center</a>mutantCryopreserved Sperm (as of 2017-01-26)Reproduction, neuroscience, environmental health, cardiovascularRRID:RRRC_00720zinc finger nucleases were used to generate a 136 bp deletion within the first exon of the progesterone receptor, resulting in a frameshift, premature stop codon, and a null.11667081BDIV-<i>Myo5a</i>/StcRrrc<a href=http://www.rrrc.us/Strain/?x=784>Rat Resource and Research Center</a>inbredCryopreserved Sperm (as of 2017-01-26)Myo5a<sup>m1Stc</sup>42721971RRID:RRRC_00784Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats11667084W<sup>Cat</sup>Wistar Cataract Rat<a href=http://www.rrrc.us/Strain/?x=704>Rat Resource and Research Center</a>mutantCryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00704ENU induced total juvenile cataract in inbred Wistar.11667088SD-<i>Esr1<sup>em1Soar</sup></i><a href=http://www.rrrc.us/Strain/?x=701>Rat Resource and Research Center</a>mutantCryopreserved Sperm (as of 2017-01-26)A range of experimentation examining the actions of estrogen in reproduction, cancer, cardiovascular, and neurobiology.Esr1<sup>em1Soar</sup>12910736RRID:RRRC_00701zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out.11667094W-Tg(CFH)Crl<a href=http://www.rrrc.us/Strain/?x=705>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00705micro-injected with a ~6 kb transgenic cassette, which contained a CMV enhancer, chicken beta-actin promoter, the full-length cDNA encoding human complement factor H, and a rabbit beta-globin poly(A) sequence that had been isolated and purified from plasmid pCAGGS-human fH.11667096WIST-<i>Tulane</i>Tulane rat<a href=http://www.rrrc.us/Strain/?x=721>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26)RRID:RRRC_00721Male Wistar rats with inbred congenital unilateral right hydronephrosis were bred from the colony described in 1979 by Friedman et al.12437069SS.BN-(<i>D13Rat25-rs198199323</i>)-<i>Btg2<sup>em21Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Btg2<sup>em21Mcwi</sup>12798564RRID:RGD_12437069CRISPR/Cas9 system was used to introduce a mutation in the Btg2 gene of SS.BN-(<i>D13Rat25-rs198199323</i>)/Mcwi rat embryos.12437071SS.BN-(<i>D13Rat25-rs198199323</i>)-<i>Btg2<sup>em24Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Btg2<sup>em24Mcwi</sup>12798565RRID:RGD_12437071CRISPR/Cas9 system was used to introduce a 2-bp insertion in the exon 1 in the Btg2 gene of SS.BN-(<i>D13Rat25-rs198199323</i>)/Mcwi rat embryos.12738212SD-Tg(LRRK2*R1441C)268Rwm<a href=http://www.rrrc.us/Strain/?x=775>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2017-08-22)Parkinson's DiseaseLRRK21353141RRID:RRRC_00775These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the R1441C mutation and fused to a YPet reporter tag.12738218SD-<i>GEPR-9</i><a href=http://www.rrrc.us/Strain/?x=304&log=yes>Rat Resource and Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-30)seizureRRID:RRRC_00304Genetically Epilepsy-Prone Rats (GEPR-9) have severe levels of seizure predisposition. This colony was bred to exhibit clonic convulsions (severe seizures with an ARS of 9) following a single wild running phase in response to sound. Seizures model human generalized tonic/clonic seizures.12738365SD-<i>Rag2<sup>em2Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Rag2<sup>em2Mcwi</sup>12738366RRID:RGD_12738365This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp frameshift deletion,Atgttgagat, in exon 2.12738372BDIX.BDIV-<i>D6Mit1-D6Mgh2</i>/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicUnknownRRID:RGD_12738372The BDIX.BDIV-<i>D6Mit1-D6Mgh2</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.12738388BDIX.BDIV-<i>D6Rat132-D6Mgh3</i>/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicUnknownRRID:RGD_12738388The BDIX.BDIV-<i>D6Rat132-D6Mgh3</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.12738394BDIX.BDIV-<i>D6Mit8-D6Rat229</i>/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicUnknownRRID:RGD_12738394The BDIX.BDIV-<i>D6Mit8-D6Rat229</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.12738452ACI.F344-<i>Apc<sup>Pirc</i>Uwm</sup>University of Wisconsin-Madison, Madison, WisconsinmutantCryopreserved Sperm (as of 2017-02-06)Apc<sup>Pirc</sup>1554322RRID:RRRC_00718This strain develops twice the number of colonic tumors as the F344-ApcPircUwm rats (RGD:1641862). Stop codon mutation at amino acid 1137 of the Apc gene. Nucleotide chr18:26,785,272 (Baylor 3.4/rn4) A to T transversion.12738455DA.F344-(<I>D10Got155-D10Nsi55</I>)The Feinstein Institute for Medical Research. congenicCryopreserved Sperm (as of 2017-02-06)RRID:RRRC_00674The Cia5a10 (D10Got155-D10Nsi55) interval was introgressed from F344 into DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a10) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.12738457DA.F344-(<I>D10Got152-D10Mcw1</I>)The Feinstein Institute for Medical Research. congenicCryopreserved Sperm (as of 2017-02-06)RRID:RRRC_00675DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a5)(D10Got152-D10Mcw1) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.12738460DA.F344-(<I>D7Rat15-D7Mit2</I>)The Feinstein Institute for Medical Research. congenicCryopreserved Sperm (as of 2017-02-06)RRID:RRRC_00681The Cia4d (D7Rat15 -D7Mit2) interval was introgressed from F344 into DA/BklArb rats through 7 backcrosses into DA/BklArb rats followed by 3 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia4d) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.12738466DA-<i>Asip<sup>m1</sup></i><a href=http://www.rrrc.us/Strain/?x=542>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-06)This strain can be used to generate pigmented embryos for use with albino ES cell lines.Asip<sup>m1</sup>12738467RRID:RRRC_00542Developed by Beth Bauer, University of Missouri. Spontaneous mutation of agouti gene with resultant black coat color from Sprague Dawley (SD) X Dark Agouti (DA). Albino mutation and hooded mutation have been bred out of this line so that only the agouti mutation remains.12743611SS-<i>Ren<sup>em1Mcwi+/-</sup></i>SS-<i>Ren<sup>em1Mcwi+</sup>/Ren<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2018-09-05)Ren<sup>em1Mcwi</sup>4139863RRID:RGD_12743611ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous12743623BN.F344-<i>Apc<sup>Pirc</i></sup><a href=http://www.rrrc.us/Strain/?x=783>Rat Resource and Research Center</a>mutantCryopreserved Sperm (as of 2017-02-10)Apc<sup>Pirc</sup>1554322RRID:RRRC_00783The phenotype of the BN.F344-<i>Apc<sup>Pirc</i></sup> congenic shows high resistance to cancer. The heterozygous animals get spontaneous intestinal lesions (small intestinal and colonic)starting at 60 days of age in males. BN animals are highly resistant to tumor development and can live over 2 years.12743627cNLH-<i>Cat</i>congenital NLH Cataract Rat<a href=http://www.rrrc.us/Strain/?x=702>Rat Resource and Research Center</a>mutantCryopreserved Sperm (as of 2017-02-10)RRID:RRRC_00702inbreeding since 2003, juvenile total cataract developed in cNLH line. cNLH = congenital non-learned helpless. congenital non-learned helpless and congenital learned helpless (cLH)lines were developed from outbred Dpargue-Dawley from Charles River.12743630BN-<i>Spib</i>spitzenborduere (spib)<a href=http://www.rrrc.us/Strain/?x=703>Rat Resource and Research Center</a>mutantCryopreserved Sperm (as of 2017-02-10)RRID:RRRC_00703Retinae display marked rosett formation in the outer nuclear layer; in the funduscopy irregular, dark pigment flecks are observed, which cannot be identified in the histology. Linkage analysis indicating at least two genes interacting.12743640DA.E3-(<i>RT1-DMa-Ggnbp1</i>)<a href=http://www.rrrc.us/Strain/?x=715>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2017-02-13)RT1-DMa|Ggnbp1735053|1359729RRID:RRRC_00715The Tcs1 QTL in DA.E3-(<i>RT1-DMa-Ggnbp1</i>)(DA.1IR85) contains a ~0.5 Mb (min- max 0.43 - 0.63 Mb) insert from DA.1I (RGD:10002743, DA.E3-(D20Rat42-D20Rat49)/Rhd). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, inclduing the RT1-B and RT1-D genes.12743645DA.KHW-(<i>RT1-Db1-RT1-DMb</i>)<a href=http://www.rrrc.us/Strain/?x=712>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2017-02-14)RT1-DMb|RT1-Db1735096|1593282RRID:RRRC_00712The Tcs2 QTL in DA.KHW-(RT1-Db1-RT1-DMb)(DA.1HR10) contains a ~0.2 from DA.1H [DA.KHW-RT1h]. The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available at GenBank.12743647DA.E3-(<i>Btnl2-RT1-DMb</i>)<a href=http://www.rrrc.us/Strain/?x=713>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2017-02-14)Btnl2|RT1-DMb620731|735096RRID:RRRC_00713The Tcs2 QTL in DA.E3-(Btnl2-RT1-DMb)(DA.1UR10) contains a ~0.2 Mb fromDA.E3-(D20Rat47-AA858870)/Rhd (RGD:10002745). The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available from GenBank. The genomic sequences of DA/OlaHsd and E3 have been completed and will be available soon (Backdahl et al. BMC Genomics 2014)12743650DA.AS2-(<i>Tesb-RT1-DMb</i>)<a href=http://www.rrrc.us/Strain/?x=714&log=yes>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2017-02-14)RT1-DMb|Tsbp1735096|1597063RRID:RGD_12743650DA.F-(Tesb-RT1-DMb) (DA.1FR61) contains a ~0.4 Mb (min- max 0.25 - 0.53 Mb) insert from DA.1F (RGD:2307301). The insert spans 12-19 genes in the MHC-II/MHC-III regions, including RT1-B and RT1-D. The 12 genes in the MHC-II region have been sequenced and sequences are available from GenBank.12743652DA.KHW-(<i>RT1-DMa-Mln</i>)<a href=http://www.rrrc.us/Strain/?x=716>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2017-02-14)RT1-DMa|Mln735053|1642907RRID:RRRC_00716The Tcs1 QTL in DA.KHW-(RT1-DMa-Mln)(DA.1HR83) contains a ~~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1H [DA.KHW-RT1h]. The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes.12743655DA.E3-(<i>RT1-DMa-Mln</i>)<a href=http://www.rrrc.us/Strain/?x=717>Rat Resource and Research Center</a>congenicCryopreserved Sperm (as of 2017-02-14)RRID:RRRC_00717The Tcs1 QTL in DA.E3-(RT1-DMa-Mln)(DA.1UR83) contains a ~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1U (RGD:10002745). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes.12790593DA.ACI-(<i>Gtf2ird1-D12Rat8</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2017-02-16)arthritis/autoimmunity studiesGtf2ird1620856RRID:RRRC_00672The strain contains the Cia25 R11 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(Chr12:27462118-Chr12:27611814) [also known as DA.ACI(Cia25) R11] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.12790595DA.ACI-(<i>D12Mit2-Gtf2i</i>)/NsiNorth Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030.congenicCryopreserved Sperm (as of 2017-02-16)arthritis/autoimmunity studiesGtf2i727961RRID:RRRC_00673The strain contains the Cia25 R12 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(D12Got43-Chr12:27368751)/Nsi [also known as DA.ACI(Cia25) R12] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter.12790599WKY-<i>Asic3<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Asic3<sup>em6Mcwi</sup>12790597RRID:RGD_12790599CRISPR/Cas9 system was used to introduce a mutation in the Asic3 gene of WKY/Ncrlrat embryos. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene.12790602SS-<i>Axl<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Axl<sup>em1Mcwi</sup>12790600RRID:RGD_12790602CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene.12790604SS-<i>Axl<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Axl<sup>em2Mcwi</sup>12790605RRID:RGD_12790604CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene.12790608SS-<i>Cd14<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Cd14<sup>em1Mcwi</sup>12790606RRID:RGD_12790608The CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of the Cd14 gene of SS/JrHsdMcwi rat embryos.12790610SS-<i>Cd14<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Cd14<sup>em2Mcwi</sup>12790611RRID:RGD_12790610CRISPR/Cas9 system was used to introduce a mutation in the Cd14 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a net 7-bp deletion of the Cd14 gene.12790615LEW-<i>Chrna4<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryorecovery (as of 2017-02-17)Chrna4<sup>em5Mcwi</sup>12790616RRID:RGD_12790615CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene.12790621SS-<i>Cybb<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm; Cryorecovery (as of 2021-11-03)Cybb<sup>em1Mcwi</sup>12790620RRID:RGD_12790621CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene.12790623SS-<i>Cybb<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Cybb<sup>em3Mcwi</sup>12790624RRID:RGD_12790623CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene.12790627LEW-<i>Igh-6<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Igh-6<sup>em1Mcwi</sup>12790625RRID:RGD_12790627CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the exon 2 of the Igh-6 gene.12790629LEW-<i>Igh-6<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Igh-6<sup>em4Mcwi</sup>12790630RRID:RGD_12790629CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/Ncrl rat embryos. The resulting mutation is a 2-bp deletion in the exon 2 of the Igh-6 gene.12790632SS-<i>Il2rg<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Il2rg<sup>em1Mcwi</sup>12790633RRID:RGD_12790632This strain was produced by injecting TALENs targeting the sequence of Il2rg gene into the SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in exon 2.12790659SD-<i>Il2rg<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-02-20)Il2rg<sup>em3Mcwi</sup>12790660RRID:RGD_12790659This strain was produced by injecting TALENs targeting the Il2rg gene into Crl:SD rat embryos. The resulting mutation is a 2-bp deletion in exon 2.12790662WKY-<i>Mb<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Mb<sup>em6Mcwi</sup>12790663RRID:RGD_12790662CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene.12790676SS-<i>P2rx1<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryorecovery (as of 2017-02-20)P2rx1<sup>em6Mcwi</sup>12790677RRID:RGD_12790676CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene.12790679PCK-<i>P2rx7<sup>em8Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Pkhd1<sup>pck</sup>|P2rx7<sup>em8Mcwi</sup>11535943|12790680RRID:RGD_12790679CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of PCK/CrljCrl-Pkhd1pck/Crl rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene.12790692SS-<i>Pon1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Pon1<sup>em1Mcwi</sup>12790693RRID:RGD_12790692CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene.12790695SS-<i>Pon1<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantExtinct (as of 2017-02-20)Pon1<sup>em2Mcwi</sup>12790696RRID:RGD_12790695CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene.12790698SS-<i>Pon1<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Pon1<sup>em3Mcwi</sup>12790699RRID:RGD_12790698CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene.12790702SS-<i>Pon3<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Pon3<sup>em1Mcwi</sup>12790703RRID:RGD_12790702CRISPR/Cas9 system was used to introduce a mutation in the Pon3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene.12790710SD-<i>Rag2<sup>em3Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Rag2<sup>em3Mcwi</sup>12790711RRID:RGD_12790710This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp deletion in exon 2.12790713SS-<i>Rag2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Rag2<sup>em1Mcwi</sup>12790714RRID:RGD_12790713This strain was produced by targeting the Rag2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.12790717SS-<i>Rfwd2<sup>em1Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Rfwd2<sup>em1Mcwi</sup>12790718RRID:RGD_12790717This strain was produced by targeting the Rfwd2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4.12790721SS.BN-(<i>D13Rat151-D13Rat197)-Serpinc1<sup>em2Mcwi</sup></i>Medical College of Wisconsin, Milwaukee, WisconsinmutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Serpinc1<sup>em2Mcwi</sup>12790722RRID:RGD_12790721ZFN system was used to introduce a mutation in the Serpinc1 gene of SS.BN-(D13Rat151-D13Rat197)/Mcwi rat embryos. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene.12790944WKY-<i>Sik2<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Sik2<sup>em5Mcwi</sup>12790945RRID:RGD_12790944CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene.12790947SS-<i>Sorcs2<sup>em7Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-02-22)Sorcs2<sup>em7Mcwi</sup>12790948RRID:RGD_12790947This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 33-bp frameshift deletion in exon 15.12790950SS-<i>Sorcs2<sup>em9Mcwi</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2017-02-22)Sorcs2<sup>em9Mcwi</sup>12790952RRID:RGD_12790950This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 15.12790954WKY-<i>Tert<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals (as of 2017-02-22)Tert<sup>em2Mcwi</sup>12790955RRID:RGD_12790954CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of WKY/NCrl rat embryos. The resulting mutation is a 17-bp deletion in Tert gene.12790957SS.SR-(<i>DXrat11-rs64754598</i>)/OpazBoston University School of Medicine, Boston, MassachusettscongenicCryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-22)RRID:RRRC_00651Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome X region from DXRat11 to rs64754598 was introgressed on the genetic background of SS.12790959SS.SR-(<i>D1Rat68-rs65309623</i>)/OpazBoston University School of Medicine, Boston, MassachusettscongenicCryopreserved Sperm (as of 2017-02-22)RRID:RRRC_00608Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from D1Rat68 to rs65309623 was introgressed on the genetic background of SS.12790962SS.SR-(<i>rs106908358-rs105920659</i>)/OpazBoston University School of Medicine, Boston, MassachusettscongenicCryopreserved Sperm (as of 2017-02-22)RRID:RRRC_00609Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from rs106908358 to rs105920659 was introgressed on the genetic background of SS.12790964SS.SR-(<i>rs66001705-D5Mgh16</i>)/OpazBoston University School of Medicine, Boston, MassachusettscongenicCryopreserved Sperm (as of 2017-02-22)RRID:RRRC_00614Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 5 region from rs66001705 to D5Mgh16 was introgressed on the genetic background of SS.12792211SS.BN-(<i>D13Hmgc1048-D13Hmgc664</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792211SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain12792212SS.BN-(<i>D13Hmgc1048-D13Hmgc1045</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792212SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain12792213SS.BN-(<i>D13Hmgc1048-D13Hmgc1050</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792213SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain12792214SS.BN-(<i>D13Hmgc1041-D13Hmgc664</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792214SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain12792216SS.BN-(<i>D13Hmgc885-D13Hmgc664</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792216SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain12792217SS.BN-(<i>D13Hmgc1041-D13Hmgc885</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792217SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain12792226SS.BN-(<i>D13Got45-D13Hmgc664</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792226SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792939SS.BN-(<i>D13Got42-D13Rat61</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792939SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792944SS.BN-(<i>D13Got42-D13Got45</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792944SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792945SS.BN-(<i>D13Got42-D13Rat130</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792945SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792946SS.BN-(<i>D13Got42-D13Hmgc354</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792946SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792947SS.BN-(<i>D13Got42-D13Hmgc497</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792947SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792948SS.BN-(<i>D13Got42-D13Hmgc885</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792948SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792949SS.BN-(<i>D13Got42-D13Hmgc664</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792949SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792950SS.BN-(<i>D13Mit5-D13Rat32</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792950SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792951SS.BN-(<i>D13Hmgc5885-D13Rat32</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792951SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792952SS.BN-(<i>D13Hmgc354-D13Rat32</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792952SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792953SS.BN-(<i>D13Rat130-D13Rat32</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792953SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12792954SS.BN-(<i>D13Got45-D13Rat32</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12792954SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798529SS.BN-(<i>D13Hmgc37-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798529SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798530SS.BN-(<i>D13Rat115-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798530SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798531SS.BN-(<i>D13Hmgc86-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798531SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798532SS.BN-(<i>D13Hmgc40-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798532SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798533SS.BN-(<i>D13Hmgc85-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798533SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798534SS.BN-(<i>D13Rat77-D13Got22</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798534SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798535SS.BN-(<i>D13Rat111-D13Rat115</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798535SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798536SS.BN-(<i>D13Rat111-D13Hmgc86</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798536SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798537SS.BN-(<i>D13Rat111-D13Rat20</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798537SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12798538SS.BN-(<i>D13Rat111-D13Hmgc85</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12798538SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12802362SS.BN-(<i>D13Rat25-RN34_13048990782</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12802362SS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12802363SS.BN-(<i>D13Rat25-rs106935835</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12802363SS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12802364SS.BN-(<i>D13Rat25-rs198199323</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12802364SS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi (RGD:2293145), rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12802365SS.BN-(<i>D13Hmgc64-D13Hmgc23</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12802365SS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12802366SS.BN-(<i>D13Hmgc64-4582</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12802366SS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12802367SS.BN-(<i>2340-RN34_13048990782</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_12802367SS/JrHsdMcwi were crossed with SS-13<sup>BN(D13Rat123-D13Rat101)</sup>/Mcwi, rats from F<sub>1</sub> were intercrossed and genotyped to get the congenic strain12859278Slc:ZUC-<I>Lepr<sup>fa-/-</sup></I>Zucker fatty ratsJapan SLC, Inc. (Hamamatsu, Japan)outbredUnknownLepr|Lepr<sup>fa</sup>3001|13432153RRID:RGD_12859278The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961.This strain was maintained at Japan SLC, Inc. (Hamamatsu, Japan.)12859279Ho:ZFDM-<I>Lepr<sup>fa</sup></I>Zucker Fatty Diabetes Mellitus ratsHoshino Laboratory Animals, Inc. (Ibaraki, Japan)outbredUnknownLepr|Lepr<sup>fa</sup>3001|13432153RRID:RGD_12859279In the Zucker fatty rat colony in Hoshino Laboratory Animals, Inc, they incidentally found fa/fa homozygous male rats having reproductive ability. The Selective breeding using the fa/fa male rats that exhibited relatively high blood glucose levels at 10 weeks of age, resulting in establishment of a diabetic strain. These fa/fa male rats developed diabetes as early as 10 weeks of age, reaching 100% incidence by 21 weeks of age, while none of the fa/+ male rats developed diabetes.12859287ZDF-<i>Lepr<sup>fa</sup></i>/DrtZucker Diabetic Fatty RatIndiana University School of Medicine, Indianapolis.inbredUnknownLepr3001RRID:RGD_12859287"Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters.12879386W-<i>Ghsr<sup>em1Ottc</sup></i><a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>, <a href=http://www.rrrc.us/Strain/?x=827>Rat Resource and Research Center</a>mutantCryopreserved Sperm; Cryorecovery (as of 2018-12-04)Ghsr<sup>em1Ottc</sup>12880435RRID:RRRC_00827The CRISPR/Cas9 genome editing system was used to generate this knock out rat strain with 846- bp deletion in the rat Ghsr gene. The rat strain had Ghsr exon1 deletion in the genome and did not express detectable Ghsr mRNA in brain regions.12879394F344-<i>Atm<sup>m1Kyo</sup></i>Atm missense rats<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=994&s_Immunology=1> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2017-04-18)ImmunologyAtm<sup>m1Kyo</sup>12879395RRID:RGD_12879394This strain is an Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P))rat and was established by ENU mutagenesis using F344/NSlc strain.12879400F344-<i>Atm<sup>em1Kyo</sup></i>ZFN-Atm rats<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1024&s_Neurobiology=1> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2017-04-18)neurobiologyAtm<sup>em1Kyo</sup>12879401RRID:RGD_12879400This rat strain was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13). Background strain: F344/Stm.12879423W-Tg(HCRT-cre-EGFP)B5Ahkyorexin-Cre rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1175&StrainsDir=Asc&StrainsPageSize=100&s_Pharmacology=1 > National BioResource Project for the Rat in Japan</a>transgenicUnknownRRID:RGD_12879423This transgenic rat strain was established by Dr. Yamanaka (Nagoya University) in 2012. Background strain: Wistar rat (CLEA Japan). plasmid backbone: pCR2.1. Transgene: human HCRT gene promoter, cre recombinase, EGFP gene, 2A gene. EGFP and cre recombinase are specifically expressed in orexin neurons.12879424LE-<i>ROSA26<sup>em1(CAG-COP4*/EGFP)Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1253&s_Behavior=1> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-19)RRID:RGD_12879424This strain was established at Kyoto University. ChR90/EGFP fusion gene sequence under CAG promoter is knock-in at the ROSA26 locus. Background strain: Long-Evans strain (charles river). COP4*: Stigeoclonium helveticum-derived channelrhodopsin (Chronos, ChR90). ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.12879426ExHC.BN-(<i>D14Got74-D14Rat132</i>)/Kyu<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1255&s_Metabolism=1> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo (as of 2017-04-19)RRID:RGD_12879426This congenic strain was established by introducing a segment of chromosome14 (D14Got74-D14Rat132 including Smek2 gene) from Brown Norway(BN)/seac strain into ExHC/Seac strain.12879428WKY.SHRSP-(<i>D1Mgh5-D1Arb21</i>)(<i>D3Rat36-D3Rat144</i>)(<i>D4Mgh7-D4Rat68</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1258&StrainsOrder=Sorter_NBRRATNo> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo (as of 2017-04-19)RRID:RGD_12879428A double congenic strain bade by introducing segments of chromosome 1, 3, and 4 from SHRSP/Izm into WKY/Izm. This strain was established by mating between WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm(NBRP Rat No:0713)and WKY.SHRSP-(D1Mgh5-D1Arb21) (D4Mgh7-D4Rat68)/IzmCNBRP Rat No:0714). This strain was established and is maintained in Shimane University.12879431Jcl:WIWistar rats<a href =https://www.clea-japan.com/en/products/outbred/item_a0360> CLEA Japan, Inc</a>outbredLive Animals (as of 2021-04-22)behavioral pharmacology, toxicity, pharmacology, drug efficacy, and safety testing.RRID:RGD_12879431This strain is a rat strain originating from the Wistar Institute in Philadelphia (USA). The Wistar Institute was named as a memorial to the famous anatomist Professor Casper Wistar at the University of Pennsylvania. CLEA Japan, Inc. started the production and supply of this strain after it was introduced from Carworth (UK).12879432W-<i>Ift140<sup>em1Kyo</sup></i>The Institute of Environmental ToxicologymutantCryopreserved Embryo (as of 2017-04-19)Ift140<sup>em1Kyo</sup>12879433RRID:RGD_12879432This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene.12879434W-<i>Ift140<sup>em2Kyo</sup></i>The Institute of Environmental ToxicologymutantCryopreserved Embryo (as of 2017-04-19)Ift140<sup>em2Kyo</sup>12879435RRID:RGD_12879434This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 2 (em2) has 2-bp deletion (c.23_24del) in the exon 1 of Ift140 (intraflagellar transport 140) gene.12879437SHC/Taspontaneously hypercholesterolemic rat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1264&StrainsOrder=Sorter_NBRRATNo> National BioResource Project for the Rat in Japan</a>inbredLive Animals (as of 2017-04-19)MetabolismRRID:RGD_12879437This strain (Nephropathy model) was segrigated from SD strain (CLEA Japan,Inc.) by selective mating on the basis of total cholesterol level in blood.12879438F344-Tg(CAG-EGFP,Acr-EGFP)2Osb<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1265&s_Development=1> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-04-19)RRID:RGD_12879438This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data).12879439F344-Tg(CAG-EGFP,Acr-EGFP)6Osb<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1266&s_Development=1> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2017-04-19)RRID:RGD_12879439This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data).12880021SD-<i>Apoe<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/apoe-knockout-rat-tgra3710> Horizon Discovery</a>mutantLive Animals (as of 2017-05-01)Alzheimer's disease, Neurodegenerative diseasesApoe<sup>em1Sage</sup>12880022RRID:RGD_12880021The mutant rat strain was produced by injecting zinc endonuclease targeting the exon 3 of rat Apoe into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in the gene and resulted in complete loss of Apoe protein in homozygotes.12880026SD-<i>App<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/app-knockout-rat-tgrs5460> Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-01)Alzheimer's disease, Neurodegenerative diseasesApp<sup>em1Sage</sup>12880027RRID:RGD_12880026This rat model carries a bi-allelic deletion of the amyloid precursor protein (APP) gene.12880037SD-<i>Dmd<sup>em1Ang</sup></i>mutantUnknownDmd<sup>em1Ang</sup>12880032RRID:RGD_12880037This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation.12902614SS.LEW-(<i>D10M11Mit119-D10Rat27</i>)/AydCentre Hospitalier de Universiti de Montrial, Quebec, CanadacongenicUnknownRRID:RGD_12902614A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment.12902616SD-<i>Apoe<sup>tm1(APOE*)Sage</sup></i><a href=https://www.horizondiscovery.com/hapoe4-knock-in-rat-tgra8960>Horizon Discovery</a>mutantLive Animals (as of 2017-05-09)Alzheimer's disease, Neurodegenerative diseasesAPOE736378RRID:RGD_12902616These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE gene12902621SD-<i>Bdnf<sup>em1Sage+/-</sup></i><a href=https://www.horizondiscovery.com/bdnf-knockout-rat-tgrs3850>Horizon Discovery</a>mutantLive Animals (as of 2017-06-20)Schizophrenia and Alzheimer's DiseaseBdnf<sup>em1Sage</sup>12902622RRID:RGD_12902621This ZFN model contains a monoallelic deletion of the Bdnf gene, encoding for the nerve growth factor protein BDNF. Homozygous animals carrying the Bdnf deletion are postnatal lethal. Reductions of BDNF have been observed in patients with Alzheimer's disease (AD), and this model may be useful for understanding the role of BDNF in AD.12902625SD-<i>Nr1i2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/pxr-knockout-rat-tgrs4130>Horizon Discovery</a>mutantLive Animals (as of 2017-05-09)Xenobiotic SensorsNr1i2<sup>em1Sage</sup>12902626RRID:RGD_12902625This ZFN model contains a 20-bp deletion within the Nr1i2 gene. No induction of Cyp3a1 in the model.12903250SD-<i>Ahr<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/ahr-knockout-rat-tgrs8890>Horizon Discovery</a>mutantLive Animals (as of 2017-05-10)Xenobiotic SensorsAhr<sup>em1Sage</sup>12903271RRID:RGD_12903250This ZFN model contains a 760-bp deletion in the rat Ahr gene.12903251LH-Chr 17<sup>LN</sup>/AekconsomicUnknownRRID:RGD_12903251Chr 17 from LN was introgressed onto the genetic background of LH by crossing LH/MRrrcAek male to LN/MRrrcAek female rats.12903257LH.LH-Chr 17<sup>LN</sup>-(<i>rs199194111-rs105876746</i>)/Aek<a href=http://www.rrrc.us/Strain/?x=822>Rat Resource & Research Center</a>congenicUnknownRRID:RRRC_00822This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from rs199194111 through rs1056876746 transferred to the LH/MRrrcAek background.12903267SD-<i>Nr1i3<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/car-knockout-rat-tgrs8190>Horizon Discovery</a>mutantLive Animals (as of 2017-05-10)Xenobiotic SensorsNr1i3<sup>em1Sage</sup>12903268RRID:RGD_12903267This model contains a ZFN-induced 10-bp deletion within rat Nr1i3 gene.12903270SD-<i>Nr1i2<sup>em1Sage</sup></i> <i>Nr1i3<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/pxr-car-knockout-rat-tgrs9100>Horizon Discovery</a>mutantLive Animals (as of 2017-05-10)Xenobiotic SensorsNr1i2<sup>em1Sage</sup>|Nr1i3<sup>em1Sage</sup>12902626|12903268RRID:RGD_12903270This model contains two knockout genes, the 20-bp deletion within rat Nr1i2 and the ZFN-induced 10-bp deletion within rat Nr1i3 gene.12903272SD-<i>Nr1i2<sup>em1Sage</sup></i> <i>Nr1i3<sup>em1Sage</sup></i> <i>Ahr<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/pxr-car-ahr-knockout-rat-tgrs9030>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-10)Xenobiotic SensorsNr1i2<sup>em1Sage</sup>|Nr1i3<sup>em1Sage</sup>|Ahr<sup>em1Sage</sup>12902626|12903268|12903271RRID:RGD_12903272This model contains three knockout genes, the 20-bp deletion within rat Nr1i2, the ZFN-induced 10-bp deletion within rat Nr1i3 gene and the 760-bp deletion in the rat Ahr gene.12904057SD-<i>Abcb1a<sup>em1Sage -/-</sup></i>SD-<i>Abcb1a<sup>em1</sup>-</sup>/Abcb1a<sup>em1</sup>-</sup></i><a href=https://www.horizondiscovery.com/mdr1a-knockout-rat-tgrs3570>Horizon Discovery</a>mutantLive Animals (as of 2017-05-16)Efflux TransporterAbcb1a<sup>em1Sage</sup>12904058RRID:RGD_12904057This ZFN model contains biallelic 20 bp deletion within Abcba1 gene. Animals exhibit increased oral bioavailability of P-gp-specific substrates. The homozygous knockout rats display total loss of protein via Western blot.12904059SD-<i>(Abcb1a- Abcb1b)<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/mdr1a-1b-knockout-rat-tgrs7070>Horizon Discovery</a>mutantLive Animals (as of 2017-05-16)Efflux TransporterRRID:RGD_12904059This model carries knockout of Abcb1a and Abcb1b.12904063SD-<i>Abcg2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/bcrp-knockout-rat-tgrs4200>Horizon Discovery</a>mutantLive Animals (as of 2017-05-16)Efflux TransporterAbcg2<sup>em1Sage</sup>12904064RRID:RGD_12904063This ZFN model carries a 588-bp deletion within Abcg2 gene. Homozygous knockouts display total loss of protein via Western blot12904679WKY-<i>Cyp2j4<sup>em1Sage</sup></i>/TjamutantUnknownCyp2j4<i><sup>em1Sage</sup></i>12904681RRID:RGD_12904679ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation.12904684SD-<i>Abcb1a<sup>em1Sage</sup></i> <i>Abcg2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/mdr1a-bcrp-knockout-rat-tgrs7490>Horizon Discovery</a>mutantLive Animals (as of 2017-05-17)Efflux TransporterAbcb1a<sup>em1Sage</sup>|Abcg2<sup>em1Sage</sup>12904058|12904064RRID:RGD_12904684This model contains two knockout genes, the 20-bp deletion within rat Abcba1 and the 588-bp deletion within rat Abcg2 gene.12904685SD-<i>Abcc2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/mrp2-knockout-rat-tgrs4340>Horizon Discovery</a>mutantLive Animals (as of 2017-05-17)Efflux TransporterAbcc2<sup>em1Sage</sup>12904687RRID:RGD_12904685This ZFN model contains a biallelic 726 bp deletion within the Abcc2 gene. Animals exhibit decreased transport of endogenous glutathione and hyperbilirubinemia. The homozygous knockout rats display total loss of protein via Western blot.12904730SD-<i>Abcb11<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/bsep-knockout-rat-tgrs8050>Horizon Discovery</a>mutantLive Animals (as of 2017-05-19)Efflux TransporterAbcb11<sup>em1Sage</sup>12904731RRID:RGD_12904730This ZFN induced knockout model contains biallelic 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot.12904733SD-<i>Slc22a1<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/oct1-knockout-rat-tgrs5600>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-19)Uptake TransportersSlc22a1<sup>em1Sage</sup>12904734RRID:RGD_12904733This ZFN induced knockout model contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot.12904891SD-<i>Slc22a2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/oct2-knockout-rat-tgrs6580>Horizon Discovery</a>mutantLive Animals (as of 2017-05-24)Uptake TransportersSlc22a261936RRID:RGD_12904891This ZFN model carries the knockout of the rat Slc22a2.12904892SD-<i>Slc22a6<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/oat1-knockout-rat-tgrs6440>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-24)Uptake TransportersSlc22a669338RRID:RGD_12904892This ZFN model carries the knockout of the rat Slc22a6.12904893SD-<i>Slc22a8<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/oat3-knockout-rat-tgrs6510>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-24)Uptake TransportersRRID:RGD_12904893This ZFN model carries the knockout of the rat Slc22a8.12904897SD-<i>Tp53<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/p53-knockout-rat-tgra3990>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-24)carcinogenicityTp53<sup>em1Sage</sup>12904898RRID:RGD_12904897This ZFN model carries the monoallelic 11 base pair deletion in Tp53 gene. Animals exhibit broad tumor spectrum with high degree of tumor malignancy.12904900SD-<i>Rag1<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/rag1-knockout-rat-sprague-dawley-tgrs3920>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag1<sup>em1Sage</sup>12904901RRID:RGD_12904900This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Homozygous animals display loss of Rag1 protein and loss of B and T cells by FACS analysis.12904902F344-<i>Rag1<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/rag1-knockout-rat-fischer-344-tgrf7980>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag1<sup>em1Sage</sup>12904901RRID:RGD_12904902This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Rag1 knockout rats lack mature