# RGD-PIPELINE: ftp-file-extracts # MODULE: strains build 2019-06-24 # GENERATED-ON: #DATE# # PURPOSE: information about active rat strains extracted from RGD database # CONTACT: rgd.data@mcw.edu # FORMAT: tab delimited text # NOTES: multiple values in a single column are separated by ';' RGD_ID STRAIN_SYMBOL FULL_NAME ORIGIN SOURCE STRAIN_TYPE LAST_KNOWN_STATUS RESEARCH_USE ALLELES ALLELE_RGD_IDS RGSC_3.4_CHR RGSC_3.4_START_POS RGSC_3.4_STOP_POS RGSC_3.4_METHOD RNOR_5.0_CHR RNOR_5.0_START_POS RNOR_5.0_STOP_POS RNOR_5.0_METHOD RNOR_6.0_CHR RNOR_6.0_START_POS RNOR_6.0_STOP_POS RNOR_6.0_METHOD 10000 ACI/N A X C 9935, Irish Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. Donated to RRRC from NIH Animal Genetic Resource Bank (NIHAGR) Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery spontaneous tumors; chronic renal disease; congenital malformations Tnfrsf1a 621237 10001 AVN/Orl Ctr de Selection et d'Elev d'Anim de Lab, Orleans, France. inbred Unknown 10002 BBDP/Rhw S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ± 53 days of age after the first and 67 ± 10 days of age after the 9th cycle. inbred Unknown 10003 BBDR/Rhw S. Bieg and coworkers (1998) generated a congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 +/- 53 days of age after the first and 67 +/- 10 days of age after the 9th cycle. R. H. William Laboratory, University of Washington, Seattle, Washington inbred Unknown 10004 BC/CpbU Obtained from the Central Laboratory Animal Institute of Utrecht University, The Netherlands. Central Laboratory Animal Institute of Utrecht University, The Netherlands. inbred Unknown 10005 BDIX/Han unknown unknown inbred Unknown 10006 BDVII/Cub Druckrey from F2 offspring of a cross between BDVI and BDI with subsequent selection of brother-sister pairs for a pink-eyed, yellow, blackhooded phenotype. Charles University, Department of Biology, Prague, inbred Unknown 10008 BN/SsNHsd Obtained by HSD from nucleus colony at NIH Harlan inbred Unknown 10009 BP/Cub Charles University, Department of Biology, Prague, inbred Unknown 10010 BUF/Pit Buffalo inbred Unknown 10011 COP/OlaHsd These are derived from the original colony which was developed by Dr. W.F. Dunning. Harlan inbred Unknown 10012 DA/PitN Unknown Unknown inbred Extinct 10013 DON/Melb inbred Unknown 10014 F344/Pit inbred Unknown 10015 FHH/Eur An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. Erasmus University-Rotterdam inbred Unknown 10016 GH/Omr Genetically Hypertensive This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. University of Otago Wellcome Med. Res. Inst, New Zealand. inbred Unknown 10017 GK/KyoSwe Goto Kakizaki Developed from outbred Wistar rats with selection for high glucose levels in and oral glucose tolerance test (Goto et al 1975). Department of Molecular Medicine, Karolinska Hospital, Stockholm, Sweden inbred Unknown 10018 IS/Kyo ishibashi rat Ishibashi rat is derived from a cross between a wild male and a Wistar female, with sib mating since 1975 at Azabu University, transferred to Kyoto University in 1978. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis 10019 LE/Mol Long Evans M & B A/S, Denmark. inbred Unknown 10020 LEW/Pit Lewis inbred Unknown 10021 LH/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown 10022 LN/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown 10023 LOU/CHan Louvain unknown unknown inbred Unknown 10024 M520/N To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. NIH Animal Genetic Resource, Rat Resource and Research Center inbred Cryopreserved Embryo 10025 MHS/Gib Milan Hypertensive Strain Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown 10026 MNR/N Maudsely non-reactive To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci. NIH Animal Genetic Resource inbred Extinct 10027 MNRA/N To Harrington in 1965 at F25 (Harrington 1981). NIH Animal Genetic Resource inbred Unknown 10028 MNS/Gib Milan Normotensive Strain Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown 10029 MR/Pit As for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). inbred Unknown 10030 NEDH/K Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. Central Institute for Diabetes, Karlsburg, Germany. inbred Unknown 10031 NP9 From Wistar inbred Unknown 10032 ODU/N Osaka Dental University From outbred Wistar Kyoto stock inbred by N Ito, Osaka Dental University. Selected for susceptibility to development of dental plaque (Ito et al 1975). To NIH in 1977 at F3 (Hansen et al 1982). NIH Animal Genetic Resource inbred Extinct 10033 OKA/Wsl Professor Herve Bazin, Universite de Louvain, France inbred Unknown 10034 OM/Ztm Osborne-Mendel unknown unknown inbred Unknown 10035 P5C inbred Unknown 10036 PVG/Pit inbred Unknown 10037 SD/Rij From Sprague-Dawley stock of an unknown source to Hoechst, Frankfurt. To O. Haferkamp, University of Ulm, to ITRI-TNO Rijswijk, The Netherlands in 1972 (van Hooft 1990). Note that other sublines of "SD" rats (including SD/A, SD/Cpb, and SD/Waa) are known to differ among themselves, and from this strain (Bender et al 1984, Festing and Bender 1984). Harlan Rijswijk inbred Unknown 10038 SHR/OlaHsd Spontaneously Hypertensive Rat Harlan Sprague Dawley, Inc. inbred Unknown 10039 SHRSP/Riv Spontaneously Hypertensive Rat, Stroke Prone inbred Unknown 10040 SR/Jr Salt Resistant Originated from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Dr. John P. Rapp, Medical College of Ohio, USA, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 10041 SS/Jr Salt Sensitive Strain originated from a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982) Dr. John P. Rapp, Medical College of Ohio, USA, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Hmox1 2806 10042 WAG/RijKyo Rij > Kyo (1979, F?, GF) National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology 10043 WF/Pit Wistar Furth inbred Unknown 10044 WIST/Nhg Wistar From outbred Wistar stock in 1967. Gesellschaft f. Strahlen & Umweltforschung, Munich, Germany. inbred Unknown Ugt1a1|Abcd2 3935|69244 10045 WN/N Inbred Wistar; W/N Heston in 1942 from Wistar stock of Nettleship, to National Institutes of Health in 1950 at F15. NIH Animal Genetic Resource inbred Unknown 10046 WKY/OlaHsd Harlan Sprague Dawley, Inc. inbred Unknown 10047 WTC/Kyo WTC was established as a coisogenic strain (tm<+/+>) from TRM (F18) in 1988. A missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene (Ohno et al. 2015). National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) 60984 GH University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). inbred Unknown 60985 BN BN Billingham and Silvers 1958, from a brown mutation maintained by DH King and P Aptekman in a pen-bred colony (Billingham and Silvers 1959). A plasma kininogen-deficient mutant strain (BN/Ka) has been described in which release of heat-induced substance P is defective (Tang et al, 1994) and response to the hypertensive effects of deoxycorticosterone acetate salt is much faster than in normal BN rats (Majima et al, 1995a,b). Charles River Laboratories inbred Unknown Cd36|Tnfrsf1a 2301|621237 60986 BUF/N Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 60987 MHS/N Milan Hypertensive Strain Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994). Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Extinct Add1|Add2 2041|2042 60988 LOU/M Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible. Histocompatible with LOU/C and maintained by selection of LOU/M males on the basis of acceptance of skin grafts from LOU/C rats (Bazin 1977, Beckers and Bazin 1978). inbred Unknown 60989 BP Strain selected for resistance to Walker 256 tumour. inbred Unknown 60990 LH/MavRrrc Lyon Hypertensive Lyon Hypertensive. In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed, unrestrained, conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-02-13) 60991 LE Long Evans Dr. M. Sabourdy about 1960 from Long-Evans outbred stock. To Muhlbock, Amsterdam, and to Han in 1973. Note that other inbred strains independently derived from Long Evans stock may differ because of the outbred origin (Festing and Bender, 1984). inbred Unknown 60992 MNS Milan normotensive strain Outbred Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. (Bianchi et al 1974). Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy inbred Unknown 60993 FHH Fawn Hooded Hypertensive An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. University of Colorado Health Science Center, Denver, Colorado inbred Unknown 60994 F344 Fischer Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown 60995 DRY Recombinant inbred strain used as normotensive control in studies of hypertension. Sankyo Co., Ltd., Tokyo, Japan inbred Unknown 60996 DON Donryu rat R. Sato 1950 by inbreeding Japanese albino rats. xx inbred Unknown 60997 DA DA Developed from stock of unstated origin by Dr. T.T. Odell, Jr. at Oak Ridge National Laboratory, Tennessee to F11, then by Dr. Darcy Wilson at the Wistar Institute, who named it DA because it expressed the 'd' blood group allele of Joy Palm, and it is 'a' agouti in colour (Wilson 1965). Inbreeding was completed in about 1965. Although Palm and Black (1971) suggest it may be related to COP, there is no real evidence that this is the case. inbred Unknown Ednrb|Tnfrsf1a 2536|621237 60998 COP This Copenhagen (COP) rat was an inbred strain from Curtiss 1921 at Columbia University Institute for Cancer Research. inbred Unknown 60999 LEW Lewis Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. Used as the inbred partner for a number of congenic strains at the major histocompatibility complex (Stark and Kren 1969). A substrain with congenital hydrocephalus due to primary aqueductal stenosis has been described by Yamada et al, (1992) Harlan Sprague Dawley Inc. Indianapolis, United States inbred Unknown Fgf2|Tnfrsf1a 2609|621237 61000 SHR Spontaneously Hypertensive Rat Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). A number of sublines have been developed with a tendency to develop cardiovascular lesions and stroke (see particularly SHRSP) (Nagaoka et al 1976), and hypercholesterolemia (Yamori 1984). For a recent review see Yamori, (1994). However, there is no evidence for substrain differentiation among SHR stocks from the major commercial suppliers in the USA both respect to phenotype and DNA fingerprints (Blizard et al, 1991). Strain WKY, developed from the same base populations is sometimes used as a normotensive control, though its use as such must be questioned as it differs at many genetic marker loci (Festing and Bender 1984, and see also strain WKY). Stelzin et al (1992) found that SHR and WKY shared only 50% of their DNA fingerprint bands, whereas SS and SR shared about 80% of bands. Most authorities suggest that WKY alone is not a good control strain, and that for most comparative studies several normotensive strains should be used. There is an extensive literature on the characteristics of SHR. DeJong (1984) provides a useful comparative review of this and other hypertensive strains, and there are regular symposia on hypertensive rat strains (see J. Hypertension 4(suppl):S1-S541, 1986, and Jpn. Heart J. 28:567-648). inbred Unknown Agtr1b|Cd36|Ephx2 2071|2301|620732 61001 NEDH Inbred by S. Warren at New England Deaconess Hospital, from Slonaker colony (University of Chicago ca. 1928). To Simonsen Laboratories in 1985 via B. Hoffman, Veterans Administration Medical Center, Palo Alto, CA. To Mollegaard in 1987. inbred Unknown 61002 BDIX Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. NB. Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 61003 BC Hagadoorn, Holland to CPB in 1949 at F15. To Utrecht in 1973. inbred Unknown 61004 WIST/Zihk From Wistar outbred stock in 1978. inbred Unknown 61005 OM/N Osborne-Mendel Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 61006 PVG PVG Kings College of Household Science, to Lister Institute, to Virol, to Glaxo 1946. Inbred by Glaxo. A substrain PVG/cBkl, which is C6 complement deficient due, presumably, to a spontaneous mutation has been described. In good environmental conditions it is perfectly healthy (Leenaerts et al, 1994). inbred Unknown 61007 WF Wistar Furth J Furth 1945 from a commercial Wistar stock in an attempt to develop a high leukaemia rat strain. Strain carries a distinctive heteropycnotic Y chromosome which may be used as a cellular marker (Zieverink and Moloney 1965). A substrain carrying the fuzzy mutation, which arose spontaneously in WF has been used in research on dermal toxicity, and is described in more detail by Marit et al, (1995). inbred Unknown 61008 WAG Wistar Albino Glaxo AL Bacharach, Glaxo Ltd 1924 from Wistar stock. Note that the presence of different coat color alleles in some sublines implies that this strain may have become genetically contaminated at some time in the past. It is therefore important that the subline should be stated carefully in published work. WAG/Cpb clearly differs from other sublines at many loci (Festing and Bender 1984). inbred Unknown 61009 AVN Unknown. Keil University from O Stark, Charles University, Prague. inbred Unknown 61010 SHRSP Spontaneously Hypertensive Rat, Stroke Prone The A1-sb and A3 substrains of SHR which had been bred as parallel lines from F20 to F36 were crossed (?) and further inbred with selection of offspring of parents that died of stroke (Okamoto et al 1974, 1986, Yamori 1984). To NIH in 1976, and designated SHRSP/A3N. Pathophysiology reviewed by Volpe and Rubattu (1994). Iffa Credo, L'arbresle, France, Max-Delbruck-Center for Molecular Medicine, Berlin-Buch inbred Unknown 61011 BB/N BioBreeding rat Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990). Unavailable inbred Extinct 61013 E3 Kroning, Gottingen from rats of unknown origin selected for fawn hooded phenotype, to Hannover 1957 at F16. To Gottschewski in 1964, then back to Hannover in 1968. inbred Unknown 61014 OLETF Otsuka Long-Evans Tokushima fatty Developed by Kazuya Kawano, Otsuka Pharmaceutical Co., Tokushima, Japan from Long-Evans outbred stock in 1982. A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan to develop this strain Otsuka Long-Evans Tokushima fatty (OLETF). A deletion of 6847 bases in length in the Cckar gene of the OLETF was identified compared to the wild type gene of the LETO gene sequence' Otsuka Research Institute, Tokushima, Japan inbred Unknown 61015 LN/MavRrrc lyon normotensive (taken from Lyon Hypertensive entry, see LH) In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. (see Vincent et al 1984, and Vincent and Sassard, 1994 for reviews). Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 61096 SHR/NCruk Spontaneously Hypertensive Rat NIH derived strain maintained at the Charles River, United Kingdom. Charles River Laboratories UK inbred Unknown 61097 WKY/NCruk NIH derived strain maintained at the Charles River, United Kingdom. Charles River Laboratories UK inbred Unknown 61098 BXH/Ipcv These recombinant inbred strains are derived from the (BN-Lx/Cub, SHR/OlaIpcv x BN)F2 pairs and maintained at Czech Academy of Sciences, Prague, Czech Republic Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic recombinant_inbred Unknown 61099 HXB/Ipcv Derived from founder strains SHR/Ola and BN-Lx/Cub, this strain has been extensively genotyped in known genes as well as DNA markers, strain distribution patterns of 700+ alleles have been published. Institute of Physiology, Czech Academy of Sciences, Charles University, Prague recombinant_inbred Unknown 61100 SHR/Ola Strain originated from an inbred SHR strain from Harlan UK Ltd. Czech Academy of Sciences, Prague, Czech Republic inbred Unknown 61103 WKY This strain was maintained at Medical College of Ohio, Toledo, Ohio Medical College of Ohio, Toledo, Ohio inbred Unknown Cd36|Nos3 2301|3186 61104 LEW/NCrl Substrain of LEW obtained from Charles River, which was developed from Dr Margaret Lewis from Wistar stock in early 1950s. This came to Charles River from Tulane in 1970 at F34. Charles River Laboratories USA inbred Unknown 61105 WKY/NHsd These animals were bought from Harlan Indianapolis, Indiana U.S.A. Harlan inbred Unknown 61106 SHR.BN-(D8Mit5-D8Mgh6)/Ipcv A segment of chr. 8 is transferred from the normotensive BN-Lx/Cub rat to the SHR/Ola. Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 8 32203394 64762616 1 - by flanking markers 8 33603024 65467051 1 - by flanking markers 8 33558660 65717592 1 - by flanking markers 61107 BB/OK BioBreeding rat This colony was established in 1983, these rats were originally from an outbred colony from Ottawa, Canada. Central Institute for Diabetes, Karlsburg, Germany, National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Diabetes Obesity; Immunology Asns|Cav1|Cftr|Cyp51|Hgf|Met|Smo|Tac1|Stx1a|Cdk5 2162|2280|2332|2481|2794|3082|3726|3807|69430|70514 61109 F344/NHsd F344/NHsd Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. Envigo inbred Unknown 61110 SHR/Mol Spontaneously hypertensive rat, maintained at the Mollegaard breeding center, displays traits of hypertension but not to diabetes. Mollegaard Breeding Centre Ltd., Denmark inbred Unknown 61111 DA/Slc dark agouti These were produced by from SD parents in 1984 by hysterectomy and fostering, then moved to Kumamoto University of Medicine in 1983. National BioResource Project for the Rat in Japan inbred Live Animals 61112 13M This is a Leprfa/Leprfa substrain derived from the Zucker rat. Laboratory of Human Behavior and Metabolism, Rockefeller University inbred Unknown 61113 BN-Lx These were derived by introgressing mutant Lx gene of the polydactylous rat onto the BN background. unknown mutant Unknown 61114 DA/Bkl Commercially available strain. Maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, MD, for production of DA background QTL monocongenic rats and experimental controls. Bantin and Kingman, Fremont, California inbred Unknown 61115 BN/SsN To N 1972 from Silvers at F34. Silvers began brother-sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King in a penbred colony. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 61116 SHRSP/A3 Derived from the a substrain of the SHR strain by selective inbreeding for stroke proneness. Graduate School of Human and Environmental Studies, University of Kyoto, Kyoto, Japan inbred Unknown 61117 BN-Lx/Cub Brown Norway with polydactyly-luxate These were derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. Charles University, Department of Biology, Prague inbred Unknown 61118 BUF/Mna Strain originated from Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer; Urology Bsis 2221 61119 WKY/NCrlCrlj Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo 61498 BN/NHsdMcwi Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115) PhysGen inbred Live Animals; Cryorecovery 61499 SS/JrHsdMcwi Inbred from a congenic control group of Dahl S rats (SS/Ren) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley etal. 2000, Physiol. Genomics. 2:107-115). PhysGen inbred Live Animals; Cryorecovery 61517 FHL/Eur Fawn Hooded Low blood pressure An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. FHL rats do not develop hypertension or renal damage Erasmus University-Rotterdam inbred Unknown 67934 WOKA Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designatedWOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. inbred Unknown 67935 WOKW Outbred Wistar BB rats from Biobreeding Laboratories, Ottawa, Canada in 1981 to Dr.I. Kloting, Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany. WOKA (originally designated WOK.1A) was developed by brother x sister mating from rats homozygous for RT1a, and WOKW (originally designated WOK.1W) from rats homozygous for RT1U , a haplotype which pre-disposes to type I diabetes. Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown 67936 WR Sykora, Rosice (Stark et al 1968b). No further infromation. inbred Unknown 67937 WST Strain WAG, Glaxo Research, Uxbridge, UK to Institute of Rheumatology, Warsaw in 1964. To Institute of Oncology, Warsaw 1964. To Institute of Occupational Medicine (Imp), Warsaw in 1965 (Pietrowicz 1986). inbred Unknown 67938 Y59 Strain developed in Zagreb, Jugoslavia. inbred Unknown 67939 YA/N No further information. Unavailable inbred Extinct 67940 YO Fredrich Cancer Research Facility to Pit at F35. Genetic charactersitics given by Kunz et al (1987). Rapid elimination of Trichinella spiralis worms (2/12) (Bell, 1992) inbred Unknown 67941 Z61 Curtis 1920 at Columbia University Institute for Cancer Research. Susceptible to Cysticercus. Susceptible to oestrogen and 2-acetylaminofluorine-induced tumours. inbred Unknown 67942 ZI A breeder in W Germany to Hannover in 1980, to Kyoto in 1983. Carries recessive autosomal gene zitter which causes spongiform encephalopathy of the central nervous system with tremors at 15 days of age as well as curley whiskers and hair (Yamada et al 1989). inbred Unknown 67943 SHE/N-cp Reference found in: Berdanier C. D., Pan J. S., Hartle D. K., and Michaelis O. E. 1993, Comparative Biochemistry and physiology B-Biochemistry & Molecular Biology 106:87-94. unknown inbred Unknown 67945 IS from a cross between a wild male and a Wistar female, with sib mating since 1968. unknown inbred Unknown 67948 JC LEW/Ss to Hall Institute, to CSIRO in Brisbane, Australia. Presumed genetic comtamination some time prior to 1980, and re-named JC. To Dr. T Fukumoto, Hamamatsu University School of Medicine in 1983. Genetic markers described by Adams et al (1984). inbred Unknown 67957 APR Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). inbred Unknown 67958 AS Albino Surgery University of Otago from Wistar rats imported from England in 1930. May be subline of GH, with which it is histocompatible (Heslop and Phelan 1973). National Institute for Medical Research, Mill Hill, UK inbred Unknown 67959 AS2 Outbred rats at the University of Otago Medical School, to Dept. of Surgery 1963 at F22-24. Not histocompatible with AS (Heslop 1968). inbred Unknown 67960 AUG Derived from one of the US August sublines in 1951 and distributed by the Chester Beatty Institute, Pollards Wood, England. inbred Unknown 67962 AN Outbred Wistar Imamichi strain. unknown inbred Unknown 67965 AXC A recombinant inbred of ACI and C. Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Albert Segaloff of the Alton Ochsner Medical Foundation, New Orleans before 1956, to Southwestern Foundation for Biomedical Research in 1976. recombinant_inbred Unknown 67966 B Dr. P Swanson from Wistar stock now known to be King B strain, to Dempster at F43. To Harrington in 1971 at F85. inbred Unknown 67967 B/1N No further information. Unknown inbred Extinct 67971 BBZ Strain developed by crossing BB/Wor rats, a lean model of type I diabetes mellitus with a Zucker fatty (fa ) rat of unstated genetic background, followed by sib mating with forced heterozygosity for the fatty gene. Thus in each generation there is a ratio of 3 inbred Unknown 67974 BDE Zentralinstitut fur Versuchstierzucht, Hannover, from a cross between BDVII and E3, with selection for black hooded offspring. inbred Unknown 67975 BDI Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 67976 BDII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can not be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 67977 BDIII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 67978 BDIV Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable, and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 67981 BDV Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 67983 BDVI Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 67984 BDVII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. Low secondary antibody response to polypeptide (T,G)-Pro-Lys (20/20) (Gunther et al 1976) inbred Unknown 67986 BDVIII Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown 67987 BDX Druckrey 1937 from a yellow, pink-eyed strain. Inbred and reduced to one pair after World War II. Crosses with Wistar stock and subsequent inbreeding led to the development of BDII. According to Druckrey (1971), strains BDIII-BDX were then developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. However, the strains have four different RT1 haplotypes (d, v, l and e) rather than the two that would be expected from such a cross (Stark and Zeiss 1970). The strains can _not_ be regarded as a set of recombinant inbred strains as defined by Bailey (1971), although their definition by coat colour alleles makes the set easily identifiable , and should help (but not guarantee!) to ensure authenticity. According to Druckrey (1971), all strains have a low tumour incidence, with a median life-span of 700-950 days, depending on strain. inbred Unknown Lypd3 69053 67988 BEG from a cross between SC and TE. inbred Unknown 67989 BH D. Wilson, University of Pennsylvania from unknown stock. To Dml, who transferred stock to University of Iowa in 1973. Dml to Won to Ztm in 1973. inbred Unknown 67990 BI Formerly called B3, but now extinct. Slow elimination of \i Trichinella spiralis\i0 worms (11/12) (Bell, 1992) inbred Unknown 67991 BIL/1 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred Unknown 67993 BIL/2 University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred Unknown 68000 BIRMB same as BIRMA. inbred Unknown 68001 BLK/N This strain has an agouti mutation Unknown inbred Extinct Asip 2003 68007 BROFO Medical Biological Laboratory, Defence Research Organisation, The Netherlands. Large Wistar type of rat maintained in germ-free and SPF conditions. inbred Unknown 68008 BS University of Otago Medical School from a cross of wild rats x Wistar stock, with black phenotype backcrossed to the Wistar (Zeiss 1966). inbred Unknown 68011 C No further information. inbred Unknown 68012 CAP Polish Academy of Sciences, Krakow (Stark et al 1968a). inbred Unknown 68013 CAR/N Hunt-Hoppert caries resistant; CA/R Hunt 1937, developed for resistance to dental caries (Hunt et al 1955). NIH Autoimmune Rat Model Repository and Development Center inbred Unknown 68014 CAS Hunt 1937, developed for high incidence of dental caries. inbred Unknown 68015 CBH Woodruff, Edinburgh to Chester Beatty Inst., Fulham Road, to Chemical Defense Establishment, Porton in 1963. Then to Chester Beatty, Pollards Wood in 1966. To Olac in 1980 when the strain was re-named CBH (Chester Beatty Hooded). inbred Unknown 68018 CPB-WE Wistar outbred rats inbred at the Central Institute for Breeding of Laboratory Animals, Zeist, The Netherlands. inbred Unknown 68019 CRDH Cohen Rosenthal Diabetic Hypertensive As Cohen Rosenthal Diabetic Hypertensive, from a cross between strains CDR and SHR followed by selection for high blood pressure and blood glucose levels following two-months of feeding a copper-poor, high (74%) sucrose diet. Selected animals were brother x sister mated (Cohen et al, 1993, Rosenthal et al 1995). Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown 68020 CWS R Shoji from a cross of an outbred Jcl:SD rat with spontaneous cataract and WKAH inbred rats. Subsequent brother x sister mating with selecting for cataract resulted in all offspring from the 3rd. generation developing cataract accompanied by microphthalmia which can be observed from the day that the eyes open. inbred Unknown 68022 DB No further information. inbred Unknown 68023 DEBR Dundee experimental bald rat The DEBR rats have been bred at the University of Dundee since March 1984. The original crosses involved the inbred stock BDIX rats showing lesion and Wistar rat. The descendants of this cross resulted from full sib-matings.Two strains of DEBR rats are geing developed: the black-hooded and brown-hooded strains. inbred Unknown 68026 DSS/1N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et al. 1962a, b). Inbred by Iwai and then Hansen (N). Unknown inbred Extinct 68027 DSS/2N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). Unknown inbred Extinct 68028 DSS/3N Three inbred strains developed from outbred Sprague-Dawley stock selected for sensitivity to sodium chloride-induced hypertension (Dahl et el 1962a, b). Inbred by Iwai and then Hansen (N). Unknown inbred Extinct 68029 DXE-1 Set of 4 recombinant inbred strains from a cross between DA and E3 (Central Institute, Hannover) recombinant_inbred Unknown 68031 ET WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). Taisho Pharmaceutical Co. Ltd inbred Unknown 68032 EXBH Hannover as a recombinant inbred strain from a cross between E3 and BN. Developed as a coat colour testing stock. Low reproductive performance (Greenhouse et al 1990) inbred Unknown 68034 F6R Mutation in an irradiated F344 strain obtained from the National Institute of Genetics, Misima, Japan. Carries chromosomal translocation (9:14) (Yosida et al 1985). inbred Unknown 68035 FCH Fice Combined Hyperlipidemic strain. Strain developed from outbred stock by selection for high serum cholesterol. inbred Unknown 68036 FH Dodds, 1974 from an outbred stock developed by NRF Maier, University of Michigan, Ann Arbor, from a cross between German brown rats and white Lashley rats (Tschopp and Zucker 1972). Note that other inbred strains have been developed from the same outbred stock (see strains FHH and FHL), which may have different characteristics. inbred Unknown Rab38^ru 1600311 68038 FHL see FHH. inbred Unknown 68040 FNL Fice Normolipidemic strain. Developed as a control strain for FCH (see FCH). inbred Unknown 68041 G Gorter, Holland to Hagedoorn, to CPB at F 35 (van Vliet 1977) inbred Unknown 68042 GEPR Jobe, 1971 from outbred Sprague-Dawley stock. Selected for moderate susceptibility to audiogenic stimuli-induced seizures (Reigel et al 1986a). inbred Unknown 68044 GHA The Queen Elizabeth Hospital, Woodville, S. Australia from mixed Wistar, LEW and coloured stock (Festing and Staats 1973). inbred Unknown 68046 HCS Harvard to Liverpool, UK in 1960. inbred Unknown 68047 HMT Outbred Alderley Park (strain 1) inbred since 1964 as "Harwell Mouth Tumor". inbred Unknown 68048 HS Probably from same Wistar x wild rat cross as BS (Zeiss 1966). Docile, fair reproduction. Approximately 12% hydrocephalus. inbred Unknown 68049 HXB-1-43/Ipcv Set of 17 recombinant inbred strains developed by Pravenec, Klir and Kren from a cross between SHR/OlaIpcv and BN.Lx/CubIpcv, and described by Pravenec et al (1988). Strains have now been typed at 500 loci and scanned for quantitative trait loci associated with blood pressure and heart weight (Pravenec et al, 1995). These recombinant inbred strains are derived from the (SHR/OlaIpcvx BN-Lx/Cub)F2 pairs. Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, P.O. Box 80.166 NL-3508 TD Utrecht, Netherlands recombinant_inbred Unknown 68050 IIM Set of nine strains bred as parallel strains from a single outbred colony maintained by B. Houssay in 1948. All strains were selected for large body weight and high fertility. One strain designated Beta IIM (RGD:40924649) derived from line 'b' became obese with mild glucose intolerance and glycosurea in older obese rats (Calderari et al 1987). Alpha IIM (RGD:40924650) was used as a control strain in study. inbred Unknown 68051 INR/N Harrington 1962 from a stock selected by CS Hall for low open field defaecation. Unknown inbred Extinct 68052 IR Harrington 1962 from a cross of a Michigan and a Berlin stock (Harrington 1981). inbred Unknown 68057 K Dr. E. Matthies, Halle-Wittenberg 1958 from outbred Wistar stock.. Low spontaneous tumour incidence (less that 0.5%). Good breeding performance. Weight at 100 days 290g in males and 200g in females. Developed for resistance to a range of transplantable tumours (Matthies and Ponsold 1973). inbred Unknown 68058 KGH/PitN Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974). Unknown inbred Extinct 68059 KIRBY-B From a cross between black hooded and CFY outbred rats with selection for resistance to chronic respiratory disease. Litter size 8-12 (60% male), but only 4-5 weaned. Agile, but tame (Bertok 1980). inbred Unknown 68060 KX developed from Slonaker colony, University of Chicago about 1928. Sublines which carry gene \i ic\i0 (infantile ichthyosis) and colour genes C and H have also been developed (Knox 1977) inbred Unknown 68061 KYN/Hok Makino, Hokkaido University 1960 from stock the carrying the National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm 68062 LA/N from a cross between ALB/N and a hooded stock of unknown origin (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 68063 LA/N-cp The corpulent (LA/N-cp) ratdeveloped at the National Institutes of Health (NIH) is a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. The obese homozygous (cp/cp) littermates developspontaneous insulin resistance, obesity, impaired glucose tolerance, hypertriglyceridemia and atherosclerosis. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 68065 LEA Hok from outbred Long Evans stock, selected for agouti coat colour (though Long Evans stock is usually fixed for non-agouti, hooded genes) (MC Yoshida, personal communication). Liver gangliosides are of the a-type (cf ACI,LEW & BUF) (Kasai et al 1993) inbred Unknown 68066 LEC In 1975, at the Center for Experimental Plants and Animals, Hokkaido University, Long Evans Cinnamon was derived originally from a closed colony of Long-Evans rats obtained from Kobe University in 1975. inbred Unknown 68067 LEJ/Hok Hok 1956 from Pacific Farms, USA as an outbred stock (Sasaki, personal communication). National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 68068 LEM Subline of LET, which was a cross between LEW and a Long-Evans stock developed by TH Yoshida. Carries an inversion of chromosome 1 (Yosida, 1980). inbred Unknown Ckb 2357 68069 LEO from National Institute of Genetics Misima, Japan. Control strain for LEM and LET, without chromosomal inversions (Yosida, 1980). inbred Unknown 68070 LEP Charles University from cross of outbred animals, including a Long Evans stock (Brdicka, personal communication). Has an unusual esterase haplotype (Festing and Bender 1984) inbred Unknown 68071 LER/N Originally designated Le-R and thought to be a mutation within LEW conferring resistance of experimental allergic encephalomyelitis (EAE) (Waxman et al, 1981, Driscoll et al 1985, Gasser et al, 1983). However, it now appears to have been an accidental genetic contamination by BUF/N rats (Goldmuntz et al, 1993),. See LEW, Immunology. Unavailable inbred Extinct 68072 LET from National Institute of Genetics, Misima, Japan. From a cross betrween LEW and LEJ. Homozygous for a 1 inbred Unknown 68073 LETL A rat with spontaneous polyurea, polyphagia and polydipsia was found in a colony of outbred Long Evans rats purchased from Charles River in 1982. Selective breeding for diabetes with brother x sister mating was subsequently started at the Tokushima Research Institute, Otsuka Pharmaceutical Co., Japan inbred Unknown 68074 LETO THe LETO was obtained by mating of Long-Evan rats in Otsuka Pharmaceutical Co.The LETO has not shown the diabetic syndrome. inbred Unknown 68077 LL/MavRrrc Lyon hypotensive Lyon Low-Tensive. See LH Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 68079 LOU Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of plasmacytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France inbred Unknown 68082 LUDW Ludwig Wistar; Wistar stock to Ludwig Institute to Olac in 1979. Susceptible to tumour induction by MNU. inbred Unknown 68083 LXB Set of 13 recombinant inbred strains from a cross between LEW and BN (Central Institute, Hannover) recombinant_inbred Unknown 68084 M14 AB Chapman 1940 from Sprague-Dawley stock, with selection for low ovarian response to pregnant mare's serum. inbred Unknown 68085 M17 AB Chapman 1940 from Sprague-Dawley stock with selection for high ovarian response to pregnant mare's serum. inbred Unknown 68086 M520 Curtiss 1920, Columbia University Institute for Cancer Research, to Heston in 1949 at F49. To NIH in 1951 at F51 (Hansen et al 1982). A congenic strain lacking vasopressin due to the presence of the diabetes insipidus gene, di (from the Brattleboro rat) has been described (Colombo et al, 1992). inbred Unknown 68087 MAXX From a cross of BNxLEW with subsequent inbreeding. inbred Unknown 68088 MF Developed as strain MF by Holme and Piechuta (1979) by selective breeding of Sprague-Dawley outbred rats. Individuals were injected sub-cutaneously with egg albumin and B. pertussis vaccine i.p. then challenged with areosolised egg albumin after 14-18 days. Individuals within litters with the most severe symproms (longest duration of dyspnea) were selected and mated brother x sister. Later re-named APR (Apnea Prone Rat). inbred Unknown 68091 MLCS Milan low-calpastatin strain From a cross between MHS and MNS followed by backcrossing to MNS with selection for low calpastatin activity. Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy recombinant_inbred Unknown 68097 MSUBL Dr. Stroyeva, Institute of Developmental Biology, Moscow from a cross of wild rats x MSU microphthalmic rats obtained from Dr Brouman, Montana State University. Selected for high incidence of microphthalmia (Borodin 1977). inbred Unknown 68098 MW Munich Wistar Munich Wistar stock selected for superficial glomeruli and inbred by Harlan-Sprague-Dawley, now at F17 (1990). See also MWF and WMS. unknown inbred Unknown 68099 MWF From outbred Wistar rats selected for large numbers of superficial glomeruli. inbred Unknown 68100 NBL Bogden in the mid-1970s from Noble (Nb) strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To Fredrich Cancer Research facility in 1978. Note that the strain name NBL was selected in 1989. In the literature these rats are called Noble or Nb rats, usually without identifying whether the animals came from the non-isogenic colony of Dr. Noble or from the isogenic colony at the National Cancer Institute (Greenhouse et al 1990). inbred Unknown 68103 NER noda epileptic rat From Crj: Wistar rats purchased from Charles River Japan in July 1985. Developed by A. Noda, Tokyo University of Agriculture, Hokkaido, from a cross of mutant rats with spontaneous tonic-clonic seizures (Noda et al. 1998). Susceptible to seizures induced by pentylenetetrazol, tossing and transcorneal electric shock, but not tactile, photic or acoustic stimuli or transauricular electric shock. No pathologic changes have been found in the CNS. The condition appears to be inherited as an autosomal recessive gene and is comparable to generalised tonic-clonic seizures in humans. Maintained by Has. inbred Unknown 68104 NIG-III/Hok From a mating in 1956 between a wild rat trapped in Misima, Japan, and Castle's black rat. To Hokkaido in 1975. Work on characterisation of RT1 summarised by Natori (1987). National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 68106 NSD/N NIH, Bethesda, 1964 from a non-inbred (Sprague-Dawley) stock. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 68107 NZR Subline of AS2 separated at F32. inbred Unknown 68109 ODUS As for ODU, but maintained at Osaka Dental University. inbred Unknown 68113 OXYR/Nov Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock, in contrast to OXYS rat strain by selection for resistance to cataractogenic effect of galactose rich diet and brother-sister mating of highly resistant rats. In 1992, due to new findings, the symbol R was assigned to this strain. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown 68114 OXYS/Nov Developed in 1972 at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) by Professor R.I. Salganik from Wistar stock by selection for susceptibility to cataractogenic effect of galactose-rich diet and brother-sister mating of highly susceptible rats. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown 68115 P77PMC Wistar rats from Beijing Medical College in 1977. inbred Unknown 68116 PA King 1909 from Wistar Institute stock, to Aptekman in 1946 at F135, to Bogden 1958 at F155. The oldest inbred strain of rats. WKA is probably a parallel subline of this strain. Vigorous (and vicious), healthy, good reproduction. inbred Unknown 68117 PETH/N Royal College of Surgeons, RCS Bourne 1938, to Sidman at F9N1, to NIH in 1966 at F9N1F18. Should probably be regarded as a subline of RCS. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown 68118 PKD PKD Outbred Han:SPRD-cy/+ Sprague-Dawley rats from the Zentralinstitut furVersuchstierkunde, Hannover, Germany to Dr. Bettina Kranzlin, Mannheim, Germany. Brother xsister inbreeding started in 1991. Central Institute for Laboratory Animal Breeding, Hanover, Germany inbred Unknown 68119 PSDO/N Reserved symbol for strain in development now at F6 (NIH 1989). Unavailable inbred Extinct 68121 R Muhlbock from a Wistar stock in 1947. A congenic strain with hyperbilirubinaemia and jaundice has been developed by Leyten et al (1986) by backcrossing the jaundice gene j (the Gunn rat) onto strain R. inbred Unknown 68122 RCS/N Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London (Sidman and Pearlstein 1965). PETH is a presumed subline. Unavailable inbred Extinct 68123 RHA/N Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). To NIH in 1968 where b x s mating was initiated. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 68124 RII/1 Tif from outbred Sprague-Dawley stock received from Ivanovas, Germany (Greenhouse et al 1991). inbred Unknown 68125 RII/2 From outbred Sprague-Dawley stock received from IFFA Credo, France has been brother x sister mated for 16 generations (Greenhouse et al 1991). inbred Unknown 68126 RLA/N Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as an unconditioned stimulus (Bignami 1965). This outbred stock to NIH in 1968 where brother x sister mating was initiated. See also RHA. Note that the original outbred stock and other independently-derived inbred strains may differ in characteristics. Behavioural characteristics described by Driscoll et al (1979) and Fumm and Battig (1979). See RHA for details of comparative studies involving both strains. inbred Unknown 68127 RP/AEurRij Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). inbred Unknown 68128 S5B Poiley 1955 from a cross of outbred NBR rats x Sprague-Dawley, with five generations of backcrossing of the albino gene followed by sib mating. inbred Unknown 68129 SBH Sabra hypertensive Sabra Hypertensive Hebrew University Sabra outbred rats with brother x sister mating and selection for high blood pressure following unilateral nephrectomy and treatment with deoxycorticosterone and sodium chloride (Ben-Ishay et al 1981, Ben-Ishay 1984, Ben-Ishay and Yagli, 1994 who also reviews their characteristics). Barzilai Medical Center, Ashkelon, Israel inbred Unknown 68130 SBN As for SBH, but selected for low blood pressure as a normotensive control strain for SBH. See SBH (Ben-Ishay 1984). inbred Unknown 68131 SC Outbred Wistar Imamichi. Has small eyes and cataract (Proc. 8th. ICLAS Symposium, Gustav Fischer Verlag pp353-360) inbred Unknown 68133 SDJ/Hok Takeda Chemical Industries from Sprague-Dawley stock, to Hokkaido in 1966. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Slc2a2 3705 68134 SDNK Sprague-Dawley outbred rats inbred since 1967 by Dr. K Yasutomi, Nippon Inst. for Biological Sciences, Japan. inbred Unknown 68136 SEL Dunning 1948. Probably extinct. inbred Unknown 68137 SHHF JE Miller of GD Searle to Sylvia McCune in 1983. Corpulent gene (cp ) partially backcrossed to SHR/N, followed by brother x sister mating (with some exceptions). Originally designated SHR/N-cp, but re-named to avoid confusion with the strain described by Michaelis and Hansen (1990) which has been backcrossed to N14. Strain is maintained by matings of proven cp/+ heterozygotes, and in some cases cp/cp homozygous males have proved to be fertile. inbred Unknown Grk2|Grk3 2062|2063 68140 SPRD/Hsd Originated by the Sprague-Dawley Company, Madison, Wisconsin, in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan colonies are direct descendants of this original colony. Harlan outbred Unknown 68143 TA Outbred Wistar Imamichi. inbred Unknown 68144 TE Outbred Wistar Imamichi rats. Males develop hydro-testes caused by sperm retention cysts in the efferent duct. This defect is caused by an autosomal dominant locus and two autosomal recessive loci. Females are normal (Ikadai et al 1987). inbred Unknown 68145 TF From outbred Wistar Imamichi rats. Carries an autosomal recessive gene causing male pseudohermaphroditism due to defect of Leydig cells. Homozygous females are normal (Ikadai et al 1988). inbred Unknown 68146 THA Developed from Jcl-Wistar stock by inbreeding with selection for a high rate of electric shock avoidance by lever pressing. The strain has good learning performance not only in the Sidman avoidance task, but also in two other tasks when compared with the Jcl-Wistar stock, though the sensitivity of the strain to electric shocks or heat stress was less (Shigeta et al 1990). inbred Unknown 68147 THE/Utp Tsukuba high-emotional rat Wistar albino rats selected for low ambulation in a bright runway out of a dark starting box (high emotionality) (see also TLE). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior 68148 TLE/Utp Tsukuba low-emotional rat Wistar albino rats selected for high ambulation in a bright runway out of a dark starting box (low emotionality) (see also THE). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Behavior 68149 TM Tester Moriyama rat Shionogi Pharmaceutical Company to Kyoto in 1976. Has thrombocyte storage pool deficiency (J Yamada, personal communication). Institute of Laboratory Animals, Faculty of Medicine, Kyoto University, Kyoto, Japan inbred Unknown 68150 TMB PL Broadhurst from stock selected by Tryon for good maze learning performance. Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred Unknown 68151 TMD PL Broadhurst from stock selected by Tryon for poor maze learning performance. Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred Unknown 68152 TO/Hok Tokyo rat A breeder in Tokyo, Japan, to Hokkaido University in 1952 (Festing and Staats 1973). Resistant to the induction of EAU by interphotoreceptor retinol-binding protein (contrast WKAH, W/M, LEJ, LEW and BUF) (Sasamoto et al, 1994). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm 68154 TOM Toma Institute, Japan (Ikadai, personal communication, 1991) inbred Unknown 68155 TS WKA strain obtained from Taisho Pharmaceutical Co. Ltd. Develops ectopic scrota in about 70% of males. The defect is controled by multiple genes, and the females are normal (Ikadai et al 1988b). inbred Unknown 68156 TS1 Harrington, from stock selected by Tryon in 1929 for good maze learning performance (Harrington 1981). Although TMB and TS1 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). inbred Unknown 68157 TS3/N Harrington, from stock selected by Tryon for poor maze learning performance (Harrington 1981). Although TMD and TS3 are derived from the same outbred stock, they were inbred independently and should be regarded as different inbred strains (Festing 1979b). Unavailable inbred Extinct 68158 TT outbred Wistar Imamichi strain. Carries an autosomal recessive gene \i as\i0 causing an arrest of spermatogenesis at an early meiotic stage. Homozygous females have normal fertility (Ikadai, personal communication, 1991). inbred Unknown 68160 TU From a cross of a wild male and Wistar Imamichi outbred rats. Small litter size with malformations of kidneys and vas deferens in about 20% of offspring (H Ikadai, personal communication, 1991) inbred Unknown 68161 TW Wistar Imamichi outbred stock. Testicular hypoplasia (unilateral or bilateral) with aplasia of the epididymus and ductus deferens in about 50% of males. Female genital organs are normal (Ikadai et al 1985, Ajisawa et al 1985). inbred Unknown 68162 TX From a cross between a wild male and Wistar Imamichi females (H Ikadai, personal communication, 1991) inbred Unknown 68163 U Zootechnical Institute, Utrecht to the Netherlands Cancer Institute in 1958. To Erasmus University, Rotterdam, then to ITRI-TNO, Rijswijk, the Netherlands in 1960 (van Hooft 1990). inbred Unknown 68164 UChA Wistar rats selected for low voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. University of Chile, Casilla, Chile inbred Unknown 68165 UChB Wistar rats selected for high voluntary 10% ethanol consumption, with brother x sister mating. Initiated from ALKO Labs, Finland now established in 1947 at University of Chile. University of Chile, Casilla, Chile inbred Unknown 68166 W/Hok Wistar Institute to University of Tokyo, Japan in 1938. To Hokkaido in 1944. Inbred by Makino. Congenital cleft palate 0.5% (Shoji 1977). inbred Unknown 68167 W/Nhg Wistar rats from the Zentralinstitut fur Versuchstier, Hannover in 1964, inbred since 1973 in Neuherberg, Germany. inbred Unknown 68168 WA St Thomas's Hospital, from outbred Wistar stock, to Laboratory Animals Centre in 1964 at F43 (Festing and Blackmore 1971). To Ola in 1983. inbred Unknown 68169 WAB Boots Ltd., from same stock as WAG, but separated in 1926, prior to inbreeding. Benign thymoma in 23% of individuals over 2 years, with 50% incidence in castrated males and 57% in spayed females (Hinsull and Bellamy 1977). inbred Unknown 68171 WBB/1N No further information Unavailable inbred Extinct 68172 WBB/2N No further information. Unavailable inbred Extinct 68173 WBN Wistar rats from the Institute of Experimental Gerontology, Basel brother x sister mated in the Institute of Pathology, University of Bonn since 1961. To the Instuitute of Medical Science, University of Tokyo in 1976, then to Shizuoka Laboratory Animals Center where they were hysterectomy-derived. inbred Unknown 68174 WCF R Shoji, 1972 from a male rat of strain WKAH/Idr with clubfoot of the right hind foot. inbred Unknown 68175 WDF Ikeda et al (1981) by backcrossing the fatty gene to F8 and later generations of outbred Wistar Kyoto rats being inbred by brother x sister mating. The aim was to develop a model of non-insulin-dependent diabetes mellitus. inbred Unknown 68176 WEC Centraal Proefdierenbedrig TNO from an outcross involving strains B, WAG and others, followed by inbreeding (Festing 1979b). Formarly known as WE/Cpb. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). inbred Unknown 68177 WEK Centraal Proefdierenbedrig TNO 1958 to Utrecht in 1973. Formerly known as WEchoc. Hyporesponder to dietary cholesterol (van Zutphen, unpublished). inbred Unknown 68178 WELS Outbred wistar rats in 1976. Some biological details mainly on haematology and blood biochemistry given by Henize et al (1984) inbred Unknown 68180 WIN WI outbred rats inbred since 1980 as WIN (Wistar-Imamichi-Natori). Has a unique RT1.A haplotype (RT1.A s BlDl) (Natori et al 1986). inbred Unknown 68183 WKA King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. To Pit at F205 (Kunz et al 1987). Probably genetically identical to PA. Slow elimination of Trichinella spiralis worms (12/12) (Bell, 1992) inbred Unknown 68184 WKAH/Hok Wistar-King Aptekman Hokkaido King 1909 from Wistar Institute stock to Aptekman in 1946 at F135, to Hokkaido University in 1953 at F148. Formerly called WKA, Probably gentically identical to PA. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 68185 WKAM King 1909 to Aptekman 1946 at F135 to Hok in 1953 at F148 to Ms in 1953 (precise number not known), to Jic in 1980 at F208, back to Ms in 1980 at F211, to Slc in 1986 at F228, back to Ms in 1987 at F230 (Greenhouse et al 1990). Formerly called WKA. inbred Unknown 68186 WKHA/N From a cross between SHR and WKY with selection for high spontaneous activity and low systolic blood pressure. Unavailable inbred Extinct 68187 WKHT/N From a cross between SHR and WKY, with selection for high blood pressureand low spontaneous activity (Hendley et al 1988, Knardahl and Hendley 1990, Hendley and Fan, 1992). Unavailable inbred Extinct 68188 WKS National Institute of Genetics, Mishima, Japan. inbred Unknown 68189 HTX/Hcj D. F. Kohn, Inst. of Comparative Medicine,Columbia University, to University of Florida 1992 at F30. Department of Pharmacology, University of Florida, Gainesville. inbred Unknown 69369 SS From a colony of Sprague-Dawley outbred rats developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for sensitivity to salt-induced hypertension (Dahl et al 1962a,b, Rapp 1982). Also designated S/JR by Rapp (1984), who gives an extensive review of the characteristics of the strain, and Dahl S by Mollegard, Copenhagen. Note that the Dahl selected strain has been independently inbred at the NIH, and designated DSS/N. There is likely to be confusion among these colonies unless considerable care is taken with nomenclature. Stlezin et al (1992) found that SS and SR had about 80% of DNA fingerprint bands in common, compared with 50% between SHR and WKY. According to Ginn et al, (1993) analysis of RFLPs and microsatellites suggest that SR is a reasonably good control strain for SS, though crosses between SS and unrelated normotensive strains will be useful in identifying the loci responsible for salt-induced hypertension. Brookhaven National Laboratories, Upton, New York inbred Unknown 69638 BN/Ka Brown Norway Katholiek (kininogen or kinin deficient) Kitasato University, Kanagawa, Japan. Kitasato University, Kanagawa, Japan. inbred Unknown 69643 F344/DuCrlCrlj This strain originated in 1920 by Curtis then was with Dunning and then with Charles River Japan from 1976. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Cardio Hypertension 70410 AA Alko, Alcohol Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as drink for 10 days, after which they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily. Fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight, so alcohol intake was used as a phenotypic measure. Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown 70411 ANA Alko, Non-Alcohol Wistar rats were outbred and selected for breeding animals that differ in their alcohol consumption. Marked difference between the strains and sex was visible by the eighth generation. After puberty the animals were isolated and given 10% alcohol as fluid for 10 days, then they had access to water and alcohol for 4 weeks. The quantity of fluid intake was measured daily, as fluid intake of animals varied greatly in animals consuming the same amount of alcohol per unit body weight. Therefore, alcohol intake was kept as a phenotypic measure. Research Laboratories of the State Alcohol Monopoly (Alko), Helsinki, Finland inbred Unknown 70413 WBB inbred Unknown 70416 ACH Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research. inbred Unknown 70417 A28807/N Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 70418 A35322 Curtiss and Dunning 1942 from a mutation originating in an aunt x nephew cross at F27 of animals of strain A990. inbred Unknown 70419 A7322 Curtis 1925 at Columbia University Institute of Cancer Research. Spontaneous mammary tumours frequent. Resistant to Cysticercus. inbred Unknown 70420 A990 Curtiss 1921 at Columbia University Institute for Cancer Research. inbred Unknown 70421 AAW Atomic Energy Commission, Melbourne (Adams et al 1984). inbred Unknown 70422 ABH Yamada from a cross between BN and outbred Wistar stock, with selection for the above coat colour, as a stock for testing coat colour genes in albino strains (Yamada and Nakajima 1976). To Nishimura, Hammatsu University School of Medicine, Japan. Nishimura, Hammatsu University School of Medicine, Japan. inbred Unknown 70423 ACP Dunning to National Cancer Institute 1967 at F54. inbred Unknown 70424 AGA Nakic, Zagreb (Stark et al 1968b). Used for immunological studies. inbred Unknown 70425 AGUS Germ-free strain developed by Gustafsson from stock (Sprague-Dawley?) by hysterectomy derivation in 1948 at F10. To Laboratory Animals Centre, Carshalton 1968 at F26. inbred Unknown 70426 ALB/N Albany Wolf and Wright, Albany Medical College in an attempt to develop a strain with a high incidence of spontaneous tumours, to NIH in 1950. No inbreeding records prior to transfer. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown 70427 AM Torres, Rio de Janeiro, from outbred stock. inbred Unknown 70428 AMDIL Torres, Rio de Janeiro, from outbred stock inbred Unknown 70429 AO From ARC Compton, probably as "WAG", to Gowans, Oxford 1957. Appears to differ from other WAG sublines in having A at the agouti locus. Resistant to the development of experimental allergic encephalomyelitis upon treatment with a myelin basic protein-specific T cell line derived from an F1 hybrid between resistant AO and susceptible DA strain rats. This resistance was not abrogated by deletion of host's leukocytes using sublethal irradiation and cytotoxi drugs (Mostaricastrojkovic et al, 1992). Susceptible (2/4) to ocular infection with herpes simplex virus. PVG was relatively resistant (Nicholls et al, 1994). Met-enkephalin decreased H2O2 production by macrophages (contrast DA) (Radulovic et al, 1995). inbred Unknown 70440 BIRMA AM Mandl 1952 from Albino rats purchased from Birmingham market. inbred Unknown 70446 LIH/Lac Liverpool Hooded "Liverpool Hooded". Strain now probably extinct, but haematology described by Lovell et al (1981). unknown inbred Unknown 70447 MNR Maudsely non-reactive PL Broadhurst, 1954, from a commercial Wistar stock with selection for low defecation response in an open field. To Harrington 1965 at F25 and to National Institutes of Health 1964 at F18+. The strain was apparently inbred as a number of parallel sublines which differ at the agouti locus and major histocompatibility complex (Hansen et al 1982). unknown inbred Unknown 70448 MNRA Substrain of MNR. To Harrington in 1965 at F25 (Harrington 1981). inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 70449 MR/N Maudsely reactive Origin: as for MNR except selection was for high defecation response in the open field. To Harrington in 1965 at F25 and to NIH in 1964 at F18+ (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center inbred Unknown 70450 NBR Poiley 1966 from heterogeneous stock inbred Unknown 70451 OKA From faculty of Medicine, Kyoto, Japan to Dr. J Roba, Machelen, Belgium 1970, to Dr. H Bazin 1971 (Bazin 1977). Should probably regarded as a subline of SHR, though skin grafts between OKA and SHR are rejected after 30-45 days. inbred Unknown 70452 OM Osborne-Mendel Heston 1946 from non-inbred Osborne-Mendel stock obtained from J White, to NIH at F10 (Hansen et al 1982). NIH Autoimmune Rat Model Repository and Development Center outbred Unknown 70453 SR Rapp from a Sprague-Dawley outbred colony developed by LK Dahl, Brookhaven National Laboratories, Upton, New York, selected for resistance to salt-induced hypertension (Dahl et al 1962a,b). Also designated R/JR by Rapp (1984), and Dahl R by Mollegard, Copenhagen. inbred Unknown 70454 WKY/N National Institutes of Health in 1971 from outbred Wistar stock from Kyoto School of Medicine. Inbred as a normotensive control strain for SHR (Hanesn et al 1973), though there is some controversy about the validity of such use (see Rapp 1987). Johnson et al (1992) found large genetic differences using restriction fragment length polymorphisms between WKY and SHR, comparable to the maximum divergence possible between unrelated humans. Also, breeding stock of ths strain was distributed before F20, possibly resulting in the emergence of a number of strains or substrains (Kurtz and Morris 1987, Kurtz et al 1989). It is therefore essential that subline codes are always used in designating this strain. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-01) 70455 WKYO/Kyo Inbred in 1980 from outbred Wistar Kyoto rats. Highly sensitive to the development of experimental glomerulonephritis following injection of nephritogenic antigen from bovine renal basement membrane (1/10) (Naito et al, 1991). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm 70456 WM Wistar Institute to Tokyo University in 1938. To Hokkaido in 1944. To National Institute of Genetics, Mishima in 1951. inbred Unknown 70457 WMS Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Sim via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Good reproductive performance. Has superficial glomeruli and prominant elongated renal papilla. See also MW and MWF inbred Unknown 70459 ZDF Vancouver diabetic fatty Zucker "Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters (Peterson et al 1990b). Animal Model Core Facility, University of California at Davis inbred Unknown 70508 SD Sprague-Dawley This strain was initiated by R. Dawley, Sprague-Dawley Company, Madison, Wisconsin in 1925. A hybrid hooded male of unknown origin was mated to a white female (Douredoure strain, probably Wistar) and subsequently to his white female offspring for 7 generations. All the current colonies are from this original stock. Harlan Sprague Dawley Inc. United States outbred Unknown Aqp1|Brca1|Brca2|Crebbp|Cyp11b1|Drd1|Edn1|Esr1|Gabrb1|Htr1b|Nos1|Nppa|Nppb|Prlr|Sdc1|Sdc4|Gpc1|Alox15|E2f5|Slc15a1|Cnga1|E2f1 2141|2218|2219|2401|2453|2518|2532|2581|2649|2846|3184|3193|3194|3407|3648|3650|61853|70493|621357|621736|621815|728892 70509 F344/NRrrc Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research,To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center inbred Cryopreserved Sperm Cdkn2a|Gfap|Tnfrsf1a 2323|2679|621237 625624 LETsc2^Eker/Hin Eker rat is derived from the Long-Evans strain that has a mutation in Tsc2 gene. Originally reported by R. Eker in 1954 at the Norwegian Radium Hospital, Oslo. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo Japan mutant Unknown Tsc2|Tsc2^Eker 3908|12791989 10 13848210 13883189 1 - by flanking markers 10 13778990 13813725 1 - by flanking markers 10 13962006 13996684 1 - by flanking markers 625659 DRH/Seac Established by inbreeding closed colony of Donryu rats ( purchased from SEAC Yoshitomi, Ltd. Fukuoka, Japan) for more than 20 generations, their diet continously contained a hepatocarcinogen 3 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer 628372 ACI.FHH-(D1Mit34-D1Rat156)/Eur The Rf-1 region of chromosome 1 which is between the D1Mit34 and D1Rat156 is transferred from FHH to the genomic background of ACI. Animal Research Center of the Erasmus University, Rotterdam, The Netherlands congenic Unknown 1 230963695 253410500 1 - by flanking markers 1 252776360 279213254 1 - by flanking markers 1 245529606 245529710 1 - by flanking markers 628486 NER/Kyo Noda epileptic rat, GMS Originated in a group of Crj:Wistar rats which were developed and maintained at the Research Institute for Animal Science in Biotechnology and Toxicology, Kanagawa, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology 628525 Ni/Hin Found in the Sprague-Dawley (Jci:SD) in Japan. In these the Tsc2 gene is not mutated. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream Clea Japan Inc. Shiga inbred Unknown 628907 SHR.BN-RT1ⁿ This strain is derived by transferring a segment from chr. 20 which contains the major histocompatibility complex of the BN-Lx strain onto SHR. congenic Unknown 628908 SHR.BN-(D1Mit3-Igf2)/Ipcv Segment of chromosome 1 from the normotensive BN/Cr was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Igf2|Sa|Scnn1b|Scnn1g 2870|3616|3640|3641 1 146971846 202915231 1 - by flanking markers 1 162692213 222733868 1 - by flanking markers 1 156446196 215839081 1 - by flanking markers 628909 SHR.BN-(D13Arb5-Ren1)/Ipcv Segment of chromosome 13 from the normotensive BN/Crl was transferred to SHR. After 10 generations of backcrossing to SHR, the differential segment was fixed with the flanking markers.These were maintained in the homozygous state by brother x sister mating. The size of the chromosome transferred is 2.5 cM with an additional 16 cM region of heterozygosity. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 13 25430110 64281346 1 - by flanking markers 13 14281836 72173144 1 - by flanking markers 13 9016742 67207219 1 - by flanking markers 629459 ZUC-Lepr^faSteJrpz-/- Obtained from Louisiana Sate University Medical Center, New Orleans by the Department of Physiology. Department of Physiology, Louisiana State University Medical Center, New Orleans, LA, USA mutant Unknown 629462 ZUC-Lepr^faSte-/- This recessive fatty Zucker rat carries a mutation that occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. University of California Davis, Davis, CA mutant Unknown Lepr^fa 13432153 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 629463 ZUC-Lepr^+Ste This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype. University of California Davis, Davis, CA mutant Unknown Lepr 3001 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 629464 ZUC-Lepr^fa This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions. mutant Unknown Lepr^fa 13432153 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 629465 SHR/NCrlCrlj NIH derived strain maintained at the Charles River, Japan. Charles River Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cardio Hypertension 629481 SHR.WKY-(D1Wox33-D1Got194) This congenic strain contains a WKY chromosome 1 segment containing QTLs affecting blood pressure and salt sensitivity transferred to the SHR background. Département de Physiologie et Pharmacologie Clinique, Faculté de Pharmacie, France congenic Unknown 1;2 160754901;198300754 208638156;198300855 1 - by flanking markers;1 - by flanking markers 1;2 174300636;224991853 228298222;224991955 1 - by flanking markers;1 - by flanking markers 1 221363524 221363653 1 - by flanking markers 629482 WKY.SHR-(D1Wox19-D1Mit2)/Njs Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY University of Leicester, Leicester, UK congenic Unknown 1 134980526 185691036 1 - by flanking markers 1 204942418 204942572 1 - by flanking markers 1 197963658 197963812 1 - by flanking markers 629484 LEW-tl The outbred stock of Osborne Mendel rats maintained at the Great lakes Naval Training Station in early 1970s had the tl mutation. These rats donot survive to breed so this mutation was transferred to the LEW/N background by a series of backcrosses of heterozygous carriers to LEW/N. Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1|Csf1^tl 621063|12910954 629485 LE/Stm The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Sperm Diabetes Obesity; Cancer 629486 PVG/OlaHsd black hooded, from A.R.C. Cambridge, United Kingdom; to Olac, United Kingdom, in 1979; to Harlan, United States, in 1992 Envigo inbred Cryorecovery 629487 SHR.WKY-(D1Wox19-D1Wox34)/Njs Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR University of Leicester, Leicester, UK congenic Unknown 1 168382195 185691036 1 - by flanking markers 1 182435050 204942572 1 - by flanking markers 1 175447029 197963812 1 - by flanking markers 629488 SI-Tg(Ednrb)Ywa transgenic spotting lethal A 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals. University of Texas Southwestern Medical Center, Dallas, Texas transgenic Unknown Ednrb|Ednrb^sl 2536|10755424 629489 Eker-Tg(Tsc2)5Hin Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 629490 DA.F344-Aia1/1 genomic segments with region of interest from chr 20 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 20 2790511 32560683 1 - by flanking markers 20 5249981 36993999 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 629491 DA.F344-Aia1/2 genomic segments with region of interest from chr 4 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 36592628 85014222 1 - by flanking markers 4 37534124 151090861 1 - by flanking markers 4 37685175 86438507 1 - by flanking markers 629492 Sl Natural mutation in the progeny of a Wistar-Imamichi female and a wild rat. Institute of Animal Reproduction, Omiya, Japan mutant Unknown Ednrb|Ednrb^sl 2536|10755424 15 87893141 87898700 1 - by flanking markers 15 91500400 91531979 1 - by flanking markers 15 88004775 88036354 1 - by flanking markers 629493 DA.F344-Aia1/3 genomic segments with region of interest from chr 4 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 4 54879077 54879214 1 - by flanking markers 4 55118586 55118722 1 - by flanking markers 4 55375865 55376001 1 - by flanking markers 629494 DA.F344-Aia1/4 genomic segments with region of interest from chr 10 were inserted to DA strain National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland congenic Unknown 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 629495 WKY.SHRSP-(Mt1pa-D1Rat57)/Bbb Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY Freie Universitdt Berlin, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 177313819 185690396 1 - by flanking markers 1 195736433 204941832 1 - by flanking markers 1 188794419 197963072 1 - by flanking markers 629499 BXS/Ipcv These recombinant inbred strains are obtained by crossing normotensive BN-Lx/Cub with hypertensive SHR/Ola progenitor strains. Czechoslovak Academy of Sciences, Prague recombinant_inbred Unknown 629500 LEXF/Stm Recombinant inbred strain derived from LE/Stm (derived from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/Stm (derived from F344/DuCrlj; Charles River Japan) and then maintained by brother-sister mating. Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan recombinant_inbred Unknown 629501 SD-Tg(Ren2)27 This is a hypertensive rat strain in which the mouse Ren2 renin gene along with its 5' and 3' flanking sequences were microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background. Center for Genome Research, University of Edinburgh, UK transgenic Unknown Agtr1b|Ace 2071|2493 629502 SHR.BN-(Il6-Npy) This congenic carries a chromosome 4 segment derived from BN/Crl (Charles River) and repeated backcross to SHR/NCruk and selection for Il6 and Npy heterozygotes MRC Clinical Centre, London, UK congenic Unknown Il6|Npy 2901|3197 4 456799 78045187 1 - by flanking markers 4 3095536 144240956 1 - by flanking markers 4 3043231 79565059 1 - by flanking markers 629503 SHR.BN-(D19Rat57-D19Mit7)/Ipcv The segment of chromosome 19 from BN/Crl was transferred onto the genetic background of SHR/Ola. After 8 generations of selective backcrossing the transferred segment had the Agt gene. This was fixed by intercrossing heterozygotes and maintained by by brother and sister mating. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Agt 2069 19 57234802 57235101 1 - by flanking markers 19 59599823 70892142 1 - by flanking markers 19 48798983 60220581 1 - by flanking markers 629504 WKY.SHR-(D1Mit3-D1Rat57)/Iwai Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 146971846 177313977 1 - by flanking markers 1 162692213 195736590 1 - by flanking markers 1 156446196 188794576 1 - by flanking markers 629505 SS.MNS-(D10Mit11-D10M11Mit119)/Mco fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers 629506 LEW-tl.BN-(D2Arb16-D2Wox8) LEW.tl carrier females were mated with BN/SsNHsd males to develop these congenic animals which has a 2.5 cM region of chr 2. Inflammatory Joint Diseases Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD congenic Unknown Csf1 621063 2 198312439 212776982 1 - by flanking markers 2 225003539 237636701 1 - by flanking markers 2 205572952 219581453 1 - by flanking markers 629509 FHH/EurMcwi An outbred stock of fawn hooded rats introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, then brother x sister mating initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in hypertension and proteinuria. The colony was transferred to Erasmus University. PhysGen, Rat Resource and Research Center inbred Live Animals; Cryorecovery 629510 SS.BN-(D12Arb13-D12Rat79)/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen congenic Live Animals 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 629511 SS-Chr 2^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629512 FHH-Chr 12^BN/Mcwi A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629513 SS-Chr 4^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629514 SS-Chr 6^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm 629515 SS-Chr 7^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629516 SS-Chr 8^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629517 SS-Chr Y^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629518 SS-Chr 9^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629519 SS.BN-(D13Mgh13-D13Mit4)/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen congenic Unknown 13 90551150 90551272 1 - by flanking markers 13 41256240 97381801 1 - by flanking markers 13 36147533 92916783 1 - by flanking markers 629520 FHH-Chr 1^BN/Mcwi A cross of FHH and BN strains which results in a FHH genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm 629521 SS-Chr 11^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629522 SS-Chr 20^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629523 SS-Chr 13^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 629524 SS-Chr 16^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm 629525 SS-Chr 18^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 629548 SHR.BN-(D1Mit3-Igf2)/1lpcv SHR.BN-(D1Mit3-Igf2)/1lpcv is a subline of SHR.BN-(D1Mit3-Igf2)/lpcv. Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 629578 SS.LEW-(D5Rat130-D5Mco10)/Jr A large segment of chr. 5 from LEW was inserted into Dahl salt-sensitive (SS/Jr) background, congenic substrains were developed by crossing SS.LEW to SS for 8 generations Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio. congenic Unknown 5 32701659 168174140 1 - by flanking markers 5 36590997 171686754 1 - by flanking markers 5 31926122 168109659 1 - by flanking markers 631158 DXE1/Ztm DXE1/Ztm is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown 631160 DXE2/Ztm Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown 631161 DXE3/Ztm Is a recombinant inbred strain produced from a cross between DA/Han and E3/Han rats. Zentralinstitut Fur Versuchstierzucht, Hannover, Germany recombinant_inbred Unknown 631163 LE/BluGill This inbred colony from the University of Illinois at Urbana-Champaign was derived from Long Evans Outbred rats originally purchased from Blue Spruce Farms, Altamont, NY in the Fall of 1982. In order to reduce individual differences, Principal Investigator, Martha U. Gillette, PhD, initiated inbreeding (consecutive brother-sister matings). In March 1993, the colony reached generation #20, defined by the Institute for Animal Laboratory Research (ILAR) as the point during inbreeding at which the strain can officially be considered inbred. This inbred colony continues to be used by Dr. Gillette and her laboratory at the University of Illinois at Urbana-Champaign to research cell, molecular and integrative mechanisms in the brain's circadian clock. University of Illinois at Urbana-Champaign inbred Unknown 631182 DA/BklArbN This is maintained in the NIH animal facility of the Inflammatory Joint Diseases Section, Arthritis and Rheumatism Branch, Bethesda MD by brother and sister breeding. NIH, Arthritis and Rheumatism Branch, Bethesda MD inbred Extinct 631219 SDT/Jcl Established from an outbred colony of Sprague-Dawley (purchased from Charles River Japan) in Torii Pharmaceutical Co. Ltd. This company was merged to CLEA Japan Inc. in 1998. This substrain was established in 1997. Rats with polyuria and glucosuria were bred for 20 generations of brother-sister mating. CLEA Japan, Inc inbred Live Animals (as of 2021-04-23) 631220 SS.LEW-(D10Mco1-D10Mco31)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10 69986912 84284667 1 - by flanking markers 10 68786307 83220224 1 - by flanking markers 10 69123603 83411656 1 - by flanking markers 631275 WKY/Cfd WKY/Cfd Substrain of WKY/Cr parents from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM), the colony was derived from WKY/Cr parents obtained from Charles River (St. Constant, Quebec CA) Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown 631276 WKHA/Cfd WKHA/Cfd Originated from a colony maintained at the Institut de Recherches Cliniques de Montreal (IRCM) Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA inbred Unknown 631278 SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc Congenic strain created by introgressing the Fst-D2Mgh12 (expanded to D2Rat13-D2Rat157) region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Gstm1|Vcam1|S1pr1 2633|2755|3952|61958 2 46542246 210636169 1 - by flanking markers 2 65576721 235592880 1 - by flanking markers 2 46537589 217498710 1 - by flanking markers 631279 SHRSP.WKY-(D2Rat13-D2Mit5)/Gcrc Congenic strain created by introgressing the Fst-D2Mit5 region from Chromosome 2 of WKY/Gcrc into the SHRSP/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst 2633 2 46542246 66680209 1 - by flanking markers 2 65576721 86560306 1 - by flanking markers 2 46537589 66828236 1 - by flanking markers 631280 WKY.SHRSP-(D2Mit5-D2Mgh12)/Gcrc Congenic strain created by introgressing the D2Mit5-D2Mgh12 region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Pklr 3336 2 66680022 181223505 1 - by flanking markers 2 86560119 207874394 1 - by flanking markers 2 66828049 188458034 1 - by flanking markers 631281 WKY.SHRSP-(Fst-Pklr)/Gcrc Congenic strain created by introgressing the Fst-Pklr region from Chromosome 2 of SHRSP/Gcrc into the WKY/Gcrc background in the lab of Dr Anna Dominiczak, University of Glasgow. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Fst|Pklr 2633|3336 2 46542246 181223505 1 - by flanking markers 2 65576721 207874394 1 - by flanking markers 2 46537589 188458034 1 - by flanking markers 631282 DA.F344-(D10Arb20-D10Arb22)/Arb This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background. Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 24006429 24006612 1 - by flanking markers 10 24340447 107484761 1 - by flanking markers 10 24483076 107857673 1 - by flanking markers 631283 DA.F344-(D10Arb21-D10Arb22)/Arb This congenic substrain contains an F344 chromosome 10 segment transferred to a DA background. Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, MD, USA congenic Extinct 10 14721135 14721325 1 - by flanking markers 10 14644150 107484761 1 - by flanking markers 10 14827894 107857673 1 - by flanking markers 631285 IER/Ihr A mutant rat strain which is a useful model for human cataract. Institute of Experimental Animals of Shiga University, Medical Science, Ohtsu, Japan, National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology; Ophthalmology 631286 WKY/Izm Wistar-Kyoto WKY strain from the Izumo colony National BioResource Project for the Rat in Japan inbred Live Animals 631294 F344.GK-(D1Arb42a-D1Rat90)/Swe This congenic strain carries a GK chromosome 1 segment defined by markers D1Arb42a and D1Rat90 transferred to the F344 background Department of Medical Cell Biology, Uppsala University, Uppsala, Sweden congenic Unknown Cyp2c12 2470 1 267110921 267111153 1 - by flanking markers 1 266156838 289137268 1 - by flanking markers 1 258709726 281795785 1 - by flanking markers 631571 SS.LEW-(D1Uia8-D1Mco38)/Jr Segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 110818690 110818887 1 - by flanking markers 1 117836211 117836407 1 - by flanking markers 1 116680361 116680557 1 - by flanking markers 631572 SBH/Ygl Sabra hypertension prone Bred from the original SBH colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed. Ben Gurion University Barzilai Medical Center, Ashkelon, Israel inbred Unknown 631573 SBN/Ygl Sabra hypertension resistant Bred from the original SBN colony established by Ben-Ishay at the Hebrew University Medical Center in Jerusalem. The original colony had been bred for 20+ generations but was found to be partly outbred and display phenotypic variability. To purify the colony and establish phenotypic homogeneity breeding pairs from the original colony were transferred to Ben Gurion University Barzilai Medical Center in Ashkelon, Israel in 1992 where renewed secondary breeding was performed. Ben Gurion University Barzilai Medical Center, Ashkelon, Israel inbred Unknown 631574 Wild/K Wild rats were captured in Rostock, Greifswald, in an industrial pig farm near Greifswald and some in a farm near Munich in Germany. Department of Laboratory Animal Science, Greifswald, Karlsburg, Germany wild Unknown 631576 LEW/CrlCrlj Developed by Dr. Lewis from Wistar stock in the early 1950s. To CRL from Tulane in 1970 at F34. Charles River, Atsugi, Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Immunology; Osteosis 631577 SHR/Izm Strain originated in 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan, Funabashi Farm, Chiba, Japan inbred Live Animals Cardio Hypertension 631578 SHR.BN-(D2Rat171-D2Arb24)/Ipcv This congenic strain carries a BN/Crl chromosome 2 segment transferred to the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague 4, Czech Republic. congenic Unknown 2 116874922 221284686 1 - by flanking markers 2 135770850 248088631 1 - by flanking markers 2 116075644 228737869 1 - by flanking markers 631579 LEW/OlaHsd Obtained from Harlan UK, and for this study kept at the Department of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands. Harlan France inbred Unknown 631581 LEW.1F Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the RT1^f haplotype into the LEW stock Zentralinstitut fur versuchstierzucht, Hannover, Germany inbred Unknown 631582 SS.WKY-(Mme-D2Wox18)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 174727552 1 - by flanking markers 2 173193501 201402094 1 - by flanking markers 2 153799203 181987474 1 - by flanking markers 631583 SS.WKY-(D2Mgh8-D2Mgh9)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 631585 SS.LEW-(D16Mit2-D16Rat12)/Ayd This congenic strain carries a LEW/NCrlBR chromosome 16 segment transferred to the SS/Jr background Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 631586 SS.MNS-(D10Mco14-D10Mit11)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic Unknown 10 45105978 102587587 1 - by flanking markers 10 44914976 101157704 1 - by flanking markers 10 45157430 101482600 1 - by flanking markers 631587 SS.MNS-(D10M11Mit119-D10Mit11)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic Unknown Ace 2493 10 69986912 102587587 1 - by flanking markers 10 68786307 101157704 1 - by flanking markers 10 69123603 101482600 1 - by flanking markers 631588 SS.MNS-(D10Mit11-Vamp2)/Mco Fragment of the chromosome 10 derived from MNS and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 101848683 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 631589 SHR.WKY-(D1Wox34-D1Rat164)/Njs Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 168382195 170218440 1 - by flanking markers 1 182435050 184213712 1 - by flanking markers 1 175447029 177235302 1 - by flanking markers 631590 SHR.WKY-(D1Wox34-Sah)/Njs Congenic substrain derived by backcrossing congenic strain SHR.WKY-(D1Wox19-D1Wox34) to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Acsm3 62086 1 168382195 178081751 1 - by flanking markers 1 182435050 196475596 1 - by flanking markers 1 175447029 189541233 1 - by flanking markers 631591 WKY.SHR-(D1Rat56-D1M7Mit206)/Njs Congenic substrain derived by backcrossing congenic strain WKY.SHR-(DWox19-D1Mit2) to WKY Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 172926151 172926455 1 - by flanking markers 1 191393321 191393468 1 - by flanking markers 1 184419946 184420093 1 - by flanking markers 631592 WKY.SHR-(D1Rat236-D1M7Mit206)/Njs Congenic substrain derived by backcrossing congenic strain WKY.SHR-(D1Wox19-D1Mit2) to WKY Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown 1 155183458 155183662 1 - by flanking markers 1 169098399 169098603 1 - by flanking markers 1 162891429 162891633 1 - by flanking markers 631593 LEW/Rj Strain first obtained in 1987 from the Centre de Selection et d’Elevage d’Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). Hopital Purpan, Toulouse Cedex, France inbred Unknown 631594 BN/Rj Strain first obtained in 1987 from the Centre de Selection et d?Elevage d?Animaux de Laboratoire (CSEAL, Orl´eans, bred at Janvier breeding centre (Le Genest-Saint-Isle, France). Hopital Purpan, Toulouse Cedex, France; Centre D'Elevage R. Janvier, Route des Chenes-Secs Le Genest-St-Isle, France inbred Unknown 631595 LEW.1AV1.DA-(D10Rat92-D10Rat135)/Ubc LEW.1AV1 x DA F1 was backcrossed to LEW.1AV1 for 9 generations with selection for the Oia3 locus using flanking markers, then F1N9F1 rats were used as founders for the Oia3 congenic strain. Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 108776963 1 - by flanking markers 10 77132487 108145987 1 - by flanking markers 10 77269759 108540162 1 - by flanking markers 631596 LEW.1AV1.DA-(D10Rat92-D10Wox17)/Ubc Congenic substrain derived from intercrosses of the Oia3-congenic strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2. Biomedical Center in Uppsala, Sweden congenic Unknown 10 78170416 91168491 1 - by flanking markers 10 77132487 89831596 1 - by flanking markers 10 77269759 90042115 1 - by flanking markers 631597 LEW.1AV1.DA-(D10Wox17-D10Rat135)/Ubc Congenic substrain derived from intercrosses of the Oia3 containing strain (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 Biomedical Center in Uppsala, Sweden congenic Unknown 10 91168332 108776963 1 - by flanking markers 10 89831438 108145987 1 - by flanking markers 10 90041957 108540162 1 - by flanking markers 631598 LEW.1AV1.DA-(D10Got154-D10Rat135)/Ubc Congenic substrain derived from the Oia3 containing strain intercrosses of (LEW.1AV1.DA-(D10Rat20-D10Mgh1)x LEW.1AV1)F2 Biomedical Center in Uppsala, Sweden congenic Unknown 10 101532360 108776963 1 - by flanking markers 10 100150192 108145987 1 - by flanking markers 10 100460820 108540162 1 - by flanking markers 631599 SHRSP/Izm Strain has been maintained at Kyoto University. National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension; Neurobiology 631600 WKY.SHRSP-(Mt1pa-D1Rat200)/Bbb Fragment of the chromosome 1 derived from SHRSP and repeated backcross to WKY Max-Delbruck-Center for Molecular Medicine, Freie Universitat Berlin, Berlin, Germany. congenic Unknown Mt1-ps1 3118 1 126938969 185690396 1 - by flanking markers 1 134116233 204941832 1 - by flanking markers 1 133076978 197963072 1 - by flanking markers 631601 WKY.SHRSP-(Asgr1-Vamp2)/Bbb Both the strains WKY and SHRSP were from University of Heidelberg, Heidelberg, Germany; The SHRSP was originated in 1974 from Okamoto and Aoki Max-Delbruck Center for Molecular Medicine, Germany congenic Unknown Asgr1|Vamp2 2160|3949 10 55848264 56903173 1 - by flanking markers 10 55418231 56411205 1 - by flanking markers 10 55675171 56666086 1 - by flanking markers 631602 BN/Elh These rats were transferred in 1986, from University of Pittsburgh, at 35 generation to University of Otago, New Zealand and have been continuously inbred in a hysterectomy-derived barrier-sustained colony. Department of Surgery and Biochemistry, University of Otago inbred Unknown 631603 WKY/Snk The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown 631604 SHR/Snk The original WKY animals were bred at the Animal Science and Toxicology Laboratories in Japan. Animal Science and Toxicology Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown 631605 SS.LEW-(D10Arb9-D10Got101)/Jr Congenic strain originated from an inbred SS/Jr strain. Medical College of Ohio, Toledo congenic Unknown 10 65068360 77547622 1 - by flanking markers 10 65339106 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 631606 SS.MNS-(D10Rat13-D10Mit11)/Jr Congenic strain originated from an inbred SS/Jr strain. Medical College of Ohio, Toledo congenic Unknown 10 97152234 101848683 1 - by flanking markers 10 95701164 95701443 1 - by flanking markers 10 95967019 95967298 1 - by flanking markers 631607 SS.WKY-(D2N35-Mme)/Mco Fragment of the chromosome 2 from WKY was transferred to SS/Jr background and repeated backcross to SS/Jr Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Mme 3098 2 153031724 153114515 1 - by flanking markers 2 173193501 173278946 1 - by flanking markers 2 153799203 153880910 1 - by flanking markers 631610 SS.LEW-(D1Rat39-D1Rat131)/Jr Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 125983422 145648920 1 - by flanking markers 1 133172202 159182239 1 - by flanking markers 1 132134307 152871103 1 - by flanking markers 631691 SHRSP/A3Izm Substrain originates from the SHRSP/Izm strain. Research Institute, International Medical Center of Japan inbred Unknown 631693 WKY.SHRSP-(Shbg-Atp1b2)/Bbb This strain has the blood pressure locus from chr 10 Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Atp1b2|Shbg 2171|3671 10 56418323 56435654 1 - by flanking markers 10 55951260 55983036 1 - by flanking markers 10 56205622 56237354 1 - by flanking markers 631694 WKY.SHRSP-(D1Rat200-D1Rat216)/Bbb This single chromosome 1 congenic strain was constructed by using the double congenic SHRSP strain WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2) as the donor strain to transfer the chromosome 1 Bp QTL to the WKY background while selecting against the chromosome 10 Bp QTL to retain only the chromosome 10 locus in strain WKY.SHRSP-(D1Rat200-D1Rat216) Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 1 126938969 185923619 1 - by flanking markers 1 134116233 205161264 1 - by flanking markers 1 133076978 133164521 1 - by flanking markers 631695 SS/JrRkb This inbred strain was derived from the inbred SS/Jr strain available from Harlan Sprague-Dawley (Indianapolis, Ind, US). The colony was established in 1997 at the Freie Universitat Berlin Benjamin Franklin Klinikum, Freie Universitat Berlin, Hindenburgdamm 30, 12203 Berlin, Germany. inbred Unknown 631696 SHR/FubRkb Strain originated from an SHR/Fub strain obtained in 1997 at the Freie Universitat Berlin. Freie Universitat Berlin inbred Unknown 631697 BBDP/Hri This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Hagedorn Research Institute, Gentofte, Denmark inbred Unknown 631698 BN/Mol This strain is maintained at the Mollegaard breeding center. Mollegaard Breeding Centre Ltd., Denmark inbred Unknown 631699 BB.SHR-(D6Rat184-D6Rat101)/K Congenic strain originated from an inbred BB/OK strain crossed with diabetes-resistant SHR/Mol females. University of Greifswald, Germany congenic Unknown 6 121381065 135964844 1 - by flanking markers 6 130448688 144756005 1 - by flanking markers 6 121224054 135658578 1 - by flanking markers 631700 BB.SHR-(Gnal-D18Mit9)/K Diabetic BB/OK were crossed with male SHR/Mol and the resulting hybrids were backcrossed to BB/OK. Hybrids of each backross were analysed using microsatellite markers. After 7 backcrosses the animals were intercrossed and the ones which were homozygous to the SHR allele were selected. This fragment is 24cM long. Department of Laboratory Animal Science, University Greifswald, Karlsburg, Germany congenic Unknown Gnal 2715 18 63595606 80370517 1 - by flanking markers 18 61991738 79748387 1 - by flanking markers 18 62805406 80696375 1 - by flanking markers 631703 SS.LEW-(D10Rat207-D10Mgh1)/Ayd Congenic strain originated from an inbred SS strain Research Centre-CHUM congenic Unknown 10 89896421 89896564 1 - by flanking markers 10 88662536 88662678 1 - by flanking markers 10 88865454 88865596 1 - by flanking markers 631844 HAD1 high-alcohol-drinking These high-alcohol-drinking rats were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown 631845 LAD1 low-alcohol-drinking These low-alcohol-drinking were developed by selective breeding from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed for alcohol preference and consumption. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown 631846 F344.GK-(D1Mgh10-D1Rat90)/Swe Congenic strain originated from an inbred F344/Mcwi strain Karolinska Institute congenic Unknown 1 204280278 267111153 1 - by flanking markers 1 223910550 289137268 1 - by flanking markers 1 217054291 281795785 1 - by flanking markers 631847 F344.GK-(D1Mit7-D1Mgh25)/Swe Congenic strain originated from an inbred F344 strain Karolinska Institute congenic Unknown 1 235677487 240980321 1 - by flanking markers 1 257430524 262617374 1 - by flanking markers 1 250195095 250195290 1 - by flanking markers 631848 SHR/OlaIpcv These are descendents of SHR which were originally from National Institutes of Health. It has been maintained by brother x sister mating at the Czech Academy of Sciences for more than 15 years. A spontaneous recessive mutation in intron 37 (-1 of exon 38) of Sbf1 was identified in this strain. Czech Academy of Sciences, Prague, Czech Republic inbred Unknown Sbf1^m1Ipcv 10002755 634359 WF.WKY-(D5Pas1-D5Uwm37)/Uwm WKY/NHsd rats, carrying a region for resistance to mammary tumors between D5Wox7 and D5Uwm37 on chromosome 5 were mated to WF/NHsd. Progeny were backcrossed to WF for 8-9 generations, selecting for Mcs5 region. University of Wisconsin-Madison congenic Unknown 5 26938679 130527490 1 - by flanking markers 5 30952629 132652105 1 - by flanking markers 5 26251767 128812854 1 - by flanking markers 634363 LEW/NIcoCrlf A substrain of LEW that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. Charles River, France inbred Unknown 634364 SHR/NIcoCrlf A substrain of SHR that was purchased from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. Charles River, France inbred Unknown 634365 SS/Hsd This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. Harlan, Indianapolis, Indiana inbred Unknown 634366 SR/Hsd This strain carries the systolic blood pressure QTL BP143 and the cholesterol-related QTLs Scl14, Scl15, Scl16, Scl17 and Scl18. Harlan, Indianapolis, Indiana inbred Unknown 634367 BN/CrlCrlj 1976's American River CHARUSU Radiobiology Institute (Netherlands) introduced. After the SPF, the cesarean CHARUSU River Japan again in 1990 (stock) was introduced. Charles River Laboratories Japan, National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Ophthalmology; Immunology 634369 WBN/KobSlc wistar bonn/kobori This strain carries the body weight QTLs Bw12 and Bw13, the chronic pancreatitis and diabetes melllitus QTL Cpdm1 and the pancreas inflammation QTL Pi1. National BioResource Project for the Rat in Japan inbred Live Animals Diabetes Obesity; Ophthalmology 634370 F344.GK-(D1Mgh10-D1Rat119)/Swe GK rats, containing a region for susceptibility to development of type 2 diabetes between D1Mgh10-D1Rat110 on chromosome 1 were mated with normoglycemic F344 rats. Progeny were backcrossd onto F344 for 10 generations. Heterozygous animals were intercrossed to establish the congenic strain. Karolinska Institute congenic Unknown 1 204280278 242586311 1 - by flanking markers 1 223910550 264429516 1 - by flanking markers 1 217054291 256949019 1 - by flanking markers 634372 GHS SD rats were selectively bred for hypercalciuria through four generations to create the genetic hypercalciuric strain. Department of Medicine and Physiology, University of Rochester, Rochester, New York inbred Unknown 634373 DA/ZtmRhd DA rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown 634374 E3/ZtmRhd E3 rats originating from Zentralinstitut fur Versuchstierzucht, Hannover, Germany and kept at Lund University. Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown 634376 LEA/Ncu These rats were established from a closed colony of Long-Evans. Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown 634377 BN/Sea BN/Sea This inbred strain was obtained from Sea life Supply Sea Life Supply, Sand City, CA Sea Life Supply inbred Unknown 634380 P alcohol-preferring These were developed at Indiana University for high-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 634381 NP alcohol-nonpreferring These were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Npy 3197 634382 SHR.BN-(D5Wox12-D5Wox20)/Ipcv This congenic strain carries a BN/Crl chromosome 5 segment transferred to the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 5 147065698 147065912 1 - by flanking markers 5 149494416 149494629 1 - by flanking markers 5 145726049 145726262 1 - by flanking markers 634743 BIL University of Pittsburgh from a mutation in a colony of unknown background held by the NIH. NIH Autoimmune Rat Model Repository inbred Unknown 724569 MWF/FubRkb Munich Wistar Fromter The MWF/FubRkb strain was established in generation F45 in 1996 by further inbreeding of rats obtained from the original colony (MWF/Ztm). Freie Universitdt Berlin, Berlin, Germany inbred Unknown 724570 LEW/Rkb The LEW/Rkb rats were obtained from M&B, Bomholtvej, Denmark, and a colony of was established at at the Freie Universitdt (FU) Berlin, Benjamin Franklin Hospital, Germany. Freie Universitdt Berlin, Berlin, Germany inbred Unknown 724571 MITE/Mna This strain was established from captured Japanese wild rats. Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japan inbred Unknown 724572 SS.LEW-(D10Wox51-D10Rat27)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 71294871 77092169 1 - by flanking markers 10 70062921 74127968 1 - by flanking markers 10 70428844 75983805 1 - by flanking markers 724573 SS/JrTol Dahl salt-sensitive (SS/Jr) rats In the 1960s, Dahl selectively bred rats for sensitivity (SS rats) to the hypertensive effect of high-salt diet. Housed at the University of Toledo College of Medicine and Life Sciences. inbred Live Animals (as of 2021-06-08) 724574 SHR/NHsd SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) Harlan inbred Unknown 724575 SS.LEW-(D10Rat17-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 95066219 95066632 1 - by flanking markers 10 93641751 93641934 1 - by flanking markers 10 93886117 93886300 1 - by flanking markers 724576 KDP/Tky Komeda diabetes-prone rat This is a diabetic-prone substrain of LETL where only diabetic males were used for the backcross. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 724577 SS.LEW-(D10Rat27-Igfbp4)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 77091834 87834315 1 - by flanking markers 10 74127825 86759484 1 - by flanking markers 10 75983662 86962563 1 - by flanking markers 728133 BN-RT1ⁿ/Rj This coisogenic strain was produced by selecting BN rats with the RT1ⁿ allele. The Center dElevage R. Janvier, France. coisogenic Unknown 728134 SS.LEW-(D1Rat35-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 157498254 1 - by flanking markers 1 131958920 171330794 1 - by flanking markers 1 130917121 165129939 1 - by flanking markers 728135 SS.LEW-(D5Uwm14-D5Uwm31)/Jr S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 48908533 48908825 1 - by flanking markers 5 52440414 52440705 1 - by flanking markers 5 47842131 47842422 1 - by flanking markers 728137 SS.LEW-(D10Rat141-D10Mgh1)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 19 38295381 38295550 1 - by flanking markers 19 51402312 51402480 1 - by flanking markers 10;19 91548145;40571888 91548388;40572056 1 - by flanking markers;1 - by flanking markers 728138 SS.MNS-(Mme-Gca)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme|Npr1 2167|3098|3195 2 153031724 182740242 1 - by flanking markers 2 173193501 209287892 1 - by flanking markers 2 153799203 189857032 1 - by flanking markers 728139 WKY.SHRSP-(D1Rat200-D1Rat216)(Shbg-Atp1b2)/Bbb This double congenic strain was constructed by using the SHRSP strain as a donor strain to transfer the chromosome 1 Bp QTL to the chromosome 10 congenic strain in a cross between SHRSP and WKY.SHRSP-(Shbg-Atp1b2) to construct an F1 that was then backcrossed to the congenic WKY.SHRSP-(Shbg-Atp1b2) for more than 10 generations to construct the double congenic strain now homozygous for the SS Bp QTL alleles at both the chromosome 10 and chromosome 1 Bp QTLs Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 728140 SS.LEW-(D10Rat11-D10Mgh1)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 10;19 100633512;38295381 100633982;38295550 1 - by flanking markers;1 - by flanking markers 10;19 99184058;51402312 99184250;51402480 1 - by flanking markers;1 - by flanking markers 10;19 99492217;40571888 99492409;40572056 1 - by flanking markers;1 - by flanking markers 728142 BN.SHR-(Il6-Cd36)/Cub This congenic strain has a segment of chr 4 which was of SHR origin. The length of the differential segment is 10 cM and has a defective cd36 allele of SHR. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Cd36|Il6 2301|2901 4 456799 13554416 1 - by flanking markers 4 3095536 14166434 1 - by flanking markers 4 3043231 14191498 1 - by flanking markers 728143 SS.LEW-(D1Mco38-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 110818690 157498254 1 - by flanking markers 1 117836211 171330794 1 - by flanking markers 1 116680361 165129939 1 - by flanking markers 728144 BN.PD-(D8Rat39-D8Rat35)/Cub This congenic strain has a segment of chr 8 from the polydactylous PD/Cub by backcrossing to the BN/Cub. The length of the differential segment is 10-15 cM. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 8 49035642 64617259 1 - by flanking markers 8 48981076 65325374 1 - by flanking markers 8 50356432 50356607 1 - by flanking markers 728145 SS.LEW-(D5Rat130-D5Rat108)/Jr S.LEW-D5Rat130/D5Mco10/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 728146 F344.BN-(D3Mgh13-D3Mgh7)/Dlw This congenic strain carries the BN Edpm3 QTL along with many BN chromosome 3 markers on an F344 background. This strain is maintained at Oakland University, Rochester MN, USA Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 3 112319451 112319585 1 - by flanking markers 3 11139240 123812293 1 - by flanking markers 3 5775856 117288411 1 - by flanking markers 728147 BN.PD-(D8Rat39-D8Rat35),SHR-(D4Mgh2-Cd36),SHR-(D20Wox3-D20Mgh5)/Cub This is a triple congenic strain that has a differential segment of chr 8, major histocompatibility complex from chr 20 and a small segment of chr 4. The length of the differential segment on chr 20 is 20 cM and on chr 8 it is 15 cM. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 728148 SS.LEW-(D16Uia2-D16Rat12)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 350121 4304517 1 - by flanking markers 16 1084304 5038806 1 - by flanking markers 16 1090054 5098704 1 - by flanking markers 728151 UPL/Ncc The UPL rat strain was founded as a mutant with cataracts in a SD/CrljRbrc rat colony. Hiroshima University, School of Medicine, Hiroshima, Japan inbred Unknown 728152 SS.LEW-(D1Rat196-D1Mgh7)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 106445306 1 - by flanking markers 1 59282428 114601028 1 - by flanking markers 1 58354072 113593716 1 - by flanking markers 728153 SS.LEW-(D1Rat196-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 157498254 1 - by flanking markers 1 59282428 171330794 1 - by flanking markers 1 58354072 165129939 1 - by flanking markers 728155 BBDR.BBDP-(D4Mit6-D4Mit7)/1Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 728156 SS.LEW-(D5Mco34-D5Mco10)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with S strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 168173895 168174140 1 - by flanking markers 5 171686510 171686754 1 - by flanking markers 5 168109415 168109659 1 - by flanking markers 728157 SS.LEW-(D5Rat130-D5Mit19)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 32701659 140744137 1 - by flanking markers 5 36590997 142892672 1 - by flanking markers 5 31926122 139102349 1 - by flanking markers 728158 SS.LEW-(D5Uia4-D5Mco10)/Jr SS.LEW-(D5Rat130-D5Mco10)/Jr was selectively bred for 2 generation to fix the chromosome and then backcrossed with SS strain Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614 congenic Unknown 5 144865363 168174140 1 - by flanking markers 5 147288554 171686754 1 - by flanking markers 5 143523348 168109659 1 - by flanking markers 728159 SS.LEW-(D1Mco36-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 124748920 146189942 1 - by flanking markers 1 131958920 160138947 1 - by flanking markers 1 130917121 153834227 1 - by flanking markers 728161 PD/Cub polydactylous Strain a highly inbred strain kept since 1969 at the Institute of Biology Medical Genetics, Charles University, Prague. Strain originated from Wistar rats exhibiting a spontaneous mutation which gave rise to the dolydactyly-luxate syndrome. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic inbred Unknown 728162 SS.LEW-(D1Mco87-D1Rat71)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrlBR rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 145648742 206567907 1 - by flanking markers 1 159182062 226102807 1 - by flanking markers 1 152870926 219232156 1 - by flanking markers 728163 SS.LEW-(D1Uia2-D1Rat49)/Jr Inbred Salt-sensitive SS/Jr rats were mated to LEW/NCrl rats to create congenic strain. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 728165 SS.LEW-(D1Rat196-D1Mco36)/Jr Segment of chr 1 from Lewis which is an in-house colony was introgressed into Dahl salt-sensitive strain which was obtained from Charles River. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 55083934 122992360 1 - by flanking markers 1 59282428 130268180 1 - by flanking markers 1 58354072 129209407 1 - by flanking markers 728166 WKY.SHRSP-(D1Rat112-D1Wox29)/Izm A segment from SHRSP/Izm was transferred on a WKY/Izm background Shimane Medical University, Izumo, Japan congenic Unknown 1 124614679 206574346 1 - by flanking markers 1 131822204 226109267 1 - by flanking markers 1 130779148 219238616 1 - by flanking markers 728167 SS.LEW-(Nos2-D10M11Mit119)/Ayd Strains SS/Jr and LEW were bred for F1 then backcrossed to S to give BC1, this was backcrossed to S to give BC2 and so on till BC5, BC5 was crossed to S to duplicate the recombinant segment Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Nos2 3185 10 65036884 65072453 1 - by flanking markers 10 65423626 65456957 1 - by flanking markers 10 66188290 66221621 1 - by flanking markers 728168 WOK The inbred Wistar-Ottowa-Karlsburg (WOK) rats were obtained from the Diabetes Research Center, Karlsburg, Germany Diabetes Research Center, Karlsberg, Germany inbred Unknown 728170 SS.MNS-(Mme-D2Mit14)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from the S strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Atp1a1|Mme 2167|3098 2 153031724 197256313 1 - by flanking markers 2 173193501 224018437 1 - by flanking markers 2 153799203 204585731 1 - by flanking markers 728171 LEW-RT1¹/Rj This coisogenic strain was produced by selecting LEW rats with the RT1¹ allele. The Center dElevage R. Janvier, France. coisogenic Unknown 728172 SS.MNS-(D2Mit6-Adh1)/Ayd Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive, the Atp1a1 gene was from MNS Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Adh1|Agtr1b|Atp1a1 2044|2071|2167 2 77630629 235811584 1 - by flanking markers 2 98037122 262102977 1 - by flanking markers 2 78321410 243562243 1 - by flanking markers 728183 WF/N To N in 1975 from NCI at F18. Developed by J. Furth in 1945 from a commercial Wistar stock, in an attempt to develop a strain with high incidence of leukemia. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown 728184 SHRSP/A3N To NIH in 1975 from Yamori at F36. SHR was isolated from Wistar Kyoto rats by Okamoto and Aoki in 1963. SHR was later separated into several sublines; the A3 subline was found to have a high incidence of cerebrovascular lesions. (517) NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-04-21) 728185 N:NIH Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony. Unavailable outbred Extinct 728186 LEW/SsN To N 1972 from Silvers at F37. Developed by Lewis from a Wistar stock; to Aptekman and Bogden, 1954, at F20; to Silvers 1958 at F31. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 728187 ACI/N-j Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH. NIH Autoimmune Rat Model Repository and Development Center congenic Extinct 728188 LOU/MN To NIH in 1975 from Bazin. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/M was selected for low immunocytoma incidence and LOU/C for high immunocytoma incidence. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct (as of 2020-09-04) 728189 SHR/N-di Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 728190 RCS-rdy-c Albino retinal dystrophy This congenic strain is obtained from pink-eyed, tan-hooded RCS rats NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 728191 LOU/CN To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045) NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 728192 RCS-rdy-p This congenic strain is obtained from pink-eyed, tan-hooded RCS rats. Retinal degeneration starts at about 3 weeks. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 728193 N:SD Sprague-Dawley To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center outbred Extinct 728194 SHR/N To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 728195 SHR/N-cp The spontaneously hypertensive corpulent (SHR/N-cp) rat developed at the National Institutes of Health (NIH) is a congenic strain in which obese homozygotes {cp/cp) are characterized by genetic obesity, mild hypertension, hyper-insulinemia, and glucose intolerance. This rat strain was initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female SHR ratof the Okamoto strain. A minimum of 12 backcrosses were carried out to eliminate the non-cp genes of the Ko-letsky strain. The obese (cp/cp) littermates develop glucosuria, proteinuria, and renal structural lesions resemblingdiabetic glomerulosclerosis. Rat Resource and Research Center congenic Cryopreserved Embryo (as of 2021-01-20) 728196 RHA/N-j Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. NIH Autoimmune Rat Model Repository and Development Center congenic Extinct 728197 RCS-rdy-+ This congenic strain is obtained from pink-eyed, tan-hooded RCS rats NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 728198 BHE/N Bureau of Home Economics To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University. NIH Autoimmune Rat Model Repository and Development Center inbred Extinct 728199 RHA Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus (Bignami 1965). NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 728200 ACI/N-di Congenic strain originated from ACI/N inbred strain which came to National Institutes of Health in 1950 at F41. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 728358 SB This outbred Sabra strain has been bred in Hebrew University for 60 years.Its breeding scheme and origin is unclear. R. Kalman, Authority for Animal Facilities outbred Unknown 728383 UPL/Cas Upjohn Pharmaceuticals Limited In 1989 spontaneous cataract was observed in Sprague-Dawley rats at the Upjohn Pharmaceuticals Limited. The progeny of affected female had cataract which was hereditary by brother-sister mating. National BioResource Project for the Rat in Japan inbred Unknown Gja8^m1Cas 13524999 728384 SS.LEW-(D10Rat24-Igfbp4)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79229067 87834315 1 - by flanking markers 10 78194957 86759484 1 - by flanking markers 10 78343027 86962563 1 - by flanking markers 728385 WF.COP-(D2Rat2-D2M13Mit286)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line QQ, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 14747814 14747981 1 - by flanking markers 2 14095321 14095488 1 - by flanking markers 2 14237830 14237997 1 - by flanking markers 728386 SS.LEW-(D10Rat119-D10Rat133)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 65668639 1 - by flanking markers 10 53273326 64823355 1 - by flanking markers 728387 WF.COP-(D2Mit29-D2Uwm13)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain (line Q) was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 11957973 1 - by flanking markers 2 5396621 11387756 1 - by flanking markers 2 5417336 11522696 1 - by flanking markers 728388 SS.LEW-(D10Rat119-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 53675361 53675478 1 - by flanking markers 10 53273326 53273444 1 - by flanking markers 728389 WF.COP-(D2Mit29-D2Rat201)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. Rats were genotyped using multiple microsatellite markers spanning 20-30 cM of the Mcs1 locus from D2Mit29 to D2Rat201 on the centromeric end of chromosome 2. The strain was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 5601528 49691646 1 - by flanking markers 2 5396621 68633866 1 - by flanking markers 2 5417336 50260392 1 - by flanking markers 728391 WF.COP-(D2Rat253-D2Uwm17)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. The recombinant congenic strain, line K, was derived from three Mcs1-congenic lines at various backcross generations and was produced at the N10 or N12 backcross generations by intercrossing heterozygous brother and sister pairs. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 25663274 32051637 1 - by flanking markers 2 44171519 50382003 1 - by flanking markers 2 25012974 31224929 1 - by flanking markers 728392 RHA/N-di Roman high avoidance-di mutation Brattleboro rats were mated with RHA/N, the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics. NIH Autoimmune Rat Model Repository and Development Center congenic Unknown 728393 SS.LEW-(D10Got125-D10Rat120)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 86983905 92373412 1 - by flanking markers 10 85965754 91041690 1 - by flanking markers 10 86168841 91270722 1 - by flanking markers 728394 SS.LEW-(D10Rat55-D10Rat13)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 97152587 1 - by flanking markers 10 87933406 95701443 1 - by flanking markers 10 88140923 95967298 1 - by flanking markers 728395 SS.LEW-(D10Rat55-D10Rat120)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 89167104 92373412 1 - by flanking markers 10 87933406 91041690 1 - by flanking markers 10 88140923 91270722 1 - by flanking markers 728396 SS.LEW-(D10Mco15-D10Mgh1)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 98392296 98392508 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 731185 MWF/Fub Munich Wistar Fromter Munich Wistar Fromter rats were obtained from colonies at the Freie Universitat, Benjamin Franklin Campus Berlin, Germany Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown 731186 SHR/Fub Spontaneously hypertensive rats were obtained from colonies at the Freie Universit?t, Benjamin Franklin Campus Berlin, Germany Charite University Medicine Berlin, Campus Benjamin Franklin, Berlin, Germany inbred Unknown 731187 HAD2 high-alcohol-drinking These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown 731188 LAD2 low-alcohol-drinking These were developed by selective breeding for alcohol preference and consumption from the heterogeneous N/N strain. 