B and T lymphocytes.12904903SD-<i>Rag2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/rag2-knockout-rat-sprague-dawley-tgrs4410>Horizon Discovery</a>mutantLive Animals (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag2<sup>em1Sage</sup>12904904RRID:RGD_12904903This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene on chromosome 3. Homozygous Rag2 knockout rats display loss of RAG2 protein via Western blot. Homozygous Rag2 knockout rats show loss of B and T cells by FACS analysis.12904905F344-<i>Rag2<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/rag2-knockout-rat-fischer-344-tgrf7840>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2017-05-24)immunology/Inflamation and ImmunodeficientRag2<sup>em1Sage</sup>12904904RRID:RGD_12904905This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene.on chromosome 3 Rag2 knockout rats completely lack B and T cells.12904907SD-<i>Prkdc<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/prkdc-knockout-rat-tgrs4550>Horizon Discovery</a>mutantLive Animals (as of 2017-05-24)immunology/Inflamation and ImmunodeficientPrkdc<sup>em1Sage</sup>151232284RRID:RGD_12904907This ZFN induced knockout rats carrying a shorter truncated gene, 872 by PCR vs 1627 in wild type, have severe combined immunodeficiency (SCID) and lack of both B and T cells12904908SD-<i>Ldlr<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/ldlr-knockout-rat-tgrs4060>Horizon Discovery</a>mutantLive Animals (as of 2017-05-24)Ldlr<sup>em1Sage</sup>12904909RRID:RGD_12904908In this ZFN induced model, a total of 337 bp were deleted at the junction of intron 3 and exon 4 (on chromosome 8), and 4 bp ccgt were inserted rat Ldlr gene on chromosome 8. Homozygous knockout rats display loss of LDLR protein via Western blot. Homozygous knockout rats have increased body weight as compared to wild type. Homozygous knockout rats show significantly elevated serum cholesterol levels.12904912SD-<i>Lep<sup>em1Sage-/-</sup></i><a href=https://www.inotivco.com/model/hsdsage-sd-lepem1sage>Inotiv</a>mutantCryopreserved Embryo (as of 2017-05-24)CardiovascularLep<sup>em1Sage</sup>12904927RRID:RGD_12904912This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels12905029SD-<i>Th<sup>tm1(cre)Sage</sup></i><a href=https://www.horizondiscovery.com/th-cre-rat-tyrosine-hydroxylase-tgra8400>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)Optogenetics RatsRRID:RGD_12905029This ZFN knock in model expresses cre-recombinase under the control of the endogenous tyrosine hydroxylase promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of Th. The TH-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.12905031SD-<i>Slc6a3<sup>tm1(cre)Sage</sup></i><a href=https://www.horizondiscovery.com/dopamine-transporter-dat-cre-rat-tgra8330>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)Optogenetics RatsRRID:RGD_12905031This model expresses cre-recombinase under the control of the endogenous dopamine transporter promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of DAT. The DAT-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.12905032LE-<i>Camk2a<sup>tm1(cre)Sage</sup></i><a href=https://www.horizondiscovery.com/camkiia-cre-rat-tgrl9170>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)Optogenetics RatsRRID:RGD_12905032This model expresses cre-recombinase under the control of the endogenous camkIIa promoter enabling specific expression in excititory neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of CamkIIa. The CamkIIa-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.12905033LE-<i>Slc32a1<sup>tm1(cre)Sage</sup></i><a href=https://www.horizondiscovery.com/vgat-cre-rat-tgrl9310>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)Optogenetics RatsRRID:RGD_12905033This model expresses cre-recombinase under the control of the endogenous solute carrier family 32 member 1 (Vgat) promoter enabling specific expression in Vgat positive GABAergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of the Vgat gene. The Vgat-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.12905034LE-<i>Vip<sup>tm1(cre)Sage</sup></i><a href=https://www.horizondiscovery.com/vip-cre-rat-tgrl9450>Horizon Discovery</a>mutantUnknown (as of 2017-05-31)Optogenetics RatsRRID:RGD_12905034This model expresses cre-recombinase under the control of the endogenous vasoactive intestinal peptide (VIP) promoter enabling specific expression in VIP positive GABAergic interneurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the VIP gene. The VIP-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.12905035LE-<i>Tph2<sup>tm1(cre)Sage</sup></i><a href=https://www.horizondiscovery.com/tph2-cre-rat-tgrl9590>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)Optogenetics RatsRRID:RGD_12905035This model expresses cre-recombinase under the control of the endogenous Tryptophan Hydroxylase 2 (Tph2) promoter enabling specific expression in Tph2 positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the Tph2 gene. The Tph2-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.12905036LE-<i>Htr3a<sup>tm1(cre)Sage</sup></i><a href=https://www.horizondiscovery.com/5ht3a-cre-rat-tgrl9380>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)Optogenetics RatsRRID:RGD_12905036This model expresses cre-recombinase under the control of the endogenous 5 prime-hydroxytryptamine receptor 3A (5Ht3a) promoter enabling specific expression in 5Ht3a positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the 5Ht3a gene. The 5Ht3a-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines.12905037LE-<i>ROSA26<sup>em1(CAG-tdTomato)1Sage</sup></i><a href=https://www.horizondiscovery.com/tdtomato-reporter-rat-tgrl9660>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)RRID:RGD_12905037This CRISPR knock in model possesses the fluorophore tdTomato, sitting behind a floxed stop codon in the ROSA26 locus under control of the CAG promoter. By introducing Cre-recombinase through viral transduction or crossing with one of our Cre-driver rats, tdTomato fluorescence will be observed anywhere Cre- is expressed. The tdTomato Reporter rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.12905038LE-<i>ROSA26<sup>em1(CAG-tdTomato-NpHR)1Sage</sup></i><a href=https://www.horizondiscovery.com/halorhodopsin-rat-tgrl9730>Horizon Discovery</a>mutantLive Animals (as of 2017-05-31)RRID:RGD_12905038This CRISPR knock in model possesses the Halorhodopsin fused to TdTomato, sitting behind a floxed stop codon in the ROSA26 locus under the control of the CAG promoter. By introducing Cre-recombinase by crossing with one of our Cre-driver rats, neuronal subtype-specific expression of halorhodopsin and TdTomato will be observed anywhere Cre- is expressed. The Halorhodopsin rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.12907568WI-<i>Abcb1a<sup>em2Sage</sup></i>mutantUnknownAbcb1a<sup>em2Sage</sup>12907569RRID:RGD_12907568This model contains biallelic 19- bp deletion in exon 7 of Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot.12907570WI-<i>Abcb1a<sup>em3Sage</sup></i>mutantUnknownAbcb1a<sup>em3Sage</sup>12907571RRID:RGD_12907570This model contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot.12910101SD-<i>Ldlr<sup>em1</sup></i>mutantUnknownLdlr<sup>em1</sup>12910102RRID:RGD_12910101This model possesses a 19-bp deletion in the seventh exon of the ldlr gene by ZFN method.12910127SD-Tg(Th-Ghsros)transgenicUnknownGhsr621397RRID:RGD_12910127This transgenic strain carries a synthetic 108-nucleotide DNA fragment spanning the 5 prime extracellular region of GHS-R was cloned in the antisense orientation driven by tyrosine hydroxylase (Th) promoter.12910483Slc:SDSprague-Dawley Derived<a href =http://www.jslc.co.jp/english/animals/rat.php#rat-cat-01/> Japan SLC, Inc.</a>outbredUnknownRRID:RGD_12910483Derived from Charles River Laboratory Inc. USA in 1968.12910493LEW.1WR1-<i>Ifnar1<sup>em1</sup></i>Department of Medicine, University of Massachusetts Medical School, Worcester, MAmutantUnknownIfnar1<sup>em1</sup>12910495RRID:RGD_12910493The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion in exon 4 of Ifnar1 gene.12910494LEW.1WR1-<i>Ifnar1<sup>em2</sup></i>Department of Medicine, University of Massachusetts Medical School, Worcester, MAmutantUnknownIfnar1<sup>em2</sup>12910496RRID:RGD_12910494The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion and 4-bp insertion in exon 4 of Ifnar1 gene.12910505SD-<i>Mmp12<sup>em2Soar</sup></i>mutantUnknownMmp12<sup>em2Soar</sup>12910506RRID:RGD_12910505TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon12910514SD-<i>Lepr<sup>em1</sup></i>East China Normal University, Shanghai, ChinamutantUnknownLepr<sup>em1</sup>12910515RRID:RGD_12910514This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion.12910517SD-<i>Lepr<sup>em2</sup></i>East China Normal University, Shanghai, ChinamutantUnknownLepr<sup>em2</sup>12910518RRID:RGD_12910517This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion.12910519SD-<i>Lepr<sup>em3</sup></i>East China Normal University, Shanghai, ChinamutantUnknownLepr<sup>em3</sup>12910546RRID:RGD_12910519This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion.12910762BN-<i>Kit<sup>Ws</sup></i>mutantUnknownKit<sup>Ws</sup>12910763RRID:RGD_12910762A spontaneous mutant male with a large white spot and coat color dilution was identified in the BN/fMai colony in Yagi Memorial Park (kani-gun, Japan).12910940SD-<i>Cdkn1b<sup>we</sup></i>mutantUnknownCdkn1b<sup>we</sup>12910941RRID:RGD_12910940The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype.13204704W-<i>Myo7a<sup>tnd</sup></i>/HubrWistar tornado ratHubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands.mutantUnknownMyo7a<sup>tnd</sup>/Hubr13204705RRID:RGD_13204704Male Wistar founder rats were mutagenized using ENU and mated with untreated female to establish F1 population. Selected F1 progeny were mated to produce F2 and then to breed induced mutation to homozygosity.13204756SS.BN-(D13Hmgc1048-D13Hmgc1050)-<i>Pappa2<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Pappa2<sup>em4Mcwi</sup>13204758RRID:RGD_13204756CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos.13204788SS.BN-(D13Hmgc1048-D13Hmgc1050)-<i>Pappa2<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Pappa2<sup>em5Mcwi</sup>13204789RRID:RGD_13204788CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos.13207339LH.LH-Chr 17<sup>LN</sup>-(<i>Fancc<sup>rgdv551196202-C</sup>-rs106387478</i>)/Aek<a href=http://www.rrrc.us/Strain/?x=824>Rat Resource & Research Center</a>congenicUnknownRRID:RRRC_00824This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from Fancc<sup>rgdv551196202-C</sup> through rs106387478 transferred to the LH/MRrrcAek background.13207341LH.LH-Chr 17<sup>LN</sup>-(<i>Fancc<sup>rgdv551196202-C</sup>-rs107291522</i>)/Aek<a href=http://www.rrrc.us/Strain/?x=825>Rat Resource & Research Center</a>congenicUnknownRRID:RRRC_00825This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from Fancc<sup>rgdv551196202-C</sup> through rs107291522 transferred to the LH/MRrrcAek background.13207416LH.LH-Chr 17<sup>LN</sup>-(<i>rgdv421102132<sup>T</sup>-rgdv413679765<sup>T</sup></i>)/Aek<a href=http://www.rrrc.us/Strain/?x=826>Rat Resource & Research Center</a>congenicUnknownRRID:RRRC_00826This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17<sup>LN</sup>/Aek from Fancc<sup>rgdv551196202-C</sup> through rs106387478 transferred to the LH/MRrrcAek background.13207488LEW-<i>Chrnb4<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Chrnb4<sup>em5Mcwi</sup>13207489RRID:RGD_13207488CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/NCrl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene.13207491SD-Tg(Col3a1-loxP-eGFP-loxP-TurboRFP)McwiMCW Gene Editing Rat Resource CentertransgenicCryopreserved Sperm (as of 2018-02-12)RRID:RGD_13207491Bacterial artificial chromosome (BAC) Transgenic rats containing a Cre-inducible reporter switch from eGFP to TurboRFP under the control of the promoter of Col3a1 (BAC: CH230-401H12 )13207492SD-<i>Cd55<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals (as of 2017-08-02)Cd55<sup>em6Mcwi</sup>13207493RRID:RGD_13207492CRISPR/Cas9 system was used to introduce a 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos.13207494SD-<i>Cd55<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Cd55<sup>em4Mcwi</sup>13207495RRID:RGD_13207494CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos.13207497SS-<i>Kcnj13<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Kcnj13<sup>em1Mcwi</sup>13207498RRID:RGD_13207497CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene.13207501SS-<i>Nlrp10<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Nlrp10<sup>em2Mcwi</sup>13207502RRID:RGD_13207501CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene.13207503SS-<i>Nlrp10<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Nlrp10<sup>em3Mcwi</sup>13207504RRID:RGD_13207503CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene.13207507SS-<i>Nlrp12<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Nlrp12<sup>em1Mcwi</sup>13207508RRID:RGD_13207507CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene.13207509SS-<i>P2rx1<sup>em7Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm; Cryorecovery (as of 2021-11-03)P2rx1<sup>em7Mcwi</sup>13207510RRID:RGD_13207509CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene.13207511SS.BN-(D13Rat151-D13Rat197)-Tg(Slc12a1-Ncf2-2A-Luc)26McwiMCW Gene Editing Rat Resource CentertransgenicCryorecovery (as of 2017-08-03)Ncf21309424RRID:RGD_13207511A transgenic rat created by Sleeping Beauty transposon system with proximal tubule-specific overexpression of Ncf2 and Luciferase via a self cleaving 2A peptide, under control of the Slc12a1 (also known as Nkcc2) promoter produced in the line 26 strain.13207513SS-Tg(Slc12a1-Ncf2-2A-Luc)-Ncf2<sup>em1</sup>McwiMCW Gene Editing Rat Resource CentermutantCryorecovery (as of 2017-08-03)Ncf2<sup>em1Mcwi</sup>5144089RRID:RGD_13207513This is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi.13207514SD-<i>ROSA26<sup>em1(Epac-SH187)Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals (as of 2017-08-03)RRID:RGD_13207514CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor.13207516SD-<i>Rag2<sup>em3Mcwi</sup></i><i>Il2rg<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Il2rg<sup>em2Mcwi</sup>|Rag2<sup>em3Mcwi</sup>10002792|12790711RRID:RGD_13207516This strain was produced by crossing of SD-Rag2em3Mcwi and SD-Il2rgem2Mcwi.13207518SHR-<i>Hspa1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryorecovery (as of 2018-05-01)Hspa1b|Hspa1a|Hspa1l2840|1593284|1595925RRID:RGD_13207518CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos.13207525SS-<i>Spp1<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)spp1<sup>em3Mcwi</sup>13207528RRID:RGD_13207525CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene.13207529SS-<i>Spp1<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Spp1<sup>em4Mcwi</sup>13207530RRID:RGD_13207529CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene.13207537SD-Tg(Cdh5-cre)2McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2017-08-04)RRID:RGD_13207537Transgenic rat overexpressing Cre under the control of the Cdh5 (VECadherin) promoter.13207551SS-Tg(Nphs2-cre/ERT2)4McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2017-08-04)RRID:RGD_13207551Transgenic rat overexpressing tamoxifen inducible Cre/ERT2 under the control of the Nphs2 (Podocin) promoter13207560SS-Tg(Aqp2-cre/ERT2)4McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2017-08-04)RRID:RGD_13207560Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Aquaporin 2 promoter13207563SS-Tg(Mylpf-cre/ERT2)22McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2017-08-04)RRID:RGD_13207563Transgenic overexpressing tamoxifen inducible CreERT2 under the control of the Mylpf (also known ad Mlc2) promoter13207595WKY-<i>Tph1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Tph1<sup>em1Mcwi</sup>13208230RRID:RGD_13207595CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene.13208223LE-ROSA26<sup>em1(LTR-nLuc)Ottc</sup><a href=http://www.rrrc.us/Strain/?x=924>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00924The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.13208224LE-ROSA26 <sup>em1(CAG-Cas9)Ottc</sup><a href=http://www.rrrc.us/Strain/?x=833>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00833The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of Cas9 under the control of CAG promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.13208231WKY-<i>Tph1<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Tph1<sup>em3Mcwi</sup>13208232RRID:RGD_13208231CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene.13208517SD-<i>Nfe2l2<sup>em1Mcwi+/+</sup></i>SD-<i>Nfe2l2<sup>em1Mcwi+</sup></i>/Nfe2l2<sup>em1Mcwi+</sup></i>PhysGen KnockoutsmutantLive Animals (as of 2017-08-09)RRID:RGD_13208517This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.13208518SD-<i>Nfe2l2<sup>em1Mcwi-/-</sup></i>SD-<i>Nfe2l2<sup>em1Mcwi-</sup></i>/Nfe2l2<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals (as of 2017-08-09)Nfe2l2<sup>em1Mcwi</sup>9588549RRID:RGD_13208518This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.13208519SD-<i>Nfe2l2<sup>em1Mcwi+/-</sup></i>SD-<i>Nfe2l2<sup>em1Mcwi+</sup></i>/Nfe2l2<sup>em1Mcwi-</sup></i>PhysGen KnockoutsmutantLive Animals (as of 2017-08-09)RRID:RGD_13208519This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.13208537HsdFfyb:WIBioterio Central- Facultad de Farmacia y Bioquÿ¿mica de la Universidad de Buenos Aires. Contact: Junin 956 8 piso Ciudad Autÿ¿noma de Buenos Aires, Argentina Tel/Fax: +54 11 5287 4811 Mail: bioterio@ffyb.uba.aroutbredLive Animals (as of 2017-08-11)RRID:RGD_13208537Descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan (Indianapolis).Since 1995 maintained at Bioterio Central- Facultad de Farmacia y Bioquÿ¿mica de la Universidad de Buenos Aires. Contact: Junin 956 8 piso Ciudad Autÿ¿noma de Buenos Aires, Argentina Tel/Fax: +54 11 5287 4811 Mail: bioterio@ffyb.uba.ar13208540CrlFvetFfyb:SDBioterio Central of Facultad de Farmacia y Bioqu¿mica de la Universidad de Buenos Aires. Junin 956 Ciudad Aut¿noma de Buenos Aires, ArgentinamutantLive Animals (as of 2017-08-11)RRID:RGD_13208540Descendants of rats from the Charles River Laboratories (USA),then to Fvet at Buenos Aires University and since 2014 maintained at Bioterio Central of Facultad de Farmacia y Bioqu¿mica de la Universidad de Buenos Aires. Junin 956 Ciudad Aut¿noma de Buenos Aires, Argentina13208571SS-Tg(Cyp11b2-cre/ERT2)2McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2019-04-26)RRID:RGD_13208571Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Cyp11b2 promoter13208576SS-Tg(Slc5a2-cre/ERT2)2McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2017-08-14)RRID:RGD_13208576Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Slc12a1 (Sglt2) promoter13208583SS-Tg(Ubc-Wisp2)2McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2017-08-14)RRID:RGD_13208583Transgenic overexpressing Wisp2 under the control of the Ubiqutin C promoter13208584SS-Tg(Ubc-Wisp2)3McwiMCW Gene Editing Rat Resource CentertransgenicLive Animals (as of 2017-08-14)RRID:RGD_13208584Transgenic overexpressing Wisp2 under the control of the Ubiqutin C promoter13208842SS-<i>Ptgs2<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Ptgs2<sup>em1Mcwi</sup>13208843RRID:RGD_13208842CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene.13208844SS-<i>Ptgs2<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Ptgs2<sup>em2Mcwi</sup>13208845RRID:RGD_13208844CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion of exon 4 in the Ptgs2 gene.13210578SD-<i>Lep<sup>em1</sup></i>mutantUnknownLep<sup>em1</sup>13210580RRID:RGD_13210578This CRISPR/Cas9 model possesses a 3 bp(ATC) deletion resulting in the deletion of isoleucine at position 14. The Lep mutant rats exhibited similar mutant phenotypes to Lep and Lepr null rats.13210773ACI.BN-(<i>Fer1l6<sup>rgdv775925951-C</sup>-D7Uwm27</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicCryopreserved Sperm (as of 2017-09-07)mammary cancerRRID:RGD_13210773This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.13210774ACI.BN-(<i>Fer1l6<sup>rgdv775925951-C</sup>-D7Uwm28</i>)/ShulDepartment of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoncongenicUnknownmammary cancerRRID:RGD_13210774This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background.13432148SS.ZUC-<i>Lepr<sup>fa-/-</sup></i>/SlccongenicUnknownDiabetes ObesityLepr<sup>fa</sup>13432153RRID:RGD_13432148SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain.13432150SS.ZUC-<i>Lepr<sup>fa-/+</sup></i>/SlccongenicUnknownDiabetes ObesityLepr|Lepr<sup>fa</sup>3001|13432153RRID:RGD_13432150SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain.13432151SS.ZUC-<i>Lepr<sup>fa+/+</sup></i>/SlccongenicUnknownDiabetes ObesityLepr3001RRID:RGD_13432151SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain.13432199SHRSP.WKY-(<i>D3Wox20-D3Rat114</i>)/GcrcInstitute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_13432199Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.13432200SHRSP.WKY-(<i>D3Mgh16-D3Rat80</i>)/GcrcInstitute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_13432200Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.13432201SHRSP.WKY-(<i>D3Mgh16-D3Wox3</i>)/GcrcInstitute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_13432201Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.13432202SHRSP.WKY-(<i>D3Mgh16-rs65433898</i>)/GcrcInstitute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_13432202Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.13432203SHRSP.WKY-(<i>D3Mgh16-rs197649383</i>)/GcrcInstitute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_13432203Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.13432204SHRSP.WKY-(<i>D3Mgh16-D3Mit10</i>)/GcrcInstitute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UKcongenicUnknownRRID:RGD_13432204Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals.13437612SS-<i>Adamts16<sup>em1Bj</sup></i>University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614.mutantUnknownAdamts16<sup>em1Bj</sup>13437613RRID:RGD_13437612This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.13441557LE-Tg(Cx3cr1-cre/ERT2)3Ottc<a href=http://www.rrrc.us/Strain/?x=858>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00858This strain was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter.13446407SD-Tg(Camk2a-cre/ERT2)/ZiRrrc<a href=http://www.rrrc.us/Strain/?x=688>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-11-07)RRID:RRRC_00688The hemizygous rats have random insertion of calcium/calmodulin-dependent protein kinase II alpha (Camk2a)- cre/ERT2 (tamoxifen inducible Cre recombinase) transgene in the genome. This transgenic exhibits expression of cre/ERT2 fusion protein in neural populations where the mouse Camk2a promoter region found in the transgene is active.13450922SD-<i>GEPR-3</i><a href=http://www.rrrc.us/Strain/?x=798>Rat Resource and Research Center</a>inbredUnknownseizureRRID:RRRC_00798Genetically Epilepsy-Prone Rats (GEPR-3) have moderate levels of seizure predisposition. This colony,initially referred to as an AGS (audiogenic response score) colony, was bred to exhibit clonic convulsions (moderate seizures with an ARS of 3) following a single wild running phase in response to sound. Siezures model human generalized tonic/clonic seizures.13451132BN-<i>Crb1<sup>m1</sup></i>mutantUnknownCrb1<sup>m1</sup>13451133RRID:RGD_13451132This Brown Norway from Janvier rat strain spontaneously develops progressive focal retinal layer disorganization, loss of photoreceptors, cystic cavitation, and RMG abnormalities associated with early retinal vascular telangiectasia and late stage subretinal neovascularization. This phenotype bears reminiscent of human Macular telangiectasia 2. A deletion insertion mutation in exon 6 of the rat crb1 was identified to be responsible for this retinal phenotype.13451538FHH-Chr 1<sup>BN</sup>-<i>Dusp5<sup>em1Mcwi</sup></i>mutantUnknownDusp5<sup>em1Mcwi</sup>13451539RRID:RGD_13451538This strain was produced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC-CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449 and 464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid 121.13452382SD-Tg(Htt<sup>*</sup>)transgenicUnknownHTT68472RRID:RGD_13452382This rat model was developed by injection of SD embryos with construct containing rat huntingtin cDNA fragment with 51 CAG repeats (from HD patient) under control of the native rat huntingtin promoter.13452406SHR/NHsdAkrSpontaneously Hypertensive RatUniversity of Akron breeding colonies, Akron, OhioinbredUnknownRRID:RGD_13452406SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at the University of Akron breeding colonies, Akron, Ohio13452407WKY/NHsdAkrUniversity of Akron breeding colonies, Akron, Ohio.inbredUnknownRRID:RGD_13452407These animals were bought from Harlan Indianapolis, Indiana U.S.A. and maintained at the University of Akron breeding colonies, Akron, Ohio.13462044LE-Tg(Thy1-GCaMP6f)9RrrcJanelia Research Campus and Princeton UniversitytransgenicUnknownRRID:RRRC_00829Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-chain kinase.13462045LE-Tg(Thy1-GCaMP6f)7RrrcJanelia Research Campus and Princeton UniversitytransgenicLive Animals (as of 2024-01-17)RRID:RRRC_00830Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-chain kinase.13464263F344-<i>Il2rg<sup>em1Iexas</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1295> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2018-01-02)ImmunologyIl2rg<sup>em1Iexas</sup>13464264RRID:RGD_13464263This strain was established by CRISPR/Cas9 targeting rat Il2rg gene using electroporation. background strain: F344/Jcl. This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion of Il2rg gene. This strain grows normally under SPF condition.13464268GH/Htru<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1293> National BioResource Project for the Rat in Japan</a>inbredCryopreserved Embryo (as of 2018-01-02)RRID:RGD_13464268University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). Characteristics Develops hypertension, cardiac hypertrophy and vascular disease (Phelan 1968, Simpson and Phelan 1984, Simpson et al, 1994).13464270Seac:LISLister Rat, Sea:Lister HoodedoutbredCryopreserved Embryo (as of 2018-01-02)RRID:RGD_13464270In 1990, this strain was introduced from Harlan Olac (UK) to Seiwa Institute of Experimental Animals. Then this strain was introduced to KYUDO Company in 2004.13464272CrljJclKud:SD<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1271> National BioResource Project for the Rat in Japan</a>outbredCryopreserved Embryo (as of 2018-01-02)RRID:RGD_13464272In 2004, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016.13464273JclKud:WIWistar rats<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1270> National BioResource Project for the Rat in Japan</a>outbredCryopreserved Embryo (as of 2018-01-02)RRID:RGD_13464273In 1977, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016.13464320STOCK <i>Aspa<sup>em34Kyo</sup> Hcn1<sup>A354V</sup></i>/Kyo<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1273> National BioResource Project for the Rat in Japan</a>inbredUnknownAspa<sup>em34Kyo</sup>|Hcn1<sup>A354V</sup>11564348|13464319RRID:RGD_13464320This double mutant strain was established by crossing WTC/Kyo (NBRP Rat No. 0020) and F344-<i>Aspa<sup>em34Kyo</sup></i> (NBRP Rat No. 0806). WTC/Kyo has a missense mutation (Hcn1A354V) in Hcn1 (Hyperpolarization-activated cyclic nucleotide-gated channel 1) gene and F344-<i>Aspa<sup>em34Kyo</sup></i> has a 16-bp deletion in the exon4 of Aspa (Aspartoacylase) gene (c.622_637del).13464326LE.W-Tg(Slc32a1-YFP*)1Yyan/Vip<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1281> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo (as of 2018-01-03)RRID:RGD_13464326The original strain, W-Tg(Slc32a1-YFP*)1Yyan (NBRP No.0554 rat), was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006 (Uematsu et al. Cerebral Cortex (2008). This original strain rats were was crossed with Long-Evans rat (Iar:Long-Evans) for 10 generations to establish the congenic strain.13464327WKY.Cg-<i>clest</i>/Iet<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1269> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2018-01-03)RRID:RGD_13464327When the depositor (The Institute of Environmental Toxicology ) conducted mating experiment using male Crl:CD(SD) rats, the offsprings of backcrossed-generation showed multiple malformations such as ectrodactylism, cleft palate or lip in 2013. These phenotype might be inherited in an autosomal recessive pattern. Therefore the congenic strain was established using WKY strain as the recipient strain.13464329FPL/IetFused pulmonary lobes, FPLThe Institute of Environmental ToxicologymutantCryopreserved Embryo (as of 2023-09-28)Frem2<sup>fpl</sup>13464330RRID:RGD_13464329This spontaneous mutant strain wa found in a colony of Jcl:Wistar strain at the Institute of Environmental Toxicology in 1978: 3 rats out of 13 rats showed fused right pulmonary lobes with reduction deformity of middle pulmonary lobes. These rats also had the syndactylism or paten tof the eyelid. It was difficult to maintain this strain in homozygous condition, mating system has been changed to sib mating between heterozygous rats.13503336W;Cg-<i>Acr<sup>tm1Osb</sup></i>Acr KO, Acr {tm1 Osb}<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1294> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2018-01-12)RRID:RGD_13503336After homologous recombination using ES cells derived from hybrid (mix) breed of Slc:Wistar (female) and F344/NSlc (male), Acr KO strain was established by GLT at Osaka University. The genomic region including exon 1 to exon 3 is replaced by Neo resistance gene. After mating with Slc:Wistar, this strain is maintained by sib mating or with Slc:Wistar rats.13506176SS-<i>Nox4<sup>em2</sup>Ncf2<sup>em1</sup>McwiMCW Gene Editing Rat Resource CentermutantCryopreserved Sperm; Cryorecovery (as of 2018-11-12)Nox4<sup>em2Mcwi</sup>|Ncf2<sup>em1Mcwi</sup>4139868|5144089RRID:RGD_13506176Breeding together of SS-Nox4em2Mcwi (RGDID: 4139883) and SS-Ncf2em1Mcwi (RGDID: 5144104), both models were generated by ZFN mutagenesis.13506737GKinbredUnknownRRID:RGD_13506737The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s, GK rats were initiated with breeding pairs in several places and also commercially available from Japanese breeders Charles River Japan, Yokohama, Oriental Yeast, Tokyo, Clea Japan Inc., Osaka (GK/Clea), Japan SLC, Shizuoka (GK/SLC), Takeda Lab Ltd., Osaka (GK/Taked), and from Taconic, USA (GK/Mol/Tac).13506738GK/ParinbredUnknownRRID:RGD_13506738The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generation.In 1988, GK/Par substrain was established in Paris, France by initiating breeding pairs F35 from Japanese colonies .13506739GK/Jcl<a href =https://www.clea-japan.com/en/products/diabetes/item_a0130> CLEA Japan, Inc</a>inbredUnknownRRID:RGD_13506739The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.This strain was introduced from Tohoku University, and CLEA Japan Inc started its production and supply as GK/Jcl.13506831SS-<i>P2rx7<sup>em10Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-02-21)P2rx7<sup>em10Mcwi</sup>13792805RRID:RGD_13506831CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 213506832SS-<i>P2rx7<sup>em13Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)P2rx7<sup>em13Mcwi</sup>13792806RRID:RGD_13506832CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 213506918F344/NFischerNIH Autoimmune Rat Model Repository and Development CenterinbredUnknownRRID:RGD_13506918Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from NIH.13506919F344/NctrFischerNational Center for Toxicological Research, FDA.inbredUnknownRRID:RGD_13506919Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Center for Toxicological Research, FDA.13508588WIWistar ratoutbredUnknownRRID:RGD_13508588The Wistar rat is an outbred albino rat. This breed was developed at the Wistar Institute in 1906 for use in biological and medical research, and is notably the first rat developed to serve as a model organism.13513909SD-Tg(Ren2)27<sup>-/-</sup>Center for Genome Research, University of Edinburgh, UKtransgenicUnknownRRID:RGD_13513909This is a littermate wild type control strain for SD-Tg(Ren2)27 (RGD:629501), which was generated by the mouse Ren2 renin gene along with its 5' and 3' flanking sequences being microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background.13524863LEC/CrljLong Evans CinnamonJapan Charles River Inc. (Yokohama, Japan)inbredUnknownRRID:RGD_13524863The LEC/Crlj is available at Japan Charles River Inc. (Yokohama, Japan) since 1991 from the Center for Experimental Plants and Animals, Hokkaido University.13524998UPLinbredUnknownRRID:RGD_13524998In 1989, a femal sprague-Dawley rat with spontaneous cataracts was observed in the Upjohn Pharmaceuticals Limited Tsukuba Research Laboratory colony. The cataract was demonstrated to be hereditary and it was determined that there are two cataract types with different onset ages.13525002Gunn ratssegregating_inbredUnknownRRID:RGD_13525002This mutation was observed for the first time in the breeding stock of the rat colony of the Connaught Laboratories in 1934. It is of Wistar origin.13592602SD-Tg(LRRK2*G2019S)418Rwm<a href=http://www.rrrc.us/Strain/?x=776>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; Cryorecovery (as of 2018-05-14)Parkinson's DiseaseLRRK21353141RRID:RRRC_00776These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag.13592603SD-Tg(LRRK2)302Rwn<a href=http://www.rrrc.us/Strain/?x=778>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; Cryorecovery (as of 2018-05-14)LRRK21353141RRID:RRRC_00778These rats were created using BAC constructs consisting of the entire 144kb human wild type LRRK2 locus fused to a YPet reporter tag.13592604SD-Tg(LRRK2*G2019S)416Rwm<a href=http://www.rrrc.us/Strain/?x=785>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; Cryorecovery (as of 2018-05-14)Parkinson's DiseaseRRID:RRRC_00785These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag.13592605F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561BrydF344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561<a href=http://www.rrrc.us/Strain/?x=797>Rat Resource and Research Center</a>transgenicLive Animals (as of 2019-03-18)RRID:RRRC_00797The transgene consists of a SpeI fragment from plasmid pCAG-loxPSTOPloxP-ZsGreen (Addgene plasmid #51269, donated by Pawel Pelczar). Hemizygous animals contain approximately 4 copies of the transgene integrated at a site on Chromosome 2.13602097LE.Cg-(ROSA26) <sup>em1(CAG-Cas9*D10A)Ottc</sup><a href=http://www.rrrc.us/Strain/?x=834>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00834The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of CRISPR associated protein 9 (Cas9) catalytic mutant protein D10A under the control of CAG promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.13628730SD-<i>Il2rg<sup>em1Ang</sup></i>Centre de Recherche en Transplantation et Immunologie UMR1064, INSERM, University de Nantes, Nantes, France.mutantUnknownIl2rg<sup>em1Ang</sup>13628731RRID:RGD_13628730TALEN targeting the 2nd exon of rat Il2rg gene was designed and mRNA coding these TALEN was microinjected into Crl:SD embyo.This strain carrying an 80 bp deletion generated a premature stop codon in the 3rd exon. No Il2rg protein was detected by western blot.13673907NMcwiWfsm:HSHeterogeneous stockDepartment of Internal Medicine, Molecular Medicine
Wake Forest Baptist Medical CenteroutbredUnknownRRID:RGD_1367390725 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy. These HS rats were derived from NMcwi:HS at the Medical College of Wisconsin and maintained at Wake Forest Baptist Medical Center starting in 2017.13702080SD-<i>Ahr<sup>em1Soar</sup></i>University of Kansas Medical CentermutantCryopreserved Sperm; Cryorecovery (as of 2019-01-21)Toxicology, reproduction, cancerAhr<sup>em1Soar</sup>13702081RRID:RRRC_00831Crispr/Cas9 targeted deletion of DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The established Ahr null strain lacks responsiveness to Ahr ligands.13702084BBDP.BBDR-<i>Gimap5</i>/SunnPhilippe Poussier,Sunnybrook Research Institute/University of TorontocongenicUnknownGimap5628871RRID:RGD_13702084To generated Gimap5 congenic BBDP/WorSunn rats, the laboratory introgressed the wild-type Gimap5 locus derived from BBDR (BBDR/Wor) rats (Biomedical Research Models) into BBDP/WorSunn rats. Briefly, BBDP/WorSunn and BBDR/Wor rats were crossed, and the resulting F1 animals were backcrossed to BBDP/WorSunn rats. This step was followed by 10 more, marker- assisted backcrosses of Gimap5 heterozygous progeny to BBDP/WorSunn rats. After the eleventh backcross, nonlymphopenic rats were intercrossed, and their progeny homozygous for wild-type Gimap5 were selected for establishing the congenic non-lymphopenic BBDP/WorSunn line (also called BBDP/WorSunn.BBDR-Iddm2).13702085BBDP.BBDR-Gimap5, WF-(<i>D13Rat124-D13Mgh5</i>)/SunnDepartment of Medicine and Immunology, University of Toronto, Toronto, Ontario, CanadacongenicCryopreserved Sperm; Cryorecovery (as of 2019-03-18)Ptprc|Gimap53451|628871RRID:RRRC_00791The Gimap5 congenic BBDP/WorSunn rats (BBDP.BBDR-Gimap5/Sunn) were corssed with the BBDP/WorSunn.WF-CD45 inbred line (BBDP.WF-(D13Rat124-D13Mgh5)/Sunn) to develop an inbred BBDP/WorSunn strain that would be congenic for both wild type Gimap5, hence non T lymphopenic (and consequently diabetes resistant), and for the WF-derived CD45.2 (RT7) allele (the original BBDP/WorSunn strain carries the CD45.1 allele).13703119SD-<i>Lamp2<sup>em1</sup></i>State Key Laboratory of Cancer Biology, National Clinical Research Centre for Digestive Diseases and Xijing Hospital of Digestive Diseases, Fourth Military Medical University, Xi'an, ChinamutantUnknownLamp2<sup>em1</sup>13703121RRID:RGD_13703119This strain was produced by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion and results in knockout of Lamp2 protein in Lamp2 y/- male.13781890SD-<i>Rnaset2<sup>em1Sage</sup></i>mutantUnknownRnaset2<sup>em1Sage</sup>13781891RRID:RGD_13781890Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats. WT, heterozygous and homozygous (KO) rats were born in the expected Mendelian ratio, and homozygous RNaseT2 KO rats were viable and fertile.13782128SD-<i>Pde4b<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/pde4b-knockout-rat-tgra7210>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2018-08-22)Pde4b<sup>em1Sage</sup>13782129RRID:RGD_13782128These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 1 of rat Pde4b into Sprague Dawley embryos. The 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 in rat was created in the mutant founders. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring.13782146SD-<i>Bace1<sup>em1Sage-/-</sup></i>SD-<i>Bace1<sup>em1Sage-</sup></i>/<i>Bace1<sup>em1Sage-</sup></i>mutantUnknownBace1<sup>em1Sage</sup>13782148RRID:RGD_13782146Bace1 (-/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)13782163SD-<i>Snca<sup>tm1(SNCA*)Sage</sup></i><a href=https://www.horizondiscovery.com/in-vivo-models/knockout-rats/all-products/alpha-synuclein-a53t-knock-in-rat> Horizon Discovery</a>mutantLive Animals (as of 2018-08-24)RRID:RGD_13782163This model contains a knockin of the A53T-mutated SNCA gene deeming the rat SNCA gene non-functional. The knockin contains humanized amino acids for the region spanning amino acids 53-122. The resulting model expresses a humanized A53T alpha-synuclein protein without endogenous rat alpha-synuclein.13782164SD-<i>Snca<sup>em1Sage</sup></i><a href=https://www.horizondiscovery.com/alpha-synuclein-knockout-rat> Horizon Discovery</a>mutantLive Animals (as of 2018-08-24)RRID:RGD_13782164This model contains a deletion of the endogenous rat SNCA gene, encoding the alpha-synuclein protein. This model was generated using the CRISPR/Cas9 genome targeting strategy.13782280SS-<i>Kcnj1<sup>em1Kasu+/+</sup></i>Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,IncmutantUnknownRRID:RGD_13782280Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein. This strain is the wild type littermate from heterozygous cross.13782351SS-<i>Kcnj1<sup>em1Kasu+/-</sup></i>Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,IncmutantUnknownKcnj1<sup>em1Kasu</sup>13782352RRID:RGD_13782351Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is TCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single -cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes.13782353SS-<i>Kcnj1<sup>em1Kasu-/-</sup></i>Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,IncmutantUnknownKcnj1<sup>em1Kasu</sup>13782352RRID:RGD_13782353Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes.13782371SD-<i>Cacna1f <sup>csnb</sup></i>congenital stationary night blindness ratmutantUnknownCacna1f <sup>csnb</sup>13782372RRID:RGD_13782371A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains.13792570WI-<i>Oprl1<sup>m1Hubr+/-</sup></i>Hubrecht Laboratory, Utrecht, The NetherlandsmutantUnknownOprl1<sup>m1Hubr</sup>13792571RRID:RGD_13792570The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.13792572WI-<i>Oprl1<sup>m1Hubr-/-</sup></i>NOPr knockout ratHubrecht Laboratory, Utrecht, The NetherlandsmutantUnknownOprl1<sup>m1Hubr</sup>13792571RRID:RGD_13792572The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.NOPr is completely absent in homozygous mutants.13792573SD-<i>Lep<sup>em1Sage+/-</sup></i><a href=https://www.horizondiscovery.com/leptin-knockout-rat-8212-kilorat-8482-tgra3780>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2018-09-13)CardiovascularLep<sup>em1Sage</sup>12904927RRID:RGD_13792573This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels13792575SD-<i>Lep<sup>em1Sage+/+</sup></i>mutantUnknown (as of 2018-09-13)CardiovascularRRID:RGD_13792575These wild type rats are littermates of homozygous knockout rats from heterozygote matings. The Lepr knockout model possesses a 151 bp deletion spanning the exon 1/intron 1 junction of the Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels13792606SD-<i>Cd59<sup>em1Ask</sup>-/-</sup></i>SD-<i>Cd59<sup>em1</sup>-/</sup></i><i>Cd59<sup>em1</sup>-</sup></i>Cardiovascular Research Institute,University of California San Francisco, CA 94143-0521
USAmutantUnknownCd59<sup>em1Ask</sup>13792720RRID:RGD_13792606The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants.13792607SD-<i>Cd59<sup>em1Ask+/+</sup></i>Cardiovascular Research Institute,University of California San Francisco, CA 94143-0521
USAmutantUnknownRRID:RGD_13792607The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion in exon 3. No protein expression was detected in the blood smear of homozygous mutants. Breeding of CD59 +/- rats was done to generate wildtype (CD59+/+)and homozygous mutant (CD59-/-) rats.13792682SD-<i>Abcc6<sup>em2Qlju+/-</sup></i>Thomas Jefferson University, PhiladelphiamutantUnknownAbcc6<sup>em2Qlju</sup>10413846RRID:RGD_13792682This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.13792683SD-<i>Abcc6<sup>em2Qlju+/+</sup></i>Thomas Jefferson University, PhiladelphiamutantUnknownRRID:RGD_13792683This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. This wild type mutant is the wild type offspring from the cross of heterozygous mutants.13792701SD-<i>Trpv1<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com//trpv1-knockout-rat-tgrs5530>Horizon Discovery</a>mutantCryopreserved Embryo (as of 2018-09-21)Trpv1<sup>em1Sage</sup>13792702RRID:RGD_13792701These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created. Homozygous knockout rats exhibit complete loss of Trpv1 protein.13792705SD-<i>Trpv1<sup>em1Sage+/+</sup></i>mutantUnknownRRID:RGD_13792705These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created ( SD-Trpv1em1Sage-/-). This wild type mutant is the wild type offspring from the cross of heterozygous mutants.13792727HanRj:WI<a href =https://www.janvier-labs.com/rodent-research-models-services/research-models/per-species/outbred-rats/product/wistar.html> Janvier Labs</a>outbredUnknownRRID:RGD_13792727Zentralinstitut fur Versuchstierzucht (Hannover) 1982 (from Allington Farm - UK 1964). This strain was selected by DONALDSON in 1906 at the Wistar Institute (USA), from a batch belonging to Chicago University (RUSSEL-LINDSAY, 1979).13792794SD-<i>Fh<sup>em1+/-</sup></i>mutantUnknownFh<sup>em1</sup>13792797RRID:RGD_13792794A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. No homozygous -/- mutant was revealed in litters.13792795SD-<i>Fh<sup>em1+/+</sup></i>mutantUnknownRRID:RGD_13792795A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. Breeding of Fh +/- rats was done to generate wildtype (Fh+/+)and Fh (+/-). No homozygous mutant were observed.13792801SS-<i>Nlrp3<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-09-28)Nlrp3<sup>em2Mcwi</sup>13792799RRID:RGD_13792801CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion of exon 1 in the Nlrp3 gene.13792803SS-<i>P2rx7<sup>em12Mcwi</sup></i>mutantCryopreserved Sperm (as of 2023-06-21)P2rx7<sup>em12Mcwi</sup>13792802RRID:RGD_13792803This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp deletion in Exon 2 of the P2rx7 gene.13792808SS-<i>Ptk2b<sup>em1Mcwi</sup></i>mutantCryopreserved Sperm (as of 2021-11-03)Ptk2b<sup>em1Mcwi</sup>13792810RRID:RGD_13792808CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.13792811SS-<i>Ptk2b<sup>em3Mcwi</sup></i>mutantUnknownPtk2b<sup>em3Mcwi</sup>13792812RRID:RGD_13792811CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a7-bp deletion in exon 2.13792813SHRSP-<i>Spp1<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-01)Spp1<sup>em2Mcwi</sup>13792814RRID:RGD_13792813CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene.13792821SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1McwiSD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1MCW Gene Editing Rat Resource CentertransgenicUnknownRRID:RGD_13792821The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.13792822SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2McwiSD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2MCW Gene Editing Rat Resource CentertransgenicUnknownRRID:RGD_13792822The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line B.13792823SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)3McwiMCW Gene Editing Rat Resource CentertransgenicUnknownRRID:RGD_13792823The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line C.13792825SD-Tg(CAG-loxP-stop-loxP-Mfn1-GFP)1McwiMCW Gene Editing Rat Resource CentertransgenicUnknownRRID:RGD_13792825The Sleeping Beauty transposon system was used to introduce a Mfn1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette. This is line A.13792827WKY-Tg(Ubc-cre/ERT2)4McwiMCW Gene Editing Rat Resource CentertransgenicCryopreserved Sperm (as of 2018-10-02)RRID:RGD_13792827The Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line D.Cre activity is detected even without tamoxifen induction.13792828WKY-Tg(Ubc-cre/ERT2)5McwiMCW Gene Editing Rat Resource CentertransgenicCryopreserved Sperm (as of 2018-10-02)RRID:RGD_13792828The Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line E.Cre activity is detected even without tamoxifen induction.13793372SS-<i>Tlr4<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownTlr4<sup>em1Mcwi</sup>13793373RRID:RGD_13793372CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2.13793374DA-<i>Tph1<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-03)Tph1<sup>em4Mcwi</sup>13793375RRID:RGD_13793374CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4.13793376SS-<i>Avpr2<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Embryo (as of 2018-10-03)Avpr2<sup>em4Mcwi</sup>13793377RRID:RGD_13793376CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2.13793378SS-<i>Avpr2<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-03)Avpr2<sup>em5Mcwi</sup>13793379RRID:RGD_13793378CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2.13799346SS-<i>Cgnl1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-10)Cgnl1<sup>em1Mcwi</sup>13799347RRID:RGD_13799346CRISPR/Cas9 system was used to introduce a 80-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryos13799348SS-<i>Cgnl1<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-10)Cgnl1<sup>em2Mcwi</sup>13799349RRID:RGD_13799348CRISPR/Cas9 system was used to introduce a 88-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryos13799350T2DN-<i>F2r<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-10)F2r<sup>em1Mcwi</sup>13799351RRID:RGD_13799350CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos.13800555F344/IcoCrl<a href=https://www.criver.com/products-services/find-model/fischer-344-rat?region=3611#> Charles RiverinbredUnknownRRID:RGD_13800555From mating #344 of rats purchased from a local breeder (Fischer). The colony was originated by M. R. Curtis, Columbia University in 1920. To the Germ-Free Animal Laboratory at CNRS, Gif-sur-Yvette, France from the Lobund Institute, University of Notre-Dame, South Bend, Indiana, U.S.A. Subsequently introduced to Charles River France in 1970 as an axenic colony.13800556F344-<i>Hsd11b2<sup>em1Jmul-/-</sup></i>F344-<i>Hsd11b2<sup>em1Jmul-</sup>/Hsd11b2<sup>em1Jmul-</sup></i>mutantUnknownHsd11b2<sup>em1Jmul</sup>13800560RRID:RGD_13800556The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG.13800557F344-<i>Hsd11b2<sup>em1Jmul+/+</sup></i>F344-<i>Hsd11b2<sup>em1Jmul+</sup>/Hsd11b2<sup>em1Jmul+</sup></i>mutantUnknownRRID:RGD_13800557This is the wild-type litter mates of the Hsd11b2 F344 mutants created by ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG.13800746SS-<i>F8<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-17)F8<sup>em1Mcwi</sup>13800747RRID:RGD_13800746CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos.13800749Lew-<i>Glp1r<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownGlp1r<sup>em1Mcwi</sup>13800750RRID:RGD_13800749CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos.13800810SS-<i>Kcnq1<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Embryo; Cryopreserved Sperm (as of 2018-10-18)Kcnq1<sup>em5Mcwi</sup>13800813RRID:RGD_13800810CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos.13800825FHH-<i>Muc1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2018-10-18)Muc1<sup>em1Mcwi</sup>13800827RRID:RGD_13800825CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos.13800838FHH-<i>Mybphl<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Mybphl<sup>em1Mcwi</sup>13800841RRID:RGD_13800838CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos.13800845FHH-<i>Mybphl<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2023-06-21)Mybphl<sup>em2Mcwi</sup>13800846RRID:RGD_13800845CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. embryos.13800848SS-<i>Nlrp3<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownNlrp3<sup>em1Mcwi</sup>13800850RRID:RGD_13800848CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene.13800869SS-<i>P2ry2<sup>em6Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownP2ry2<sup>em6Mcwi</sup>13800870RRID:RGD_13800869CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene.13800871SS-<i>P2ry2<sup>em7Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownP2ry2<sup>em7Mcwi</sup>13800873RRID:RGD_13800871CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene.13800875SS-<i>Prl<sup>tm1(PRL)Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownPRL736187RRID:RGD_13800875CRISPR/Cas9 and plasmid donor containing floxed human prolactin cDNA were used to insert the human cDNA into the start coden of rat prolactin gene13800877LH-Chr 17<sup>LN</sup>-<i>C17h6orf52<sup>em2Mcwi</sup></i>mutantCryopreserved Sperm (as of 2018-10-18)C17h6orf52<sup>em2Mcwi</sup>13800878RRID:RGD_13800877CRISPR/Cas9 system was used to introduce a net 10-bp insertion in exon 2 of rat C17h6orf52.13825143WKY-<i>Gja5<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Gja5<sup>em1Mcwi</sup>13825144RRID:RGD_13825143CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos.13825147SS-<i>Per1<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownPer1<sup>em3Mcwi</sup>13825148RRID:RGD_13825147CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos.13825196SS-<i>Sh2b3<sup>tm1Mcwi</sup></i>mutantCryopreserved Sperm (as of 2018-11-21)Sh2b3<sup>tm1Mcwi</sup>14394610RRID:RGD_13825196CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exons13825199WI-<i>Mc4r<sup>m1Hubr</sup></i>Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic.mutantUnknownMc4r<sup>m1Hubr</sup>13825200RRID:RGD_13825199The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.13838845SD-<i>Ahr<sup>em2Sage</sup></i>mutantUnknownAhr<sup>em2Sage</sup>126790510RRID:RGD_13838845ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene.This ZFN model contains a 29-bp deletion in the rat Ahr gene.14390067WI-<i>Slc6a4<sup>m1Hubr-/-</sup></i>Hubrecht Laboratory, Utrecht, The NetherlandsmutantUnknownSlc6a4<sup>m1Hubr</sup>14390068RRID:RGD_14390067The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The homozygoous mutant rats were generated by incrossed between heterozygous Slc6a4 knock out rats.14390069WI-<i>Slc6a4<sup>m1Hubr+/-</sup></i>Hubrecht Laboratory, Utrecht, The NetherlandsmutantUnknownSlc6a4<sup>m1Hubr</sup>14390068RRID:RGD_14390069The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The heterozygoous mutant rats were used to generate homozygous Slc6a4 knock out rats.14390082SD-Tg(Fos-LacZ)Bhope<a href=http://www.rrrc.us/Strain/?x=865>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00865The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Rats were rederived from frozen embryos in 2002 and bred onto SD background for >35 generations at NIDA IRP (Bruce Hope lab)14390083WI-Tg(Fos-LacZ)BhopetransgenicUnknownRRID:RGD_14390083The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Initial SD rats were then bred onto Wistar background for >10 generations at NIDA IRP (Bruce Hope lab)14392784ACI.SD-<i>Esr1<sup>em1Soar</sup></i><a href=http://www.rrrc.us/Strain/?x=849>Rat Resource and Research Center</a>mutantUnknown (as of 2019-02-28)Esr1<sup>em1Soar</sup>12910736RRID:RRRC_00849This strain was produced by backcrossing the ZFN induced 482 deletion allele (Esr1em1Soar) in HsdHot:SD to the ACI/SegHsd background for 12 generations. ACI strain is particularly sensitive to Estrogen-induced tumorigenesis.14392813SD-<i>Cftr<sup>em1Sage+/-</sup></i><a href=https://www.inotivco.com/model/hsdsage-sd-cftrem1sage>inotiv</a>mutantCryopreserved Embryo; Cryorecovery (as of 2023-06-06)Cftr<sup>em1Sage</sup>14392814RRID:RGD_14392813Cftr ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. This Cftr heterozygous rats exhibited similar bioelectric and other characteristics to wild-type.14392815SD-<i>Cftr<sup>em1Sage-/-</sup></i><a href=https://www.horizondiscovery.com/cftr-knockout-rat-tgrs5740>Horizon Discovery</a>mutantUnknown (as of 2019-03-04)Cftr<sup>em1Sage</sup>14392814RRID:RGD_14392815CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats are produced by crossing the Cftr heterozygous rats.14392817SD-<i>Cftr<sup>em1Sage+/+</sup></i>mutantUnknownRRID:RGD_14392817CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats and wild-type rats are produced by crossing the Cftr heterozygous rats.14394485SD-<i>Bace1<sup>em1Sage</sup></i>mutantUnknownBace1<sup>em1Sage</sup>13782148RRID:RGD_14394485The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)14394486SD-<i>Bace1<sup>em1Sage+/-</sup></i>SD-<i>Bace1<sup>em1Sage+</sup>/Bace1<sup>em1Sage-</sup></i>mutantUnknownBace1<sup>em1Sage</sup>13782148RRID:RGD_14394486The Bace1 (+/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)14394487SD-<i>Bace1<sup>em1Sage+/+</sup></i>SD-<i>Bace1<sup>em1Sage+</sup>/Bace1<sup>em1Sage+</sup></i>mutantUnknownRRID:RGD_14394487The Bace1 (+/+) rats were generated by crossing SD-Bace1em1Sage. The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly)14394488Lew-<i>Glp1r<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Glp1r<sup>em2Mcwi</sup>14394489RRID:RGD_14394488CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos.14394491Lew-<i>Glp1r<sup>em3Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Glp1r<sup>em3Mcwi</sup>14394492RRID:RGD_14394491CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos.14394494SS-<i>Kcnj2<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2019-03-22)Kcnj2<sup>em2Mcwi</sup>14394495RRID:RGD_14394494CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos.14394496SS-<i>Kcnj2<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Kcnj2<sup>em4Mcwi</sup>14394497RRID:RGD_14394496CRISPR/Cas9 system was used to introduce a 2-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos.14394501SHR-<i>Klrb1a<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2019-03-25)Klrb1a<sup>em1Mcwi</sup>14394503RRID:RGD_14394501CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos.14394504SHR-<i>Klrb1a<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknown (as of 2019-03-25)Klrb1a<sup>em2Mcwi</sup>14394505RRID:RGD_14394504CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos.14394506SS-<i>P2ry2<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2019-03-25)P2ry2<sup>em5Mcwi</sup>14394507RRID:RGD_14394506CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3.14394508BBDR.BBDP-(D4Mit6-D4Mit7)-<i>Tlr4<sup>em5Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2019-03-25)Tlr4<sup>em5Mcwi</sup>14394509RRID:RGD_14394508CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos.14394515LE-<i>Grin2b<sup>em1Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Autism, Developmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/GRIN2B>SFARI GENE</a>)Grin2b<sup>em1Mcwi</sup>14394517RRID:RGD_14394515CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3.14394518LE-<i>Arid1b<sup>em1Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/ARID1B>SFARI GENE</a>)Arid1b<sup>em1Mcwi</sup>14394519RRID:RGD_14394518CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4.14394520SS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1McwiSS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1MCW Gene Editing Rat Resource CentertransgenicUnknownRRID:RGD_14394520The Sleeping Beauty transposon system was used to introduce a Rpl10a-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette14394616DA-<i>Tph2<sup>em3Mcwi+/+</sup></i>PhysGen KnockoutsmutantCryopreserved Sperm (as of 2021-11-03)Tph2<sup>em3Mcwi</sup>10402820RRID:RGD_14394616This wild type strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.14394617DA-<i>Tph2<sup>em3Mcwi+/-</sup></i>PhysGen KnockoutsmutantUnknownTph2<sup>em3Mcwi</sup>10402820RRID:RGD_14394617The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.14394618DA-<i>Tph2<sup>em3Mcwi-/-</sup></i>PhysGen KnockoutsmutantUnknownTph2<sup>em3Mcwi</sup>10402820RRID:RGD_14394618This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.14394619DA-<i>Tph2<sup>em2Mcwi+/+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_14394619This wild type strain was produced by crossing Tph2em2Mcwi heterozygous rats and confirmed by sequencing. The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.14394620DA-<i>Tph2<sup>em2Mcwi+/-</sup></i>PhysGen KnockoutsmutantUnknownTph2<sup>em2Mcwi</sup>10402817RRID:RGD_14394620The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.14394621DA-<i>Tph2<sup>em2Mcwi-/-</sup></i>PhysGen KnockoutsmutantUnknownTph2<sup>em2Mcwi</sup>10402817RRID:RGD_14394621The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing.14398460SS-<i>Cd40<sup>em1Uthal-/-</sup></I>University of ToledomutantUnknownCd40<sup>em1Uthal</sup>14398461RRID:RRRC_00840Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein.14398463SS-<i>Prr5<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2019-04-19)Prr5<sup>em1Mcwi</sup>40818256RRID:RGD_14398463CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene.14398465SS-<i>Prr5<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2019-04-19)Prr5<sup>em2Mcwi</sup>40818255RRID:RGD_14398465CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene.14398479SS-<i>Xdh<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Xdh<sup>em1Mcwi</sup>14398480RRID:RGD_14398479CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos.14398481SS-<i>Xdh<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Xdh<sup>em2Mcwi</sup>14398482RRID:RGD_14398481CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos.14398499LE-<i>Drd1<sup>em1(iCre)Berke</sup></i><a href=http://www.rrrc.us/Strain/?x=856>Rat Resource and Research Center</a>mutantLive Animals (as of 2021-02-12)Drd1<sup>em1(iCre)Berke</sup>14398500RRID:RRRC_00856The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE.14398734LE-<i>Adora2a<sup>em1(iCre)Berke</sup></i><a href=http://www.rrrc.us/Strain/?x=857>Rat Resource and Research Center</a>mutantLive Animals (as of 2021-02-12)Adora2a<sup>em1(iCre)Berke</sup>14398735RRID:RRRC_00857The CRISPR system was used to created target insertion of iCre recombinase immediately after Adora2a gene, with P2A linker, of the embryos of BluHsd:LE.14398825SD-<i>Fah<sup>em15Dlli-/-</sup></i>East China Normal University, Shanghai, China.mutantUnknownFah<sup>em15Dlli-/-</sup>14398826RRID:RGD_14398825This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates.14398828SD-<i>Fah<sup>em10Dlli-/-</sup></i>East China Normal University, Shanghai,
China.mutantUnknownFah<sup>em10Dlli-/-</sup>14398829RRID:RGD_14398828This strain was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates14402419LE-<i>Chrna5<sup>em18Pas</sup></i>Strains were produced at Institut Pasteur (France), Departement de Neuroscience, Benoit Forget. The lines will be maintained at Charles River Laboratory France (CRLF).mutantUnknownChrna5<sup>em18Pas</sup>14402420RRID:RGD_14402419The Zinc Finger Nuclease system was used to create184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous.14402421LE-<i>Chrna5<sup>em20(D398N)Pas</sup></i>Strains were produced at Institut Pasteur (France), Departement de Neuroscience, Benoit Forget. The lines will be maintained at Charles River Laboratory France (CRLF).mutantUnknownChrna5<sup>em20(D398N)Pas</sup>14402422RRID:RGD_14402421The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous.14694847LE-<i>Pvalb<sup>em1(flpo)Berke</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=859>Rat Resource and Research Center</a>mutantUnknownPvalb<sup>em1(flpo)Berke</sup>14694849RRID:RRRC_00859A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. The CRISPR/Cas9 system was used to knock in the plasmid into the targeted gene in the Crl:LE embryo. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. )14694998SD-<i>Sdhb<sup>em1Ast</sup></i><a href=http://www.rrrc.us/Strain/?x=853>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00853This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 4 bp-deletion in Sdhb.14694999SD-<i>Sdhb<sup>em2Ast</sup></i><a href=http://www.rrrc.us/Strain/?x=854>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00854This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 6 bp-deletion in Sdhb.14695000SD-<i>Sdhb<sup>em3Ast</sup></i><a href=http://www.rrrc.us/Strain/?x=855>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00855This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 15 bp-deletion in Sdhb.14695002SD-<i>L1cam<sup>em1Jgn</sup></i><a href=http://www.rrrc.us/Strain/?x=850>Rat Resource and Research Center</a>mutantUnknownL1cam<sup>em1Jgn</sup>38599015RRID:RRRC_00850The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain.14695003SD-<i>L1cam<sup>em2Jgn</sup></i><a href=http://www.rrrc.us/Strain/?x=851>Rat Resource and Research Center</a>mutantUnknownL1cam<sup>em2Jgn</sup>14696788RRID:RRRC_00851The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. No protein expression was detected in the brain.14695004BBDR.F344-(D4Mgh24-D4Rhw6),BBDP-(D4Rhw6-D4Rhw10)/Rhw<a href=http://www.rrrc.us/Strain/?x=458>Rat Resource and Research Center</a>congenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-06-27)RRID:RRRC_004583 Mb of F344 DNA introgressed on Chr.4 between D4Mgh24 (73.75 Mb) and D4Rhw6 (76.83 Mb), and BB diabetes prone (DP) DNA introgressed from D4Rhw6 to D4Rhw10 (the most distal marker the end of the chromosome)14695026W-Tg(Crh-cre)Msg<a href=http://www.rrrc.us/Strain/?x=852>Rat Resource and Research Center</a>transgenicLive Animals (as of 2021-02-12)RRID:RRRC_00852Cre recombinase has been inserted into the genome under the control of the Crh promoter. Generated on Wistar and backcrossed to Wistar every generation.14695028SD.DA-<i>Kcnh2<sup>tm(EGFP-Pac)1Qly </sup></i><a href=http://www.rrrc.us/Strain/?x=847>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00847This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.3kb 5' and 2.1kb 3' homology arm. The Kcnh2 gene 7th and 8th exons are replaced with a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain.14695029SD.DA-<i>Kcnh2<sup>tm(CAG-EGFP)1Qly </sup></i><a href=http://www.rrrc.us/Strain/?x=848>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00848This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 7.5kb 5' and 1.6kb 3' homology arm. A FRT-CAG-EGFP-IRES-Pac-FRT cassette is inserted into the intron between 8th and 9th exons of Kcnh2 gene. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain14695030SD.DA-<i>Pex1<sup>Tm(G843D-FRT-CAG-Pac-FRT)1Qly</sup></i><a href=http://www.rrrc.us/Strain/?x=846>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00846This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 5.8kb 5' and 1.7kb 3' homology arms. A G843D point mutation is introduced into the Pex1 gene. The 12th and 13th exons are flanked with two loxP sites. A FRT-CAG-Pac-FRT cassette is inserted into the intron between Pex1 13th and 14th exon. This strain mimics the Peroxisomal Disorders. Heterozygote does not show any abnormalities.14695031SD.DA-<i>Il2rg<sup>Tm(G843D-FRT-CAG-Pac-FRT)1Qly</sup></i><a href=http://www.rrrc.us/Strain/?x=845>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00845This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.0kb 5' and 1.8kb 3' homology arms and a FRT-CAG-Pac-FRT cassette. The FRT-CAG-Pac-FRT cassette is inserted into the intron between Il2rg 4th and 5th exon. No genomic sequence is deleted. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain.14695032SD-Tg(CAG-loxP-mCherry-loxP-EGFP)1Qly<a href=http://www.rrrc.us/Strain/?x=844>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00844A CAG-loxP-mCherry-loxP-EGFP cassette was injected into SD zygote to generate this line. The integration site is not determined. This transgenic line could be mated to other rat lines that express Cre/CreER for lineage tracing.14695033SD-Tg(CAG-Flpe)Qly<a href=http://www.rrrc.us/Strain/?x=843>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00843A CAG-Flpe cassette was injected into SD zygote to generate this line. The integration site is not determined.This transgenic line could be used to mate with other rat models that contains FRT sites to remove the cassette that is flanked by those FRT sites.14695034ZUC-<I>Lepr</I><sup>fa</sup>.BN-(D1Rat183-D1Rat90)/Ste<a href=http://www.rrrc.us/Strain/?x=837>Rat Resource and Research Center</a>congenicUnknownRRID:RRRC_00837Congenic for distal half of Chromosome 1 from D1Rat183 to D1Rat90 from Brown Norway (BN) on the UC Davis ZUC Lepr faSte/+ strain background. The genetic backgound of the ZUC strain carries a defective leptin receptor on Chromosome 4.14695052ACI-Tg(ROSA26-ALPP)Rrrc<a href=http://www.rrrc.us/Strain/?x=817>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2019-07-01)ALPP1314395RRID:RRRC_00817F344-Tg(ROSA26-ALPP)EpsRrrc (RGD:1566458) received in 1999 from Dr. Eric Sandgren, Univ. Wisconsin-Madison. Since 1999 bred on ACI background.14695053ZDF-<i>Cnr1<sup>em1</sup></i>/RrrcZDF-<i>Cnr1<sup>em1</sup></i><a href=http://www.rrrc.us/Strain/?x=800>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_0080011bp deletion from genomic DNAfor the cannabinoid-1 receptor (Cnr1)using Zinc-Fingers Nucleases. Animals are resistant to the development of type-2 diabetes.14695054F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551BrydF344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551<a href=http://www.rrrc.us/Strain/?x=795>Rat Resource and Research Center</a>transgenicLive Animals (as of 2019-07-01)RRID:RRRC_0079514695055MHS/RomanMilan Hypertensive Strain<a href=http://www.rrrc.us/Strain/?x=794>Rat Resource and Research Center</a>inbredUnknownRRID:RRRC_00794Inbred hypertension model linked to a mutation in Add1 gene that has been validated as one of the genes linked to hypertension in numerous human genetic studies. Inbred strain originally developed by Dr. Bianchi in Milan in 1979.14695058SD-<i>Add3<sup>em1Roman</sup></i><a href=http://www.rrrc.us/Strain/?x=792>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00792frame shift deletion in an exon 12 of Add3 gene causing a stop codon and loss of function. SD outbred background.14695059BBDP/WorSunn.WAG-rnu/Sunn<a href=http://www.rrrc.us/Strain/?x=789>Rat Resource and Research Center</a>congenicUnknownRRID:RRRC_00789To develop BBDP rats congenic for the rnu mutation (nude BBDP), researchers introgressed the rnu mutation from inbred rnu/rnu WAG rats (obtained from Biomedical Research Models) using marker assisted genotyping.14695060WKY-Tg(Eef1a1-GFP)Tja<a href=http://www.rrrc.us/Strain/?x=780>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00780Transgenic strain using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP) under the rat eukaryotic translation elongation factor 1 alpha (Eef1a1) promoter. Two integration sites located on chromosome 8:28170658 and chromosome 1:276465837, both located in intronic gene areas, Jam3 (RGD:1303248) intron 1 and Vti1a (RGD:621490) intron 6, respectively. The Jam3 intron 1 is 51bp long, and the transgene resides at 37kb from exon 1 and 13kb from exon 2. In Vti1a intron 6, 102 bp long, the transgene is located at 81.4 kb from exon 5 and 21 kb from exon 6.14695061LobRrrc:WILobund-WistarFreimann Life Science Center, University of Notre Dame, IndianaoutbredUnknownRRID:RRRC_00962Male L-W develop spontaneous tumors in the anterior and ventral prostate and the seminal vesicle @ an average of 20 months. Tumors can be induced with N-methylnitrosourea and testosterone propinate in an average of 10 months. A cell line of a prostate adenocarcinoma was also created from the strain (PAIII) and can be administer SC in L-W rats with palpable tumor in 7-14 days and metastasis to the lymph nodes and lungs in 28-30 days.14695063BN.LEW-(<i>D10Rat258 and D10Rat51</i>)/SsnUniversity of Massachusetts Medical SchoolcongenicCryopreserved Sperm; Cryorecovery (as of 2024-01-11)RRID:RRRC_00752Severe osteopetrosis with numerous non-functioning osteoclasts. Locus on chromosome 10. Homozygotes not fertile, need to test breed to ID heterozygotes. Homozygotes have no teeth, require ground food. One of only 4 osteopetrotic mutations in rat. Genetic lesion is not yet known but mutation is inherited in an autosomal recessive manner. The candidate gene region has been localized to Chr 10 between D10Rat258 and D10Rat51. original background strain is LEW/Ssn.14695083W/LnneRrrcAudiogenic Wistar rat<a href=http://www.rrrc.us/Strain/?x=697>Rat Resource and Research Center</a>inbredUnknownRRID:RRRC_00697Wistar rats maintained at the animal facility of the Ribeirao Preto School of Medicine at the University of Sao Paulo, Brazil, were tested for audiogenic seizures, using as criteria an SI and the L1 (ref. RGD:14695082). The WAR colony foundation stock was produced by mating animals displaying at least procursive behaviors in three consecutive tests, one every 4 days (two males and four females). Each couple produced two or three lit-ters, from which selected individuals displaying the highest SI and shortest L1 were mated, at adult age,with their fathers and mothers. From the second generation on, brother and sister matings were done, in a ratio of one male to two females, selected accordingto the criteria above.14695085SD-<i>Trim63<sup>em1(hiLuc)</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=731>Rat Resource and Research Center</a>mutantUnknownTrim63<sup>em1(hiLuc)</sup>14696789RRID:RRRC_00731The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, can be used as a universalbiomarker of skeletal muscle atrophyin vivo, and has abioluminescent readout compatible with whole animal imagingmodalities.14695086Zuc/VcJwZucker fatty<a href=http://www.rrrc.us/Strain/?x=740>Rat Resource and Research Center</a>inbredUnknownRRID:RRRC_00740The original background strain derived from Sherman and Merck stock M rats (13 M strain). Obese animals produced by crossing homozygous obese males to heterozygous lean females.14695088WMS/SimfBRMunich Wistar<a href=http://www.rrrc.us/Strain/?x=832>Rat Resource and Research Center</a>inbredCryopreserved Embryo (as of 2019-07-03)RRID:RRRC_00832Received from Munich, Germany via the V.A. San Francisco as line bred stock. Caesarean rederived when pedigreed brother x sister matings began. Selected for surface glomeruli and prominent elongated nephrons at the 6th, 12th and 18th .This strain also possess elongated nephrons. Unlike other Wistar strains with surface glomeruli, these animals do not become proteinuric as they age, which allows for the study of long term, chronic models. Age related proteinuria and spontaneous renal disease could interfere with experimentally-induced conditions.14695547LEW-Tg(HLA-B*2705,B2M)33-3Trg<a href=http://www.rrrc.us/Strain/?x=624>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08)B2M|HLA-B735892|1352836RRID:RRRC_00624This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 55 copies of HLA-B*2705 and 29 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center .14695548LEW-Tg(HLA-B*2705,B2M)21-4HTrg<a href=http://www.rrrc.us/Strain/?x=622>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08)B2M|HLA-B735892|1352836RRID:RRRC_00622This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 150 copies of HLA-B*2705 and 90 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center .14696715SD-<i>Htr7<sup>em1Msu</sup></i>Transgenic and Genome Editing Facility, and Institute for Quantitative Health Science and Engineering, Michigan State University, East Lansing, MichiganmutantUnknownHtr7<sup>em1Msu</sup>14696716RRID:RGD_14696715CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene.14696719F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi+/+</sup></i>PhysGen, TransposagenmutantUnknownRRID:RRRC_00344These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the wild type mutant.14696720F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi-/-</sup></i>PhysGen, TransposagenmutantUnknownRRID:RRRC_00344These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the homozygous mutant.14696721F344-<i>Trpc4<sup>Tn(sb-T2/Bart3)2.192Mcwi-/+</sup></i>PhysGen, TransposagenmutantUnknownRRID:RRRC_00344These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the heterozygous mutant.14696722SD-<i>Cyp3a23/3a1<sup>em1Myliu</sup></i>,<i>Cyp3a2<sup>em1Myliu</sup></i>East China Normal University and Shanghai Changzheng Hospital Joint Research Center for Orthopedic Oncology, Shanghai Key Laboratory of Regulatory Biology
Institute of Biomedical Sciences and School of Life Sciences. Shanghai, ChinamutantUnknownCyp3a23-3a1<sup>em1Myliu</sup>|Cyp3a2<sup>em1Myliu</sup>14696724|14696725RRID:RGD_14696722This rat strain is a double knock out for Cyp3a23/3a1 and Cyp3a2 created by using CRISPR/Cas9 targeting exons of Cyp3a23/3a1 and Cyp3a2. This strain carries a 22-bp deletion of Cyp3a23/3a1 and a 10-bp deletion of Cyp3a2 on Sprague Dawley background.14700890SD-Tg(Cx3cr1-cre/ERT2)3Ottc<a href=http://www.rrrc.us/Strain/?x=862&log=yes>Rat Resource & Research Center</a>transgenicLive Animals (as of 2021-02-12)RRID:RRRC_00862This strain was generated by microinjection of Sprague-Dawley embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter.14975242ACI.FHH-(rs105487995-rs105373896)/McwiMedical College of WisconsincongenicUnknownRRID:RGD_14975242This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.14975243ACI.FHH-(rs105487995-rs106411696)/McwiMedical College of WisconsincongenicUnknownRRID:RGD_14975243This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.14975244ACI.FHH-(rgdv393055223-rs107095981)/McwiMedical College of WisconsincongenicUnknownRRID:RGD_14975244This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] ((also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.14975245ACI.FHH-(rgdv393055223-rs198922144)/McwiMedical College of WisconsincongenicUnknownRRID:RGD_14975245This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.14975246ACI.FHH-(rgdv393055223-rs198076037)/McwiMedical College of WisconsincongenicUnknownRRID:RGD_14975246This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.14975247ACI.FHH-(rs105373896-rgdv253272372)/McwiMedical College of WisconsincongenicUnknownRRID:RGD_14975247This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.14975248ACI.FHH-(rs198076037-rs105278863)/McwiMedical College of WisconsincongenicUnknownRRID:RGD_14975248This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping.14975305F344-<i>Bmpr2<sup>em1Sage+/-</sup></i>VA Palo Alto Health Care System, Stanford University School of MedicinemutantUnknownBmpr2<sup>em1Sage</sup>14981587RRID:RGD_14975305These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. The strains of both sexes were confirmed Bmpr2 haplodeficiency.14981588F344-<i>Bmpr2<sup>em2Sage+/-</sup></i>VA Palo Alto Health Care System, Stanford University School of MedicinemutantUnknownBmpr2<sup>em2Sage</sup>14981589RRID:RGD_14981588These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. The strains of both sexes were confirmed Bmpr2 haplodeficiency.14981597SD-Tg(SOD1*G93A)26DwcTactransgenicUnknownSOD1730855RRID:RGD_14981597SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation. Originally created by John Kulik at Wyeth. Transgenic Model of SOD1 mediated Amyotrophic Lateral Sclerosis (ALS, Lou Gehrig's Disease). Came to Taconic in April 2002 for David Howland at Wyeth for distribution as an Emerging Model. Joint collaboration between Wyeth and The ALS Association.14985210LE-<i>Cyfip1<sup>em1Sage+/-</sup></i>mutantUnknownCyfip1<sup>em1Sage</sup>14985211RRID:RGD_14985210The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8.14995941WpkWistar polycystic kidney ratmutantUnknownTmem67<sup>wpk</sup>14995943RRID:RGD_14995941The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain.15017093Wpk <sup>+/-</sup>Wpk heterozygous ratmutantUnknownTmem67<sup>wpk</sup>14995943RRID:RGD_15017093The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L).15017094Wpk <sup>-/-</sup>Wpk homozygous ratmutantUnknownTmem67<sup>wpk</sup>14995943RRID:RGD_15017094The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L).15036806WKAH/TjWistar-King A, WKAinbredUnknown (as of 2019-11-18)RRID:RGD_15036806WKAH/Tj inbred rats were bred in the Institute for Animal Experimentation, the University of Tokushima School of Medicine, under specific pathogen free conditions.15045605SD-Tg(Prnp-LacZ/EGFP)12084transgenicUnknownRRID:RGD_15045605This transgenic strain line 12084 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter.15045606SD-Tg(Prnp-LacZ/EGFP)12085transgenicUnknownRRID:RGD_15045606This transgenic strain line Tg12085 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter.15045607SD-Tg(Prnp-Prnp)2919transgenicUnknownRRID:RGD_15045607This transgenic strain line Tg2919 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter.15045608SD-Tg(Prnp-Prnp)2922transgenicUnknownRRID:RGD_15045608This transgenic strain line Tg2922 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter.15090817WI-<i>Ahr<sup>em1Hyama+/-</sup></i>mutantUnknownAhr<sup>em1Hyama</sup>15090818RRID:RGD_15090817Heterozygous rats carrying a defective exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI.15090819WI-<i>Ahr<sup>em1Hyama-/-</sup></i>mutantUnknownAhr<sup>em1Hyama</sup>15090818RRID:RGD_15090819The homozygous rats carrying 2 defective Ahr genes. The deletion of part of exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI.18182944SS-<i>Vwf<sup>em2Mcwi-/-</sup></i>MCW Gene Editing Rat Resource Center, through Versiti Blood Research InstitutemutantLive Animals (as of 2020-01-14)Bleeding DisordersVwf<sup>em2Mcwi</sup>18182945RRID:RGD_18182944CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos18182946SS-<i>Vwf<sup>em3Mcwi-/-</sup></i>MCW Gene Editing Rat Resource Center, through Versiti Blood Research InstitutemutantCryopreserved Sperm (as of 2020-01-14)Bleeding DisordersVwf<sup>em3Mcwi</sup>18182947RRID:RGD_18182946CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos18337282Iar: LELong-Evans Rats<a href=http://www.iar.or.jp/english/index_la.html>Institute for Animal Reproduction</a>outbredUnknownOphthalmology, BehaviorRRID:RGD_18337282This strain was established by Dr. Long and Dr. Evans in 1915. This traces its roots to Monash University to Tohoku University in 1984; to Institute for Animal Reproduction through acquisition in 1996.19165133F344;SD-<i>C3<sup>em1Linf</sup></i>The animal facility of Lerner Research Institute, Cleveland ClinicmutantUnknownC3<sup>em1Linf</sup>19165134RRID:RGD_19165133This mutant strain was created by CRISPR/Cas9 genome editing system. The mutant carried insertion of a premature termination codon in exon 2 and was predicted to result in loss of protein expression due to non-sense mediated decay of mRNA. The heterozygous knock out rats (F344/Sprague Dawley mixed background) were bred to each other, and the pups were genotyped to identify the WT and C3 homozygous knock out littermates.19259464SHR-<i>Camk2n1<sup>em1Tja-/-</sup></i>SHR-<i>Camk2n1<sup>em1Tja-</sup>/Camk2n1<sup>em1Tja-</sup></i>mutantUnknownCamk2n1<sup>em1Tja</sup>19259465RRID:RGD_19259464SHR-Camk2n1-/- knockout rats were generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1, into one-cell stage SHR/NCrl embryos that were implanted into pseudopregnant rats. Heterozygous progeny, from a founder harboring a 38bp deletion in Camk2n1, were intercrossed to generate homozygous knockout rats.21079475SD-<i>Lepr<sup>em4Lizh</sup></i>Chinese Academy of Medical Sciences & Comparative Medical Center, Peking Union Medical College, ChinamutantUnknownRRID:RGD_21079475The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR.21083604SD-ROSA26 <sup>em1(LTR-nLuc)Ottc</sup><a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>mutantUnknownRRID:RGD_21083604The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.21409748DA/MmabDark AgoutiMilitary Medical Academy, SerbiainbredUnknownRRID:RGD_21409748Dark Agouti rats which were bred and housed at the Military Medical Academy in Belgrade, Serbia21409752DA/IbissDark AgoutiDark agouti rats were bred and housed at Institute for biological research Sinisa Stankovic, Belgrade, SerbiainbredUnknownRRID:RGD_2140975225314294MWF/ZtmMunich Wistar FromterinbredUnknownRRID:RGD_25314294Fromter selected from outbred Munich-Wistar rats for large numbers of superficial glomeruli.25330087LE-<i>Cntnap2<sup>em1Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantUnknownAutism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Bipolar disorder (from <a href=https://gene.sfari.org/database/human-gene/CNTNAP2>SFARI GENE</a>)Cntnap2<sup>em1Mcwi</sup>25330101RRID:RGD_25330087The rat strain was produced by injecting CRISPR/Cas9 targeting rat Cntnap2 into Crl:LE embryos. The result is a 1-bp deletion in exon 6 of the gene.25330088LE-<i>Chd8<sup>em1Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantLive Animals; Cryopreserved Sperm (as of 2021-11-03)Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia (from <a href=https://gene.sfari.org/database/human-gene/CHD8>SFARI GENE</a>)Chd8<sup>em1Mcwi</sup>25330100RRID:RGD_25330088The rat strain was produced by injecting the CRISPR/Cas9 system targeting rat Chd8 gene of Crl:LE embryos. The result is a 5-bp deletion in exon 3 of rat Chd8 gene.25330089LE-<i>Nrxn1<sup>em1Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantUnknownAutism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia, Bipolar disorder (from <a href=https://gene.sfari.org/database/human-gene/NRXN1>SFARI GENE</a>)RRID:RGD_25330089The rat strain was produced by injecting CRISPR/Cas9 targeting rat Nrxn1 into Crl:LE embryos. The result is a 4-bp deletion in exon 1.25330091SS-<i>Rictor<sup>em4Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Rictor<sup>em4Mcwi</sup>40818254RRID:RGD_25330091CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene.25330093SD-<i>Mir146b<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownMir146b<sup>em1Mcwi</sup>152600899RRID:RGD_25330093CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b.25394526LE-<i>Dyrk1a<sup>em3Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantUnknownDevelopmental delay, Intellectual disability, Epilepsy (from <a href=https://gene.sfari.org/database/human-gene/DYRK1A>SFARI GENE</a>)RRID:RGD_25394526The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene.25394528SD-<i>Ephx2<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantCryopreserved Sperm (as of 2021-11-03)Ephx2<sup>em2Mcwi</sup>25394529RRID:RGD_25394528CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3.25394530LE-<i>Scn2a<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantLive Animals (as of 2021-11-03)Scn2a<sup>em1Mcwi</sup>25394531RRID:RGD_25394530The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT).25394532LE-<i>Scn2a<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownScn2a<sup>em2Mcwi</sup>25394533RRID:RGD_25394532The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 6-bp deletion in exon 5 of the gene.25824850NHla:SDoutbredUnknownRRID:RGD_25824850The colony history began with a colony of rats established by Robert Dawley around 1925. SD rats are often referred to as "Sprague-Dawley" Mr. Dawley used both his name and the maiden name, "Sprague", of his wife to create the name of the stock. The colony then went to Sprague Dawley, Inc. in 1945. NIH began a closed colony with animals obtained from Sprague Dawley, Inc. Hilltop Lab Animals, Inc. received animals from NIH in 1984. Through cesarean rederivation, the animals were fostered onto gnotobiotic rats in isolation. Descendants of these animals then became the colonies currently available. All colony histories contain some possibility of inaccuracy. This information is provided to the best of Hilltop's knowledge.27095885SS.BN-(<i>D13Hmgc41-D13Rat101</i>)-<i>Ren<sup>em2Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownRen<sup>em2Mcwi</sup>27095886RRID:RGD_27095885This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Rat101)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5.30309956SS.BN-(<i>D13Hmgc41-D13Rat101</i>)/McwiMedical College of Wisconsin, Milwaukee, WisconsincongenicUnknownRRID:RGD_30309956These were generated by crossing SS/JrHsdMcwi with SS-Chr 13<sup>BN</sup>/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain.32716420BDIX.BDIV-<i>D6Rat132-D6Rat229</i>/ZteInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicUnknownRRID:RGD_32716420The BDIX.BDIV-<i>D6Rat132-D6Rat229</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.35668858LEW-Tg(HLA-B*2705m1,B2M)133-1Trg<sup>Tg/0</sup>transgenicUnknownRRID:RGD_35668858This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. The strain carries 12 copies of HLA-B*2705 and 4 copies of the human beta-2-microglobulin gene.35668859W-<i>Gnrh1<sup>tm1(cre)Aeh</sup></i>(1.) Allan Herbison at Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK.; (2.) Vincent Prevot in INSERM, Lille, France.mutantLive Animals (as of 2020-07-09)Neuroendocrinology, Neurobiology, DevelopmentRRID:RGD_35668859This model was generated using zinc finger nuclease (ZFN) method. Cre recombinase was expressed under the control of the endogenous Gnrh1 gene by inserting an internal ribosomal entry site (IRES)-Cre cassette 30bp downstream from the translational stop site of the Gnrh1 open reading frame. This was achieved by pronuclear co-injection of zinc finger nucleases (ATCCACAACATCCGAGTGtgacattGACGCTGAGATCCATGAC; cleavage site in lower case) along with a donor plasmid containing two 800bp homologous arms (HA) flanking IRES-Cre into a one-cell stage rat embryo.35668861LEW-Tg(HLA-B*2705,B2M)<sup>Tg/0</sup>21-3RehtransgenicUnknownRRID:RGD_35668861This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene.35668863LEW-Tg(HLA-B*2705,B2M)21-3Reh<sup>Tg/Tg</sup>transgenicUnknownRRID:RGD_35668863This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 40 copies of HLA-B*2705 and 30 copies of human beta-2-microglobulin gene. Founder 21-3 was selected and carrier animals from this founder were mated and bred to homozygosity.36174030SD-<i>Hamp<sup> em1Jfcol +/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-28)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em1Jfcol </sup>38455987RRID:RGD_36174030Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol +/- (RGD: 36174030) is heterozygous carrying a 169-bp deletion between exons 2 & 3 of rat Hamp gene.36174220SD-<i>Hamp<sup> em1Jfcol -/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em1Jfcol </sup>38455987RRID:RRRC_00907Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol -/- (RGD:36174220) is homozygous carrying the 169-bp deletion between exons 2 & 3 of both rat Hamp alleles.36174221SD-<i>Hamp<sup> em2Jfcol +/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em2Jfcol </sup>38455989RRID:RGD_36174221Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol +/- (RGD:36174221) is heterozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene.36174222SD-<i>Hamp<sup> em2Jfcol -/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em2Jfcol </sup>38455989RRID:RRRC_00909Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol -/- (RGD:36174222) is homozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of both rat Hamp alleles.36174223SD-<i>Hamp<sup> em3Jfcol +/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em3Jfcol </sup>38455990RRID:RGD_36174223Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol +/- (RGD:36174223) is heterozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene.36174224SD-<i>Hamp<sup> em3Jfcol -/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em3Jfcol </sup>38455990RRID:RRRC_00911Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol -/- (RGD:36174224) is homozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of both rat Hamp alleles.36174225SD-<i>Hamp<sup> em4Jfcol +/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em4Jfcol </sup>38455991RRID:RGD_36174225Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol +/- (RGD:36174225) is heterozygous carrying a 15-bp deletion in exon 2 of the rat Hamp gene36174226SD-<i>Hamp<sup> em4Jfcol -/-</sup></i>mutantCryopreserved Sperm (as of 2020-07-29)This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research.Hamp<sup> em4Jfcol </sup>38455991RRID:RRRC_00913Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol -/- (RGD:36174226) is homozygous carrying a 15-bp deletion in exon 2 of both rat Hamp alleles38456008LOU/CInstitut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, FranceinbredUnknownRRID:RGD_38456008Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of immunocytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978).38500209NISAGInstitute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, RussiainbredUnknownRRID:RGD_38500209NISAG were stress-sensitive hypertensive rats that exhibited normal systolic pressure during the first weeks after birth. The development of hypertension in these rats is accompanied by increased sensitivity of the hypothalamic-pituitary-adrenocortical and sympathoadrenal systems to stress.38501059SD-<i>Cp<sup>em1Ang+/+</sup></i>mutantUnknownRRID:RGD_38501059The wild type rats were littermates of cross of heterozygotes Cp mutant rats. The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.38501060SD-<i>Cp<sup>em1Ang+/-</sup></i>mutantUnknownCp<sup>em1Ang</sup>38501062RRID:RGD_38501060The heterozygous Cp mutant rats were created by CRISPR/Cas9. They contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.38501061SD-<i>Cp<sup>em1Ang-/-</sup></i>mutantUnknownCp<sup>em1Ang</sup>38501062RRID:RGD_38501061The homozygous Cp mutant rats are littermates of cross of heterozygotes Cp mutant rats . The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop codon in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39.38501086SD-<i>Bmpr2<sup>em1Ang+/-</sup></i>mutantUnknownBmpr2<sup>em1Ang</sup>38501087RRID:RGD_38501086BMPR2-deficient rats were generated by using zinc-finger nucleases (Sigma, St. Louis, MO). The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates.38508891F344-Tg(Cx3cr1-cre/ERT2)3OttctransgenicUnknownRRID:RGD_38508891The transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter.38508893F344.LE-ROSA26 <sup>em1(LTR-nLuc)Ottc</sup>mutantUnknownRRID:RGD_38508893The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus.38543943SD-<i>Rag2<sup>em1Hera</sup></i>mutantUnknownRRID:RGD_38543943The Rag2 gene in rat spermatogonia stem cells (SSC, SD-WT2) was targeted by TALENs and resulted in a 27-bp in-frame deletion. The genome modified SSC was transplanted to Busulfan-treated, Dazl-deficient male Sprague Dawley rats and mated with wild type female Sprague Dawley rats 70 to 81 later. The allele was then bred to homozygosity to generate the Sprague-Dawley Rag2 (SDR)-knockout rat.38548914SD-<i>Rag1/Rag2<sup>em1Mlit</sup></i>The animal facility at Tongji University (Shanghai, China).mutantUnknownRRID:RGD_38548914The Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2.38548915SD-<i>Il2rg<sup>em1-/y</sup></i>/MlitThe animal facility at Tongji University (Shanghai, China).mutantUnknownRRID:RGD_38548915The Il2rg knock-out rats were obtained by injecting Il2rg-targeting sgRNA into 1-cell embryos. The resulted mutation is 1-bp insertion (A) at 71169012 position. No protein was detected in the spleen of this Il2rg knock out.38548916SD-<i>Rag1/Rag2<sup>em1Mlit</sup>Il2rg<sup>em1Mlit-/y</sup></i>The animal facility at Tongji University (Shanghai, China).mutantUnknownRRID:RGD_38548916The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915).38548927HsdCpb:WUWistar Wu RatoutbredUnknownRRID:RGD_38548927The Wistar rat is selected at the Wistar Institute, Philadelphia, USA, prior to 1910. In 1932, from Wistar Institute to Glaxo Laboratory, UK. In 1933, from Glaxo to the Dutch Institution for Nutrition, Amsterdam. In 1941, the Unilever Company, Vlaardingen, the Netherlands, obtained a breeding stock from Dutch Institution for Nutrition. Thereafter, the Unilever stock was referred as the Wistar Unilever or WU rat. In 1958, transferred from Unilever to TNO Central Institute for the Breeding of Laboratory Animals. To Harlan Laboratories through acquisition in 1986. Harlan became Envigo in 2015.38549341RP/AEurRijHsdinbredUnknownRRID:RGD_38549341Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). To Harlan (?).38549343WKY/NIcoCrlfinbredUnknownRRID:RGD_38549343A substrain of WKY from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France.38549351HXB10/IpcvMcwiMedical College of Wisconsin, Milwaukee, Wisconsinrecombinant_inbredUnknownRRID:RGD_38549351Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, and maintain by Medical College of Wisconsin.38549352SHR/OlaIpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_38549352These are re-derived rats of SHR substrain (SHR/OlaIpcv, RGD:9586450) from Czech Academy of Sciences now maintained at Medical College of Wisconsin.38549353SD-<i>Defb23<sup>em1Mlit</sup></i>School of Life Science and Technology, Tong Ji University, Shanghai, China.mutantUnknownDefb23<sup>em1Mlit</sup>38599011RRID:RGD_38549353CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2.38549354SD-<i>Defb26<sup>em1Mlit</sup></i>School of Life Science and Technology, Tong Ji University, Shanghai, China.mutantUnknownDefb26<sup>em1Mlit</sup>38599012RRID:RGD_38549354CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2.38549355SD-<i>Defb42<sup>em1Mlit</sup></i>School of Life Science and Technology, Tong Ji University, Shanghai, China.mutantUnknownDefb42<sup>em1Mlit</sup>38599013RRID:RGD_38549355CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2.38549356SD-<i>Defb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup></i>School of Life Science and Technology, Tong Ji University, Shanghai, China.mutantUnknownDefb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup>38599014RRID:RGD_38549356CRISPR/Cas9 system was used to generate this double-gene knockout. The Slc:SD zygotes were injected with sgRNAs that containing 4 sgRNAs (5 ng/ml each) targeting 2 adjacent sites (target sites 1 and 2) of each of the 2 genes. The resulting mutations are 317 bp (Defb23) and 380 bp (Defb26) fragments which were deleted in the Defb23/Defb26 double-mutant strain.38549357SD-<i>Defb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup>Defb42<sup>em1Mlit</sup></i>School of Life Science and Technology, Tong Ji University, Shanghai, China.mutantUnknownDefb42<sup>em1Mlit</sup>|Defb23<sup>em2Mlit</sup>Defb26<sup>em2Mlit</sup>38599013|38599014RRID:RGD_38549357CRISPR/Cas9 system was used to generate the Defb23, Defb26 double-gene knockout (RGD:38549356) and Defb42 (RGD:38549355). The triple-KO rats were generated by crossing the heterozygous Defb23/26 mutation rats with the heterozygous Defb42 mutation rats.38549372SD-<i>Eif2ak4<sup>em1</sup></i>mutantUnknownEif2ak4<sup>em1</sup>38599016RRID:RGD_38549372The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4.38596327WI-<i>Tbc1d4<sup>em1Gdcz</sup></i>Unit for Laboratory Animal Medicine, University of Michigan.mutantUnknownTbc1d4<sup>em1</sup>38596330RRID:RGD_38596327The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) .38596339SD-<i>Rarres2<sup>em1Msu</sup></i>Department of Pharmacology and Toxicology, Michigan State University, East Lansing, Michigan, USA.mutantUnknownRarres2<sup>em1Msu</sup>38596341RRID:RGD_38596339Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2.38599146BN-<i>Aire<sup>em1Ang-/-</sup></i>mutantUnknownAire<sup>em1Ang</sup>38599148RRID:RGD_38599146The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG-
39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear
localization signal sequence, causing a premature stop codon.38599147SD.BN-<i>Aire<sup>em1Ang-/-</sup></i>mutantUnknownAire<sup>em1Ang</sup>38599148RRID:RGD_38599147The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG-
39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear
localization signal sequence, causing a premature stop codon.38599152WI-<i>Lpin1<sup>m1Hubr</sup></i>From the Hubrecht Institute-KNAW and University Medical Center Utrecht, 3584 CT Utrecht, The Netherlands,mutantUnknownLpin1<sup>m1Hubr</sup>38599153RRID:RGD_38599152The mutant rats were created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5'-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity.38599155BN-<i>Themis<sup>m1Adej</sup></i>UMR Inserm, U1043, Toulouse, France, UMR CNRS, U5282, Toulouse, France, Universit de Toulouse, UPS, Centre de Physiopathologie de Toulouse Purpan (CPTP), Toulouse, FrancemutantUnknownThemis<sup>m1Adej</sup>38599156RRID:RGD_38599155This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption.38599157F344-<i>Depdc5<sup>em1Kyo+/-</sup></i>mutantUnknownDepdc5<sup>em1Kyo</sup>38599194RRID:RGD_38599157TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5.38599158F344-<i>Depdc5<sup>em2Kyo+/-</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1154> National BioResource Project for the Rat in Japan</a>mutantUnknownDepdc5<sup>em2Kyo</sup>38599195RRID:RGD_38599158TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5.38599187SHRSP.SHR-(<i>D1Mgh5-D1Got87</i>)(<i>D18Rat73-D18Rat11</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1296> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2020-09-14)Hypertension and cerebral apoplexyRRID:RGD_38599187A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University.38599188SHRSP.SHR-(<i>D1Rat23-D1Rat213</i>)(<i>D18Rat73-D18Rat11</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1297> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2020-09-14)Hypertension and cerebral apoplexyRRID:RGD_38599188A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University.38599189F344-<i>Rag2<sup>em1Iexas</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1299> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2020-09-14)immunology/Inflamation and ImmunodeficientRag2<sup>em1Iexas</sup>38599191RRID:RGD_38599189This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition.38599190F344-<i>Il2rg<sup>em1Iexas</sup>Rag2<sup>em1Iexas</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1300> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2020-09-14)severe combined immunodeficiencyIl2rg<sup>em1Iexas</sup>|Rag2<sup>em1Iexas</sup>13464264|38599191RRID:RGD_38599190This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late.38599197W.F344-<i>Lep<sup>m1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=996> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2020-09-14)ObesityLep<sup>m1Kyo</sup>12792963RRID:RGD_38599197This cocngenic strain was made by backcrossing F344-Lepm1Kyo(RGD: 8549776, F344/NSlc rats having an induced mutation in the Lep gene by ENU mutagenesis) to W/Kyo (RGD:1302672).38599201SHRSP.SHR-(<i>D18Rat73-D18Rat8</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1243> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2020-09-15)Hypertension and cerebral apoplexyRRID:RGD_38599201A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm.38599202SHRSP.SHR-(<i>D1Rat23-D1Rat213</i>)(<i>D18Rat73-D18Rat52</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1240> National BioResource Project for the Rat in Japan</a>, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan.congenicCryopreserved Sperm (as of 2020-09-15)Hypertension and cerebral apoplexyRRID:RGD_38599202A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm.38599203LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A/YFP*)2Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1238 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-15)RRID:RGD_38599203The transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 3, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number.38599204LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A/YFP*)1Jfhy<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1237 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-15)RRID:RGD_38599204The transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 1, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number.38599206SHR-<i>Prdx2<sup>em2Izm</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1217> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-15)RRID:RGD_38599206This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 6-bp deletion (5'-CTCCGG-3', c.6_12del6) in the exon2 of Prdx2 gene.
Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT).38599208SHR-<i>Prdx2<sup>em1Izm</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1216> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-15)RRID:RGD_38599208This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion (5'-CTCCGGC-3', c.6_13del7) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT).38599241SD;DA-Tg(Thy1-APP*)1Dspb<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1301> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-16)dementiaRRID:RGD_38599241Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are different among Lines (12>1>14>6).38599242SD;DA-Tg(Thy1-APP*)6Dspb<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1302> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-16)dementiaRRID:RGD_38599242Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6).38599243SD;DA-Tg(Thy1-APP*)12Dspb<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1303> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-16)dementiaRRID:RGD_38599243Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6).38599244SD;DA-Tg(Thy1-APP*)14Dspb<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1304> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-16)dementiaRRID:RGD_38599244Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6).38599245LE-Tg(Tac1-cre)6-7Koba<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1305> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-16)RRID:RGD_38599245Background strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs. This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)6-7Koba are lower than in LE-Tg(Tac1-cre)4-1Koba (RGD:38599247)38599247LE-Tg(Tac1-cre)4-1Koba<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1314> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-16)RRID:RGD_38599247Background strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs.This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)4-1Koba are higher than in LE-Tg(Tac1-cre)6-7Koba (RGD:38599245).38676250F344-<i>Hcn1<sup>em3Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1306> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-16)RRID:RGD_38676250TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 13-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein.38676251F344-<i>Hcn1<sup>em2Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1307> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-16)RRID:RGD_38676251TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 24-bp deletion in the exon4 of Hcn1 gene. It is predicted that 8 amino-acid deleted HCN1 protein is expressed.38676253F344-<i>Hcn1<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1308> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-16)Hcn1<sup>em1Kyo</sup>150429632RRID:RGD_38676253TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein.38676254F344-<i>Pparg<sup>m1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1182> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-16)Pparg<sup>m1Kyo</sup>127285617RRID:RGD_38676254By using ENU mutagenesis followed by MuT-POWER screening of the KURMA (Kyoto University Rat Mutant Archive) samples, the depositors generated a heterozygous PPARg mutant (Ppargmkyo/+) rat with a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg. The PpargG488T homozygous rats are embryonic lethal. Heterozygous Ppargmkyo/+ rats showed reduced fat mass with adipocyte hypertrophy and insulin resistance, which were highly predictable from known actions of Pparg agonists and phenotypes of patients with the PPARG mutation.38676255F344-<i>Hcn1<sup>em4Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1309> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-16)RRID:RGD_38676255TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed.38676310RjHan:SDJanvier Labs, FranceoutbredLive Animals (as of 2020-09-17)RRID:RGD_38676310The outbred strain [Sprague-Dawley] was created by R. W. Dawley in 1925, from a hooded male hybrid of unknown origin and an albino female (probably Wistar), and was crossed with the female's progeny for 7 generations. Janvier Labs received from Zentralinstitut fur Versuchstierzucht (Hannover) in1982.38676445W-Tg(Slc32a1-cre)1_4Fusa<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1310> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-17)RRID:RGD_38676445This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system.38676446W-Tg(Slc32a1-cre)2_5Fusa<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1311> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-17)RRID:RGD_38676446This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system.38676447W-Tg(Slc32a1-cre)5_9Fusa<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1312> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-17)RRID:RGD_38676447This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system.38676448W-<i>Trpa1<sup>em1Kcrd</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1313> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Embryo (as of 2020-09-17)Trpa1<sup>em1Kcrd</sup>38676449RRID:RGD_38676448This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted.38676450F344-<i>Phf24<sup>em2Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1316> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2021-07-01)RRID:RGD_38676450In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation.38676451W-<i>Phf24<sup>em11Iexas</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1317> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-17)RRID:RGD_38676451This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined.38676452W-<i>Phf24<sup>em24Iexas</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1318> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-17)RRID:RGD_38676452This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined.38676453F344; W-<i>Phf24<sup>em6(EGFP)Iexas</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1319> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-17)RRID:RGD_38676453This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc.38676459HHR/HatHirosaki hairless ratDepart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of MedicinemutantUnknownRRID:RGD_38676459Hirosaki hairless rat (HHR) is a mutant strain spontaneously derived from Sprague-Dawley rats, and its inheritance is autosomal recessive. . These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster. HHR attain sexualmaturity at approximately 10 weeks of age and give birth to young but are not able to nurse them.38676461HiSER/HatHirosaki small-eye ratDepart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of MedicinemutantUnknownRRID:RGD_38676461HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1.38676463HHSE/Hat<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1320> National BioResource Project for the Rat in Japan</a>
;Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of MedicinemutantCryopreserved Embryo; Cryopreserved Sperm (as of 2020-09-18)Cryba1<sup>Hiser</sup>38676462RRID:RGD_38676463HHSE/Hat was derived from Hirosaki hairless rat (HHR) and Hirosaki small-eye rat (HiSER), which are Sprague-Dawley rat (SDR)mutant lines. HHR was established in 1984 as a spontaneous mutant of SDR that has been inbred in Department of Biochemistry and Genome Biology Hirosaki University Graduate School of Medicine. Whole body shows hypotrichosis, abnormal differentiation of thymus, and regressed mammary gland in females. These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster and the lectin-like receptor gene Ly49s3. HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat maintained in our course in the same way as HHR/Hat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. The mutations in HHR and HiSER are on different chromosomes and do not affect each other.38676464WIC-<i>Cspg4<sup>em1Kyst</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1321> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-18)RRID:RGD_38676464By CRISPR/Cas9 system, mutation was introduced in <i>Cspg4</i> gene of Wistar-Imamichi rat. 7 bp deletion on Exon1.38676495BN-<i>Lx</i>/CubMcwiBrown Norway with polydactyly-luxate<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>mutantLive Animals; Cryopreserved Embryo (as of 2023-10-24)The Hybrid Rat Diversity PanelRRID:RGD_38676495These are re-derived rats of BN-Lx/Cub now maintained at Medical College of Wisconsin. The parent strain was derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background.39128162WIC-<i>Cspg4<sup>em2Kyst</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1322> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-23)RRID:RGD_39128162By CRISPR/Cas9 system, mutation was introduced in <i>Cspg4</i> gene of Wistar-Imamichi rat. 7 bp deletion on Exon1.39128163WIC-<i>Cspg4<sup>em3Kyst</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1323> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-23)RRID:RGD_39128163By CRISPR/Cas9 system, mutation was introduced in <i>Cspg4</i> gene of Wistar-Imamichi rat. 2 bp insertion on Exon1.39128166WIC-<i>Sparc<sup>em1Kykn</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1324> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-23)RRID:RGD_39128166By CRISPR/Cas9 system, mutation was introduced in Sparc gene of Wistar-Imamichi rat. 7 bp deletion around Exon7.39128167W-Tg(Grp-YFP*)14Hskmt<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1325> National BioResource Project for the Rat in Japan</a>transgenicLive Animals; Cryopreserved Sperm (as of 2020-09-23)RRID:RGD_39128167This strain was generated by microinjecting YFP* (Venus): yellow fluorescent protein variant, which is inserted at downstream of Grp-promoter (4 kb) to Wistar rat zygotes. The number of inserted gene is approximately 100 copy.39128170SHRSP-<i>Stim1<sup>em1Izm</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1326> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2020-09-23)RRID:RGD_39128170"This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence.
The sequence of the guide RNA target site is as follows,
Stim1: 5'-GCAGGGTAGCTGAAACACAC-3'
The sequence of the ssODN for homologous recombination is as follows,
5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'"39128171LE-Tg(Pvalb-cre)2-28Koba<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1261> National BioResource Project for the Rat in Japan</a>mutantLive Animals; Cryopreserved Sperm (as of 2020-09-23)RRID:RGD_39128171This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs.39128172W-Tg(Slc32a1-cre)3_5Fusa<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1248> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2020-09-23)RRID:RGD_39128172This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT(Slc32a1: mouse, Kanamycin resistance gene(E. coli), Cre(P1 phage), polyA signal(SV40 virus). Mouse BAC clone: RP23-392-P1139128239GK/CskCrljinbredUnknownRRID:RGD_39128239The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995.39128242SD-<i>Vwf<sup>em1Mcwi-/-</sup></i>MCW Gene Editing Rat Resource Center, through Versiti Blood Research InstitutemutantCryopreserved Sperm (as of 2020-10-09)Vwf<sup>em1Mcwi</sup>39457948RRID:RGD_39128242CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon.39131285SD-Tg(DIO-mCherry)2Ottc<a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>transgenicUnknownRRID:RGD_39131285This Cre recombinase reporter rat expressing mCherry was generated by backcrossing Sprague-Dawley to LE-Tg(DIO-mCherry)2Ottc (RGD:8693598).
The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter.39456105F344/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_39456105F344/StmMcwi was redelivered from F344/Stm which was derived from F344/DuCrlj.39456107LE/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_39456107The LE/StmMcwi was rederived from LE/Stm and maintained at Medical College of Wisconsin. The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50.39456108SD-<i>Trpv4<sup>em1Sage</sup></i>mutantUnknownTrpv4<sup>em1Sage</sup>39456109RRID:RGD_39456108TRPV4 gene?specific zinc finger constructs directed against exon 13, containing the coding sequence for part of TM5, the pore region, and TM6, were injected in zygotes from Sprague-Dawley rats. An animal with an 899 bp deletion in the TRPV4 gene was selected as a founder for further breeding. This deletion completely removes exon 13, plus parts of intron 12-13 and intron 13-14 .39457682LCR-mt<sup>HCR</sup>/TolUniversity of Toledo College of Medicine and Life Sciences, Toledo, OH 43614conplasticUnknownRRID:RGD_39457682Mitochodrial genome of LCR/ was selectively replaced by HCR to create this conplastic strain; these have the mitochondrial genome of HCRl on LCR nuclear genetic background39457683HCR-mt<sup>LCR</sup>/TolUniversity of Toledo College of Medicine
and Life Sciences, Toledo, OH 43614conplasticUnknownRRID:RGD_39457683Mitochodrial genome of HCR/ was selectively replaced by LCR to create this conplastic strain; these have the mitochondrial genome of LCRl on HCR nuclear genetic background39457699LCR/TolLow-capacity runnersUniversity of Toledo College of Medicine and Life Sciences, Toledo, Ohio.inbredUnknownRRID:RGD_39457699Artificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for low capacity based on distance run to exhaustion on a motorized treadmill.39457701HCR/TolHigh-capacity runnersUniversity of Toledo College of Medicine and Life Sciences, Toledo, Ohio.inbredUnknownRRID:RGD_39457701Artificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for high capacity based on distance run to exhaustion on a motorized treadmill.39457945WI-<i> Lpar1<sup>m1Hubr</sup></i>Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic.mutantUnknownLpar1<sup>m1Hubr</sup>126848739RRID:RGD_39457945The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. The founder animal was mated with wild type Msh6 females. The Msh6 mutated allele was eliminated by systematic selection of F2.39457947SD-<i>Bckdk<sup>m1Dbsa</i></sup>Spring Valley Laboratories, Inc (Woodbine,MD)mutantUnknownRRID:RGD_39457947The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk.39457950SD-<i>Ngly1<sup>em1Ta-/-</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1164> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2021-07-22)Ngly1<sup>em1Ta</sup>149735565RRID:RGD_39457950The homozygous Ngly1 mutant rats are littermates of cross of heterozygotesNgly1 mutant rats . The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. By the time of deposition, this strain was crossed twice to Crl:CD (SD). "Homozygous rats are obtained by crossing between heterozygous rats.
Maintain the strain by crossing between heterozygous rats or by backcrossing to Crl:CD (SD) rats.
Homozygous rats, both females and males, have no record of pregnancy and reproduction. They are more likely to be infertile."40818253LE-<i>Dyrk1a<sup>em1Mcwi</sup></i>Generated with support from the Simons Foundation Autism Research Initiative (<a href=https://www.sfari.org/resource/rat-models/>SFARI</a>); MCW Gene Editing Rat Resource CentermutantUnknownRRID:RGD_40818253The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 14-bp deletion in exon 340818401M520/NRrrcMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_40818401To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. It was then sent to Rat Resource and Research Center (RRRC). Medical College of Wisconsin received live animals from cryo-resuscitated pairs at RRRC in 2009.40924649Beta IIMSchool of Medicine at Rosario, ArgentinainbredUnknownRRID:RGD_40924649Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' were separated in 1958 and raised at the School of Medicine at Rosario. In 1976, some degree of overweight was found in the original 'b' group and in 1980, the obesity group was identified as Beta line.40924650Alpha IIMSchool of Medicine at Rosario, ArgentinainbredUnknownRRID:RGD_40924650Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' and 'alpha' were separated in 1958 and 1972 respectively and raised at the School of Medicine at Rosario. This line alpha (Alpha IIM) ), obtained from the F1 'a' X 'd', was used as control for the obese Beta line (RGD:40924649).40924656BN.ZUC-<i>Lepr<sup>fa</sup></i>mutantUnknown (as of 2021-01-19)Lepr<sup>fa</sup>13432153RRID:RGD_40924656Established as congenics by introducing fa from 13M/Vc to BN/Crl40924661LA-<i>cp</i>/NRllmutantUnknownLepr<sup>cp</sup>11570565RRID:RGD_40924661This corpulent rat used by Rudolph L Leibel's laboratory was developed at the National Institutes of Health (NIH). It was a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. This congenic carrying the recessive Leprcp (RGD:11570565) identified in in the obese spontaneously hypertensive Koletsky rat.41404646SD-<i>Lrp5<sup>em1Vari</sup></i>mutantUnknownLrp5<sup>em1Vari</sup>41404647RRID:RGD_41404646CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos.41404648SD-<i>Lrp5<sup>em2Vari</sup></i>mutantUnknownLrp5<sup>em2Vari</sup>41404650RRID:RGD_41404648CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos.41404651SD-<i>Lrp5<sup>em3Vari</sup></i>mutantUnknownLrp5<sup>em3Vari</sup>41404652RRID:RGD_41404651CRISPR/Cas9 system was used to introduce an
inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos.41404660GK/JpeCenter for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, PortugalinbredUnknownRRID:RGD_41404660The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s,41404661W/JpeCenter for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, PortugalinbredUnknownRRID:RGD_41404661Inbred Wistar rats maintained at Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal41404705SD-<i>Shank3<sup>em1Bux</sup></i>mutantUnknownShank3<sup>em1Bux</sup>41404706RRID:RGD_41404705The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon.41404723DA.W-<i>Ncf1<sup>W</sup></i>/RhdSection for Medical Inflammation Research, Lund University, Lund, Sweden.congenicUnknownNcf1<sup>W</sup>41404724RRID:RGD_41404723The Wistar Ncf1 (Ncf1W) allele was backcrossed to the DA background for 10 generations41408337DA.F344-Dpp4<sup>DPPIV</sup>/SvHHannover Medical School, Hannover, GermanymutantUnknownDpp4<sup>DPPIV</sup>12792942RRID:RGD_41408337Generation of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient
congenic DA strain is maintained via brother=sister mating41408339WI.SD-<i>Pclo<sup>Tn(sb-B-Geo)Fkh</sup></i>University of Texas Southwestern Medical Center, Dallas TXmutantUnknownPclo<sup>Tn(sb-B-Geo)Fkh</sup>41408340RRID:RGD_41408339The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame.41410881WI-<i>Grm2<sup>em1</sup></i>Transposagen BiopharmaceuticalmutantUnknownGrm2<sup>em1</sup>41410882RRID:RGD_41410881This mutant rat strain was produced by Transposagen Biopharmaceutical and available in mGluR2+/- breeding pairs. The genome modification created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional.41412170BBDR/RhwMcwiMedical College of Wisconsin, Milwaukee WIinbredUnknownRRID:RGD_41412170This strain was given to Medical College of Wisconsin by Ake Lernmark and maintained there.41412172BBDR.BBDP-(<i>D4Mit6-D4Mit24</i>)/RhwMcwiMedical College of Wisconsin, Milwaukee, WI, USAcongenicUnknownRRID:RGD_41412172The lymphopenia locus from diabetic proned BBDP rat was transferred onto the genome of diabetic-resistant BB rat by marker-assisted selection in nine cycles of cross-intercross breeding. This congenic strain from Ake Lernmark, Laboratory, University of Washington, Seattle, Washington to Medical College of Wisconsin.41412186BBDP/WorinbredUnknownRRID:RGD_41412186Diabetic prone BB rats. The Biobreeding rats (BB) spontaneously developed autoimmune diabetes mellitus were found in a closed colony of outbred WI (Wistar) rats at the Bio-Breeding Laboratories, Ottawa, Ontario in 1974. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center
(laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and and 2 strains were produced: disease prone (DP) and disease resistant (DR) by selected progenies were diabetic (DP) or remained diabtes free (DR).41457452WI-<i>Prdm14<sup>em10Nips</sup></i>mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24)Prdm14<sup>em10Nips</sup>41457453RRID:RGD_41457452Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype.42721973LEW/SsNArcinbredUnknownRRID:RGD_42721973This strain is now maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The LEW rats were received from National Institutes of Health, Bethesda MD, USA.42721974LEW-<i>Nek8<sup>lpk</sup></i>/ArcmutantUnknownNek8<sup>lpkArc</sup>42721975RRID:RGD_42721974The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene.42721977SD-<i>Pde6b<sup>em1Baek</sup></i>Asan Institute for Life Sciences, University of Ulsan College of Medicine, Asan Medical Center, Seoul, Republic of KoreamutantUnknownPde6b<sup>em1Baek</sup>42721979RRID:RGD_42721977Cpf1 mRNA (50 ng per uL) and CRISPR RNA (100 ng per uL) were co-microinjected into the cytoplasm of pronuclear stage embryos; surviving embryos were transplanted into the oviducts of pseudo-pregnant surrogate mothers to generate live animals. A Pde6b-mutant rat line with an 11-bp deletion in exon 1 was established. Western blot analysis confirmed deficiency of Pde6b protein in the homozygous mutant retina, indicating successful generation of Pde6b-deficient rats with Cpf1-mediated gene targeting.42722004F344-Tg(HIV)1HsdtransgenicUnknownRRID:RGD_42722004Noninfectious clone containing gag-pol-deleted HIV-1 provirus under the viral LTR promoter was microinjected into fertilized one-cell Sprague�Dawley � Fisher 344/NHsd F1. Female founder with opaque cataracts was mating with wil-type Fischer 344/NHsd.
Tg rats from line 1 contained 20�25 copies.45073130SD-<i>Fmr1<sup>em1Mzhe</sup></i>The laboratory animal center of Peking University.mutantUnknownFmr1<sup>em1Mzhe</sup>124715480RRID:RGD_45073130The CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of the rat Fmr1 gene of outbred Sprague-
Dawley embryos. The resulting mutation is a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification results in a frame-shift starting from the second Agenet-like 2 domain in the Fmr1 protein.45073133SD-<i>Pon1<sup>em1Lizh</sup></i>Institute of Laboratory Animal Science of Peking Union Medical CollegemutantUnknownPon1<sup>em1Lizh</sup>124715481RRID:RGD_45073133CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague-
Dawley embryos. The destruction of Pon1 gene caused the absence of the the expression of Pon1 mRNA, protein in liver, spleen and thymus in the Pon1 homozygous knock-out rat.53621137SD-Tg(Wnt1-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2024-01-10)RRID:RRRC_00868The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT256677892SD-Tg(GFAP-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2024-01-05)RRID:RRRC_00876The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent.58366897SD-Tg(Tie2-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2024-01-10)RRID:RRRC_00877The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2124713544W-<i>Cyp27b1<sup>em1Thka</sup></i>mutantUnknownCyp27b1<sup>em1Thka</sup>124713545RRID:RGD_124713544This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes.124713546W-<i>Vdr<sup>em1Thka</sup></i>mutantUnknownVdr<sup>em1Thka</sup>124713547RRID:RGD_124713546This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array
near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr (R270L) rats for analysis were fed an F-2 formula diet (Oriental Yeast
Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2
diet partially reversed their rickets symptoms. Homozygotes Vdr(R270L mutants were maintained bymating of heterozygotes.124713548W-<i>Vdr<sup>em2Thka</sup></i>mutantUnknownVdr<sup>em2Thka</sup>124713550RRID:RGD_124713548This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array
near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes.125093746SD-<i>Disc1<sup>em1Rst</sup></i>University of Wisconsin-Madison School of Medicine and Public HealthmutantUnknownDisc1<sup>em1Rst</sup>125093747RRID:RGD_125093746CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation.125097486SD-<i>Nr3c1<sup>em1Kuan</sup></i>Department Pharmacology and Systems Physiology, University of Cincinnati, Cincinnati, United StatesmutantUnknownNr3c1<sup>em1Kuan</sup>125097487RRID:RGD_125097486The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. The LoxP sequences were inserted in the 5prime and 3prime sides of exon 3. For CaMKIIa cell-specific knockdown, 0.1 ul of AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40 (CaMKIIa Cre) [Penn Vector Core] was injected bilaterally and allowed a minimal of 3 weeks to incubate.125097491WI;WDB-<i>Prdm14<sup>tm1(H2BVenus)Nips</sup></i>mutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Prdm14<sup>tm1(H2BVenus)Nips</sup>126781696RRID:RGD_125097491Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation . Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats.
Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype.125097492WI-<i>Sall1<sup>em1Nips</sup></i>mutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Sall1<sup>em1Nips</sup>126781694RRID:RGD_125097492Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1.125097494WI;WDB-<i>Sall1<sup>tm4(tdTomato)Nips</sup></i>mutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Sall1<sup>tm4(tdTomato)Nips</sup>126781695RRID:RGD_125097494Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation.Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats..These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1.125097496Iar:WICIar:Wistar-Imamichi<a href=http://www.iar.or.jp/gp_rat/wi_rat/index.html> Institute for Animal Reproduction in Japan</a>outbredUnknownMetabolism; DevelopmentRRID:RGD_125097496125097497WIC;WI;WDB-<i>Kiss1<sup>tm8Nips</sup></i>Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan, National Institute for Physiological Sciences, Okazaki Aichi, JAPANmutantLive Animals; Cryopreserved Embryo (as of 2021-04-01)Kiss1<sup>tm8Nips</sup>126781693RRID:RGD_125097497This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination. Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Iar:Wistar-Imamichi rats to produce heterozygous founder rats. This rat strain is being maintained by crossing the founder rat with Iar:Wistar-Imamichi rats.126777684WI-<i>Mkx<sup>em1Asah</sup></i>mutantUnknownMkx<sup>em1Asah</sup>126777685RRID:RGD_126777684The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 14- bp deletion causing frameshift mutation in the gene.126777687WKY-<i>Dnd1<sup>ter</sup></i>/ZtmInstitute for Laboratory Animal Science, Hannover Medical School (MHH), GermanymutantUnknownDnd1<sup>ter</sup>150340622RRID:RGD_126777687A spontaneous mutation (ter) leading to the formation of congenital ovarian and testicular tumors was detected in the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. This recessive ter mutation has a complete penetrance of teratocarcinogenesis and infertility of both sexes in homozygous genotype.126779578LOU/MWslExperimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs 30.56 Bruxelles 1200
BELGIUMinbredUnknownRRID:RGD_126779578A substrain of LOU/M maintained in the laboratory of Dr. H. Bazin at Universite de Louvain.126779586SD-<i>Csf1r<sup>tm(EGFP)+/-</sup></i>/TsetUniversity of Edinburgh, United KingdommutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692RRID:RGD_126779586Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients126779587DA-<i>Csf1r<sup>tm(EGFP)+/-</sup></i>/HumeDepartment of Microbiology, University of Queensland, Brisbane, Queensland 4072
AustraliamutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692RRID:RGD_126779587Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia.126779591SD-<i>Csf1r<sup>tm(EGFP)-/-</sup></i>/TsetUniversity of Edinburgh, United KingdommutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692RRID:RGD_126779591Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. The homozygotes were obtained by crossing of heterozygotes.126779592DA-<i>Csf1r<sup>tm(EGFP)-/-</sup></i>/HumeDepartment of Microbiology, University of Queensland, Brisbane, Queensland 4072
AustraliamutantUnknownCsf1r<sup>tm(EGFP)Tset</sup>126781692RRID:RGD_126779592Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. The homozygotes were obtained by crossing of heterozygotes126781838SD-Tg(PDGFB-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2024-01-10)RRID:RRRC_00869The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent.126781839SD-Tg(Olfr16-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2024-01-05)RRID:RRRC_00870The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent.126781841SD-Tg(Mnx1-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryorecovery (as of 2024-01-10)RRID:RRRC_00872The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2126781842SD-Tg(Drd1-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryorecovery (as of 2024-01-05)RRID:RRRC_00873The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neurons126781843SD-Tg(Gad1-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryorecovery (as of 2024-01-05)RRID:RRRC_00874The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes.126781844SD-Tg(SMHC-cre/ERT2)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2024-01-04)RRID:RRRC_00878This mutant strain was created by injecting embryos from 'docking site ready (DSR)' rat strains. The DSR rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. The DSR embryos were microinjected with integrase, a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, and a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The vascular smooth muscle tissue-specific expression of a CreERT2 is tamoxifen-dependent."126781845SD-Tg(CAG-GFP-LacZ)AppscRrrcApplied StemCell, Inc., Milpitas, CA, USAtransgenicUnknownRRID:RRRC_00879A transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 line126790464SD-<i>Ube3a<sup>em1Jue</sup></i>mutantUnknownUbe3a<sup>em1Jue</sup>126790465RRID:RGD_126790464The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos and inserted
into a surrogate. Two genomic RNAs (gRNAs) were designed to target the 5ʹ-end of the Ube3a gene (upstream of the Ube3a coding sequence) and two gRNAs target sequences downstream of Ube3a. gRNA pairs were used on each end of the deletion to maximize the probability of a complete deletion of the 90-kb region encompassing the Ube3a gene. The 90 kb deletion in Ube3a was confirmed by genome sequencing. Only pups with maternal inheritance of the deletion carried traits for model of Angleman Syndrome.126790469F344.Cg-<i>Foxn1<sup>rnu-/-</sup></i>/Jcl<a href =https://www.clea-japan.com/en/products/immunodeficiency/item_a0020> CLEA Japan, Inc</a>congenicLive Animals (as of 2021-04-22)Immuno deficiencyRRID:RGD_126790469This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats.126790472F344.Cg-<i>Foxn1<sup>rnu-/+</sup></i>/Jcl<a href =https://www.clea-japan.com/en/products/immunodeficiency/item_a0020> CLEA Japan, Inc</a>congenicLive Animals (as of 2021-04-22)Immuno deficiencyRRID:RGD_126790472This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the <i>Foxn1<sup>rnu</sup></i> was transferred. Originally, hairless mutant (<i>rnu</i>) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats.126790496SD-<i>Shank2<sup>em13Sage</sup></i>mutantUnknownShank2<sup>em13Sage</sup>126790499RRID:RGD_126790496The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA126790511Jcl:WISToutbredLive Animals (as of 2021-04-23)RRID:RGD_126790511CLEA Japan, Inc., Taconic Farms Inc. (USA), and Taconic Europe (Denmark) created the Global Alliance for Laboratory Animal Standardization (GALASTM) agreement in collaboration with the Central Institute for Experimental Animals to promote the international standardization of outbred stocks usable for safety testing in the field of toxicity and pharmacology. Based on these activities,Wistar Hannover GALAS rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.). At and after the end of 1998, RCC Ltd. gave more than 50 pairs of pedigreed BrlHan:WIST rats to each GALAS member to use as seed rats for the Wistar Hannover GALAS strain.126790547SD-<i>Rin1<sup>em1-/-Hcz</sup></i>Department of Histology and Embryology, Basic Medical College, China Medical University, Shenyang 110122, ChinamutantUnknownRin1<sup>em1Hcz</sup>126790548RRID:RGD_126790547This strain was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene.126848737WI-<i> Msh6<sup>m1Hubr</sup></i>Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic.mutantUnknownMsh6<sup>m1Hubr</sup>126848738RRID:RGD_126848737The Msh6 knockout mutant rat line was generated by target-selected ENU-driven mutagenesis on Crl:WI rats. The founder rat carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene was bred to obtain homozygous animals.126848740SDT.Cg-<i>Lepr<sup>fa</sup></i>/JttJclSDT fatty<a href =https://www.clea-japan.com/en/products/diabetes/item_a0150> CLEA Japan, Inc</a>congenicLive Animals (as of 2021-05-06)RRID:RGD_126848740<i>Lepr<sup>fa</sup></i> allele from ZDF was introgressed into SDT rats using the speed congenic method. The newly establised congenic strain of a SDT rat for Leprfa was maintained by intercross between fa-heterozygous littermates in Japan CLEA Inc.126848751RCS-<i>Mertk<sup>rdy</sup>p</i>/LavJcl<a href =https://www.clea-japan.com/dcms_media/other/p0020_RCSRat.pdf> CLEA Japan, Inc</a>congenicLive Animals (as of 2021-04-28)Mertk<sup><i>rdy</i></sup>40902839RRID:RGD_126848751This strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for a deletion in the Mertk gene.126848763ODS-<i>Gulo<sup>od+/+</sup>/ShiJclOsteogenic disorder Shionagi rat, wild type<a href =https://www.clea-japan.com/en/products/other_disease/item_a0250> CLEA Japan, Inc</a>inbredLive Animals (as of 2021-04-29)RRID:RGD_126848763This is the wild type control for ODS-Gulood/od/ShiJcl (RGD:4140404) . Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females.126848776RCS-<i>Mertk<sup>rdy+</sup>p</i>/LavJcl<a href =https://www.clea-japan.com/dcms_media/other/p0020_RCSRat.pdf> CLEA Japan, Inc</a>congenicLive Animals (as of 2021-04-30)RRID:RGD_126848776This strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for wild type Mertk gene.126848777SD-Tg(HRAS)128NccJcl<a href =https://www.clea-japan.com/en/products/genetically_modified/item_a0203> CLEA Japan, Inc</a>transgenicLive Animals (as of 2021-04-30)RRID:RGD_126848777Hras128 is a transgenic rat, introduced human proto-type c-Ha-ras gene to Jcl:SD rat fertilized egg by Dr. Hiroyuki Tsuda, Natl. Cancer Center, in 1998. The strain has been kept by CLEA Japan from its creation and supplied to the related research organization after concluded an agreement with Natl. Cancer Center and Japan Science and Technology Agency (JST). This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region.126848778SD-Tg(CAG-KRAS*G12V)301Jcl<a href =https://www.clea-japan.com/en/products/genetically_modified/item_a0206> CLEA Japan, Inc</a>transgenicLive Animals (as of 2021-04-30)OncologyRRID:RGD_126848778The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-Kras*G12V (KrasV12) was injected into embryos of SD rat (RGD:8547938). This strain was generated at CLEA Japan,Inc. This strain is introduced 3 copies of hemagglutinin (HA) epitope tag connected HA-K-rasv12 gene expression cassette by using Cre/loxP system for controlling term/location expression of human mutated form K-rasv12 gene (changing glycine to valine at the 12 amino acid sequence) that normally floxed rat does not express K-rasv12 gene.126848793SS-<i>Gper1<sup>em1Bj-/-</sup></i>University of Toledo College of Medicine and life Sciences OHmutantUnknownGper1<sup>em1Bj</sup>151347865RRID:RGD_126848793CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. RNA validation performed via deletion
PCR using a sense primer at the 5' end and an antisense primer at the 3' end showed a deletion PCR product of 544
bps versus wild-type PCR product of 1484 bps. The homozygous founders had complete deletion of Gper1 was confirmed by DNA sequenching.126848794SHR-<i>Zbtb16<sup>em1Ipcv+/-</i></sup>Institute of Biology and Medical Genetics, Charles University, PraguemutantUnknownZbtb16<sup>em1Ipcv</sup>150340624RRID:RGD_126848794TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. The founder was bred with SHR to generate more heterozygous animals. The homozygous animals die perinatally because of multiple developmental abnormalities.126848804F344-<i>Trpc4<sup>Tn(sb)1Bni</sup></i>Laboratorium voor Fysiologie, Campus Gasthuisberg, KU Leuven, B-3000 Leuven
BelgiummutantUnknownTrpc4<sup>Tn(sb)Tngen</sup>126848808RRID:RGD_126848804The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. Trpc4 knock-out (510 bp) and wild-type allele (905 bp) were confirmed using PCR and gel electrophoresis126908010SD-<i>Kcnk3<sup>em1Ang-/-</sup></i>mutantUnknownKcnk3<sup>em1Ang</sup>126908015RRID:RGD_126908010The homozygous Kcnk3 mutant rats are littermates of cross of heterozygotesKcnk3 mutant rats . The mutation created by CRISPR/Cas9 contained a 94- bp deletion in exon1 of resulted a premature stop codon.126908013SD-<i>Kcnk3<sup>em1Ang-/+</sup></i>mutantUnknownKcnk3<sup>em1Ang</sup>126908015RRID:RGD_126908013The heterozygous Kcnk3 mutant rats were created by CRISPR/Cas9. The mutated allele contained a 94- bp deletion in exon1 of resulted a premature stop codon.126925134SD-<i>Il36rn<sup>tm1(Myh6-cre)Mhzh</sup></i>Nanjing University Model Animal Center.mutantUnknownIl36rn<sup>tm1(Myh6-cre)Mhzh</sup>126925161RRID:RGD_126925134This line was produced by mating rats carrying Il36rnf/f allele and Myh6-cre-allele. The expression of Il36rn was knockout in cardiomyocytes.126925135SD-<i>Il1rl2<sup>tm1(Myh6-cre)Mhzh</sup></i>Nanjing University Model Animal Center.mutantUnknownIl1rl2<sup>tm1(Myh6-cre)Mhzh</sup>126925159RRID:RGD_126925135This line was produced by mating rats carrying IIl1rl2f/f allele and Myh6-cre-allele. The expression of Il1rl2 was knockout in cardiomyocytes.126925136SD-<i>Mstn<sup>em1Cqin</sup></i>mutantUnknownMstn<sup>em1Cqin</sup>151347430RRID:RGD_126925136ZFN constructs were designed to target the genomic region of rat Mstn exon 1. A ZFN construct engineered to target bp 277 to 281 of rat Mstn was used for the rat embryo injection. The # 6 founder was found to have sequence changed from GATCA to AGTC, resulting in a frame shift mutation within the open reading frame and generate an early termination codon, resulting in a truncated 109 amino acid peptide (wild type is 376). ZFN mutant founders were backcrossed to Spargue Dawley rats to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.126925137SD-<i>Ogdh<sup>em1Yuyi</sup></i>Laboratory Animal Center of Zhengzhou universitymutantUnknownOgdh<sup>em1Yuyi</sup>126925168RRID:RGD_126925137The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. No homozygous rats were obtained from mating of heterozygotes that suggests embryonic lethal for the homozygotic mutant.126925138SD-<i>Ubd<sup>em1</sup></i>Department of Cardiovascular Medicine, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006mutantUnknownUbd<sup>em1</sup>126925166RRID:RGD_126925138This Ubd (FAT10) knockout rat strain was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd.126925139SD-<i>Dnmt1<sup>tm1(Myh6-cre)Cqin</sup></i>Beijing Engineering Research Center for Experimental Animal Models of Human Diseases, Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College (ZLF18003), Beijing, ChinamutantUnknownDnmt1<sup>tm1(Myh6-cre)Cqin</sup>126925165RRID:RGD_126925139To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats126925196F344-<i>Slc6a3<sup>m1Span</sup></i>Central Institute of Mental Health
Department of Psychopharmacology
Central Institute of Mental Health
Mannheim,mutantUnknownSlc6a3<sup>m1Span</sup>126925197RRID:RGD_126925196This strain was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence.126925212WI-<i> Drd1<sup>m1Hubr</sup></i>Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands.mutantUnknownDrd1<sup>m1Hubr</sup>126925213RRID:RGD_126925212The Drd1 mutant rat line was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein.126925756SD-<i>Cryba1<sup>Nuc1Dbsa</sup></i>The Johns Hopkins University School of Medicine
The Wilmer Eye Institute
The Johns Hopkins University School of Medicine
BaltimoremutantUnknownCryba1<sup>Nuc1Dbsa</sup>126925758RRID:RGD_126925756This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1.126925949SD-<i>Myh7b<sup>em1Blar+/-</sup></i>Beijing Laboratory
Animal Research Center of Chinese Academy of
Medical Sciences.mutantUnknownMyh7b<sup>em1Blar</sup>126925953RRID:RGD_126925949The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was
approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.126925952SD-<i>Myh7b<sup>em1Blar-/-</sup></i>Beijing Laboratory
Animal Research Center of Chinese Academy of
Medical Sciences.mutantUnknownMyh7b<sup>em1Blar</sup>126925953RRID:RGD_126925952The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was
approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.126925978SD-<i>Ercc6<sup>em1Cgen</sup></i>Key Laboratory of Neurological Function and Health, School of Basic Medical Science, Guangzhou Medical University, Guangzhou 511436, China.mutantUnknownErcc6<sup>em1Cgen</sup>126925980RRID:RGD_126925978The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA). A silent mutation (ACC to ACG) was also introduced to prevent the binding and re-cutting of the sequence by gRNA after HDR. Founder animals harboring the expected single-nucleotide substitution were bred to produce heterozygous and homozygous rats.The heterozygous rats had phenotypes similar to the wild type littermates.126925992SD-<i>Cftr<sup>em1Ang</sup></i>mutantUnknownCftr<sup>em1Ang</sup>126925993RRID:RGD_126925992The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification.126925994SD-<i>Cftr<sup>em2Ang</sup></i>INSERM 1151 INEM Universit? de Paris Paris France.mutantUnknownCftr<sup>em2Ang</sup>126925995RRID:RGD_126925994The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon. Two knockout founders ( referred as MUKORAT8.3 and MUKORAT 6.4) exhibit no difference in phenotypes and were pooled for study.126928141SD-<i>F8<sup>em1Sage</sup></i>/Novo-Tg(ITGA2B-F8*)McwiBlood Research Institute
8733 W Watertown Plank Road
Milwaukee, WI 53226transgenicUnknownF8<i><sup>em1Sage</sup></i>11531096RRID:RGD_126928141This transgenic was produced by crossing the SD transgenic rat carrying Lentivirus constructs containing the 2bF8 vector [B-domain deleted human FVIII under control of ITGA2B (IIb) promoter] with an F8 knockout rat SD-F8em1Sage-/-/Novo (RGD:11531091). This transgenic rat strain expressed B-domain deleted human F8 under the control of ITGA2B promoter in the absence of rat F8 product.126928146ACI.Cg.-<i>Cdkn1b<sup>em1Musc</sup></i>Transgenic and Gene Function Core, Medical University of South Carolina, Charleston, South Carolina, United States of AmericamutantUnknownCdkn1b<sup>em1Musc</sup>126928147RRID:RGD_126928146The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-<i>Cdkn1b<sup>em1Musc</sup></i> harbors 32-bp deletion of Cdkn1b exhibits same phenotype as the em4Musc with 65-bp deletion126928150ACI.Cg.-<i>Cdkn1b<sup>em4Musc</sup></i>Transgenic and Gene Function Core, Medical University of South Carolina, Charleston, South Carolina, United States of AmericamutantUnknownCdkn1b<sup>em4Musc</sup>126928151RRID:RGD_126928150The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-<i>Cdkn1b<sup>em4Musc</sup></i> harbors 65-bp deletion of Cdkn1b exhibits same phenotype as the em1Musc with 32-bp deletion127284837GK/WnsmUniversity of Wales College of Medicine (Cardiff, UK)inbredUnknownRRID:RGD_127284837The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations. This GK/Wnsm colony was established at the University of Wales College of Medicine (Cardiff, UK) after received breeding
pairs provided by Professor Y Goto (Tohoku University School of Medicine, Sendai, Japan).127284865F344-<i>Nppc<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/nbr> National BioResource Project for the Rat in Japan</a>mutantUnknownNppc<sup>em1Kyo</sup>127284866RRID:RGD_127284865This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em1Kyo</sup></i> strain ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1).127284868F344-<i>Nppc<sup>em2Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/nbr> National BioResource Project for the Rat in Japan</a>mutantUnknownNppc<sup>em2Kyo</sup>127284869RRID:RGD_127284868This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em2Kyo</sup></i> strain ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194,
NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc127284870F344-<i>Nppc<sup>em3Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/nbr> National BioResource Project for the Rat in Japan</a>mutantUnknownNppc<sup>em3Kyo</sup>127284871RRID:RGD_127284870This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em3Kyo</sup></i> strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1)127284872F344-<i>Nppc<sup>em4Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/nbr> National BioResource Project for the Rat in Japan</a>mutantUnknownNppc<sup>em4Kyo</sup>127284873RRID:RGD_127284872This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C
(target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-<i>Nppc<sup>em4Kyo</sup></i> strain ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats.127284883SD-<i>Aqp4<sup>em1Hrt</sup></i>Department of Anatomy and Histology, School of Basic Medical Sciences, Peking University, Beijing, ChinamutantUnknownAqp4<sup>em1Hrt</sup>127284884RRID:RGD_127284883The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate Aqp4-deficient rats. The synthesized TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. The founder animal lacking three base pairs was crossed with wild-type rat to produced the F1 generration and the heterozygous offspring of F1 were corssed to produce mutant strains and confirmed by sequencing analysis of PCR products of modified genome region.127285380SD-<i>Mir31<sup>em1Sage</sup></i>Department of Cancer Biology and Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, OH 43210;mutantUnknownRRID:RGD_127285380CRISPR/Cas9 system was used to introduce the gene knockout of Mir31 in the Sprague Dawley embryos.127285404SHR-<i>Cfb<sup>em1Tja</sup></i>Centre for Genomic and Experimental Medicine, MRC Institute for Genetics and Molecular Medicine, Edinburgh, United KingdommutantUnknownCfb<sup>em1Tja</sup>127285405RRID:RGD_127285404This strain was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion.127285409SD-<i>Abcc8<sup>em1Cgen</sup></i>mutantUnknownAbcc8<sup>em1Cgen</sup>127285598RRID:RGD_127285409TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This strain carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats is homozygous. No Abcc8 protein was detected in the liver and muscle tissues.127285661SD-<i>Adgrl3<sup>em1Huyc</sup></i>Department of Pediatrics, University of Cincinnati College of Medicine, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OHmutantUnknownAdgrl3<sup>em1Huyc</sup>127285662RRID:RGD_127285661The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs
targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three
primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp.127285810SD-<i>Trpa1<sup>em1Gne</sup></i>Department of Neuroscience, Genentech, 1 DNA Way, South San Francisco, CA 94080 USAmutantUnknownTrpa1<sup>em1Gne</sup>127285812RRID:RGD_127285810This Trpa1-deleted Sprague Dawley strain was generated by using CRISPR/Cas9. Rats harboring a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901 were identified.127338473WM/NemThe research institute of Environmental Medicine, Nagoya University.inbredUnknownRRID:RGD_127338473This Strain was from the National Institute of Genetics., Mishima, Japan to the research institute of Environmental Medicine, Nagoya University.127338474BDIX/NeminbredUnknownRRID:RGD_127338474This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973127345097SD-<i>Muc1<sup>em1Cgen</sup></i>mutantUnknownMuc1<sup>em1Cgen</sup>127345099RRID:RGD_127345097The Muc1 knock out Sprague Dawley rats were produced by targeted gene mutation at rat Muc1 gene. The deletion was made by microinjection of TALENs and located in the exon 1 of rat Muc1 gene (Gen Bank: NM_012602.1). Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5′-CTAGCAAGCCTAAAAGGTGAGAGGT-3′ and reverse primer 5′-ACGAAGAGCATTTGCCTACTC-3′, followed by DNA sequencing analysis.127345123F344-<i>Angptl8<sup>em1Kyo-/-</sup></i>Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, JapanmutantUnknownAngptl8<sup>em1Kyo</sup>127345127RRID:RGD_127345123This line #1 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3' (sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1.127345124F344-<i>Angptl8<sup>em1Kyo+/-</sup></i>Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, JapanmutantUnknownAngptl8<sup>em1Kyo</sup>127345127RRID:RGD_127345124This line #1 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1.127345125F344-<i>Angptl8<sup>em2Kyo-/-</sup></i>Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, JapanmutantUnknownAngptl8<sup>em2Kyo</sup>127345128RRID:RGD_127345125This line #2 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon.127345126F344-<i>Angptl8<sup>em2Kyo+/-</sup></i>Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, JapanmutantUnknownAngptl8<sup>em2Kyo</sup>127345128RRID:RGD_127345126This line #2 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing
two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon.149735334SD-<i>Wfs1<sup>em1Ptsn</sup></i>Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu,mutantUnknownWfs1<sup>em1Ptsn</sup>149735335RRID:RGD_149735334Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1<sup>em1</sup> ( Wfs1-ex5-KO232), Wfs1<sup>em2</sup> (Wfs1-ex5-KO266) and Wfs1<sup>em3</sup> (Wfs1-ex5-INS244). Wfs1<sup>em1</sup> rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine).149735336SD-<i>Wfs1<sup>em2Ptsn</sup></i>Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu,mutantUnknownWfs1<sup>em2Ptsn</sup>149735337RRID:RGD_149735336Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1<sup>em1</sup> ( Wfs1-ex5-KO232), Wfs1<sup>em2</sup> (Wfs1-ex5-KO266) and Wfs1<sup>em3</sup> (Wfs1-ex5-INS244). Wfs1<sup>em2</sup> rats carry a 27 amino acids deletion in exon 5 (aa212-238).149735338SD-<i>Wfs1<sup>em3Ptsn</sup></i>Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu,mutantUnknownWfs1<sup>em3Ptsn</sup>149735339RRID:RGD_149735338Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1<sup>em1</sup> ( Wfs1-ex5-KO232), Wfs1<sup>em2</sup> (Wfs1-ex5-KO266) and Wfs1<sup>em3</sup> (Wfs1-ex5-INS244). Wfs1<sup>em3</sup> rats carry a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226)
into YCMNTI in the WFS1 protein.149735356SD-Tg(Wnt1-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2021-07-19)RRID:RGD_149735356The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT2149735357SD-Tg(PDGFB-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19)RRID:RGD_149735357The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent.149735358SD-Tg(Olfr16-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19)RRID:RGD_149735358The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent.149735359SD-Tg(Mnx1-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryorecovery (as of 2024-01-10)RRID:RGD_149735359The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2149735361SD-Tg(Drd1-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)RRID:RGD_149735361The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neurons149735362SD-Tg(Gad1-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicCryopreserved Embryo; Cryorecovery (as of 2021-07-19)RRID:RGD_149735362The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes.149735363SD-Tg(GFAP-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2021-07-19)RRID:RGD_149735363The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent.149735364SD-Tg(Tie2-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2021-07-19)RRID:RGD_149735364The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2149735365SD-Tg(SMHC-cre/ERT2)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicLive Animals (as of 2021-07-19)RRID:RGD_149735365The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent.149735366SD-Tg(CAG-GFP-LacZ)AppscApplied StemCell, Inc., Milpitas, CA, USAtransgenicUnknownRRID:RGD_149735366A transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 line149735371SHR-<i>C3<sup>em1Kyo</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1145 > National BioResource Project for the Rat in Japan</a>advanced_intercross_lineCryopreserved Embryo (as of 2021-07-20)C3<sup>em1Kyo</sup>149735372RRID:RGD_149735371ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The DNA of 10 day old pups was extracted and screened for ZFN-induced mutations. Briefly, DNA extracted from ear tissue was amplified using primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'-AATAGAGGCCACCAATGCAC-3'). This mutant revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg).149735516LL/MavRrrcAekLyon hypotensiveinbredUnknown (as of 2021-07-21)RRID:RGD_149735516In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. The strain from Rat Resource & Research Center was maintained at Department of Pharmacology, University of Iowa149735517LEXF10A/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredUnknownRRID:RGD_149735517These are re-derived rats of LEXF10A/Stm now maintained at Medical College of Wisconsin. The parent strain was derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj.149735518HXB4/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu > contact HRDP</a>recombinant_inbredUnknownRRID:RGD_149735518These are re-derived rats of HXB4/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub149735519HXB31/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredUnknownRRID:RGD_149735519These are re-derived rats of HXB31/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub149735520HXB2/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredUnknownRRID:RGD_149735520These are re-derived rats of HXB2/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub.149735521HXB20/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu > contact HRDP</a>recombinant_inbredUnknownRRID:RGD_149735521These are re-derived rats of HXB20/Ipcv now maintained at Medical College of Wisconsin. The parent strain wasDerived from founder strains SHR/OlaIpcv and BN-Lx/Cub149735530BXH2/CubMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredUnknownRRID:RGD_149735530These are re-derived rats of BXH2/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv149735533BXH3/CubMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredUnknownRRID:RGD_149735533These are re-derived rats of BXH3/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv.149735557LE-Tg(Pdyn-cre)2-9KobaKazuto Kobayashi Fukushima Medical UniversitytransgenicCryopreserved Sperm (as of 2024-01-26)RRID:RGD_149735557This strain was produced by injecting a modified BAC, in which a Cre recombinase was inserted into the third exon of the rat Pdyn gene, into rat zygotes (Iar:Long-Evans, RGD:18337282). This strain is a transgenic rat that expresses Cre recombinase under the control of the Pdyn gene.149735558F344.LEA-Ugl/Okt<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1333> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2021-07-22)RRID:RGD_149735558A congenic strain in which the ugl locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the ugl locus, which contains a 13 bp deletion in the Ctns gene.Cystinosis model rat.149735559F344.LEA-Idao/Okt<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1334> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2021-07-22)RRID:RGD_149735559A congenic strain in which the Idao locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the Idao locus, which contains a 54.1 kb deletion in the Dao gene.149735560LE-<i>Gad1<sup>em15Yyan</sup></i>Gunma University Graduate School of MedicinemutantCryopreserved Sperm (as of 2021-07-22)Gad1<sup>em15Yyan</sup>149735561RRID:RGD_149735560Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes.149735562LE-<i>Gad2<sup>em24Yyan</sup></i>Gunma University Graduate School of MedicinemutantCryopreserved Sperm (as of 2021-07-22)Gad2<sup>em24Yyan</sup>149735563RRID:RGD_149735562Knockout rats in which the Gad2 gene was disrupted using the TALEN. In this strain, the Gad2 gene encoding GAD65 was knocked out. In homozygous rats, a high rate of epileptic seizures was observed at 2 to 3 weeks of age.149735570F344-<i>Atg16l1<sup>em8Rrrc</sup></i>mutantLive Animals (as of 2021-07-23)Inflammatory Bowel Disease, autophagyAtg16l1<sup>em8Rrrc</sup>149735571RRID:RGD_149735570CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal.149735895LEW-Tg(Col2a1-luc,-mCherry)RmptRrrc<a href=http://www.rrrc.us/Strain/?x=942&log=yes>Rat Resource and Research Center</a>transgenicUnknownSkeletal Regenerative MedicineRRID:RRRC_00942Random insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferin149735896LEW-Tg(Col2a1-luc,-mCherry)RmptThis transgenic was created by Dr. Ryan Porter at University of Arkansas for Medical Sciences.transgenicUnknownSkeletal Regenerative MedicineRRID:RGD_149735896Random insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferin149735897F344-<i>Cacna1a<sup>gry</sup></i>/Okym<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1164 > National BioResource Project for the Rat in Japan</a>congenicCryopreserved Sperm (as of 2021-07-29)NeurobiologyRRID:RGD_149735897This strain is derived from GRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) provided from NBRP-Rat.
GRY/Idr was backcrossed to F344/NSlc.149735898SD-<i>Myh7b<sup>em1Blar+/+</sup></i>Beijing Laboratory
Animal Research Center of Chinese Academy of
Medical Sciences.mutantUnknownRRID:RGD_149735898This is the homozygous wild type littermate from crossing of heterozygous SD-Myh7b mutants. The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was
approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death.149735906RCCHan:WISToutbredUnknownRRID:RGD_149735906Wistar Hannover rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.)150340617SHRSP.SHR-(<i>rs197197017 -rs198445122</i>)/UtxUniversity of Texas, Houston, TXcongenicUnknownRRID:RGD_150340617A congenic strain made by introducing B2 fragment (a segment of chromosome 1, 154.7 Mb - 203 Mb) from SHR/Utx into SHRSP/BbbUtx.The B2 fragment contains wild-type Stim1 as confirmed by sequencing.150340629SS-<i>Tgfb1<sup>em3Mcwi+/+</sup></i>SS-<i>Tgfb1<sup>em3Mcwi+</sup>/Tgfb1<sup>em3Mcwi+</sup></i>PhysGen KnockoutsmutantUnknownRRID:RGD_150340629ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed to produce homozygous wild type and heterozygous mutant littermates.150404267LEW-<i>Myo15a<sup>ci2</sup></i>/ZtmInstitute of Laboratory Animal Science, Hannover Medical School, Hannover, GermanymutantUnknownMyo15a<sup>ci2</sup>150404269RRID:RGD_150404267LEW/Ztm-ci2 rat is an animal model for syndromal deafness that arose from a spontaneous mutation. Base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region.150429598SS-<i>Vwf<sup>em4Mcwi</sup></i><a href=http://rgd.mcw.edu/rgdweb/models/allModels.html>Rat Genetic Models</a>, through Versiti Blood Research InstitutemutantUnknownType I von Willebrand DiseaseVwf<sup>em4Mcwi</sup>150429599RRID:RGD_150429598The rat strain was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting rat strain has a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. Some mRNA must make it through to translation, because low levels of VWF protein are detectable via ELISA (<10%). Both homozygous pairs and heterozygous pairs were used for breeding.150429601MWF.SHR-(<i>D6Rat1-D6Rat30</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429601The congenic MWF.SHR-(<i>D6Rat1-D6Rat30</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429602MWF.SHR-(<i>D6Rat1-D6Rat106</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429602The congenic MWF.SHR-(<i>D6Rat1-D6Rat106</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429603MWF.SHR-(<i>D6Rat1-D6Mit8</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429603The congenic MWF.SHR-(<i>D6Rat1-D6Mit8</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429604MWF.SHR-(<i>D6Rat1-D6Rat121</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429604The congenic MWF.SHR-(<i>D6Rat1-D6Rat121</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429605MWF.SHR-(<i>D6Rat1-D6Mgh4</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429605The congenic MWF.SHR-(<i>D6Rat1-D6Mgh4</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429606MWF.SHR-(<i>D6Rat1-D6Rat81</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429606The congenic MWF.SHR-(<i>D6Rat1-D6Rat81</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429607MWF.SHR-(<i>D6Rat1-D6Rat115</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429607The congenic MWF.SHR-(<i>D6Rat1-D6Rat115</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429608MWF.SHR-(<i>D6Rat1-D6Rat184</i>)/RkbFreie Universitdt Berlin, Berlin, GermanycongenicUnknownRRID:RGD_150429608The congenic MWF.SHR-(<i>D6Rat1-D6Rat184</i>)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated.150429614FHH-Tg(CAG-Add3)McwiRomanDepartment of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, MississippitransgenicUnknownAdd32043RRID:RGD_150429614A full-length rat wild type Add3 cDNA obtained from an expression plasmid pCMV6-entry-Add3 purchased from Origene (Rockville, MD) was inserted in a sleeping beauty transposon vector. The expression of wild type ADD3 in the transposon vector was driven
by a CAG promoter. The construct was injected into the pronucleus ofoocytes collected from female FHH/EurMcwi rats along with SB100 transposase mRNA. A single-transgene insertion was identified on chromosome 10, which is located .64 kbp away from the protein shisa-6 homolog precursor at its 59 end and .360 kbp away from the phosphoinositide-interacting protein at the 3 prime end. Heterozygous founders were intercrossed to derive a homozygous transgenic line that was used for studies.150429615SD-<i>Add3<sup>em1Mcwi</sup></i>/ RomanDepartment of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, MississippimutantUnknown (as of 2021-09-09)Add3<sup>em1Mcwi</sup>150429617RRID:RGD_150429615ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used150429618FHH-Chr 1<sup>BN</sup>-<i>Add3<sup>em2Mcwi</sup></i> /RomanDepartment of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, MississippimutantUnknownAdd3<sup>em2Mcwi</sup>150429619RRID:RGD_150429618ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was
injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant
females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain
to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used150429634F344 -<i>Aspa<sup>em34Kyo</sup> Hcn1<sup>em1Kyo</sup></i>Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto
606-8501, JapanmutantUnknownAspa<sup>em34Kyo</sup>|Hcn1<sup>em1Kyo</sup>11564348|150429632RRID:RGD_150429634F344-Aspaem34Kyo (RGD:11564349) and F344-Hcn1em1Kyo (RGD:38676253) rats
from the National BioResource Project-Rat
were intercrossed to produce F1 hybrids and then to obtain F2 progeny.
Rats homozygous for both Aspa and Hcn1 knockout
alleles were selected from among F2 progeny and were
used to generate the F344-Aspaem34Kyo/Hcn1em1Kyo double-
knockout strain.150429707SD-<i>Cyp2c11<sup>em1Nju</sup></i>mutantUnknownCyp2c11<sup>em1Nju</sup>150429708RRID:RGD_150429707CRISPR/Cas9 system containing two pairs of single guide RNA
(sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG-
TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC-
39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39;
reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT)
insertion into exon 6 of CYP2C11 and resulting in the knockout allele.150429760SHRSP.SHR-(<i>rs198233821-rs198932221</i>)/UtxUniversity of Texas, Houston, TXcongenicUnknownRRID:RGD_150429760A congenic strain made by introducing IgH haplotype block (a segment of chr6:146,030,387 to 154,214,590 ,Rn5 assembly of the rat genome). from SHR-B2 (SHR/Utx) into SHR-A3 (SHRSP/BbbUtx). The igH block contains sequences that are highly divergent between of SHR-A3 and SHR-B2 .150429814SD-<i>Gnal<sup>em1Hpng+/-</sup></i>Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, GermanymutantUnknownGnal<sup>em1Hpng</sup></i>150429816RRID:RGD_150429814The heterozygousGnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to
position 34 to 46 downstream of the translation start point ATG of the
Gnal splicing variant 2 was detected resulting in an early stop at position
150 and producing a truncated protein with 50 amino acids .150429815SD-<i>Gnal<sup>em1Hpng+/+</sup></i>Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, GermanymutantUnknownRRID:RGD_150429815The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids .150429817SD-<i>Gnal<sup>em1Hpng-/-</sup></i>Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, GermanymutantUnknownGnal<sup>em1Hpng</sup></i>150429816RRID:RGD_150429817Thehomozygous Gnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to
position 34 to 46 downstream of the translation start point ATG of the
Gnal splicing variant 2 was detected resulting in an early stop at position
150 and producing a truncated protein with 50 amino acids. Only 5% of homozygous Gnal knockout mice could survive till maturity150429818BN/HsdMcwiRrrc<a href=http://www.rrrc.us/Strain/?x=562>Rat Resource & Research Center</a>inbredCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-09-30)RRID:RRRC_00562Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115). This strain was maintained at RRRC.150429825SD-<i>Scn9a*<sup>tm1Amgn</sup></i>/CrlThis Sprague Dawley (SD) rat model
was designed by Amgen, adapted and executed by
SAGE Labs, Sigma-Aldrich.mutantUnknownScn9a*<sup>tm1Amgn</sup>150429827RRID:RGD_150429825Exon 25 of the rat Scn9a gene was replaced with the human SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase).150429828SD-<i>Tspo<sup>em1Vpl</sup></i>McGill University and Genome Quebec Innovation Centre (Montreal, Canada)mutantUnknownTspo<sup>em1Vpl</sup>150429831RRID:RGD_150429828Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting
with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using
the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and
273 bp for the mutant,(89 bp deletion).150429830SD-<i>Tspo<sup>em2Vpl</sup></i>McGill University and Genome Quebec Innovation Centre (Montreal, Canada)mutantUnknownTspo<sup>em2Vpl</sup>150429832RRID:RGD_150429830Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30. Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion).150429960WIC-<i>Wwox<sup>lde</sup></i>/FtaLaboratory of Veterinary Physiology, Nippon Veterinary and Life Science University, TokyomutantUnknownWwox<sup>lde</sup>150429961RRID:RGD_150429960Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting severe dwarfism, short lifespan (early postnatal lethality), and high incidence of epileptic seizures. Mutant rats showed growth retardation after 3 d of age, and at 21 d their weight was about 56% that of normal rats. Sequencing of the full-length Wwox transcript identified a 13-bp deletion in exon 9 in lde/lde rats. This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal.150429963WI-<i>Pmch<sup>m1Hubr</sup></i>Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic.mutantUnknownPmch<sup>m1Hubr</sup>150429964RRID:RGD_150429963The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU.150429965SD-<i>Apoa4<sup>em1Bcgen</sup></i>Beijing Biocytogen Co., Ltd. (Beijing, China).mutantUnknownApoa4<sup>em1Bcgen</sup>150429966RRID:RGD_150429965TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp.150429988SHR-Tg(EEF1A1-Wars2)IpcvCzech Academy of Sciences, Prague, Czech RepublictransgenicUnknownWars21593417RRID:RGD_150429988This strain was derived by microinjecting fertilized eggs with a mix of the Sleeping Beauty construct containing BN Wars2 cDNA under control of the universal EF-1α (human EEF1A1) promoter and mRNA of the SB100X transposase (Ivics et al. 2014). Transgenic rats were detected using PCR with the following primers: Wars2-F 5'-TGT GCT ACA AGT CCA CAC AC-3' and Wars2-R 5'-GCA GAA GGG TCA CGA AGA GA-3'.150517549SS.SHR-(<i>D2Rat46- D2Mco48</i>)/McoUniversity of Toledo Toledo, OhiocongenicUnknownRRID:RGD_150517549This SS congenic carries the chromosomal fragment from the spontaneously hypertensive rat (SHR). Recombinant Progeny Testing (RPT) was used to fine-map the proteinuria locus. The congenic was developed from the recombinant families by fixing the transferred genomic interval (D2Rat46- D2Mco48) in the homozygous SHR/SHR state150517550SS.SHR-(<i>D2Rat127- D2Rat230</i>)/McoUniversity of Toledo Toledo, OhiocongenicUnknownRRID:RGD_150517550This SS congenic carries the chromosomal fragment from the spontaneously hypertensive rat (SHR). Recombinant Progeny Testing (RPT) was used to fine-map the proteinuria locus. The congenic was developed from the recombinant families by fixing the transferred genomic interval (D2Rat127- D2Rat230) in the homozygous SHR/SHR state150519895SD-<i>Gfap<sup>em1Mes</sup></i> /Rrrc<a href=http://www.rrrc.us/Strain/?x=932&log=yes>Rat Resource and Research Center</a>mutantUnknownGfap<sup>em1Mes</sup>150519905RRID:RRRC_00932The targeted mutation in the rat GFAP gene was based on the severity and frequency of the R239H mutation in human disease. The CRISPR/Cas9 system was used to mediated knockin of point mutation (R237H) to Sprague-Dawley embryos. The current background srain is Crl:CD (SD). This mutant strain serves as a model for Alexander disease. knockins have post-weaning failure to thrive and ~10% mortality by 12 weeks, but afterwards are viable and can breed .150519896SD-<i>Gfap<sup>em2Mes</sup></i> /Rrrc<a href=http://www.rrrc.us/Strain/?x=931&log=yes>Rat Resource and Research Center</a>mutantUnknownGfap<sup>em2Mes</sup>150519906RRID:RRRC_00931CRISPR/Cas9 mediated single nucleotide deletion resulting in a frameshift that creates a premature stop and generates a null allele. This strain serves as a model for Alexander disease - nulls are of interest for traumatic brain injury and many other studies of CNS disease and astrocyte response.150519899F344-<i>Prkar1b<sup>em1Tua</sup></i>Department of Animal Science
Faculty of Agriculture
Tokyo University of Agriculture
1737 Funako
Atsugi
Kanagawa
243-0034
JapanmutantUnknownPrkar1b<sup>em1Tua</sup>150519902RRID:RGD_150519899CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant strain F344-<i>Prkar1b<sup>em1Tua</sup></i> carried a 2-bp frameshift insertion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants.150519901F344-<i>Prkar1b<sup>em2Tua</sup></i>Department of Animal Science
Faculty of Agriculture
Tokyo University of Agriculture
1737 Funako
Atsugi
Kanagawa
243-0034
JapanmutantUnknownPrkar1b<sup>em2Tua</sup>150519903RRID:RGD_150519901CRISPR/Cas9 system containing guide RNAs targeting exon 2 and intron 2 were introduced into the F344/Stm embryos using a super electroporator NEPA 2. This mutant strain F344-<i>Prkar1b<sup>em2Tua</sup></i> carried a 13-bp frameshift deletion in exon2 creating a premature stop codon in the Prkar1b transcripts. Expression levels of Prkar1b transcripts and protein are significantly decreased in the mutants.150520049WBN-<i>Ht</i>/KobcongenicUnknownRRID:RGD_150520049The hairless rat was orginially found in JCL:Wistar rats at Ishikawa Laboratory Animal company, Saitama, Japan. Thereafter, hairless rats were backcrossed with WBN rats for 8 generations and the congenic strain of hairless rats has been established with a background of WBN at the company.150520052SS-<i>Mlycd<sup>em1Mcwi</sup></i>Medical College of WisconsinmutantUnknownRRID:RGD_150520052CRISPR/Cas9 system was used to introduce a mutation in the Mlycd gene of SS/JrHsdMcwi rat embryos. This resulted in a global knock-out of the rat Mlycd gene.150520162Kwl:Wistar<a href="https://kwl-a.co.jp/rat/">Kiwa Laboratory Animals Co., Ltd. Japan</a>outbredUnknownRRID:RGD_150520162150520182LE-<i>ROSA26<sup>em1(CAG-tdTomato)Rrrc</sup></i><a href=http://www.rrrc.us/Strain/?x=938>Rat Resource and Research Center</a>mutantLive Animals (as of 2023-08-01)RRID:RRRC_00938 The DNA construct was made by replacing ZsGreen with TdTomato in plasmid pCAG-loxP-STOP-loxP-ZsGreen (Addgene plasmid #51269, donated by Pawel Pelczar). CRISPR/Cas9 genome editing technology was used to knock in the DNA construct into the rat ROSA26 locus in the embryos from outbred BluHsd:LE. Reporter line that can be crossed with Cre-expressing strains. In presence of Cre, the floxed "STOP" upstream of the TdTomato gene is deleted allowing expression of the red fluorescent TdTomato protein. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.150520183BDIX.BDIV-<i>Mss1c/ZteRrrc<a href=http://www.rrrc.us/Strain/?x=904>Rat Resource and Research Center</a>congenicUnknownRRID:RRRC_00904strain haboring on a BDIX background a 22,3 MB BDIV Fragment called Mss1c which covers part of the Mss1 fragment. Homozygous rats of both sexes display resistence towards ENU-induced development of PNS tumors in terms of survival time and incidence.150520185SD-<i>Ldlr<sup>em1Dlli</sup></i>mutantUnknownLdlr<sup>em1Dlli</sup>150520193RRID:RGD_150520185Zygotes of SD rats were microinjected with CRISPR/Cas9 system targeting Ldlr . This mutant possesses a 118-bp deletion from No.22759599bp to 22759716bp in the Ldlr gene (NC_005107.4), resulting in a termination codon TAG, and deletion
of 768 amino acids of Ldlr.150520186SD-<i>Apoe<sup>em1Dlli</sup></i>Shanghai Key Laboratory of Regulatory Biology East China Normal University, Shanghai, ChinamutantUnknownRRID:RGD_150520186carried a 130 bp deletion from No.80613571bp to 80613700bp in Apoe gene (NC_005100.4), resulting in a termination codon TAA, and deletion of 231 amino acids of ApoE.150520187LE-<i>Apoe<sup>em1Dlli</sup>Ldlr<sup>em1Ldlr</sup></i>mutantUnknownRRID:RGD_150520187This Apoe/Ldlr double knock-out (DKO) was derived from cross-breeding of SD-Apoeem1Dlli (RGD:150520186) and SD-Ldlrem1Dlli (150520185).150520189SD-<i>Apoe<sup>em1Ejt</sup></i>Purdue Center for Cancer Research, 201 South University Street, Purdue University, West
Lafayette, Indiana, 47907, United StatesmutantUnknownApoe<sup>em1Ejt</sup>150520190RRID:RGD_150520189The mutant rat strain was produced by injecting TALEN system targeting the exon 4 of rat Apoe into Sprague Dawley (Hsd:SD) embryos. This mutant rat has a 16-bp deletion in the gene third coding exon) located on chromosome 1; frameshift mutation resulted (p.Glu178fs)150520204SHR/OlaIpcv-mt<sup>LEW/Ipcv</sup>Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech RepublicconplasticUnknownRRID:RGD_150520204Mitochodrial genome of SHR/OlaIpcv was selectively replaced by LEW/Ipcv to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of LEW/Ipcv on SHR/OlaIpcv nuclear genetic background.150520205SHR-<i>Gja8</i><sup>m1+/-Cub</sup>Department of Biology, Charles University in Prague, Prague, Czech RepublicmutantUnknownGja8<sup>m1Cub</sup>12791992RRID:RGD_150520205This strain is derived from SHR/OlaIpcv where a spontaneous mutation was observed in the NH<sub>2</sub>-terminal cytosolic domain of Cx50, L7Q. The connexin50 mutation in heterozygous state affects significantly the lipid profile and the oxidative stress parameters in SHR rats.150520206SHR-Tg(EEF1A1-Folr1 )IpcvCzech Academy of Sciences, Prague, Czech RepublictransgenicUnknownRRID:RGD_150520206Generated by microinjecting SHR/OlaIpcv zygotes with wild type Folr1 cDNA from BN-Lx/Cub under control of EF-1α (human EEF1A1) universal promoter150520207F344-<i>ROSA26<sup>em1(AttP)Davis</sup></i>/RrrcmutantCryopreserved Sperm (as of 2021-11-05)Tool rat for creating other trasngenic rat modelsRRID:RRRC_00939The CRISPR/Cas9 system was used to introduce 2 AttP landing sites in the ROSA26 locus of F344/NHsd rat embryos. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.150520208ACI-<i>Pvt1<sup>em1Shul</sup></i>Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisonmutantLive Animals (as of 2021-11-05)RRID:RGD_150520208Using CRISPR/Cas9, exon 1b of the Pvt1 gene was excised from the ACI/SegHsd genome in a 1165bp deletion.150520209ACI-<i>Pvt1<sup>em1Shul</sup></i>/RrrcShull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. mutantUnknownRRID:RGD_150520209The ACI-<i>Pvt1<sup>em1Shul</sup></i> was created using CRISPR/Cas9 by Shull laboratory at UW madison. The exon 1b of the Pvt1 gene was excised from the ACI/SegHsd genome in a 1165bp deletion.150520210ACI-<i>Pvt1<sup>em2Shul</sup></i>Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisonmutantLive Animals (as of 2021-11-05)RRID:RGD_150520210Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3.150520211ACI-<i>Pvt1<sup>em2Shul</sup></i>/RrrcThe strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. mutantUnknown (as of 2021-11-09)RRID:RGD_150520211Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3.150520212ACI-<i>Pvt1<sup>em3Shul</sup></i>Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisonmutantLive Animals (as of 2021-11-05)RRID:RGD_150520212using CRISPR/Cas9, exon 8 of the pvt1 gene was deleted from the ACI genome. Resulting in a total excision of 588bp.150520213ACI-<i>Pvt1<sup>em3Shul</sup></i>/RrrcThe strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. mutantLive Animals (as of 2021-11-05)RRID:RGD_150520213using CRISPR/Cas9, exon 8 of the pvt1 gene was deleted from the ACI genome. Resulting in a total excision of 588bp.150520214ACI-<i>Pvt1<sup>em4Shul</sup></i>Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisonmutantLive Animals (as of 2021-11-05)RRID:RGD_150520214CRISPR/Cas9 was used to delete miR1208 in a 763bp excision in ACI rat embryos.150520215ACI-<i>Pvt1<sup>em4Shul</sup></i>/RrrcThe strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. mutantUnknownRRID:RGD_150520215CRISPR/Cas9 was used to delete miR1208 in a 763bp excision in ACI rat embryos.150520216ACI-<i>Pvt1<sup>em5Shul</sup></i>Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisonmutantLive Animals (as of 2021-11-05)RRID:RGD_150520216Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos.150520217ACI-<i>Pvt1<sup>em5Shul</sup></i>/RrrcThe strain was created at Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison. mutantUnknownRRID:RGD_150520217Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos.150520220SD-<i>Ccdc39<sup>em1Jgn</sup></i>Cincinnati Children's Hospital Medical Center, Cincinnati, OHmutantUnknownCcdc39<sup>em1Jgn</sup>150521525RRID:RGD_150520220The CRISPR/Case9 system was desgined to create the progressive hydrocephalus (prh) mutation in Sprague Dawley rats. The homozygous rat carries chr2:g.120305679A>T change that creates a splice site (Ccdc39c.916+2T ) mutation in the rat Ccdc39 gene.150520221SD-<i>Slco1b2<sup>em1Myliu</sup></i>Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences and School of Life Sciences, East China Normal University, Shanghai 200241, ChinamutantUnknownSlco1b2<sup>em1Myliu</sup>150521524RRID:RGD_150520221The Sprague Dawley embryos were injected with CRISPR/Case9 system targeting the first exon of the rat Slco1b2 gene. A Slco1b2 knockout was created with 11-bp deletion.150521538SD-<i>Uox<sup>em1Cya</sup></i>Yunnan University of Traditional Chinese Medicine,and Kunming Medical University, Kunming, Yunnan, China.mutantUnknownUox<sup>em1Cya</sup>150521540RRID:RGD_150521538The CRISPR/Cas9 system targeting exons 2 to 4 was injected into Sprague Dawley embryos. The resulting mutation was complete deletion of exons 2, 3 and 4.150521556SD-<i>Trpm4<sup>em1Sage</sup></i>Laboratory of Biological Psychology, Brain and Cognition,
Katholieke Universiteit Leuven (KUL), Tiensestraat 102,
3000 Leuven, BelgiummutantUnknownRRID:RGD_150521556Trpm4 gene specific Zinc finger constructs directed against exons 18-19, which
contain the coding sequence for TM3-5 and the pore region of the TRPM4 protein, were injected in zygotes from Sprague-Dawley rats. This mutant rat with a 514 bp deletion which includes completely removes exon 18 and a piece of exon 19 from the Trpm4 gene, plus the intron 18-19. The deletion was confirmed via genomic
sequencing and western blotting.150521559LEW.SD-<i>CD8a<sup>m1Trg</sup></i>University of Texas Southwestern Medical Center, 5323mutantUnknownRRID:RGD_150521559Male SD rats were treated with the mutagen N-ethyl-N-nitrosourea (60
mg/kg intraperitoneally) at ages 9 and 10 weeks. A heterozygous mutant founder carrying a T to C transition that encoded a substitution of a proline residue (CCA) for a highly conserved serine residue (TCA) at amino acid position 94 was identified. This mutant male was mated to a LEW female and phenotyping by the expression of CD8a and CD8ab.150521599SD-<i>Tshr<sup>em1Mlit</sup></i>Animal Center of Tongji University; Tongji University School of Medicine, Shanghai, 200065, ChinamutantUnknownTshr<sup>em1Mlit</sup>150521600RRID:RGD_150521599CRISPR/Cas9 system targeting exon 10 of the rat Tshr gene was injected into Sprague Dawley embryos to create this mutant strain. The strain was homozygous with 5 bp deletion (CACGC) which introduces frameshift at residue 449 and a stop codon at 478 (P449fsX478).150521602OFA(SD)-<i>Dsg4<sup>hr</sup></i>/CrlIffa Credo (L'Arbresle Cedex, France; www.criver.com/ ico/iffa_reachus.html).mutantUnknownDsg4<sup>hr</sup>150521603RRID:RGD_150521602This Iffa Credo ( IC) hairless strain was a spontaneous recessive mutant identified in a colony of Crl:OFA(SD) at 1974. A large intracellular out-of-frame deletion in Dsg4 of IC mutant rats was identified. The intragenic deletion spanning exons 2?10 that results in a significant down-regulation of Dsg4 message.150521604WKY-<i>Tnfrsf14<sup>em1Tja</sup></i>/RrrcThis strain was created by Tim Aitman at University of Edinburgh.mutantCryopreserved Sperm; Cryorecovery (as of 2021-11-11)RRID:RRRC_00796This strain was produced by injecting ZFNs targeted sequence into WKY/Cruk rat embryos. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.150521605W/LnneAudiogenic Wistar ratNorberto Garcia-Cairasco at University of Sao PauloinbredUnknownaudiogenic seizuresRRID:RGD_150521605Wistar rats maintained at the animal facility of the Ribeirao Preto School of Medicine at the University of Sao Paulo, Brazil, were tested for audiogenic seizures, using as criteria an SI and the L1 (ref. RGD:14695082). The WAR colony foundation stock was produced by mating animals displaying at least procursive behaviors in three consecutive tests, one every 4 days (two males and four females). Each couple produced two or three lit-ters, from which selected individuals displaying the highest SI and shortest L1 were mated, at adult age,with their fathers and mothers. From the second generation on, brother and sister matings were done, in a ratio of one male to two females, selected accordingto the criteria above.150521606SD-<i>Lrp5<sup>em2Vari</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=880>Rat Resource and Research Center</a>mutantUnknownLrp5<sup>em2Vari</sup>41404650RRID:RRRC_00880CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos.150521608SD-<i>Lrp5<sup>em3Vari</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=881>Rat Resource and Research Center</a>mutantUnknownLrp5<sup>em3Vari</sup>41404652RRID:RRRC_00881CRISPR/Cas9 system was used to introduce an
inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos.150521610SD-<i>Lrp5<sup>em1Vari</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=867>Rat Resource and Research Center</a>mutantUnknownLrp5<sup>em1Vari</sup>41404647RRID:RRRC_00867CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos.150521611BDIX.BDIV-<i>D6Mit8-D6Rat229</i>/ZteRrrcInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicUnknownRRID:RRRC_00899The BDIX.BDIV-<i>D6Mit8-D6Rat229</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.150521612BDIX.BDIV-<i>Mss1b/ZteRrrc<a href=http://www.rrrc.us/Strain/?x=905>Rat Resource and Research Center</a>congenicUnknownRRID:RRRC_00905strain haboring on a BDIX background two BDIV Fragments generated by a double recombination, 37,3 and 20,0 Mb long,Mss1b1 and Mss1b2 both covering parts of the Mss1 fragment. Homozygous rats of both sexes display susceptibility towards ENU-induced development of PNS tumors in terms of survival time and incidence. Through the Mss1b1 and Mss1b2 fragments and the Mss1c fragment the Mss1 locus was fine-mapped between 82.9 and 85.2Mb150521613BDIX.BDIV-<i>D6Mit1-D6Mgh2</i>/ZteRrrcInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany.congenicUnknownRRID:RRRC_00901The BDIX.BDIV-<i>D6Mit1-D6Mgh2</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.150521614BDIX.BDIV-<i>D10Got1-D10Rat45</i>/ZteRrrcInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicUnknownRRID:RRRC_00902The BDIX.BDIV-<i>D10Got1-D10Rat45</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.150521616BDIX.BDIV-<i>D10Mit3-D10Mgh16</i>/ZteRrrcInstitute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, GermanycongenicLive Animals (as of 2021-11-12)RRID:RRRC_00903The BDIX.BDIV-<i>D10Mit3-D10Mgh16</i>/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background.150521617BDIX/IfzRrrcDuisburg-Essen University Medical School, Essen, GermanyinbredUnknownRRID:RRRC_00900BDIX/IFZ rats have been inbred in the Institute of Cell Biology, Essen and later in the Central Animal Facility,Essen for about 45 years. The BDIX/Ifz rats are extremely susceptible to ENU-induced development of tumors of the peripheral and central nervous system.150521619BDIV/lfzRrrc<a href=http://www.rrrc.us/Strain/?x=898>Rat Resource and Research Center</a>inbredUnknownRRID:RRRC_00898Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971). BDIV/IFZ rats have been inbred in the Institute of Cell Biology, Essen and later in the Central Animal Facility for about 45 years. BDIX/Ifz rats are extremely resistant to ENU-induced development of tumors of the peripheral nervous System.150521659FHH-Chr 1<sup>BN</sup>-<i>Dusp5<sup>em1Mcwi</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=922>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-11-15)RRID:RGD_150521659This strain was produced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC-CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1<sup>BN</sup>/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449 and 464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid 121.150521660LE-Tg(DIO-mCherry)2OttcA Rrrc substrain available at <a href=http://www.rrrc.us/Strain/?x=687>Rat Resource and Research Center</a>transgenicUnknownRRID:RGD_150521660The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter.150521661SD-Tg(DIO-mCherry)2OttcRrrc<a href=http://www.rrrc.us/Strain/?x=928>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00928 The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter. Expresses mCherry in cells of the brain transduced with a Cre-expression virus. Currently in SD background generated by backcrossing to LE-Tg(DIO-mCherry)2Ottc150521675BN/NHsdShulShull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoninbredLive Animals (as of 2021-11-16)RRID:RGD_150521675Inbred substrain derived from BN/SsNHsd(RGD:10008)150521676ACI/SegHsdShulShull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-MadisoninbredLive Animals (as of 2021-11-16)RRID:RGD_150521676Inbred substrain of ACI of ACI derived from ACI/SegHsd150521677BN/HsdShulRrrcThis substrain is transferred from Shull Lab, Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison to Rat Reource & Research Center in 2021.inbredUnknownRRID:RGD_150521677Inbred substrain derived from BN/SsNHsd(RGD:10008)150521708SD-<i>Tbc1d1<sup>Tn(sb)1Fkh</sup></i>University of Texas Southwestern Medical Center, Dallas TXmutantUnknownTbc1d1<sup>Tn(sb)1Fkh</sup>150521709RRID:RGD_150521708The Sleeping Beauty transposon-mediated mutagenesis was used to knock out the rat Tbc1d1 gene in in rat spermatogonial stem cells from Sprague Dawley.150523755SD-<i>Ighm<sup>em1Ang</sup></i>Platform Rat Transgenesis IBiSA-CNRS, Nantes, France.mutantUnknownIghm<sup>em1Ang</sup>150523756RRID:RGD_150523755The mutation in this rat strain (line 19) comprised a 64 bp deletion of the IgM CH1 domain and generation of a stop codon. This strain carries deletion in both alleles has
truncated Cmu.150523757SD-<i>Ighm<sup>em2Ang</sup></i>Platform Rat Transgenesis IBiSA-CNRS, Nantes, France.mutantUnknownIghm<sup>em2Ang</sup>150523758RRID:RGD_150523757Microinjection of Sprague-Dawley rat zygotes with ZFN mRNA specific for the JH locus resulted in the generation of a mutant animal with a 2465 bp DNA deletion, spanning the entire locus150523775LEW-Tg(HLA-B*2705,B2M)<sup>Tg/0</sup>21-3Reh RrrctransgenicCryopreserved Sperm; Cryorecovery (as of 2022-03-10)RRID:RRRC_00916This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene.150523778LEW-Tg(B2M)283-2RehRrrc<a href=http://www.rrrc.us/Strain/?x=917>Rat Resource and Research Center</a>transgenicCryopreserved Sperm; Cryorecovery (as of 2022-03-10)RRID:RRRC_00917This strain carries 35 copies of genomic human B2-microglobulin gene. When crossed with the 21-3 line (RRRC:00 916), the F1 males develop a spontaneous disease mimicking human spondyloarthritis.150523780LEW-<i>Erap1<sup>em1Reh</sup></i>2786/Rrrc<a href=http://www.rrrc.us/Strain/?x=918>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-11-19)RRID:RRRC_00918The ZFN mRNA targeting exon 2 of Erap1 was microinjected into both the pronuclei and the cytoplasm of fertilized LEW eggs. This strain was heterozygous for a 2-bp deletion within the targeted AGGAGA sequence of Erap1.150523781LEW-<i>Erap1<sup>em1Reh</sup></i>2786University of Texas Southwestern Medical CentermutantUnknownRRID:RGD_150523781The ZFN mRNA targeting exon 2 of Erap1 was microinjected into both the pronuclei and the cytoplasm of fertilized LEW eggs. This strain was heterozygous for a 2-bp deletion within the targeted AGGAGA sequence of Erap1.150524338SD-Tg(ERAP1*)2793RehRrrc<a href=http://www.rrrc.us/Strain/?x=919>Rat Resource and Research Center</a>transgenicCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-11-29)RRID:RRRC_00919This transgenic rat carrying the human " II or *002" allele of ERAP1 under mouse H-2K promoter control. The construct was made by Dr. Edd James, University of Southampton, UK. The II allele is generally considered to be a risk allele for ankylosing spondylitisThe original background strain is SD and the current background strain is mixed Lewis x SD.150526804AZK/MisivAzman Kamal ratsForest Research Institute MalaysiainbredLive Animals (as of 2021-12-01)Wound healingRRID:RGD_150526804The rat was derived from inbreeding of Sprague Dawley rats for 3 years. Because of longer inbreeding process we got SD progenies without fur. So, this rat is used for wound healing study in our facility.150526809SD-<i>Ar<sup>tfm</sup></i>/RrrcDonated by Cynthia Jordan from Michigan State UniversitymutantUnknownRRID:RRRC_00940This spontaneous mutant strain was originally derived from King Holtzman background and now maintained in Sprague Dawley background. A single nucleotide mutation was identified in the androgen receptor gene. The tfm males are sterile so the mutation is carried via females who breed normally.150527860BDIX/OrlIcoBDIX Rats<a href=http://www.criver.com/>Charles River Laboratories </a>inbredUnknownRRID:RGD_150527860Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans (Orl) acquired by IFFA CREDO later (Ico).150573816SD-<i>Nkx3-1<sup>em1Pjhak+/-</sup></i>Department of Laboratory Animal Medicine
College of Veterinary Medicine
Seoul National UniversitymutantUnknownNkx3-1<sup>em1Pjhak</sup>150573819RRID:RGD_150573816A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein.150573818SD-<i>Nkx3-1<sup>em1Pjhak-/-</sup></i>Department of Laboratory Animal Medicine
College of Veterinary Medicine
Seoul National UniversitymutantUnknownNkx3-1<sup>em1Pjhak</sup>150573819RRID:RGD_150573818A pair of TALENs targeting coding region of rat Nkx3-1gene was electroporated into SD zygotes to create NKx3-1 mutants. The resulting mutation was indel mutation with sequences loss beyond TALEN recognition resulting a premature termination codon of the protein.151347605SD-<i>Ddah1<sup>em1Ywxu</sup></i>Cardiovascular Department, Shanghai Tenth People's Hospital, Tongji University, School of Medicine, Shanghai, ChinamutantUnknownDdah1<sup>em1Ywxu</sup>151347606RRID:RGD_151347605CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3').151347873Slc:ZUC-<I>Lepr<sup>fa+</sup></I>Zucker lean ratsJapan SLC, Inc. (Hamamatsu, Japan)outbredUnknownLepr3001RRID:RGD_151347873The Zucker lean rats were siblings of Zucker fatty rats. They were used as lean controls for Zucker fatty rats studies. This strain was available at Japan SLC, Inc. (Hamamatsu, Japan.)151356741SD-Tg(Alb-TAg)MlcrMcArdle Laboratory for Cancer Research, Medical School, University of Wisconsin, Madison, Wisconsin 53706-1599, USA.transgenicUnknownRRID:RGD_151356741This transgenic strain was generated by microinjection into outbred Sprague-Dawley from Harlan Sprague-Dawley (Hsd:SD) fertilized eggs and carries simian virus T Antigen drived by the enhancer/promoter region of the mouse albumin gene.151356945LE-<i>ROSA26<sup>em1(EF1a-TetR, Fos-iCre)</sup></i>/BhopeNIDA IRP (Hope lab).mutantUnknownRRID:RGD_151356945Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EF1a promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab).151356946LE-<i>ROSA26<sup>em1(EEF1A1-TetR, Fos-iCre)</sup></i>/BhopeRrrc<a href=http://www.rrrc.us/Strain/?x=953>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00953Two DNA expression constructs, the bacterial tetracyclin repressor (TetR) under the expression control of human EEF1A1 promoter and the improved Cre recombinase (iCre) under Fos promoter were joined in an antiparallel orientation in one rat ROSA26 targeting cassette. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. The DNA construct, together with CRISPR /Cas9 system, was injected to one cell Long-Evans (Crl:LE) rat embryos and founders were identified and bred for 8 generations at at NIDA IRP (Hope lab).151356950WI-Tg(Fos-LacZ)BhopeRrrc<a href=http://www.rrrc.us/Strain/?x=952>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00952The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Initial SD rats were then bred onto Wistar background for >10 generations at NIDA IRP (Bruce Hope lab)151356957Sah:SDNorth Terrace
Adelaide
SA
5000
AustraliaoutbredUnknownRRID:RGD_151356957Sprague-Dawley maintained at South Australian Health and Medical Research Institute151356958SD-<i>Cftr<sup>em1Apb</sup></i>Organization: Australian Phenomics Facility, Australian National UniversitymutantUnknownCftr<sup>em1Apb</sup>151660342RRID:RGD_151356958The CRISPR/Cas9 system was used to target exon 11 to create a deletion at codon F508 which was injected into Sprague-Dawley one-cell
embryos (C076 line). One rat
had an allele that contained the desired homology-directed
repair edited TTT deletion and was designated the
Phe508del founder (c.1522_1524delTTT).151356959SD-<i>Cftr<sup>em2Apb</sup></i>Organization: Australian Phenomics Facility, Australian National UniversitymutantUnknownCftr<sup>em2Apb</sup>151660343RRID:RGD_151356959The CRISPR/Cas9 system was used to target exon 11 and create a deletion at codon F508, which was injected into Sprague-Dawley one-cell
embryos (C076 line). A rat with an 8-bp deletion upstream of the TTT site
(c.1514_1521delATATCATC) was used to establish the KO strain.151356971RjOrl:LE<a href=https://janvier-labs.com/en/fiche_produit/long-evans_rat/>Janvier</a>outbredLive Animals; Cryopreserved Embryo (as of 2022-02-21)RRID:RGD_151356971This model was developed by Dr Long and Dr Evans in 1915. The LONG EVANS rat is the result of a cross between a female albino from the WISTAR Institute and a wild male (Rattus norvegicus) captured near Berkeley and offspring selection.
The LONG EVANS rat is small and resistant to oncogenesis. This strain is widely used in behavioral, learning, ageing (visual acuity less affected than that of albino strains), addiction - especially to alcohol - studies.151356985LE-Tg(cFos-eGFP)BhopeNIDA IRP (Hope lab)transgenicUnknownRRID:RGD_151356985This LE transgenic rats were created by injecting the cfos-eGFP construct to pronuclei of fertilized eggs obtained from Long Evans females. The 5 prime end of the transgenic DNA construct contained mouse genomic cFos (indluding the promoter and all exon and intron sequences) was fused with eGFP (including poly(A) tail derived from the IRES (phosphorylated-internal ribosomal entry site) of the EGFP Clontech (Cambridge, UK) vector. A single founder animal was identified. All subsequent breeding used hemizygous cfos-GFP male rats paired with wild-type Long Evans female rats obtained from Charles River Laboratories. Rats were bred on Long-Evans background for 13 generations at NIDA IRP (Hope lab).151356988LE-Tg(cFos-eGFP)BhopeRrrc<a href=http://www.rrrc.us/Strain/?x=954>Rat Resource and Research Center</a>transgenicUnknownRRID:RRRC_00954This transgenic was created by Dr. Bruce Hope at at NIDA IRP and donated to RRRC in 2022. The transgenic rats were created by injecting the cfos-eGFP construct to pronuclei of fertilized eggs obtained from Long Evans females. The 5 prime end of the transgenic DNA construct contained mouse genomic cFos (indluding the promoter and all exon and intron sequences) was fused with eGFP (including poly(A) tail derived from the IRES (phosphorylated-internal ribosomal entry site) of the EGFP Clontech (Cambridge, UK) vector. A single founder animal was identified. All subsequent breeding used hemizygous cfos-GFP male rats paired with wild-type Long Evans female rats obtained from Charles River Laboratories. Rats were bred on Long-Evans background for 13 generations151664748SD-<i>Slc9a6 <sup>em1Moro</sup></i>Organization: Dr. Eric Morrow at Brown University
70 Ship Street, Box G-E4
Providence
RI
02912
USAmutantUnknownSlc9a6 <sup>em1Moro</sup>151664749RRID:RGD_151664748CRISPR/Cas9 system was used to generate this mutant. Guide RNA sequence is the following: 5'-CGGCTGTGTAACCCTGATGA-3'. Cas9-mediated cleavage at exon 7 in the Slc9a6 locus resulted in the insertion of 2 bp (TT) generating frameshift and a premature stop codon.151665324SS-<i>Ucp2<sup>em1Mcwi</sup></i>Medical College of WisconsinmutantCryopreserved Sperm (as of 2022-03-18)RRID:RGD_151665324Generated by CRISPR/Cas9 mutagenesis of SS/JrHsdMcwi rats by Aron Geurts. The resulting mutation is a 23-bp deletion (rn7: chr1:154,842,967-154,842,989)151665772WI-<i>Tfap2c<sup>em1(tdTomato)Nips</sup></i>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2022-04-01)RRID:RGD_151665772The targeting vector was designed to replace the stop codon of Tfap2c with T2A-tdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Tfap2c expressing cells.151667414LE-<i>Ckm<sup>tm1(cre)</sup></i>/RrrcmutantUnknownRRID:RGD_151667414This model expresses cre-recombinase under the control of the endogenous Ckm (creatine kinase, M-type) promoter. Cre was targeted to the rat Ckm gene of LE embryos through CRISP/Cas9 system genome editing system.151893484SS-Tg(CAG-Fh)A1McwiMedical College of WisconsintransgenicLive Animals; Cryopreserved Sperm (as of 2022-04-21)RRID:RGD_151893484This is a transgenic model created using Sleeping Beauty system. The transgenic animals are overexpressing fumarate hydratase (Fh) under the control of the ubiquitous CAG promoter in the Dahl salt-sensitive strain background.152975964SS-<i>F8<sup>em2Mcwi</sup></i>Blood Research Institute 8733 W Watertown Plank Road Milwaukee, WI 53226mutantUnknownRRID:RGD_152975964Full gene inversion of the rat F8 gene introduced by CRISPR/Cas9, to DahlSS background rats. This inversion causes a premature stop codon 3 amino acids into the protein. F8 activity in rats, homozygous for the mutation, is undetectable.152975965SS-<i>F8<sup>em2Mcwi</sup></i>-Tg(ITGA2B-F8*)McwiBlood Research Institute 8733 W Watertown Plank Road Milwaukee, WI 53226transgenicUnknownRRID:RGD_152975965This transgenic was produced by crossing the SS transgenic rat carrying Lentivirus constructs containing the 2bF8 vector [B-domain deleted human FVIII under control of ITGA2B (IIb) promoter] with an F8 knockout rat SS-F8em2Mcwi (RGD:152975964). This transgenic rat strain expressed B-domain deleted human F8 under the control of ITGA2B promoter in the absence of rat F8 product.152977766LE-Tg(Drd2-IL2RA/YFP)1Koba<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1337 > National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2022-07-06)RRID:RGD_152977766Background strain: Iar:LE (Institute for Animal Reproduction) ( RGD:18337282). This strain was generated by injecting a modified BAC, in which a fusion protein created from the human IL2R alpha-subunit gene (IL2RA) and YFP was inserted into the second exon of the rat Drd2 gene, into fertilized eggs of Long-Evans rats.152977768WIC-Tg(Oprk1-YFP*)1Utthe<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1338 > National BioResource Project for the Rat in Japan</a>transgenicUnknownRRID:RGD_152977768The KOR-Venus construct consisting of promoter of rat Oprk1 (opioid receptor, kappa 1) fused with Venus fluorescent protein, was introduced into fertilized eggs of Wistar rats (Crlj:WI, Charles River Japan). They were then crossed with Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction) to maintain the strain. Transgenic rats expressing the fluorescent protein Venus under the control of the Oprk1 promoter. This strain is heterozygous.152985526WIC-<i>Cdkn2a<sup>em1Kyhs</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1339> National BioResource Project for the Rat in Japan</a>mutantUnknownRRID:RGD_152985526A 7-bp deletion in exon 1 of the Cdkn2a (p16) gene was introduced by the CRISPR/Cas9. Genetic background is Iar:Wistar-Imamichi (Institute for Animal Reproduction) (RGD:125097496). Introducing the deletion mutation in the Cdkn2a (p16) gene into the background of DMD rats (muscular dystrophy model rats) improves muscle pathology.152995284W/NovInstitute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, RussiainbredUnknownRRID:RGD_152995284Substrain of Wistar, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk)152999000LE-<i>Fxn<sup> em2Fara-/+</sup></i>mutantUnknownFxn<sup> em2Fara</sup>152999006RRID:RGD_152999000Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system152999001LE-<i>Fxn<sup> em1Fara-/+</sup></i>mutantUnknownFxn<sup> em1Fara</sup>152999004RRID:RGD_152999001Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9152999002LE-<i>Fxn<sup> em2Fara-/+</sup></i>/RrrcmutantUnknownFxn<sup> em2Fara</sup>152999006RRID:RRRC_00961Heterozygous KO of the Fxn gene obtained by targeting exon 4 with CRISPR/Cas9 system152999003LE-<i>Fxn<sup> em1Fara-/+</sup></i>/Rrrc<a href=http://www.rrrc.us/Strain/?x=960>Rat Resource and Research Center</a>mutantUnknownFxn<sup> em1Fara</sup>152999004RRID:RRRC_00960Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9152999023SD-<i>Aif1<sup>tm(EGFP)Apps</sup></i>/MmmcDepartment of Pharmacology, University of Maryland School of Medicine, Baltimore, Maryland 21201mutantUnknownAif1<sup>tm(EGFP)Apps</sup>152999024RRID:RGD_152999023Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using
CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the
EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine
teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately
downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just
downstream of the translational start site were used.153298963Taiep/JosvRrrc<a href=http://www.rrrc.us/Strain/?x=963>Rat Resource and Research Center</a>mutantUnknownRRID:RRRC_00963These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 and donated by John Svaren to RRRC now are maintained at RRRC153323320MR/NRrrcMaudsely reactive<a href=http://www.rrrc.us/Strain/?x=00173>Rat Resource and Research Center</a>, <a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>inbredLive Animals; Cryopreserved Embryo; Cryorecovery (as of 2023-10-25)RRID:RRRC_00173Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). Now is available at Rat Resource & Research Center153323324FXLE12/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)Diabetes Obesity; CancerRRID:RGD_153323324This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. This substrain was maintained at Medical College of Wisconsin153344518FXLE15/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_153344518This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. This substrain was maintained at Medical College of Wisconsin153344519LEXF1C/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)Diabetes Obesity; CancerRRID:RGD_153344519This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin153344520LEXF6B/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)Diabetes Obesity; CancerRRID:RGD_153344520This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin.155260360COP/HsdUwmRrrcCopenhagen<a href=http://www.rrrc.us/Strain/?x=966>Rat Resource and Research Center</a>, <a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-25)RRID:RRRC_00966Donated from Michael Gould/Jim Shull at University of Wisconsin Madison to Rat Resource & Research Center,155260361SD-Tg(Sycp1-Cas9-eGFP)SynblRrrc<a href=http://www.rrrc.us/Strain/?x=968&log=yes>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2022-10-06)Genetics, Reproductive Biology, Gene Conversion, Active GeneticsRRID:RRRC_00968This project entailed generation of a novel rat strain in which a P2A-Cas9-T2A-EGFP coding sequence was inserted at the stop codon of the rat Sycp1 gene for co-expression of Cas9 and EGFP under the control of the Sycp1 regulatory elements. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin
URL: Doi:10.1101/2022.08.30.505951155260362SD-Tg(Ddx4-Cas9)SynblRrrc<a href=http://www.rrrc.us/Strain/?x=969&log=yes>Rat Resource and Research Center</a>transgenicUnknownGenetics, Reproductive Biology, Gene Conversion, Active GeneticsRRID:RRRC_00969rat strain designed to express Cas9 under the control of the rat Ddx4 (Vasa) regulatory elements while also retaining expression of Ddx4. The strategy entailed insertion of a P2A sequence followed by human-codon-optimized Cas9 coding sequences with nuclear localization signals near the C-terminus of the rat Ddx4 (Vasa) gene. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951
URL: Doi:10.1101/2022.08.30.505951155260363SD-Tg(Cyp2e1-CYP2E1*-Cas9)SynblRrrctransgenicCryopreserved Sperm (as of 2022-10-06)Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450RRID:RGD_155260363rat strain in which the rat Cyp2e1 gene is humanized by insertion of a human CYP2E1 minigene (CYP2E1*) insert at the native start codon. The insert also included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance of the modified allele when crossed to a rat expressing Cas9 in the germline. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951
URL: URL: Doi:10.1101/2022.08.30.505951155260364SD-Tg(Cyp3a23-3a1-Cyp3A4*-Cas9)SynblRrrc<a href=http://www.rrrc.us/Strain/?x=970&log=yes>Rat Resource and Research Center</a>transgenicCryopreserved Sperm (as of 2022-10-06)Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450RRID:RRRC_00970rat strain in which the rat Cyp3a1 gene (Cyp3a23-3a1, RGD:628626) was inactivated by insertion of a human CYP3A4 minigene (Cyp3A4*) and the linked rat Cyp3a2 locus was simultaneously mutated by CRISPR-mediated indel introduction. Strain contains Indel 8 at the Rat 3A2 locus (55 kb away), The CYP3A4 minigene included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance. Strain contains and Active Genetic cassette which encodes a gRNA targeting the Rat 3A1 and 3A2 translation initiation site. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951
URL: URL: Doi:10.1101/2022.08.30.505951155260365SD-Tg(Sycp1-Cas9-eGFP)SynblCreated by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USAtransgenicCryopreserved Sperm (as of 2022-10-06)Genetics, Reproductive Biology, Gene Conversion, Active GeneticsRRID:RGD_155260365This project entailed generation of a novel rat strain in which a P2A-Cas9-T2A-EGFP coding sequence was inserted at the stop codon of the rat Sycp1 gene for co-expression of Cas9 and EGFP under the control of the Sycp1 regulatory elements. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin
URL: Doi:10.1101/2022.08.30.505951155260366SD-Tg(Ddx4-Cas9)SynblCreated by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USAtransgenicUnknownGenetics, Reproductive Biology, Gene Conversion, Active GeneticsRRID:RGD_155260366rat strain designed to express Cas9 under the control of the rat Ddx4 (Vasa) regulatory elements while also retaining expression of Ddx4. The strategy entailed insertion of a P2A sequence followed by human-codon-optimized Cas9 coding sequences with nuclear localization signals near the C-terminus of the rat Ddx4 (Vasa) gene. Animals express Cas9 in the testis in the spermatogonial layer and in meiosis stages with 4N DNA content. Strain catalyzes high levels of Active Genetic Gene conversion when paired with certain Active Genetic cassettes. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951
URL: Doi:10.1101/2022.08.30.505951155260367SD-Tg(Cyp2e1-CYP2E1*-Cas9)SynblCreated by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USAtransgenicCryopreserved Sperm (as of 2022-10-06)Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450RRID:RGD_155260367rat strain in which the rat Cyp2e1 gene is humanized by insertion of a human CYP2E1 minigene (CYP2E1*) insert at the native start codon. The insert also included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance of the modified allele when crossed to a rat expressing Cas9 in the germline. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951
URL: URL: Doi:10.1101/2022.08.30.505951155260368SD-Tg(Cyp3a23-3a1-Cyp3A4*-Cas9)SynbCreated by Dr. Kurt Jarnagin at Synbal, Inc.San Diego, CA, USAtransgenicCryopreserved Sperm (as of 2022-10-06)Genetics, Reproductive Biology, Gene Conversion, Active Genetics, Drug Metabolism, Cyp450RRID:RGD_155260368rat strain in which the rat Cyp3a1 gene (Cyp3a23-3a1, RGD:628626) was inactivated by insertion of a human CYP3A4 minigene (Cyp3A4*) and the linked rat Cyp3a2 locus was simultaneously mutated by CRISPR-mediated indel introduction. Strain contains Indel 8 at the Rat 3A2 locus (55 kb away), The CYP3A4 minigene included a CRISPR/Cas9 gene drive element to enable super-Mendelian inheritance. Strain contains and Active Genetic cassette which encodes a gRNA targeting the Rat 3A1 and 3A2 translation initiation site. ROBUST AND EFFICIENT ACTIVE GENETICS GENE CONVERSION IN THE RAT AND MOUSE Chenyen Lai, Oscar Alvarez, Kristen Read, Don van Fossan,Christopher M Conner, Shannon Xaing-Ru Xu, Dale O. Cowley, Valentino Gantz, David R. Webb, Kurt Jarnagin URL: Doi:10.1101/2022.08.30.505951 URL: Doi:10.1101/2022.08.30.505951
URL: URL: Doi:10.1101/2022.08.30.505951155269039WI;WDB-<i>ROSA26<sup>tm1(H2B-tdTomato)</sup></i>/NipsmutantCryopreserved Embryo (as of 2022-10-11)RRID:RGD_155269039PCR products of the human H2BC11 (H2B-6), tdTomato, splice acceptor sequence, and IRES-Neor-SV40pA were inserted into the NheI site of prROSA26-1 with an in-fusion cloning kit. The final tdTomato-H2B-6 targeting vector was linearized by SalI digestion. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation. Targeted ES cells were injected into Crlj:WI (RGD ID: 2312504) blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats.These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.155269040F344-Tg(CAG-ACE2)057BrydtransgenicLive Animals (as of 2022-10-11)RRID:RRRC_00946The human ACE2 gene was placed under control of the synthetic CAG promoter which allows ubiquitous expression of the gene. Based on droplet digital PCR analysis, the strain carries only 1 copy of the transgene. The integration site is unknown. These rats express the human ACE2 gene. The encoded protein is a functional receptor for the spike glycoprotein of several human coronaviruses including SARS-CoV-2, the causative agent of coronavirus disease-2019 (COVID-19).155269102McwiWfsmAap:HSHeterogeneous stockDr. Abraham Palmer laboratory at UCSDoutbredUnknownRRID:RGD_155269102This HS is maintained and distributed from Dr. Palmer's laboratory at UCSD. The origin of HS was from 25 breeding pairs obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy. The Wake Forest HS rats were derived from NMcwi:HS at the Medical College of Wisconsin and maintained at Wake Forest Baptist Medical Center starting in 2017. The colony from Wake Forest was sent to Dr. Palmer's laboratory at University of California San Diego
Department of Psychiatry.155598601SD-<i>Bmal1<sup>em1Mcwi</sup></i>MCW Gene Editing Rat Resource CentermutantUnknownBmal1<sup>em1Mcwi</sup>155598603RRID:RGD_155598601CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein.155630631CD-<i>Ctns<sup>em2Vjupk</sup></i>Vernon Jansen Unit, Faculty of Medical and Health Sciences, The University of Auckland, Auckland, New ZealandmutantUnknownCtns<sup>em2Vjupk</sup>155630632RRID:RGD_155630631The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 2-bp insertion which results in frameshift and pre-mature stop truncated protein.155630633CD-<i>Ctns<sup>em3Vjupk</sup></i>Vernon Jansen Unit, Faculty of Medical and Health Sciences, The University of Auckland, Auckland, New ZealandmutantUnknownCtns<sup>em3Vjupk</sup>155630634RRID:RGD_155630633The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 8-bp insertion which results in frameshift and pre-mature stop truncated protein.155630635CD-<i>Ctns<sup>em4Vjupk</sup></i>Vernon Jansen Unit, Faculty of Medical and Health Sciences, The University of Auckland, Auckland, New ZealandmutantUnknownCtns<sup>em4Vjupk</sup>155630636RRID:RGD_155630635The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 7-bp deletion which results in frameshift and pre-mature stop truncated protein.155631259TaiepDepartamento de Ciencias Fisiologicas, Universidad Autonoma de Puebla, Mexico.mutantUnknownRRID:RGD_155631259These mutants were found in Sprague-Dawley rats at University of Puebla in 1989. A spontaneous neurological mutation was detected in a colony of Sprague Dawley rats. The animals developed a progressive neurological syndrome characterized by tremor (which appeared at the age of 1 month), ataxia (at 4 months), immobility episodes (after 5-6 months), audiogenic seizures and hindlimb paralysis (after 10 months). Cross breeding experiments indicate that this is an autosomal recessive mutation, The rat line was named taiep (tremor, ataxia, tonic immobility episodes, epilepsy and paralysis) rats.155631261SD-<i>Brca1<sup>em1Kyo</sup></i>Kyoto University
Institute of Laboratory Animals Graduate School of Medicine Yoshida Konoe-cho, Skyo-ku, Kyoto 606-8501
JAPANmutantUnknownBrca1<sup>em1Kyo</sup>155631262RRID:RGD_155631261CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9 targeting exon 4 of rat Brca1was injected to fertilized eggs of Jcl:SD rats (Clea Japan). The founder animal carried c.188T>A (p.L63X) was mated to closed-colony Jcl:SD rats.155631278SD-<i>Flna<sup>em1Ang</sup></i>The Transgenic Rats and ImmunoPhenomic (TRIP) facility in Nantes (France).mutantUnknownFlna<sup>em1Ang</sup>155631280RRID:RGD_155631278This mutant strain was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene.155631285SD-Tg(MECP2 )ChnsrtransgenicUnknownRRID:RGD_155631285PAC671D9 (AF031078) DNA containing all the exons of human MECP2 was injected to SD embryos to generate MECP2 duplication rat.155631289SD-<i>Pde6b<sup>em1Cgen</sup></i>mutantUnknownPde6b<sup>em1Cgen</sup>155631290RRID:RGD_155631289This mutant strain was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. Pde6b knock out rat was successfully created.155631293SD-<i>Pde3a<sup>em1Bdr</sup></i>Max-Delbr'ck-Center for Molecular Medicine (MDC) in the Helmholtz Association, Berlin, GermanymutantUnknownPde3a<sup>em1Bdr</sup>155631294RRID:RGD_155631293The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 9-bp deletion within the conserved 15-bp regulatory region that leads to the loss of 3 amino acids (aa 441-443 analogous to human PDE3A aa 444-446).155631295SD-<i>Pde3a<sup>em2Bdr</sup></i>Max-Delbr'ck-Center for Molecular Medicine (MDC) in the Helmholtz Association, Berlin, GermanymutantUnknownPde3a<sup>em2Bdr</sup>155631296RRID:RGD_155631295The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the region in the rat Pde3a gene homologous to the human T445N mutation. The rat model exhibits a 20-bp deletion within the conserved 15-bp regulatory region that leads to n a frameshift and thus in a truncated and functionally deleted protein (functional DEL).155631298SD-<i>Pde3a<sup>em3Bdr</sup></i>Max-Delbr'ck-Center for Molecular Medicine (MDC) in the Helmholtz Association, Berlin, GermanymutantUnknownPde3a<sup>em3Bdr</sup>155631299RRID:RGD_155631298The rat mutant was generated by pronuclear microinjection of Sprague-Dawley rat zygotes with a mixture of Cas9/Cas9 system to target the catalytic domain in the rat Pde3a gene. The model has a carriesa CGT to TGD missense mutation and results in R862C substitutions in the protein155641233SD-Tg(Rho*P23H)1Lav<a href=http://ophthalmology.ucsf.edu/matthew-lavail-phd-retinal-degeneration-rat-model-resource/> Retinal Degeneration Rat Model Resource </a>,<a href=http://www.rrrc.us/Strain/?x=639>Rat Resource and Research Center</a>transgenicUnknownRRID:RGD_155641233This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A).155641235WMI/EerWKY most immobileDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, IllinoisinbredUnknownRRID:RRRC_009733 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated.155641237WLI/EerWKY least immobileDept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, IllinoisinbredUnknownRRID:RRRC_009673 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated.155641239SS.SR-(<i>rs65785750-rs13452155</i>)/OpazRrrcWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenicCryopreserved Sperm; Cryorecovery (as of 2022-11-03)RRID:RRRC_00612Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains155641240SS.SR-(<i>rs65785750-rs106808193</i>)/OpazRrrcWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenicCryopreserved Sperm (as of 2022-11-03)RRID:RRRC_00613Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains155641241SS.SR-(<i>rs105019230-D17Rat44</i>)/OpazRrrcWhitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenicCryopreserved Sperm (as of 2022-11-03)RRID:RRRC_00616Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains.155641245SD-Tg(Oprm1-icre)1OttcThis rat was produced by <a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>.transgenicLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-12-13)RRID:RRRC_00975Targeted knock-in adding a T2A-iCre to the Oprm1 (mu opioid receptor) in this cre recombinase reporter SD rat155641246F344-Tg(Cx3cr1-cre/ERT2)3OttcRrrctransgenicUnknownRRID:RGD_155641246The transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter.155641247F344.LE-ROSA26 <sup>em1(LTR-nLuc)Ottc</sup>/RrrcmutantUnknownRRID:RRRC_00926The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.155641248SD-ROSA26<sup>em1(LTR-nLuc)Ottc</sup>/RrrcThis strain was created by <a href=http://irp.drugabuse.gov/OTTC/index.php>Optogenetics and Transgenic Technology Core</a>.mutantUnknownRRID:RRRC_00925The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.155641251F344-Tg(CAG-ACE2)057BrydRrrc<a href=http://www.rrrc.us/Strain/?x=946>Rat Resource and Research Center</a>transgenicLive Animals (as of 2022-11-04)RRID:RRRC_00946The human ACE2 gene was placed under control of the synthetic CAG promoter which allows ubiquitous expression of the gene. Based on droplet digital PCR analysis, the strain carries only 1 copy of the transgene. The integration site is unknown. These rats express the human ACE2 gene. The encoded protein is a functional receptor for the spike glycoprotein of several human coronaviruses including SARS-CoV-2, the causative agent of coronavirus disease-2019 (COVID-19).155663364SD-Del(Yp)1McwiMedical College of WisconsinmutantLive Animals (as of 2022-11-11)RRID:RGD_155663364CRISPR guide RNAs flanking Sry4a and Sry1 (Sry) on the Y-chromosome were injected into Crl:SD strain embryos. Chromosomal deletions have not been explicitly defined.155663365CD-Tg(RNECO-180E22)208ArnoArt Arnold laboratory, University of California Los AngelestransgenicUnknownRRID:RGD_155663365This transgenic model line 208 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y.155663366CD-Tg(RNECO-180E22)424ArnoArt Arnold laboratory, University of California Los AngelestransgenicUnknownRRID:RGD_155663366This transgenic model line 424 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y.155663367CD-Tg(RNECO-180E22)733ArnoArt Arnold laboratory, University of California Los AngelestransgenicUnknownRRID:RGD_155663367This transgenic model line 733 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y.155663368CD-Tg(RNECO-180E22)737ArnoArt Arnold laboratory, University of California Los AngelestransgenicUnknownRRID:RGD_155663368This transgenic model line 737 was made by injecting bacterial artificial chromosome (BAC) RNECO-180E22, into Crl:CD(SD) strain embryos. The BAC clone RNECO-180E22, a kind gift of Helen Skaletsky, is derived from Rattus norvegicus strain SHR chromosome Y.155663559SD-<i>Gcg<sup>tm1(iCre)Lrina</sup></i>This strain was created by Dr. Linda Rinaman PhD at Florida State UniversitymutantLive Animals (as of 2022-11-28)Neuroscience, diabetes, metabolic syndrome, obesity, anxietyRRID:RGD_155663559CRISPR/Cas9 technology was used to insert an IRES for iCre expression after the final coding sequence of exon 6 of the rat Gcg gene, before the 3' UTR.155663560SD-<i>Gcg<sup>tm1(iCre)Lrina</sup></i>/RrrcThis strain was created by Dr. Linda Rinaman PhD at Florida State University, and now deposited at <a href=http://www.rrrc.us/Strain/?x=983>Rat Resource and Research Center</a>mutantUnknownNeuroscience, diabetes, metabolic syndrome, obesity, anxietyRRID:RRRC_00983CRISPR/Cas9 technology was used to insert an IRES for iCre expression after the final coding sequence of exon 6 of the rat Gcg gene, before the 3' UTR.155663675LE-Tg(ChAT-cre)5.1DeistransgenicLive Animals; Cryopreserved Sperm (as of 2022-12-05)RRID:RGD_155663675Cre gene was introduced immediately before the ATG of the mouse choline acetyltransferase (Chat) gene in BAC RP23-246B12. This strain is estimated to carry 6 copies of the transgene at the integration site.155782877SHRSP/NgskMeltwDepartment of Life Sciences in Molecular Embryological & DNA Methylation Lab at National Chung Hsing University, TaiwaninbredLive Animals (as of 2022-12-07)Chronic kidney disease; Hypertension; Proteinuria; StrokeRRID:RGD_155782877Imported from Kyoto University in 2010, now maintained at Molecular Embryological & DNA Methylation Lab at National Chung Hsing University, Taiwan.155782879SS-Chr3<sup>BN</sup>.SS-<i>(D3Rat26-D3Mgh30)</i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782879SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782880SS-Chr 3<sup>BN</sup>.SS-<i>(D3Arb3-D3Rat93)( D3Rat78-D3Rat1)</i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782880SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782881SS-Chr3<sup>BN</sup>.SS-<i>(D3Rat222-D3Rat218)</i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782881SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782885SS-Chr3<sup>BN</sup>.SS-(D3Rat36-D3Rat156)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782885SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782909SS-Chr3<sup>BN</sup>.SS-(D3Arb22 - D3Mgh30)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782909SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782910SS-Chr3<sup>BN</sup>.SS-(D3Rat154 - D3Mgh30)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782910SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782911SS-Chr3<sup>BN</sup>.SS-(D3Rat26 - D3Rat14)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782911SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782912SS-Chr3<sup>BN</sup>.SS-(D3Rat26 - D3Rat5)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782912SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782913SS-Chr3<sup>BN</sup>.SS-(D3Rat12 - D3Mgh30)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782913SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782914SS-Chr3<sup>BN</sup>.SS-(D3Rat217- D3Mgh30)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782914SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155782915SS-Chr3<sup>BN</sup>.SS-(D3Rat26 - D3Rat217)/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155782915SS/JrHsdMcwi were crossed with SS-3BN/Mcwi, rats from F1 were intercrossed and genotyped to select the congenic strain carrying introgressed chromosome 3 from SS to BN.155791425SS-Chr 3<sup>BN</sup>-<i>Il2rg<sup>em1Mcwi</sup></i>/McwiMedical College of WisconsinmutantUnknownRRID:RGD_155791425The IL2Rg gene was targeted in the SS/JrHsdMcwi rat by
TALEN injection into single-cell rat embryos. Once established, a homozygous (RGD:12790632) female rat from the SSIL2Rg line was intercrossed with a homozygous SS.BN3 (RGD:1358154) male to yield heterozygous SS.BN3IL2Rg offspring (F1),
followed by brother-sister mating to yield homozygous SS.
BN3IL2Rg offspring by the F3 generation. This strain is Immunodeficient Ilrg (X-SCID) mutant consomic line.155791431SS-Chr 3<sup>BN</sup>.SS-<i>(D3Arb3-D3Rat93)( D3Rat78-D3Rat1)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155791431Immunodeficient congenic line developed by intercross of SS-Chr 3BN.SS-(D3Arb3-D3Rat93)( D3Rat78-D3Rat1)/Mcwi (RGD:155782880) withSS-Il2rgem1Mcwi (RGD:12790632) to breed the Il2rg (X-SCID) mutation into this background.155791432SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat26-D3Mgh30)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155791432Immunodeficient congenic line developed by intercross of SS-Chr3BN.SS-(D3Rat26-D3Mgh30)/Mcwi(RGD:155782879)
withSS-Il2rgem1Mcwi (RGD:12790632) to breed the Il2rg (X-SCID) mutation into this background.155791433SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat222-D3Rat218)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155791433Immunodeficient congenic line developed by intercross of SS-Chr3BN.SS-(D3Rat222-D3Rat218)/Mcwi(RGD:155782881)
withSS-Il2rgem1Mcwi (RGD:12790632) to breed the Il2rg (X-SCID) mutation into this background.155791434SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat222-D3Got42)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155791434Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218)-Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. .155791435SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat222-D3Mco33)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155791435Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218)-Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines.155791436SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat26-D3Rat218)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155791436Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218)-Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines.155791437SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat160-D3Rat218)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. congenicUnknownRRID:RGD_155791437Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218)-Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines.155791438SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat164-D3Rat218)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. mutantUnknownRRID:RGD_155791438Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218)-Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines.155791439SS-Chr 3<sup>BN</sup>.SS-<i>(D3Mgh13-D3Rat218)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. mutantUnknownRRID:RGD_155791439Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218)-Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines.155791440SS-Chr 3<sup>BN</sup>.SS-<i>(D3Rat 86 to D3Rat218)-Il2rg<sup>em1</sup></i>/McwiThis strain was submitted by Dr. Amit Joshi Medical College of Wisconsin. mutantUnknownRRID:RGD_155791440Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218)-Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines.155791645BN/NOlaHsdinbredUnknownRRID:RGD_155791645In 1980, from National Institutes of Health, Bethesda, USA (BN/SsN, RGD:61115)
to OLAC (now Envigo).155804258BN/RijinbredUnknownRRID:RGD_155804258inbred Brown Norway (BN) rat strain produced in the Rijswijk colony.155888488MWF/SimwMcwiMedical College of WisconsininbredLive Animals (as of 2023-02-07)RRID:RGD_155888488A colony of inbred Munich Wistar Fromter (MWF) rats maintained at the Medical College of Wisconsin since 2014, more than 20 breeding generations. Imported from a colony at Indiana University maintained more than 20 years; originally obtained from Roland Blatz at the University of California, San Diego155888489MWF/SimwIndiana UniversityinbredLive Animals (as of 2023-02-07)RRID:RGD_155888489A colony of Munich Wistar Fromter (MWF) rats maintained at Indiana University over 20 years, originally obtained from Roland Blatz at the University of California, San Diego155900755SD-<i>Chrna6<sup>em1Slot</sup></i>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2023-02-09)Drug Addiction, Nicotine/Tobacco AddictionChrna6<sup>em1Slot</sup>155900756RRID:RRRC_00984Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous GG nucleotide modification at position 123 within the CHRNA6 gene 3'UTR.155900757SD-<i>Chrna6<sup>em2Slot</sup></i>mutantUnknown (as of 2023-12-19)Drug Addiction, Nicotine/Tobacco AddictionChrna6<sup>em2Slot</sup>155900759RRID:RRRC_00985Using CRISPR/Cas9 genomic engineering in rats via homologous end-joining in fertilized embryos, we have knocked'in a humanized CHRNA6 3'UTR in place of the natural CHRNA6 3'UTR of the Sprague Dawley rat line. This new genetically modified CHRNA6C123G humanized rat line carries a homozygous CC nucleotide modification at position 123 within the CHRNA6 gene 3'UTR.156212871HSRA/Ummcheterogeneous stock-derived renal agenesis ratMichael Garrett, University of Mississippi Medical CenterinbredLive Animals (as of 2023-02-14)Renal agenesis, CAKUT, altered neprhogenesisRRID:RGD_156212871An inbred strain derived from the Heterogeneous Stock by selective inbreeding more than 20 generations for spontaneous renal agenesis.156340304MWF/HsdMcwiMunich Wistar Fromter<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156340304These are re-derived rats of from substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley and now maintained at Medical College of Wisconsin156354230PVG/SeacMcwiPiebald Virol Glaxo<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)ImmunologyRRID:RGD_156354230These are re-derived rats of from Seac Yoshitomi, LTD., Fukuoka, Japan. and maintained at Medical College of Wisconsin.156362762RCS/LavRrrcMcwiroyal college of surgeons rat<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156362762These are re-derived rats of from RCS/LavRrrc and maintained at Medical College of Wisconsin. Originally developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Then to University of California- San Francisco, School of Medicine, deposited to Rat Resource & Research Center.156368567BDIX/NemOdaMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)CancerRRID:RGD_156368567These are re-derived rats of from BDIX/NemOda and maintained at Medical college of Wisconsin. This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992.156403001BUF/MnaMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)Cancer; UrologyRRID:RGD_156403001These are re-derived rats of from BUF/Mna and maintained at Medical College of Wisconsin. BUF strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10.156406412HTX/KyoMcwihydrocephalus texas<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)NeurobiologyRRID:RGD_156406412These are re-derived rats of from HTX/Kyo and maintained at Medical College of Wisconsin.1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992.156420138MR/HarMcwiMaudsely reactive<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420138These are re-derived rats of MR/Har now maintained at Medical College of Wisconsin. This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965.156420139MNS/NMcwiMilan normotensive strain<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420139These are re-derived rats of MNS/N now maintained at Medical College of Wisconsin. Origin: Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS.156420144HXB1/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420144Embryo-rederived from breeder stock HXB1/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin.156420145HXB7/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420145Embryo-rederived from breeder stock HXB7/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin.156420146HXB13/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420146Embryo-rederived from breeder stock HXB13/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin.156420147HXB17/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420147Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin.156420148HXB18/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420148Embryo-rederived from breeder stock HXB18/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin.156420149HXB23/IpcvMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420149Embryo-rederived from breeder stock HXB23/Ipcv provided by Pravenec and Kren from the Prague colonies, maintained at Medical college of Wisconsin.156420150BXH6/CubMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, contact Hybrid Rat Diversity Panel at
<a href=mailto:HRDP@mcw.edu> HRDP@mcw.edu </a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156420150Embryo-rederived from breeder stock BXH6/Cub provided by Dr. Kren from Charles University, Department of Biology, Prague, Czech Republic, maintained at Medical College of Wisconsin156420151ZDF-<i>Lepr<sup>fa/+</sup></i>/Crl<a href=https://www.criver.com/products-services/find-model/zdf-rat-lean-fa?region=3611>Charles River Laboratories </a>coisogenicUnknownRRID:RGD_156420151This is the control model for the ZDF-Leprfa/Crl.156420152Mlac:WRWistar rats<a href=https://nlac.mahidol.ac.th/en/index.php/mlacwr/> National Laboratory Animal Center, Mahidol University Thailand</a>outbredUnknownRRID:RGD_156420152This outbred Wistar was maintained at National Laboratory Animal Center (NLAC), Thailand. All animals were housed at the Chulalongkorn University Laboratory Animal Center (CULAC) .156420153Mlac:SDSprague Dawley rats<a href=https://nlac.mahidol.ac.th/en/index.php/mlacwr/> National Laboratory Animal Center, Mahidol University Thailand</a>outbredUnknownRRID:RGD_156420153This outbred Sprague Dawley was maintained at National Laboratory Animal Center (NLAC), Thailand. All animals were housed at the Chulalongkorn University Laboratory Animal Center (CULAC) .156430076LEXF1A/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430076This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430077LEXF2A/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430077This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430078LEXF2B/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430078This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430079LEXF2C/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430079This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430080LEXF3/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)Diabetes Obesity; CancerRRID:RGD_156430080This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430081LEXF4/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430081This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430082LEXF5/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430082This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430083LEXF7A/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430083This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430085LEXF7B/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430085This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430086LEXF7C/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430086This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430087LEXF8A/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430087This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430089LEXF8D/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430089This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430090LEXF9/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430090This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430091LEXF10B/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430091This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430092LEXF10C/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430092This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430093LEXF11/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430093This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430094FXLE13/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430094This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430095FXLE14/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430095This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430099FXLE16/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430099This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430100FXLE17/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430100This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430101FXLE18/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430101This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430102FXLE19/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430102This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430103FXLE21/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430103This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430104FXLE22/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430104This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430105FXLE23/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430105This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430106FXLE24/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430106This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430107FXLE25/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430107This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430108FXLE26/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430108This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm.156430109FXLE20/StmMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430109This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. This substrain was maintained at Medical College of Wisconsin156430110BXH12/CubMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_156430110Embryo-rederived from breeder stock BXH12-1/Cub provided by Dr. Kren from Charles University, Department of Biology, Prague, Czech Republic, maintained at Medical College of Wisconsin156430169SD-<i>Mecp2<sup>em1Sage</sup></i>/Hsd<a href=https://www.envigo.com/model/hsdsage-sd-mecp2em1sage> ENVIGO</a>mutantCryopreserved Embryo (as of 2023-02-22)Autism, Rett syndrome, CognitionRRID:RGD_156430169The MeCP2 KO rat model was originally created at SAGE Labs,
Inc. in St. Louis, MO and distributed out of the Boyertown, PA
facility. The line continues to be maintained through the original
SAGE Labs animal inventory acquired by Envigo. The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2).156430327FSLFlinders Sensitive Line RatKarolinska Institutet, Stockholm SwedeninbredUnknownRRID:RGD_156430327Flinders Sensitive Line Rat (FSL) was selectively bred from outbred Sprague Dawley for increased response an anticholinesterase agent. The FSL rat
partially resembles depressed individuals with phenotypes of reduced appetite and psychomotor function but exhibits normal hedonic
responses and cognitive function.156430328FRLFlinders Resistant Line RatKarolinska Institutet, Stockholm SwedeninbredUnknownRRID:RGD_156430328Flinders Resistant Line Rat (FRL) was selectively bred from outbred Sprague Dawley for less response to an anticholinesterase agent than FSL. FRL is not more resistant to the anticholinesterase agent compared to other outbred rats. The FSL rat
partially resembles depressed individuals with phenotypes of reduced appetite and psychomotor function but exhibits normal hedonic
responses and cognitive function.156451369HADhigh-alcohol-drinkingDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianaoutbredUnknownRRID:RGD_156451369These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N (N:NIH) strain . 8 inbred rat strains were intercrossed for alcohol preference and consumption.Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines156451370LADlow-alcohol-drinkingDepartment of Medicine, Indiana University School of Medicine, Indianapolis, IndianaoutbredUnknownRRID:RGD_156451370These low-alcohol-drinking were developed by selective breeding from the heterogeneous strain N:NIH (RGD:728185). 8 inbred rat strains were intercrossed for alcohol preference and consumption. Within-family selection and a rotational breeding design were employed to reduce inbreeding and to allow maintenance of non-inbred replicate lines.158013766SD-<i>Akt1<sup>em1Soar</sup></i>Institute for Reproductive and Developmental Sciences, Department of Pathology
& Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS
66160, USA.mutantUnknownAkt1<sup>em1Soar</sup>158013767RRID:RRRC_00891This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT;
nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein.288084580F344-<i>Txn1<sup>m1Kyo</sup> </i>age dependent mitochondrial cytopathy ratDivision of Animal Genetics, Laboratory Animal Research Center, Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, JapanmutantUnknownNeurobiologyRRID:RGD_288084580This mutation Phe54Leu is an autosomal dominant mutation that appeared in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU). Rats heterozygous for Txn1 (Txn1 /+) exhibited running seizures only in its juvenile stage. The rat called Adem rat, exhibited age dependent mitochondrial cytopathy (Adem). The rats were backcrossed for more than ten generations on the F344/NSlc inbred background to ensure other mutations induced by ENU was reduced. The causative gene was identified as a missense substitution (c. 160 T > C, p. Phe54Leu) in exon 3 of Txn1.288084582F344-<i>Txn1 <sup>em1Kyo</sup></i>Division of Animal Genetics, Laboratory Animal Research Center, Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, JapanmutantUnknownNeurobiologyRRID:RGD_288084582This CRISPR/Cas9 induced mutation Phe54Leu is induced in embryos of F344/NSlc. The genome editing system targeting exon 3 of Txn1 gene ( (c. 160 T > C) was delivered into embryos by electroporation. The two-cell stage embryos were transferred into the oviducts of pseudopregnant females. The rat called Txn1-F54L rat, replicates Adem rats (RGD:288084580) which carried Phe54Leu mutation in the same gene.These two strains exhibit similar phenotype.291492855SD-Tg(Prp-DISC1)UhgCenter for Behavioral Neuroscience, Institute of Experimental Psychology, Heinrich-Heine University D�sseldorf, D�sseldorf, GermanytransgenicUnknownRRID:RGD_291492855Transgenic Sprague Dawley rats were generated by injecting the linearized
fragment of the CosSHa.tet vector containing the full-length, non-mutant
human DISC1 as transgene with the polymorphisms F607 and C704, under the control of the Syrian hamster prion protein promoter, into pronuclei of Sprague Dawley rats.329322880SD-<i>Mertk<sup>em1Cgen</sup></i>mutantLive Animals (as of 2023-04-24)RRID:RGD_329322880The gRNA to rat Mertk gene, and Cas9 mRNA were co-injected into fertilized rat eggs to generate targeted knockout offspring. F0 founder animals were identified by PCR followed by sequence analysis, which were bred to wildtype rat to test germline transmission and F1 animal generation. This strain was derived from founder 6# carrying a 13934 deletion which included exons 3 to 5.329333019SD-<i>Spon2<sup>em1Holi</sup></i>Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan 430060, ChinamutantUnknownSpon2<sup>em1Holi</sup>329333021RRID:RGD_329333019This Spon2 knockout mutant was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats.329812004Ibd:WIWistar ratsoutbredUnknownRRID:RGD_329812004The Wistar rats maintained at The Nencki Institute of Experimental Biology of the Polish Academy of Sciences, Warsaw, Poland329845586W;WIAR-<i>Izumo1<sup>em1Osb</sup></i>Osaka UniversitymutantCryopreserved Sperm (as of 2023-12-28)Izumo1<sup>em1Osb</sup>329845587RRID:RGD_329845586Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (RGD:2304222) (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence:TGG. A 7-bp deletion(CTTTGGA)after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR background KO rats, this strain was mated with Slc:Wistar (RGD:2314928), hence this mutant is in mix background.Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed.329845597WKY-<i>Col4a5<sup>em1Matsu</sup></i>Division of Molecular Genetics, Shigei Medical Research Institute, 2117 Yamada, Minami-ku, Okayama, 701-0202, JapanmutantCryopreserved Embryo (as of 2023-05-30)Col4a5<sup>em1Matsu</sup>329969888RRID:RGD_329845597Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em1 mutant carries a premature stop coden after 9 amino acids due to the insertion of a 20 bp stop codon. Col4a5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age.329845599WKY-<i>Col4a5<sup>em2Matsu</sup></i>Division of Molecular Genetics, Shigei Medical Research Institute, 2117 Yamada, Minami-ku, Okayama, 701-0202, JapanmutantUnknownCol4a5<sup>em2Matsu</sup>329969892RRID:RGD_329845599Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em2 mutant carries a premature stop coden after 15 amino acids due to insertion of a 42bp stop codon. Col4α5 em2 rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age.329845600WKY-<i>Col4a5<sup>em3Matsu</sup></i>Division of Molecular Genetics, Shigei Medical Research Institute, 2117 Yamada, Minami-ku, Okayama, 701-0202, JapanmutantUnknownCol4a5<sup>em3Matsu</sup>329969893RRID:RGD_329845600Genome editing was performed using the rGONAD method to produce three different lines of KO rats due to three different genome mutations thus different in protein expression predication. The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan) (RGD:61119). Tandem STOP codons were designed to integrate into 27 bases after the first ATG in the rat Col4a5 gene This em3 mutant carries a deletion of 56 base pairs containing the first methioine. Col4α5 em3 ratshave urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age.329848962SHRSP.SHR-(<i>D1Got82-D1Rat97</i>)/Izm<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1344> National BioResource Project for the Rat in Japan</a>congenicUnknownRRID:RGD_329848962A subcongenic strain generated by backcrossing SHRSP.SHR-(D1Mgh5-D1Got87)/Izm (NBRP Rat No.0709, RGD:7411707) to SHRSP/Izm. A segment of the QTL region of chromosome 1 involved in salt-induced stroke (Niiya et al. Sci Rep. 2018; 8; 9403) has been exchanged.329848994WIC.WDB-<i>Kiss1<sup>tm1(tdTomato)Nurep</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1345> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2023-06-21)RRID:RGD_329848994Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). The targeting vector (tdTomato/puromycin N-acetyl transferase) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction).329848995WIC;WDB-<i>Kiss1<sup>tm1Nurep</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1346> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2023-06-07)RRID:RGD_329848995The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction).329848998LE-Tg(Drd2-cre)487-3Koba<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1249> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2023-06-07)RRID:RGD_329848998This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs.
Detailed information of BAC: Drd2, CH230-11B15 from the CHORI-230 Female Brown Norway rat BAC Library (BACPAC Resources Center, Children?s Hospital Oakland Research Institute)"329848999LE-Tg(Drd2-cre)490-9Koba<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1348> National BioResource Project for the Rat in Japan</a>transgenicCryopreserved Sperm (as of 2023-06-07)RRID:RGD_329848999This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs. "329849003LE-<i>Pvalb<sup>em2(cre)Koba</sup></i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1347> National BioResource Project for the Rat in Japan</a>mutantUnknownRRID:RGD_329849003A complex of Cas9 protein and gRNA was introduced into Iar:LE fertilized rat eggs by electroporation. Combi-CRISPR (Yoshimi K. et al.) was used to induce knock-in. Knock-in rats were selected and crossed with wild-type rats to establish this strain. Sequence features: the intron just before the fourth exon of the Pvalb gene (intron 3) is deleted by NHEJ after double-strand break by one base compared to the wild-type. ---ttggcgggccagaacctcagggg---(wild-type) ---ttggcgggccagaacc-cagggg---(knock-in)329849006LE;LEH-<i>Ednrb<sup>sl</sup></i>/Kwb<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1349> National BioResource Project for the Rat in Japan</a>congenicCryopreserved Embryo (as of 2023-06-08)Ednrb<sup>sl</sup>10755424RRID:RGD_329849006LEH/Hkv (NBRP Rat No. 0802 aka. RGD:6480220) was resuscitated from frozen embryos and heterozygous male was obtained.
The heterozygous male was mated with female Long-Evans rats (Crlj:LE), and the resulting offspring were deposited to NBRP.329849009F344-<i>Tyr<sup>C</sup>Kit<sup>H</sup>/Hkv</i><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1350> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2023-06-09)Kit|Tyr620568|1589755RRID:RGD_329849009F344-TyrC KitH/Kyo (Black F344, NBRP Rat No. 0768, aka RGD:11040971), carrying 1) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) induced was crossed with F344/NSlc (Japan SLC, Inc.). Then, from the F2 generation, Tyr as a wild-type homozygous (confirmed by sequence) and Kit as a hooded homozygous (confirmed by phenotype) were selected.329849010F344-<i>Tyr<sup>C</sup>Kit<sup>H</sup></i>.LEA-(<i>Tel-D17Got10</i>)/Hkv<a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1351> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2023-06-09)Kit|Tyr620568|1589755RRID:RGD_329849010A congenic strain in which a chromosome 17 fragment of LEA rats (provided by Dr. Tadashi Okamura) was introduced into the F344-TyrC KitH (NBRP Rat No. 0768).329849011SD-<i>Fos<sup>em1Yossi</i></sup><a href=http://www.anim.med.kyoto-u.ac.jp/NBR/strains/Strains_d.aspx?StrainID=1352> National BioResource Project for the Rat in Japan</a>mutantCryopreserved Sperm (as of 2023-06-09)RRID:RGD_329849011SD rats (Slc:SD) in which the c-Fos gene (ENSRNOG00000008015) was disrupted by the CRISPR/Cas9 system. Two guide RNAs and Cas9 protein were injected into the pronucleus of fertilized eggs of SD rats. After injection, they were transferred into the oviducts of the recipient rats and born. The founder rat (line 12) showed abnormal teeth, and PCR and sequencing analysis revealed that 1,067 bases including Exon 1 were deleted. The founder rat were mated with SD rats and bred.329951704ACI.BBDP-(<i>RT1<sup>u</sup></i>)/SunnSunnybrook Research Institute, Toronto, Ontario, Canada.congenicCryopreserved Sperm; Cryorecovery (as of 2023-07-10)RRID:RRRC_007901 BBDP regions [Iddm1(RT1u) was introgressed into the ACI/SegHsd background329951705SD-<i>Cited2<sup>em1Soar</sup></i><a href=http://www.rrrc.us/Strain/?x=807>Rat Resource and Research Center</a>mutantCryopreserved Sperm; Cryorecovery (as of 2023-07-10)hypoxiaRRID:RRRC_00807Deletion of coding sequence (Exon 2) using CRISPR/Cas9329951706SD-<i>Adrm1<sup>em1Uok</sup></i><a href=http://www.rrrc.us/Strain/?x=861>Rat Resource and Research Center</a>mutantCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2023-07-10)RRID:RRRC_00861CRISPR/Cas9-mediated deletion of ATG start site in Exon 2 of Adrm1 gene329955364WKY-Tg(CD68-GFP)KjwKevin Woollard at Imperial College LondontransgenicUnknownglomerulonephritisRRID:RGD_329955364Transgene insertion (human CD68-GFP) using Sleeping Beauty transposon system on Wistar Kyoto rats. Rat monocyte/macrophage reporter strain on a WKY background which has susceptibility to experimental glomerulonephritis. GFP expression occurs exclusively within blood monocytes and tissue macrophages.329955365WKY-Tg(CD68-GFP)KjwRrrcDevelop by Kevin Woollard at Imperial College LondontransgenicCryopreserved Embryo; Cryorecovery (as of 2023-07-11)glomerulonephritisRRID:RRRC_00866Transgene insertion (human CD68-GFP) using Sleeping Beauty transposon system on Wistar Kyoto rats. Rat monocyte/macrophage reporter strain on a WKY background which has susceptibility to experimental glomerulonephritis. GFP expression occurs exclusively within blood monocytes and tissue macrophages.329955449SD-<i>Serpina6<sup>em1Glha</sup></i>Rats were originally bred and maintained at the Center for Disease Modeling.mutantCryopreserved Embryo; Cryorecovery (as of 2023-07-12)Serpina6<sup>em1Glha</sup>329955453RRID:RGD_329955449A CRISPR/cas9 strategy was employed by Sage Labs, to generate Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon.329955451SD-<i>Serpina6<sup>em1Glha</sup></i>/RrrcRats were originally bred and maintained at the Center for Disease Modeling.mutantCryopreserved Embryo; Cryorecovery (as of 2023-07-12)Serpina6<sup>em1Glha</sup>329955453RRID:RRRC_00930A CRISPR/cas9 strategy was employed by Sage Labs, to generate Charles River Sprague Dawley rats with a 53 base pair deletion within SerpinA6. The single guide RNA (sgRNA) targeted sequences within exon 2 of SerpinA6, encoding amino acid residues within the amino-terminal region of the mature Serpina6, also known as corticosteroid-binding globulin (CBG) polypeptide. The resulting 53 base pair deletion removed codons for residues Pro40-Thr57, with a frameshift after Ser39, resulting in a unique 14 residue sequence followed by a TGA stop codon.329955459WKY-<i>P2rx7<sup>em1Tja</sup></i>Imperial College LondonmutantUnknownP2rx7<sup>em1Tja</sup>329955460RRID:RGD_329955459A global P2RX7KO on a WKYbackground was created at Imperial College London using zinc finger nuclease
(ZFN) technology to generate a 2 base pair insertion in exon 10 of P2rx7329955557SD-<i>Ace2<sup>em1(ACE2)Prem</sup></i>mutantLive Animals (as of 2023-07-17)COVID-19 research.ACE21347174RRID:RGD_329955557CRISPR/Cas9 knock-in of the human ACE2 transgene into the endogenous locus of the rat Ace2 gene. Single integration of hACE2, with expression driven by the endogenous rat Ace2 promoter. Provides a more natural expression pattern (versus abundant overexpression as seen in prior models).329969882SD-Tg(Myh6-cre)LizhKey Laboratory of Human Disease
Comparative Medicine, NHFPC, Institute of
Laboratory Animal Science, Peking Union
Medicine College, Chinese Academy of
Medical Sciences,transgenicUnknownRRID:RGD_329969882The heart-specific cre expression plasmid (alpha-MHC-Cre) was produced by inserting the cre coding sequence downstream of the a-MHC (Mgh6) promoter in the a-MHC expression vector. The a-MHC-Cre transgenic rat was generated by microinjection of linearized alpha-MHC-Cre plasmid to Sprague Dawley embryos.329969883SD-<i>Trim44<sup>em1Lizh</sup></i>Key Laboratory of Human Disease Comparative Medicine, NHFPC, Institute of Laboratory Animal Science, Peking Union Medicine College, Chinese Academy of Medical Sciences,mutantUnknownRRID:RGD_329969883A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were linearized and used as templates for in vitro transcription. A mixture of the donor vector (4ââ¬â¦ng/ul), Cas9 mRNA (25ââ¬â¦ng/ul), and sgRNAs (10ââ¬â¦ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO).329969885SD-<i>Trim44<sup>em1Lizh</sup></i>,Tg(Myh6-cre)LizhKey Laboratory of Human Disease Comparative Medicine, NHFPC, Institute of Laboratory Animal Science, Peking Union Medicine College, Chinese Academy of Medical Sciences,mutantUnknownRRID:RGD_329969885The conditional Trim44 knockout (Trim44 cKO, SD-Trim44em1Lizh, RGD:329969883) was bred with the α-MHC-Cre tool rat (SD-Tg(Myh6-cre)Lizh, RGD:329969882) to generate cardiac-specific Trim44 knockout which had the Trim44flox/flox/α-MHC-Cre genotype.401717572SD-<i>Mpo<sup>em1Mcwi</sup></i>Medical College of WisconsinmutantLive Animals (as of 2023-08-07)Mpo<sup>em1Mcwi</sup>401717573RRID:RGD_401717572CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats.401795481WI-<i>Nanos3<sup>em1(tdTomato)Nips</sup></i>mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-11)Nanos3<sup>em1(tdTomato)Nips</sup>401795483RRID:RGD_401795481The targeting vector was designed to replace the stop codon of Nanos3 with T2A-2xtdTomato. The adeno-associated virus carrying the targeting vector was infected to Crlj:WI (RGD ID: 2312504) rat 1 cell zygotes followed by the introduction of CRISPR/Cas9 ribonucleoprotein complex by electroporation. After incubation overnight, the zygotes were transferred into oviducts of pseudo-pregnant rats. The pups were judged correct gene-targeting by genomic PCR. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. The tdTomato fluorescence faithfully label Nanos3 expressing cells.401795484CD-<i>Slc30a10<sup>em1Sommu</sup></i>The strain was submitted by Dr. Somshuvra Mukhopadhyay from the University of Texas at Austin.mutantCryopreserved Sperm (as of 2023-09-11)neuroscience, toxicology, metal homeostasis, physiology, manganese toxicitySlc30a10<sup>em1Sommu</sup>401795485RRID:RGD_401795484Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line.401799619SD-Tg(Acr3-EGFP)NipstransgenicCryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-12)RRID:RGD_401799619This transgenic strain was created by intracytoplasmic sperm injection (ICSI) mediated DNA transfer. Linearized Acr3-EGFP plasmid DNA (Nakanishi et al., FEBS Lett. 1999; 0.1 micrograms/ml) is mixed with sperm heads of Slc:SD rats for 2 min. The sperm head is microinjected into ovulated oocytes of Slc:SD rat (RGD ID:12910483) and incubated overnight prior to embryo transfer to pseudopregnant females. Resultant pups are examined for correct gene-targeting by genomic PCR, and maintained by crossing the founder with Slc:SD rat.401824639SD-<i>Fah<sup>em3Mcwi</sup>Il2rg<sup>em2Mcwi</sup>Rag1<sup>em6Mcwi</sup>Medical College of Wisconsin, Aron Geurts, ageurts@mcw.edu.mutantCryopreserved Sperm (as of 2023-09-18)RRID:RGD_401824639Produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgem2Mcwi (RGDID:10002794) and SD-Fahem3Mcw (RGDID: 10002791). The resulting CRISPR-induced mutation in Rag1 deletes 25-bp (rn7: chr3:87,923,384-87,923,408) and inserts 17 bp (ACCCTAAACAGCTGTGC) for a net 8-bp deletion.401824640SD.SD-<i>Fah<sup>em3Mcwi</sup>Il2rg<sup>em2Mcwi</sup>Rag1<sup>em6Mcwi</sup>/McwiMedical College of Wisconsin, Aron Geurts, ageurts@mcw.edu.congenicCryopreserved Sperm (as of 2023-09-18)RRID:RGD_401824640This model was made by taking RGD:401824639 (Fah, Il2rg, and Rag1 triple knockout model) and backcrossing to Crl:SD, then intercrossing multiple generations again until all three gene alleles were homozygous again.401827145LE-<i>Pink1<sup>em1Davis</sup></i>mutantLive Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2023-09-25)Parkinson's researchRRID:RGD_401827145The CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos.401827899BXH13/CubMcwi<a href=https://rgd.mcw.edu/wg/hrdp_panel/ > RGD HRDP</a>, <a href=mailto:HRDP@mcw.edu> contact HRDP</a>recombinant_inbredLive Animals; Cryopreserved Embryo (as of 2023-10-24)RRID:RGD_401827899This recombinant inbred was originally derived from founder strains BN-Lx/Cub and SHR/OlaIpcv at Charles University, Department of Biology, Prague, Czech Republic. This substrain was maintained at the Medical College of Wisconsin.401900746SD-<i>Prl7b1<sup>tm1(cre)Soar</sup></i>University of Kansas Medical CentermutantCryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21)Reproductive biologyPrl7b1<sup>tm1(cre)Soar</sup>401900752RRID:RRRC_001013CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site.401900748SD-<i>Prl7b1<sup>tm1(cre)Soar</sup></i>/RrrcThis strain is rederived at Rat Resource and Research Center mutantCryopreserved Embryo; Cryopreserved Sperm (as of 2023-11-21)Reproductive biologyPrl7b1<sup>tm1(cre)Soar</sup>401900752RRID:RRRC_001013CRISPR/Cas9 system was used to introduce Cre recombinase downstream of the Prl7b1 start site.401900749SD-<i>Prl7b1<sup>em1Soar</sup></i>University of Kansas Medical CentermutantCryopreserved Embryo (as of 2023-11-21)Reproductive biologyPrl7b1<sup>em1Soar</sup>401900751RRID:RRRC_001014CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus401900750SD-<i>Prl7b1<sup>em1Soar</sup></i>/RrrcThis strain is rederived at Rat Resource and Research Center mutantCryopreserved Embryo (as of 2023-11-21)Reproductive biologyPrl7b1<sup>em1Soar</sup>401900751RRID:RRRC_001014CRISPR/Cas9 system was used to introduce a 272 bp deletion at the Prl7b1 locus401901198SHHF<i><sup>cp/cp</sup></i>/MccGmiCrl<a href=https://www.criver.com/products-services/find-model/spontaneously-hypertensive-heart-failure-shhf-rat-obese?region=3611>Charles River Laboratories </a>inbredUnknownRRID:RGD_401901198401901199SHHF<i><sup>cp/+</sup></i>/MccGmiCrl<a href=https://www.criver.com/products-services/find-model/spontaneously-hypertensive-heart-failure-shhf-rat-lean?region=3611>Charles River Laboratories </a>inbredUnknownRRID:RGD_401901199401901201SHHF<i><sup>cp/+</sup></i>/MccDr. McCune laboratoryinbredUnknownRRID:RGD_401901201401901202SHHF<i><sup>cp/cp</sup></i>/MccDr. McCune laboratoryinbredUnknownRRID:RGD_401901202401901286test8Dectest8Decadvanced_intercross_lineUnknownRRID:RGD_401901286test8Dec401938647SD-<i>Slc9a6 <sup>em1Moro</sup></i>/RrrcDr. Eric Morrow at Brown University
70 Ship Street, Box G-E4
Providence
RI
02912
USAmutantLive Animals (as of 2023-12-18)neurodevelopment/neurodegenerationSlc9a6 <sup>em1Moro</sup>151664749RRID:RGD_401938647Crispr-Cas was used to introduce a 2bp insertion of TT to create a stop codon in exon 7 of SLC9a6 gene, causing termination of translation. The strain was rederived at RRRC.401938650CD-<i>Slc30a10<sup>em1Sommu</sup></i>/RrrcThe strain was created by Dr. Somshuvra Mukhopadhyay from the University of Texas at Austin.mutantCryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2023-12-19)neuroscience, toxicology, metal homeostasis, physiology, manganese toxicityRRID:RGD_401938650Exon 1 of Slc30a10 was targeted using CRISPR/Cas9 in the Crl:CD(SD) embryos . A mosiac founder that transmitted a 248 bp deletion in exon 1 of Slc30a10 leading to an out of frame mutation after amino acid 22 was bred to a CD rat to select for the above deletion and establish the line.401938653SD-<i>Ctns<sup>em1Odev</sup></i>University of Zurich - Institute of Physiology, Mechanisms of Inherited Kidney Disorders Group Winterthurerstrasse 190 CH-8057 ZürichmutantLive Animals (as of 2024-03-18)CystinosisCtns<sup>em1Odev</sup>401938654RRID:RGD_401938653The Ctns gen was deleted by oocyte injection of the CRISPER/Cas9 system (PolyGene AG, Zurich,Switzer-land). Two single guideRNAs(sgRNAs) targeting exon3 of Ctns were selected :CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG), CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resultingin a premature stop codon in the exon3 of Ctns.401940195SD-<i>Ahr<sup>em1Iexas-/-</sup></i>Osaka University, Faculty of Medicine, Institute of Experimental Animal SciencesmutantUnknownAhr<sup>em1Iexas</sup>401940199RRID:RGD_401940195The homozygous knockout rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .401940197SD-<i>Ahr<sup>em1Iexas+/-</sup></i>Osaka University, Faculty of Medicine, Institute of Experimental Animal SciencesmutantUnknownAhr<sup>em1Iexas</sup>401940199RRID:RGD_401940197The Ahr heterozygous rats were created using CRISPR/Cas9 gene editing to delete 10 bp of exon 2 of Ahr in Sprague Dawley rats .401940198SD-<i>Ahr<sup>em1Iexas+/+</sup></i>Osaka University, Faculty of Medicine, Institute of Experimental Animal SciencesmutantUnknownRRID:RGD_401940198The Ahr wild type littermates from the cross of heterozygous Ahr rats. The Ahr mutants were created using CRISPR/Cas9 gene editing to delete a portion of exon 2 of Ahr in Sprague Dawley rats .401959229LE-Tg(Thy1-GCaMP6f)8RrrcJanelia Research Campus and Princeton UniversitytransgenicUnknownNeuroscienceRRID:RRRC_01010Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-chain kinase. Reference ID: https://doi.org/10.1101/2023.08.17.553594401959407OlaHsd:LHLong EvansoutbredUnknownBehaviourRRID:RGD_401959407Medical Research Council, Mill Hill obtained LH stock from ICI, Alderley Edge in 1932 and have maintained closed colony since that time.
From Medical Research Council, Mill Hill to OLAC (Harlan) in 1969. Harlan became Envigo in 2015, then Envigo was acquired by Inotiv in 2021401959606Cnc:SDSprague-DawleyR. Dawley, Sprague-Dawley Company,outbredUnknownRRID:RGD_401959606This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. This strain was maintained by China National Center For Rodent Laboratory Animal. and available from SPF biotech since 2018.401960080Yxch:SDExperimental Animal Center of Army Medical University (Chongqing, China).outbredUnknownRRID:RGD_401960080Experimental Animal Center of Army Medical University (Chongqing, China).401960101ZSF1-<i>Lepr<sup>fa/cp</sup></i>/CrlGenetic Models International, Indianapolis.hybridUnknownLepr<sup>cp</sup>|Lepr<sup>fa</sup>11570565|13432153RRID:RGD_401960101This F1 obese model was developed by crossing rat strains with two separate leptin receptor mutations (fa and facp), In Charles River, they mate a Heterozygous ZDF (fa/+) with a Homozygous SHHF (cp/cp).This mating of ZDF and SHHF parent can produce obese ZSF1 (having fa and cp mutation from both parents) or lean ZSF1 (having just one copy of mutated Lepr, either cp or fa). The obese F1 develop insulin resistance, hyperglycaemia, and mild hypertension401960104ZSF1-<i>Lepr<sup>lean</sup></i>/CrlGenetic Models International, Indianapolis.hybridUnknownRRID:RGD_401960104This F1 lean model was developed by crossing rat strains with two separate leptin receptor mutations (fa and cp). In Charles River, they mate a Heterozygous ZDF (fa/+) with a Homozygous SHHF (cp/cp).This mating of ZDF and SHHF parent can produce obese ZSF1 (having fa and cp mutation from both parents) or lean ZSF1 (having just one copy of mutated Lepr, either cp or fa).401976372SD-<i>Crh<sup>tm1(Cre)Kji</sup></i>This strain was created by Dr. Karl Iremonger at the Centre for Neuroendocrinology, Department of Physiology, University of Otago, Dunedin, New ZealandmutantUnknownRRID:RGD_401976372CRISPR/Cas9 technology was used to insert an IRES for Cre expression after the corticotropin-releasing hormone (Crh) gene and is expressed in cells that produce CRH.401976374NTacSam:SDoutbredUnknownRRID:RGD_401976374This outbred Sprague Dawley was originally from Taconic and bred at SAMTAKO in Korea.401976436Cnc:WIWistar ratsoutbredUnknownRRID:RGD_401976436The Wistar rat is an outbred albino rat. This breed was developed at the Wistar Institute in 1906 for use in biological and medical research. The Wistar was maintained by China National Center For Rodent Laboratory Animal. and available from SPF biotech since 2019.401976445HsdOla:LISLister HoodedoutbredUnknownRRID:RGD_401976445Medical Research Council, Mill Hill obtained LH stock from ICI, Alderley Edge in 1932 and have maintained closed colony since that time.
From Medical Research Council, Mill Hill to OLAC (Harlan) in 1969. Harlan became Envigo in 2015, then Envigo was acquired by Inotiv in 2021.401976475CrlNifdc:CD(SD)Sprague-DawleyoutbredUnknownRRID:RGD_401976475Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system. The Nifdc strain is available from ?National Rodent Laboratory Animal Resources Center? in China.404976871DA/MolTacMcwiMedical College of WisconsininbredLive Animals (as of 2024-03-18)RRID:RGD_404976871A closed colony of DA/MolTac (RRID:RGD_1566438) has been maintained at the Medical College of Wisconsin for more than 30 generations.404976872DA.CD-Tg(RNECO-180E22)733Arno/McwiMedical College of WisconsintransgenicCryopreserved Sperm (as of 2024-03-18)RRID:RGD_404976872CD-Tg(RNECO-180E22)733Arno, RGD:155663367 was backcrossed at the Medical College of Wisconsin to DA/MolTacMcwi for 6-7 generations before cryopreservation of sperm.404976873SS-Del(1q)2McwiMedical College of WisconsinmutantCryopreserved Sperm (as of 2024-03-18)RRID:RGD_404976873Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted.405100226LE-<i>Fmr1<sup>em1Pwc</sup></i>SAGE (Sigma Advanced Genetic Engineering) LabsmutantUnknownRRID:RGD_405100226Colony founders were produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting founders did not express FMRP or eGFP.