8 inbred rat strains were intercrossed. After 26 generations of selective breeding, six reciprocal matings were done between HAD1 and LAD1 rats. From each of the 6 parental litters, three brother-sister sets of F1(HAD1?LAD1) rats were chosen and bred to yeild 459 F2 offsprings. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown 731189 SHRSP.WKY-(Klk1-D1Rat116)/Izm A segment of RNO1 (~70 cM in size) was transferred from WKY/Izm onto the genetic background of SHRSP/Izm by the speed congenic method. Department of Gene Diagnostics and Therapeutics, International Medical Center of Japan, Toyama, Shinjuku-ku, Tokyo, Japan congenic Unknown 731190 SS.LEW-(D1Rat211-D1Rat18)/Mco A segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17;1 1147796;43747374 1148037;43747532 1 - by flanking markers;1 - by flanking markers 1 35077728 50297622 1 - by flanking markers 1 33667777 49454378 1 - by flanking markers 731191 SHRSP.WKY-(D2Rat14-D2Mgh12)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 731192 SS.LEW-(D3Rat52-D3Rat130)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 44551542 1 - by flanking markers 3 19410399 55227748 1 - by flanking markers 3 14090411 48562146 1 - by flanking markers 731193 DA.PVG-(D4Rat141-D4Mgh11) PVG allele is introgressed into the DA rats. Recombinant strains were derived from these which were used in further studies. Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 151158666 171204531 1 - by flanking markers 4 210231569 230565226 1 - by flanking markers 4 146942075 168047091 1 - by flanking markers 731194 SS.LEW-(D3Chm64-D3Rat17)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 52127226 121619110 1 - by flanking markers 3 62850379 133513825 1 - by flanking markers 3 56217734 127023997 1 - by flanking markers 731195 DA.E3-(D14Wox8-D14Rat64)/Rhd The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain. Medical Inflammation Research, BMC, University of Lund, Lund, Sweden congenic Unknown 14 68573958 68574165 1 - by flanking markers 14 67969510 67969716 1 - by flanking markers 14 67944692 67944898 1 - by flanking markers 734471 SS.LEW-(D1Mgh7-D1Mco41)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 71 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 106445165 227693454 1 - by flanking markers 1 114600888 249451438 1 - by flanking markers 1 113593576 242177304 1 - by flanking markers 734472 SS.LEW-(D1Mco2-D1Wox6)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 40 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 131956599 131956825 1 - by flanking markers 1 58687835 138778112 1 - by flanking markers 1 57761120 137787460 1 - by flanking markers 734473 SS.LEW-(D17Mco3-D17Mco10)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 17 28967455 70289318 1 - by flanking markers 17 24748228 66699053 1 - by flanking markers 17 22774867 64946465 1 - by flanking markers 734474 SS.LEW-(D5Mit9-D5Mco10)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 62555131 168174140 1 - by flanking markers 5 66128197 171686754 1 - by flanking markers 5 61612600 168109659 1 - by flanking markers 734475 DA/OlaHsd Odell at the Oak Ridge National Laboratory (USA) initiated the inbreeding of these rats which was completed at the Wistar Institute (USA) in 1965. Envigo inbred Unknown 734476 Crl:CD(SD) Originated in 1925 by Robert W. Dawley from a hybrid hooded male and a female Wistar rat. To CRL in 1950 from Sprague Dawley, Inc. Caesarean rederived in 1955 from original Charles River Sprague Dawley. colonies. In 1991, 8 colonies were selected to form the IGS Foundation Colony. Rederived into isolator foundation colony in 1997. IGS refers to animals bred using the CRL International Genetic Standard system. Charles River Laboratories outbred Unknown 734478 F344/DuCrl This colony was originated by mating F344 rats which were purchased from local breeder(Fischer) by M.R. Curtis, Columbia University Institute for Cancer Research, 1920. Dunning at Columbia inbred to form the strain starting in 1920. Dunning to CRL in 1960 at F68. Caesarean rederived in 1960. Charles River Laboratories inbred Unknown 734479 SS.LEW-(D1Mco2-D1Rat49)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 57 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 58687835 171330794 1 - by flanking markers 1 57761120 165129939 1 - by flanking markers 734480 SS.LEW-(D10Mit10-D10Mgh1)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 102587587 1 - by flanking markers 10 27082535 101157704 1 - by flanking markers 10 27237530 101482600 1 - by flanking markers 734481 SS.LEW-(D1Mco2-D1Mco35)/Jr SS rats were crossed with LEW and the F1 rats were backcrossed to SS. Heterozygous rats with the chromosomal region of interest were selected and backcrossed for the next generation. This was done for eight generations and then the heterozygous animals were intercrossed. A 118 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 238358625 238358813 1 - by flanking markers 1 58687835 259930393 1 - by flanking markers 1 57761120 252708858 1 - by flanking markers 734482 SS.LEW-(D1Rat45-D1Mco41)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Sa 3616 1 146189650 227693454 1 - by flanking markers 1 160138797 249451438 1 - by flanking markers 1 153834077 242177304 1 - by flanking markers 734483 SS.LEW-(D1Rat42-D1Wox10)/Jr This is a congenic substrain derived from SS.LEW-(D1Mco2-D1Mco35)/Jr. A 43 cM fragment of LEW chr 1 was introgressed into SS background. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 135418152 220639653 1 - by flanking markers 1 142342107 244066407 1 - by flanking markers 1 141381406 236763528 1 - by flanking markers 734526 OLETF/Got Otsuka Long Evans Tokushima Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan inbred Unknown 734527 OLETF.F344-(D1Rat169-D1Rat459)/Got Female OLETF/Got rats were crossed with F344/DuCrlCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 229876870 267593558 1 - by flanking markers 1 251652807 289700417 1 - by flanking markers 1 244401175 282365384 1 - by flanking markers 734528 OLETF.BN-(D1Rat76-D1Rat459)/Got Female OLETF/Got rats were crossed with male BN rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 230411091 267593558 1 - by flanking markers 1 252243728 289700417 1 - by flanking markers 1 244992467 282365384 1 - by flanking markers 734531 OLETF.F344-(D1Rat306-D1Rat461)/Got Female OLETF/Got rats were crossed with F344/DuCrlj rats. The F1 were backcrossed to OLETF to produce the BC1. Selective males from BC1 were backcrossed to OLETF to produce successive congenic generations. Fourth generation backcrossed congenic animals were intercrossed to produce the F2 generation. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 248583506 266234812 1 - by flanking markers 1 268967725 288207792 1 - by flanking markers 1 280850604 280850810 1 - by flanking markers 734758 DA/Ham Dark-agouti Original DA rats purchased from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). Shizuoka Laboratory Animal Center Hamamatsu, Japan inbred Unknown 734759 SHRSP/Gcrc Spontaneously hypertensive rat, stroke prone SHRSP strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 SHRSP (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown 734760 WKY/Gcrc Wistar-Kyoto WKY strain is maintained at the University of Glasgow since December 1991. This colony is the result of the strain specific brother-sister mating of 13 WKY (6 males and 7 females of each) that were obtained from Dr D.F. Bohr (Department of Physiology, University of Michigan, Ann Arbor) where they had been maintained as inbred colonies for more than 15 years. Their breeding stocks were originally obtained from NIH University of Glasgow, Western Infirmary, Glasgow, UK inbred Unknown 734761 WF/Kga Wistar-Furth Obtained from Hiroshima University (Hiroshima, Japan) and maintained by brother-sister matings for more than 90 generations in the laboratory of Dr M. Kitano (Kagoshima University Dental School, Kagoshima, Japan). Kagoshima University Dental School, Kagoshima, Japan inbred Unknown 737657 LEW.1AV1 Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1^av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region. National Veterinary Institute, Uppsala, Sweden congenic Extinct 737658 PVG.1AV1 Piebald-Virol-Glaxo Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany Harlan UK, Blackthorn, Bicester, UK congenic Unknown 737690 F344/Crli These animals were from Charles River Italia, Calco, LC, Italy Charles River, Calco, Italy inbred Unknown 737691 BN/Crli These animals were from Charles River Italia, Calco, LC, Italy Charles River Laboratories Italy inbred Unknown 737703 LEW-Tg(HLA-B*0702,B2M)120-4Trg^Tg/Tg Lewis from CRL were used as the background strain. This strain was made by pronuclear injection into Lewis embryos. The embryos were coinjected with DNA fragments containing the HLA-B*0702 human gene and the human beta-2-microglobulin gene. Founder 120-4 was selected and carrier animals from this founder were mated and this strain was bred to homozygosity. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-07-08) 737857 DA.PVG.1AV1-(D4Rat155-D4Rat84) Congenic strain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 185398415 185398530 1 - by flanking markers 4 47848402 246313537 1 - by flanking markers 4 48053950 182171018 1 - by flanking markers 737858 DA.PVG.1AV1-(D4Rat155-Spr) Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown Spr 3753 4 119365578 119369308 1 - by flanking markers 4 47848402 181496612 1 - by flanking markers 4 48053950 116916073 1 - by flanking markers 737859 DA.PVG.1AV1-(D4Mgh17-D4Rat56) Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 116611031 143663540 1 - by flanking markers 4 177782842 204673386 1 - by flanking markers 4 113100978 113247809 1 - by flanking markers 737861 DA.PVG.1AV1-(D4Rat63-D4Rat203) Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 161435775 1 - by flanking markers 4 219683260 224843794 1 - by flanking markers 4 152598827 157826751 1 - by flanking markers 737862 SHRSP.WKY-(D2Rat14-D2Mit5)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP. University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 737863 SHRSP.WKY-(D2Wox9-D2Mgh12)/Gcrc A segment of chromosome 2 containing blood pressure QTLs was transferred from WKY into SHRSP University of Glasgow, Glasgow, UK congenic Unknown Gstm1 2755 2 141259937 210636169 1 - by flanking markers 2 161271919 235592880 1 - by flanking markers 2 141583337 217498710 1 - by flanking markers 737864 SS.SR-(D13Mit9-D13Mit1)/Jr Congenic strain developed by introgressing SR/Jr renin gene into the SS/Jr strain. J.P.Rapp, Dept. Physiol. & Molecular Med, Medical College of Ohio, P.O. Box 10008, Toledo, OH 43699-0008, USA congenic Unknown 13 25430110 55033994 1 - by flanking markers 13 14281836 63533335 1 - by flanking markers 13 9016742 58537177 1 - by flanking markers 737865 WKY.SHRSP-(D2Rat14-D2Mgh12) A segment of chromosome 2 which includes blood pressure QTLs was transferred from SHRSP into WKY. University of Glasgow, Glasgow, UK congenic Unknown 2 210636008 210636169 1 - by flanking markers 2 61825950 235592880 1 - by flanking markers 2 42776916 217498710 1 - by flanking markers 737866 WKY.SHRSP-(D2Rat14-D2Mit5) A segment of chromosome 2 near blood pressure QTLs was transferred from SHRSP into WKY University of Glasgow, Glasgow, UK congenic Unknown 2 66680022 66680209 1 - by flanking markers 2 61825950 86560306 1 - by flanking markers 2 42776916 66828236 1 - by flanking markers 737867 SS.SR-(D13N1-D13Mit1)/Jr Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 13 25430110 38985930 1 - by flanking markers 13 14281836 48881269 1 - by flanking markers 13 9016742 43785939 1 - by flanking markers 737868 SS.SR-(Syt2-D13Mit1)/Jr Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Syt2 3804 13 25430110 47699094 1 - by flanking markers 13 14281836 56630530 1 - by flanking markers 13 9016742 51577824 1 - by flanking markers 737869 OLETF.BN-(D1Rat461-D1Rat459)/Got Female OLETF/Got rats were crossed with male BN rats. The fifth generation of congenic animals were used for a Niddm QTL linkage study. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan congenic Unknown 1 266234605 267593558 1 - by flanking markers 1 288207586 289700417 1 - by flanking markers 1 280850604 282365384 1 - by flanking markers 737870 DA.E3-(D20Wox3-D20Mgh4)/Rhd A fragment containing MHC region was introduced in DA by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 3660646 6880472 1 - by flanking markers 20 6935875 7910747 1 - by flanking markers 20 4855475 5875448 1 - by flanking markers 737871 DA.E3-(D12Got46-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23362298 23845733 1 - by flanking markers 12 27316608 30964880 1 - by flanking markers 12 25307118 29014362 1 - by flanking markers 737872 DA.E3-(D4Mit16-D4Mgh11)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 4 130228504 171204531 1 - by flanking markers 4 192286223 230565226 1 - by flanking markers 4 127777294 168047091 1 - by flanking markers 737873 DA.E3-(D6Wox5-D6Rat90)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6 117361909 117362003 1 - by flanking markers 6 126582753 126582846 1 - by flanking markers 6 117355600 117355693 1 - by flanking markers 737885 RHA/Kun Roman high avoidance Roman High Avoidance strain selectively bred for good two-way avoidance acquisition, maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands Dept of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlands inbred Unknown 737886 BDX/Cub Recombinant inbred substrain of BDX, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown 737887 AO/OlaHsd These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Envigo inbred Cryorecovery 737888 LEW/NHsdCpb These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown 737889 LEW/Ipcv These rats were obtained from Harlan UK and maintained at the Dept. of Laboratory Animal Science, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands unknown inbred Unknown 737891 Crl:SD Sprague-Dawley stock initiated by R. Dawley in 1925; To SASCO from ARS/Sprague Dawley in 1979. To Charles River in 1996 now maintained by Charles River Laboratory. Charles River Laboratories, Inc., Wilmington, MA outbred Unknown 737892 ACI/SegHsd This substrain is derived by Albert Segaloff of the Alton Ochsner Medical Foundation in 1956, now maintained by Harlan Sprague-Dawley, Inc. Envigo inbred Unknown Carcinogenesis; Estrogen-induced pituitary growth; Transplant immunology 737893 F344/Ztm Substrain of Fischer rats maintained by Dr. H.J. Hedrich, Hannover Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737894 LEW/Orl Substrain of Lewis rats, maintained in Orleans, France Institut de Transgenose, Orleans, France inbred Unknown 737895 WKY/Ztm Substrain of WKY rats maintained by Dr. H.J. Hedrich, Hannover Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737896 BN/Maas Substrain of BN rats, maintained by Dr. Alex Maas, The Netherlands Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown 737897 ACI/Kun Substrain of ACl maintained by Mr. F.G.J. Janssen at Katholieke Universiteit, The Netherlands Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown 737898 WOKA/K Substrain of WOKA, maintained by Dr. H. Bibergeil in Karlsburg, Germany Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany inbred Unknown 737899 BN/Cub Recombinant inbred substrain of BN, maintained by Faculty of Veterinary Medicine, Utrecht University, The Netherlands Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown 737900 WF/Ztm Recombinant inbred substrain of WF, from Utrecht University to Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737901 LH/Ztu A substrain of LH unknown inbred Unknown 737902 BDIX/Orl Substrain of BDIX, now maintained in Orleans, France Institut de Transgenose, Orleans, France inbred Unknown 737903 Hsd:SD Sprague Dawley Originated by the Sprague-Dawley Company in 1925 through a series of crosses begun with a single-hooded male and six albino females of unknown origin. Current Harlan Laboratories' colonies are direct descendants of this original colony. Harlan outbred Unknown 737904 U/A Substrain of U, from Zootechnical Institute, Utrecht to The Netherlands Cancer Institute The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown 737905 LEW/Maas Strain originated from Dr. Margaret Lewis from Wistar stock, to Aptekman and Bogden 1954 at F20, to Silvers in 1958 at F31. Subsequently distributed by Silvers. University of Limburg, Netherlands inbred Unknown 737906 MWF/Hsd Munich Wistar Fromter Substrain of Munich Wistar stock, inbred by Harlan Sprague Dawley Harlan inbred Unknown (as of 2020-04-03) 737907 SS.SR-Inha/Jr A chromosome 9 segment that may contain an SR/Jr low blood pressure allele was transferred to the SS/Jr recipient strain J.P. Rapp, Dept Physiology and Molec Med, Medical College of Ohio, USA congenic Unknown 737908 WF/NHsd Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan Sprague Dawley. Harlan inbred Unknown 737909 R/A Substrain of R, from Wistar stock in 1947, to The Netherlands Cancer Institute The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown 737910 ARISTORAT/Wsl Substrain of ARISTORAT, from Dr. Herve Bazin in Bruxelles, Belgium Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown 737911 BUF/Ztm Substrain of BUF, from Heston 1946 from Buffalo stock of H. Morris, to Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737912 SS/JrIpcv strain originated from Dr. John P. Rapp, Medical College of Ohio, USA Czech Academy of Sciences inbred Unknown 737913 E3/Ztm Substrain of E3, from Dr. H.J. Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737914 SDL/Ipcv Substrain of SDL unknown inbred Unknown 737915 R/AWa Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 Dept of Genetics, Agricultural University, Wageningen, The Netherlands inbred Unknown 737916 DZB/Gro Substrain of DZB, to Dr. G.A. van Oortmerssen at University of Groningen Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown 737917 WF/Mol Substrain of Wistar Furth stock, from J Furth in 1945 to P Schjodtz, Denmark Mollegaard Breeding Centre Ltd., Denmark inbred Unknown 737918 BN/Orl Substrain of BN, from Billingham and Silvers 1958, to JP Regnault in Orleans, France Institut de Transgenose, Orleans, France inbred Unknown 737919 LEW/Han Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to HJ Hedrich, Hannover, Germany Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737920 BH/Ztm Substrain of BH, black-hooded, from D Wilson at U of Penn, to DML at U of Iowa in 1973, to ZTM in 1973 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737921 BDIV/lfz Substrain of BDIV, from cross between BDI and BDII single mating pair, with selection for coat color alleles (Druckrey 1971) unknown inbred Unknown 737922 LEW/SsNHsd Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNHsd rats were descended from a nucleus colony obtained from the National Institutes of Health, Bethesda, Maryland USA. Harlan became Envigo in 2015. ENVIGO inbred Unknown 737923 SHR/Maas Substrain of SHR, spontaneously hypertensive rat, from Okamoto in 1963, to A Maas in The Netherlands Erasmus MC, DR Rotterdam, The Netherlands inbred Unknown 737924 WAG/Rij Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Kyoto in 1979 Harlan Sprague Dawley, Indianapolis, IN inbred Unknown 737925 BN/Gro Substrain of BN, from Billingham and Silvers 1958, to U of Groningen Center for Biology Kerklaan, University of Groningen, The Netherlands inbred Unknown 737926 F344/NCrl Derived from NIH stock in 1992 by SASCO. To Charles River in 1996. Charles River Laboratories inbred Unknown 737927 ALC/Colle Substrain of ALC unknown inbred Unknown 737928 BN/NHsdCpb Substrain of BN, from Billingham and Silvers 1958 Harlan CPB, Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown 737929 Crl:WI Wistar rats To Scientific Products Farm, Ltd. [predecessor of Charles River United Kingdom (CRUK)] in 1947 from Wistar Institute. To Charles River in 1975 from CRUK. This particular colony was selected because of a low incidence of hydronephrosis. Charles River Laboratories outbred Unknown 737930 LEW/Ztm LEW/Ztm This inbred strain originated from LEW rats housed at the Tierlaboratorium der Medizinischen Hochschule Hannover, Germany Tierlaboratorium der Medizinischen Hochschule Hannover, Germany inbred Unknown Ncf1 61307 737931 GC/Kun inbred Unknown 737932 LEW/Crl Lewis Developed by Dr. Lewis from Wistar stock in the early 1950s. To Charles River from Tulane in 1970 at F34. Charles River Laboratories inbred Unknown 737933 SD/A Sprague-Dawley stock initiated by R. Dawley in 1925 The Netherlands Cancer Institute, Amsterdam, The Netherlands inbred Unknown 737934 BN/RijKun Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Central Catholic University Central Animal Laboratory, Katholieke Universiteit, Nijmegen, The Netherlands inbred Unknown 737935 LEW/Nhg Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Neuherberg, Germany Gesellschaft fur Strahlen- und Umweltforschung Munchen, Neurerberg, Germany inbred Unknown 737936 SR/JrIpcv Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962) Baylor College of Medicine, Houston, TX inbred Unknown 737937 SDH/Ztu unknown unknown inbred Unknown 737938 AUG/OlaHsd Substrain of AUG, derived from US August substrains in 1951 Envigo inbred Cryorecovery 737939 BBWB/Mol unknown Mollegaard Breeding Centre Ltd., Denmark inbred Unknown 737940 PAR/Wsl unknown Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles Belgium inbred Unknown 737941 LEP/Cub Substrain of LEP, from Charles University cross of outbred animals Dr. Vladimir Kren, Dept of Biology, Charles University, Prague, Czech Republic inbred Unknown 737942 LE/Ztm Substrain of Long-Evans, from Dr. M Sabourdy in 1960, to Hannover in 1973 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737943 R/AEurRij Substrain of R, from Muhlbock from a Wistar stock in 1947, to Leyton in 1986 Dr. Adam Goedde, Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Unknown 737944 BN/RijN Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk Harlan Rijswijk, Harlan Sprague Dawley, Indianapolis, IN inbred Extinct 737945 BN/Han Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Dr. H.J. Hedrich, Hannover, Germany in 1973. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737946 WAG/OlaHsd Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, maintained at Harlan Sprague Dawley Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown 737947 BDII/Ztm Substrain of BDII, from cross between BDI and outbred Wistar stock to form single mating pair, with selection for coat color alleles (Druckrey 1971) Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737948 BDE/Ztm Substrain of BDE, resulting from a cross between BDIV and E3, and selected for black hood coat color. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737949 A2/Colle unknown Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown 737950 DA/Ztm Substrain of DA/OlaHsd, to Hannover after 1965 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737951 CAP/Kuv unknown Dr. HU Wottge, Universitat Kiel, Kiel, Germany inbred Unknown 737952 ACI/Ztm unknown Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737953 LEW/Gut Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Dr. H.J. Hedrich, Hannover, Germany unknown source inbred Unknown 737954 AS/Ztm unknown Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737955 Hooded/Colle unknown Dr. RL Collins, The Jackson Laboratory, Bar Harbor, ME inbred Unknown 737956 WF/Gut substrain of Wistar Furth stock, from J Furth in 1945 unknown inbred Unknown 737957 WOKW/K Substrain of WOKW (originally designated WOK.W1), from outbred Wistar BB rats by brother x sister mating, selected for homozygosity for RT1U, a haplotype which predisposes to type I diabetes, to Karlsburg after 1991 Zentralinstitut fur Diabetes, Division of Laboratory Animal Science, Karlsburg, Germany; National BioResource Project for the Rat in Japan inbred Unknown Diabetes Obesity; Metabolism 737958 CHOC/Cub unknown Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown 737959 RNU/Mol unknown Mollegaard Breeding Centre Ltd., Denmark inbred Unknown 737960 Hsd:WI Wistar These are descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania that are now available from Harlan. Harlan outbred Unknown 737961 SR/JrMol Substrain of SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Medical College of Ohio to Mollegaard Mollegaard Breeding Centre Ltd., Denmark inbred Unknown 737962 SPRD/Ztm Substrain of SPRD, from outbred Sprague-Dawley rats at the Hannover facility, where inbreeding began in 1976 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737963 LEW/Cub Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Charles University in Prague Institute of Physiology, Czech Academy of Sciences, Charles University, Prague inbred Unknown 737964 BN/OlaHsd Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk to Harlan UK and back to Indianapolis Harlan inbred Unknown 737965 AGUS/OlaHsd Substrain of AGUS, germ-free strain selected by hysterectomy derivation, to Harlan Sprague Dawley after 1968 Harlan inbred Unknown 737966 LEW/Kuv Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s, to Kiel University in Germany Universitat Kiel, Kiel, Germany inbred Unknown 737967 BS/Ztm Substrain of BS, developed at U of Otago Medical School from a cross of wild rats x Wistar (Zeiss 1966), to Hannover after it was inbred in 1988 Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 737968 BN/Gut Substrain of BN, from Billingham and Silvers 1958 unknown inbred Unknown 737969 NAR/SaU non-albumin rat Substrain of NAR, non-albumin rat, from the National Bio Resource Project in Japan to Utrecht Dept of Laboratory Animal Science, University of Utrecht, The Netherlands inbred Unknown 737970 AMORAT/Wsl unknown Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs, Universite de Louvain, Bruxelles, Belgium inbred Unknown 737971 SHRSP/Rivm unknown National Institute of Public Health and Environmental Protection, The Netherlands inbred Unknown 737972 BN/Crl Silvers and Billingham began brother x sister matings with selection for histocompatibility in 1958 from a brown mutation in a stock of wild rats maintained by King and Aptekman in a pen-bred colony of rats trapped from the wild in 1930 by King at the Wistar Institute. To Charles River from Radiobiology Institute, Netherlands in 1976. Charles River Laboratories inbred Unknown 738038 HEP high ethanol preferring High ethanol preferring strain HEP from generations S6 and S7 of selection were obtained from Robert D. Myers, East Carolina University at Greenville, North Carolina, USA Institut Francois Magendie, rue Camille Saint-Saens, Bordeaux Cedex, France inbred Unknown 738120 LEW-Tg(HLA-B*2705m1,B2M)133-1Trg^Tg/Tg This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. Founder 133-1 was selected and carrier animals from this founder were mated and bred to homozygosity. The strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center in 2002. The strain has been maintained by sibling mating. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-20) 738122 SD-Tg(UBC-EGFP)1BalRrrc This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by inter-breeding of carrier animals. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) 1298093 LEW/NHsd Obtained from Harlan-Sprague Dawley (Indianapolis, Indiana) at 35-45 days of age. Harlan inbred Unknown 1299868 SS.SR-(D7Uia1-D7Mco7)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 113014423 1 - by flanking markers 7 112367543 116100169 1 - by flanking markers 7 112429186 112429483 1 - by flanking markers 1299869 SS.SR-(Cyp11b1)/Jr Congenic strain which has a SR/Jr chromosome 7 segment containing Cyp11b1 transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1299870 SS.LEW-(D5Uia8-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 121964356 134872385 1 - by flanking markers 5 124025017 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 1299871 DA.F344-(D20Arb2-D20Arb8)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 1299872 DA.F344-(D8Arb15-D8Arb22)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 8 71843628 124310337 1 - by flanking markers 8 77653284 127239929 1 - by flanking markers 8 73320439 128033168 1 - by flanking markers 1299873 SS.LEW-(D5Mco34-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 134871897 134872385 1 - by flanking markers 5 137107818 137108002 1 - by flanking markers 5 133313668 133313852 1 - by flanking markers 1299874 OLETF.F344-(D1Rat166-D1Rat90)/Tj Female OLETF were crossed with male F344 rats. The male F1 progeny were backcrossed with female F344 to produce the BC1. Five generations of backcross matings were made between selective males from the BC1 and F344 females to produce the new congenic strain. Sucessive generations were maintained by a standard brother-sister mating protocol. Laboratory of Animal Breeding and Genetics, Kyoto University, Kyoto, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1299875 DA.F344-(D7Rat22-D7Mit2)/Nsi Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 9 times then brother-sister mating to maintain in the homozygous state The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 7 76615341 123191874 1 - by flanking markers 7 125794079 125794357 1 - by flanking markers 7 126080176 126080454 1 - by flanking markers 1299876 SS.LEW-(D5Rat54-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 126386030 134872385 1 - by flanking markers 5 128816449 137108002 1 - by flanking markers 5 124957483 133313852 1 - by flanking markers 1299877 DA.F344-(D10Rat204-D10Arb22)/Arb Region of interest was introgressed from F344/Hsd into DA/BklArb by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 10 95695076 95695218 1 - by flanking markers 10 94240348 107484761 1 - by flanking markers 10 107857524 107857673 1 - by flanking markers 1299878 DA.F344-(D4Arb30-D4Arb4)/Arb The DA/BklArbN strain came from Bantin & Kingman and the F344/NHsd strain came from Harlan Sprague Dawley The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 73972453 154937227 1 - by flanking markers 4 216606296 216606455 1 - by flanking markers 4 150682435 150682594 1 - by flanking markers 1299879 SS.SR-(D7Mco7-D7Wox19)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 113044000 113044249 1 - by flanking markers 7 116151764 116152012 1 - by flanking markers 7 116249395 116249643 1 - by flanking markers 1299880 F344.DA-(D20Arb2-D20Arb8)/Arb Region of interest was introgressed from DA/BklArb into F344/Hsd by eight to ten genotype guided backcrosses followed by minimum five intercrosses. The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 20 2790511 2811567 1 - by flanking markers 20 5249981 5270235 1 - by flanking markers 20 3151815 3172069 1 - by flanking markers 1299881 SS.LEW-(D5Wox3-D5Rat108)/Jr SS.LEW-(D5Rat130-D5Rat108)/Jr was selectively backcrossed with the SS strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 99080786 134872385 1 - by flanking markers 5 101964092 137108002 1 - by flanking markers 5 97921932 133313852 1 - by flanking markers 1300432 HAA/FDSC Hatano High Avoidance In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a higher rate of avoidance response and showed little interindividual variation. Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior 1300433 LAA/FDSC Hatano Low Avoidance In 1985 two lines of Sprague-Dawley were selectively bred for their active shuttle-box avoidance task which is a device used for evaluating the effects of chemicals in pharmacological and toxicological studies and testing learning behavior of animals. These animals have a lower rate of avoidance response and showed little interindividual variation. Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan, National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Behavior 1300439 SD-Tg(UBC-EGFP)2BalRrrc This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into SD rat embryos. Animals that exhibited fluorescence of tails where then mated. The colony was transferred from Carlos Lois, California Institute of Technology, Pasedena, California to the Rat Resource and Research Center in 2002. This strain has been maintained by backcrossing carrier males to SD stock females in order to segregate transgenes and maintain the SD background. The strain now carries a single transgene which is located at chromosome 14q21. Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-07-10) 1302359 HsdFcen:SD These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred Unknown 1302360 W/HsdFcen These animals were originally bought from Harlan, Indianapolis, USA are have been bred at Bioterio Central since then. Bioterio Central, Ciudad Universitaria, Costanera Norte Ciudad Aut?noma de Buenos Aires Buenos Aires, Argentina outbred Unknown 1302372 SDDIO/Rrrc This strain was made by inbreeding SD rats selected for an obese phenotype when fed a high fat diet. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1302373 SDDR/Rrrc This strain was made by inbreeding SD rats selected for a lean phenotype when fed a high fat diet. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1302377 SPRD-Anks6^PKD/Rrrc From outbred Han:SPRD (Sprague-Dawley rats) from Zentralinstitut furVersuchstierkunde, Hannover. This strains carries the Pkdr1 (Anks6) mutation that causes autosomal dominant polycystic kidney disease. The strain was transferred from Dr. Jared Grantham, University of Kansas Medical Center to the Rat Resource and Research Center in 2002. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-07) Anks6^PKD 11534996 5 63633540 63674953 1 - by flanking markers 5 67163440 67204853 1 - by flanking markers 5 62642974 62684387 1 - by flanking markers 1302416 ACI.DA-(D10Rat2-D10Rat19)/Arb A fragment from DA/OlaHsd rats is transferred to ACI/SegHsd. Center for Genomics and Human Genetics, Manhasset, New York congenic Unknown 1302597 LEXF7C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302598 FXLE26/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer 1302599 WKY/Ta This strain originated from Takeda Chemical Industries, Ltd., Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm 1302600 HTX/Kyo hydrocephalus texas 1981 by Kohn from institutional albino rats of unknown origin at University of Texas. From Juntendo University to Kyoto University in 1992. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology 1302601 FXLE23/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302602 FXLE12/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302603 FXLE25/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302604 LEXF4/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302605 LEXF2A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer 1302606 SHRSP/Ta This strain originated from Takeda Chemical Industries, Ltd., Japan National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1302607 FXLE21/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302608 CXH6/Tj Strain originated from the Institute for Animal Experimentation, University of Tokushima, Tokushima, Japan National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology 1302610 KMI/Tky miniature rat ishikawa Miniature Rat Ishikawa derived from a breeding colony of Wistar rats at the Ishikawa Animal Laboratory (Saitama). Introduced to Tokyo Medical College. National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Osteosis Prkg2 3401 1302611 FXLE24/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302612 LEXF10C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302613 BN/fMaiHok Kyoto University (Kyo)to Aichi Colony Institute (Idn)to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1976, F7 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982,F21 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo 1302614 WKY/NMna Inbred strain originated at Fujita Health University School of Medicine, Japan from a WKY/N strain. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1302615 FXLE14/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302616 LEXF10B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302617 LEXF6B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302618 LEXF9/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals; Cryopreserved Embryo Diabetes Obesity; Cancer 1302619 FXLE16/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer 1302620 SHR/Kyo spontaneously hypertension rat Okamoto 1963 from outbred Wistar Kyoto rats. Bred from a male with mild hypertension, mated with a female with high blood pressure. Brother x sister mating with continued selection for high blood pressure (Okamoto 1969, Okamoto et al 1972). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1302621 LEXF10A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302622 WF/Kop Inbred originated from Kagoshima University, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Cancer 1302623 TM/Kyo tester moriyama rat Tester Moriyama rat derived from Long-Evans at Aichi Cancer Center, were transferred to Moriyama Mental Disease Hospital and Nagoya University. Inbred Line was established at Nagoya University. From Shionogi & Co., Ltd. to Kyo in 1976 . National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Hematology Rab38^ru 1600311 1 144783919 144864573 1 - by flanking markers 1 158385888 158466621 1 - by flanking markers 1 152072716 152153449 1 - by flanking markers 1302624 RICO/Ngs Strain originated at Division of Comparative Medicine, Center for Frontier Life Sciences, Nagasaki University, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Ophthalmology 1302625 F344.OLETF-(D16Wox4-D16Rat13)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 1302626 BN.UPL-(D2Rat134-D2Rat2)/Cas Strain originated from Hiroshima University, Japan National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology 2 14747814 190963154 1 - by flanking markers 2 14095321 217785884 1 - by flanking markers 2 14237830 198298901 1 - by flanking markers 1302627 F344/NSlc Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals 1302628 ACIS/Hok Spontaneous mutation from ACI/Hok in 1981. National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1302629 WKY.SHRSP-(D1Rat49-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302630 F344.OLETF-(D10Wox7-D10Wox6)/Tj Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 1302631 BN/SsNSlc Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Immunology 1302632 WKY.SHRSP-(D1Smu11-D1Arb21)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302633 FXLE20/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302634 BB/WorTky BioBreeding rat Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Introduced to Tokyo Medical College in 1983. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Diabetes Obesity; Immunology 1302635 F344.OLETF-(D12Rat8-D12Rat16)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 12 23934730 31489223 1 - by flanking markers 12 27805580 36160041 1 - by flanking markers 12 25799119 34265075 1 - by flanking markers 1302636 WKY.SHRSP-(D1Wox29-D1Arb21)/Izm This congenic strain contains an SHRSP/Izm chromsome 1 segment containing a blood pressure QTL transferred to a WKY/Izm background National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1302637 LAA Hatano Low Avoidance Strain originated from Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan Hatano Reserch Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown 1302638 LEXF11/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302639 KHR/Kyo kaken hairless rat Kaken hairless rat were detected by Kimura from Gunn National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Dermatology Oca2 2318412 1 115683593 115991040 1 - by flanking markers 1 114661970 114987433 1 - by flanking markers 1302640 ACI/Tj Strain originated from The University of Tokushima, Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 1302641 LEXF1A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302642 LEA/Hkm Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo 1302643 ACI/NKyo august copenhagen irish NIH (1988, F143) > Kyo (F43) National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Reproduction 1302644 CXA5/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology 1302645 DMY/Kyo demyelination rat From a closed but not inbred colony of Sprague Dawley (SD) rats in the laboratory animal facilities of the Universitat Autonoma de Barcelona (Bellaterra Campus) in 1991. Via Institute Pasteur, Paris, to Kyoto University (1996). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Mrs2^dmyKyo 12793071 17 47124915 47142840 1 - by flanking markers 17 43932146 43951399 1 - by flanking markers 17 42064271 42083602 1 - by flanking markers 1302646 LEXF2C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302647 F344.OLETF-(D5Rat166-D5Rat90)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan congenic Unknown 5 137718909 139664499 1 - by flanking markers 5 140063670 141938308 1 - by flanking markers 5 136271682 138128882 1 - by flanking markers 1302648 LEC/Hok Long Evans Cinnamon At the Center for Experimental Plants and Animals, Hokkaido University, LEC, along with LEA, was established from a closed colony of Long-Evans rats obtained from Kobe University in 1975. In 1984, within the LEC rats of their F24 generation, a rat exhibiting spontaneous hepatitis with severe jaundice was found (Yoshida, 1987). The LEC was available from Charles River Japan, Inc., Kanagawa, as of spring, 1991. National BioResource Project for the Rat in Japan mutant Unknown (as of 2016-12-01) Cancer; Immunology Atp7b^hts 11532742 16 74607988 74680080 1 - by flanking markers 16 74495179 74575822 1 - by flanking markers 16 74865516 74944935 1 - by flanking markers 1302649 LEXF7B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302650 F344.OLETF-(D9Mgh8-D9Rat15)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 9 33374546 62634991 1 - by flanking markers 9 40808491 71887966 1 - by flanking markers 9 41139089 70686886 1 - by flanking markers 1302651 CXA1/Tj Strain originated from the The University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology 1302652 LEXF7A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302653 LEXF8A/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302654 F344.OLETF-(D7Mgh16-D7Mgh20)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.26.6 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 103612739 123191874 1 - by flanking markers 7 106942155 125794357 1 - by flanking markers 7 106995385 126080454 1 - by flanking markers 1302655 TO/Hkm Strain originated from the Graduate School of Medicine, Hokkaido University, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 1302656 LEA/Hok Long Evans Agouti Long Evans Agouti derived originally from an outbred Long Evans stock at Hokkaido University and selected for agouti coat colour . It is used as the control strain of the LEC rat, which is reported to exhibit several mutant phenotypes such as hepatic disorder (hts), blockage of the T cell differentiation (thid) and X-ray hypersensitivity (xhs1 and xhs2). National BioResource Project for the Rat in Japan inbred Unknown (as of 2016-12-01) 1302657 DOP/Nem dilute-opisthotonus (dop) Founded from a breeding colony of Wistar by Ohno at Yagi Memorial Park in 1988. A congenic line BN-dop and an inbred line DOP-dop were established. National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Myo5a 3143 1302658 LEJ/Hkm Strain originated at the Graduate School of Medicine, Hokkaido University, Japan. National BioResource Project for the Rat in Japan inbred Live Animals 1302659 CXH5/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology 1302660 RCS/Kyo royal college of surgeons rat From Department of Ophthalmology & Visual Sciences, Kyoto University to Institute of Laboratory Animals (Kyo) in 1998. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Ophthalmology Mertk^rdy 40902839 3 116308387 116416414 1 - by flanking markers 3 128669534 128777078 1 - by flanking markers 3 121235230 121340932 1 - by flanking markers 1302661 F344.OLETF-(D14Rat23-D14Rat12)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.29.5 cM segment from the centromere of chr 14 of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 1302662 CXH2/Tj Strain originated at the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology 1302663 F344.OLETF-(D11Rat4-D11Rat1)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 11 64573222 84443333 1 - by flanking markers 11 66731054 89693367 1 - by flanking markers 11 65352097 86593596 1 - by flanking markers 1302664 WNA/Nshm Nagoya University, Agriculuture to Nagoya University, Medicine 1986 to Nagoya University, Institute of Laboratory Animal Research National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm 1302665 FXLE13/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302666 LEXF1C/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302667 F344.OLETF-(D5Mgh5-D5Mgh23)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 1302668 IS-Tlk/Kyo tail anomaly lethal kyoto Spontaneous mutation was found in IS/Kyo inbred (F10) at Kyoto University in 1988. Tlk(Tail anomaly Lethal Kyoto) National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Osteosis 1302669 HAA Hatano High Avoidance Strain originated at the Hatano Research Institute, Food and Drug Safety Center, Kanagawa, Japan. Hatano Research Institute, Food and Drug Safety Center, Hadano, Kanagawa, Japan inbred Unknown 1302670 ACI/NSlc Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals 1302671 WM/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm 1302672 W/Kyo Hok>Hkm>Kyo National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1302673 FXLE15/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302674 VF/Kyo vacuole formation rat The vacuole formation (VF) rat is an autosomal recessive myelin mutant characterized by generalized tremor, hypomyelination, and periaxonal vacuole formation of the central nervous system (CNS). A nonsense mutation in the dopey family member 1 (Dopey1) was identified as the likely causative gene for the neurological disease phenotype of the VF rat. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-10) Neurobiology 1302675 WKY.SHRSP-(D1Smu13-D1Smu11)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302676 NER/Slc noda epileptic rat Strain is from Japan SLC, Inc. Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant Live Animals Neurobiology 1302677 NIG-III/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 1302678 NAR/Slc non albumin rat Strain originated from Japan SLC, Inc, Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant Live Animals Hematology 1302679 TRMR/Kyo tremor resistant Tremor Rat which was found in a colony of outbred Wistar/Kyo in 1980 was separated to Tanabe Seiyaku Co., Ltd. in 1982. This strain is a substrain of TRM/Kyo and does not show tremor behavior. This strain carrying wild type Hcn1, is considered as segregating inbred strain of TRM. National BioResource Project for the Rat in Japan segregating_inbred Unknown Aspa 621693 1302680 SHR/Ta Strain orginated at Takeda Chemical Industries, Ltd., Osaka, Japan. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1302681 WKY.SHRSP-(D1Smu11-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302682 FXLE18/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302683 FXLE22/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Live Animals Diabetes Obesity; Cancer 1302684 F344/NHok Dwango-Heston-N(Jay) 1950-Hokkaido University, Faculty of Science(Mk) 1956-National Institute of Genetics(Ms) 1958-Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1959, F68-Hokkaido University, Center for Experimental Plants & Animals National BioResource Project for the Rat in Japan inbred Unknown 1302685 F344.OLETF-(D14Rat8-D14Rat26)/Tj Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating. Comprises of a 18.5 cM transferred segment. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 1302686 F344/Stm Derived from F344/DuCrlj rats that were purchased from Charles River Kanagawa, Japan. These are maintained by brother and sister mating. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302687 WKAH/HkmSlc Wistar King A, Hokkaido Strain originated from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals 1302688 ACI/NMna This strain is derived from the ACI/NMs strain bred at the Fujita Health University School of Medicine, Aichi, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1302689 WKY.SHRSP-(Ntrk3-D1Smu13)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302690 FXLE19/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302691 ALB/Hok Albany Albany, N.Y.(Wolf)?N(Jay)to Hokkaido University, Faculty of Science(Mk)to National Institute of Genetics(Ms) 1958?Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1975, F48 to Hokkaido University, Center for Experimental Plants & Animals(Hok) National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Dentistry 1302692 WKY.SHRSP-(D1Wox18-D1Rat44)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302693 KZ-Lepr^faTky A inbred strain from Zucker-fatty rats which were introduced to Takeda Chemical Industries in 1980. National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Metabolism Lepr 3001 1302694 WKA/Seac Wistar King > Aptekman > Hokkaido University 1953 > Kyushu University 1955 > Seac Yoshitomi, LTD. 1979 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology 1302695 SER/Kyo spontaneously epileptic rat Spontaneously Epileptic Rat was developed as a double mutant by Serikawa by crossing zi rats (derived from SD), carrying an autosomal recessive attractin mutation with trm rats (derived from Kyo:Wistar), carrying a genomic deletion comprising Aspartate Ac National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrn|Aspa 69063|621693 1302696 FH/HamSlc fawn hooded rat Strain originated at Japan SLC, Inc., Shizuoka , Japan. National BioResource Project for the Rat in Japan mutant Live Animals Cardio Hypertension 1302697 KND/Tky komeda non-diabetic rat Komeda diabetes-prone rat developed by Komeda from Long-Evans Tokushima Lean (LETL) rat at Tokyo Medical College in 1996. Komeda non Diabetic Rats were established simultaneusely as controls. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Diabetes Obesity 1302698 SDR/Slc Spontaneous dwarf rat The G to A substitution at the end of the 3rd intron of the rat Growth hormone gene was identified as the cause of the dwarf phenotype. This spontaneous mutation affected the 3' splice/acceptor site. Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan, Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-05-04) Metabolism Gh1^sdr 12880380 10 95692240 95694117 1 - by flanking markers 10 94237414 94239391 1 - by flanking markers 10 94486204 94488181 1 - by flanking markers 1302699 LEXF8D/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302700 HOB/Snk hobble rat HOB rat was identified in the F344 congenic rats (N12F13) to which the coat color locus (C) of fatty rat has been transferred in Sankyo Co., Ltd. Introduced to Kyoto University in 1999 at F13. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Unc5c|Unc5c^hob 735109|12802353 2 239365109 239721231 1 - by flanking markers 2 265573406 265926229 1 - by flanking markers 2 247045813 247397483 1 - by flanking markers 1302701 LEW/SsNSlc Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. LEW/SsNSlc rats were descended from a colony obtained from the National Institutes of Health, Bethesda, Maryland USA in 1994 to Japan SLC, Inc.,Shizuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals (as of 2020-08-26) Immunology 1302702 TRM/Kyo tremor rat In 1980, a spontaneous tremor mutant rat was found in the colony of Kyo:Wistar (Yamada, 1985). This disorder was found to be caused by an autosomal recessive gene and was designated tremor (tm). Deletion of Aspa gene was identified in the animal with no aspartoacylase activity in the brain and measurable level of activity in the kidney. TRM was established as a segregating inbred strain. In F18 progeny, a rat which did not have tm mutation was separated and established as a control strain of WTC (NBRP No.0020). (Dec 8, 2010) National BioResource Project for the Rat in Japan segregating_inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-01-03) Neurobiology Aspa|Hcn1^A354V 621693|13464319 1302703 WKY.SHRSP-(D1Wox29-D1Rat112)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302704 WKY.SHRSP-(D1Wox29-D1Rat199)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302705 WKY.SHRSP-(D1Wox29-D1Smu13)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302706 F344.OLETF-(D5Rat32-D5Rat26)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 5 119332868 139659574 1 - by flanking markers 5 121495621 141933383 1 - by flanking markers 5 117554114 138123957 1 - by flanking markers 1302707 LEXF3/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302708 FXLE17/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Diabetes Obesity; Cancer 1302709 WKY/Hcm Strain is from the Hyogo College of Medicine, Japan. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1302710 LEXF2B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302711 ExHC/Seac Isolated from Sprague-Dawley (SD/Jcl) rats by Imai and Matsumura by selection for high serum cholesterol under high cholesterol diet for 7 days (app. 250 mg/dl, normal 100 mg/dl) in 1973. Kyushu University > Seac Yoshitomi, LTD. 1993 National BioResource Project for the Rat in Japan inbred Unknown 1302712 ZIMY/Kyo Zitter Masao Yamada ZIMY was produced by crossing tremor (TRM) rat and zitter (ZI) rat at Kyoto University. zi/zi, tm<+/+>. ZIMY (Zitter Masao Yamada). This strain is homozygous for zi and wild-type for tm. ZIMY (Zitter Masao Yamada) National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-17) Neurobiology Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 1302713 F344.OLETF-(D8Rat58-D8Mgh17)/Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Unknown 8 19796514 48675424 1 - by flanking markers 8 21850030 48631820 1 - by flanking markers 8 50007641 50007776 1 - by flanking markers 1302714 KZC/Tky Komeda Zucker Creeping rat Komeda Zucker Creeping rat derived from a closed colony of the Zucker fatty rat by spontaniously mutation at Tokyo Medical College in 1983. National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Reln 3553 1302715 WKY.SHRSP-(D1Wox18-D1Wox29)/Izm The desired fragment is transferred from SHRSP to WKY. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1302716 OM/NSlc Osborne-Mendel rat The Instutite of Medical Science, The University of Tokyo to Slc (1985) National BioResource Project for the Rat in Japan inbred Live Animals 1302717 ACI/NHok NIH to Tokyo Biochemical Research Institute(Tbi) to Hokkaido University, Laboratory of Experimental Animal Science(Hok) 1967, F87 to Hokkaido University, Center for Experimental Plants & Animals(Hok) 1982, F135 National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension 1302718 HWY/Slc hairless wistar yagi Strain is from Japan SLC, Inc., Shizuoka, Japan. National BioResource Project for the Rat in Japan mutant Live Animals Dermatology 1302719 DON/Kyo Donryu rat Japanese albino rats > R.Sato, Nippon Rat(1950) > Kyo (1978, F64), formaly DONRYU/2 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1302720 CXH10/Tj Strain is from the University of Tokushima, Japan. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo Metabolism; Immunology 1302721 LEC/Tj Found in Long Evans strain at Kobe University > Inbreeding at Hokkaido University > Otsuka Pharmaceutical Co. > The University of Tokushima 1989 National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Cancer Atp7b^hts 11532742 16 74607988 74680080 1 - by flanking markers 16 74495179 74575822 1 - by flanking markers 16 74865516 74944935 1 - by flanking markers 1302722 PVG/Seac Piebald Virol Glaxo Strain is from Seac Yoshitomi, LTD., Fukuoka, Japan. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology 1302723 LEXF5/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1302724 SHR/Hcm Strain is from the Hyogo College of Medicine, Japan. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Cardio Hypertension 1302726 ZI/Kyo Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrn^zi 40902832 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 1302727 SHRSR/Ta Strain is from Takeda Chemical Industries, Ltd., Osaka, Japan. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1302728 MES/Slc Matsumoto Eosinophilia Shinshu Derived frm one pregnant SPF SD rat from a closed colony of SD rats at Japan SLC. 3 males and 5 females offspring had high eosinophil count at 10 weeks of age, these were bred brother x sister mating to generate these rats. Institute of Experimental Animals, Shinshu University School of Medicine to Slc (1999) National BioResource Project for the Rat in Japan mutant Live Animals Hematology Cyba^m1Sdi 13209000 19 52713150 52721609 1 - by flanking markers 19 65959818 65967224 1 - by flanking markers 19 55249634 55257824 1 - by flanking markers 1302729 LEA/Tj Found in Long Evans strain at Kobe University; Inbreeding at Hokkaido University; Otsuka Pharmaceutical Co.; The University of Tokushima 1989 National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer 1302795 HTG Prague hypertriglyceridemic These were originally derived from a colony of Wistar rats. Animals with high plasma triglyceride levels were selected as breeding pair and their offsprings used for further breeding. Institute of Physiology, Academy of Sciences Prague, Czech Republic inbred Unknown 1302921 F344-Tg(NPHS2-HBEGF)Wig hDTR (HBEGF) cDNA was inserted at the 3' of the 2.5 kb human podocin (NPHS2) promoter. This transgenic construct was released by XbaI/HindIII digestion and injected into the pronuclei of fertilized eggs. Division of Nephrology, Department of Internal Medicine, University of MIchigan, Ann Habor, Michigan transgenic Unknown 1303393 LEC/Ncu These rats were established from a closed colony of Long-Evans. Nagoya City University Medical School, Nagoya, Aichi, Japan inbred Unknown 1304487 BBDR/Wor Diabetic resistant BB rats. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at BRM. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and a strain disease resistant (DR) by was established by selective breeding of diabtes free progenies. inbred Unknown 1331811 LEW.BN-(D10Rat32-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 1331812 LEW.BN-(D10Rat83-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46860047 65668639 1 - by flanking markers 10 46728252 64823355 1 - by flanking markers 10 46955258 46955430 1 - by flanking markers 1331813 BN.GK-(D8Rat29-D8Got130)/Ox This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 74769551 87069779 1 - by flanking markers 8 76345502 89012772 1 - by flanking markers 8 89482236 89482480 1 - by flanking markers 1331814 BN.GK-(D8Got302-D8Got130)/Ox This congenic strain contains the Nidd/gk5 locus transferred onto the BN background. GK rats are from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 8 48185711 87069779 1 - by flanking markers 8 48160321 89012772 1 - by flanking markers 8 49533872 89482480 1 - by flanking markers 1331815 LEW/Mol LEW/Mol This substrain can be traced originally to Scripps Clinic, La Jolla, to University of Pennsylvania to Simonsen Laboratories in 1966, to Institute of Pathological Anatomy, University of Copenhagen, Denmark 1973. From University of Copenhagen to M&B A/S (Mollegaard Breeding Center Ltd., Denmark ) from 1977 to 2002. (now Taconic Europe) Mollegaard Breeding Center Ltd., Denmark inbred Unknown Ncf1 61307 1331816 DA.ACI-(D10Rat2-D10Rat29)/Kini (DA x ACI) x DA backcross in the second generation transfered 40 cM of DNA from ACI to DA. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology; Immunology 10 68842878 68843272 1 - by flanking markers 10 67642121 110568670 1 - by flanking markers 10 67988035 110992275 1 - by flanking markers 1331817 BN.LEW-(D10Rat32-D10Mgh4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 96799937 1 - by flanking markers 10 53381898 95372987 1 - by flanking markers 10 53630865 95638337 1 - by flanking markers 1331818 LEW.BN-(D10Rat43-D10Mco4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 42042465 1 - by flanking markers 10 22266756 41793199 1 - by flanking markers 10 22402817 41976505 1 - by flanking markers 1331819 F344/Eer F344/Eer Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown 1331820 LEW.BN-(D10Got9-D10Rat2)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 5641331 5641541 1 - by flanking markers 10 4578252 110568670 1 - by flanking markers 10 5760565 110992275 1 - by flanking markers 1331821 LEW.BN-(D10Wox26-D10Arb4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 30343658 46737218 1 - by flanking markers 10 30131785 46592053 1 - by flanking markers 10 30303447 46835685 1 - by flanking markers 1331822 DA.ACI-(D10Rat2-D10Rat6) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 106310811 106310957 1 - by flanking markers 10 104746165 110568670 1 - by flanking markers 10 105077900 110992275 1 - by flanking markers 1331823 LEW.BN-(D10Rat43-D10Rat27)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 23428127 77092169 1 - by flanking markers 10 22266756 74127968 1 - by flanking markers 10 22402817 75983805 1 - by flanking markers 1331824 DA.ACI-(D10Rat219-D10Rat29) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 68842878 81986757 1 - by flanking markers 10 67642121 80884595 1 - by flanking markers 10 67988035 81042642 1 - by flanking markers 1331826 LEW.BN-(D10Mgh7-D10Rat27)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 77092169 1 - by flanking markers 10 55720558 74127968 1 - by flanking markers 10 55978483 75983805 1 - by flanking markers 1331827 DA.ACI-(D10Rat10-D10Rat142) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, Stockholm, Sweden congenic Unknown 10 92448353 100301488 1 - by flanking markers 10 91113514 98868127 1 - by flanking markers 10 91345679 99171690 1 - by flanking markers 1331828 DA.ACI-(D10Rat12-D10Rat144) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 86290650 99198997 1 - by flanking markers 10 85276455 97759008 1 - by flanking markers 10 85487741 98044833 1 - by flanking markers 1331829 BN.LEW-(D9Got8-D9Got200)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 9 3811425 3811711 1 - by flanking markers 9 2597055 9698468 1 - by flanking markers 9 2657610 10706733 1 - by flanking markers 1331830 F344.BN-(D5Rat1-D5Mit5)/Dlw This congenic strain carries the BN Edpm5 QTL on an F344 background. This strain is maintained at Oakland University, Rochester, MI, USA Department of Biological Sciences, Oakland University, Rochester, MI congenic Unknown 5 35911094 109163425 1 - by flanking markers 5 39876314 112058005 1 - by flanking markers 5 35225432 108092802 1 - by flanking markers 1331831 LEW.BN-(D10Rat173-D10Rat133)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with LEW females to transfer the desired locus to LEW background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 37505289 65668639 1 - by flanking markers 10 37209026 64823355 1 - by flanking markers 10 37435916 37436126 1 - by flanking markers 1331832 BN.LEW-(D10Rat72-D10Arb4)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 46737218 1 - by flanking markers 10 46591952 46592053 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 1331833 DA.ACI-(D10Rat15-D10Rat29) DA.ACI-(D10Rat2-D10Rat29) congenic rats were backcrossed to parental DA rats and progeny were intercrossed to obtain homozygous recombinations within the desired region. Neuroimmunology Unit, Center for Molecular Medicine, L8:04, Stockholm, Sweden congenic Unknown 10 68842878 96667338 1 - by flanking markers 10 67642121 95243104 1 - by flanking markers 10 67988035 95508221 1 - by flanking markers 1331834 BN.LEW-(D10Rat100-D10Rat126)/Rj This congenic strain was derived from female LEW rats and male BN rats obtained from the Janvier breeding center, Le Genest-Saint-Isle, France. F1 offsprings were crossed with BN males to transfer the desired locus to BN background. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 26434477 26434620 1 - by flanking markers 10 26363403 42526523 1 - by flanking markers 10 26517020 42716241 1 - by flanking markers 1331836 WKY/Eer WKY/Eer Inbred strain originated from animals purchased from Harlan Industries, Indianapolis, Indiana Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown 1354669 BN/OrlIcoCrlf Strain selected by Silvers and Billingham in 1958 after cross-breeding of histocompatible animals from a colony of mutants. These animals were then maintained in closed colony by H.D. King and P. Aptekman at the National Institutes of Health (NIH) (Bethesda, MD, USA). The strain was obtained by Microbiological Associates, Inc., Department of Laboratory Animals, Walkersville, Maryland, USA in 1969 and introduced into CNRS/CSEAL in Orleans, France in 1988. It was then transferred to Charles River Laboratories France in 1991. Charles River France inbred Unknown 1354670 F344/IcoCrlf These are inbred rats that were bought from Charles River, Les Oncins near Lyon, France. Charles River France inbred Unknown 1357172 WF.BBDR-(D4Arb29-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 121645621 1 - by flanking markers 4 63250011 183837621 1 - by flanking markers 4 63537179 63537431 1 - by flanking markers 1357173 SS.MNS-(Vamp2-D10M11Mit84)/Mco This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Vamp2 3949 10 55848264 55852132 1 - by flanking markers 10 55418231 55422465 1 - by flanking markers 10 55675171 55679405 1 - by flanking markers 1357174 BBDR.BBDP-(D4Mit6-D4Mit24)/Rhw S. Bieg and coworkers (1998) generated this congenic line in which diabetes and lymphopenia are controlled solely by Iddm 1. This strain was generated by nine cycles of cross-intercross breeding of diabetes-prone DP with DR BB rats. Iddm 1 in the BioBreeding (BB) rat designates the genomic region on rat Chromosome (Chr) 4 that harbors the gene causing peripheral T cell lymphopenia (Lyp) and diabetes. The average age of onset of diabetes was 85 ÃÂ± 53 days of age after the first and 67 Â± 10 days of age after the 9th cycle. Lacks one C nucleotide at 478 position which causes a frameshift mutation in the ORF of exon 3 forming a significantly truncated protein. Department of Medicine University of Washington, Seattle, Washington congenic Unknown 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 1357175 F344.DR-(D4Mit6-D4Mit24)-Tg(Gimap5)Mcwi Wild type allele of Gimap5 from BN was microinjected into the pronuclei of fertilized eggs from a T cell lymphopenic congenic strain F344.DR-(D4Mit6-D4Mit24) Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin transgenic Unknown 1357176 WF.BBDR-(D4Arb29-D4Rat96)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 65434807 1 - by flanking markers 4 63250011 65397196 1 - by flanking markers 4 63537179 65577249 1 - by flanking markers 1357177 F344.DR(DP)-(D4Mit6-D4Mit24)/Rhw The lymphopenia locus from BBDR.BBDP-(D4Mit6-D4Mit24) was transferred onto F344 by marker assisted selection in five cycles of cross-intercross breeding. Department of Medicine University of Washington, Seattle, Washington, Rat Resource & Research Center congenic Cryopreserved Embryo 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 1357178 CD Cohen diabetic rat Originally developed by late professor A.M. Cohen in Israel nearly 40 years ago. These were genetically selected from the Hebrew University albino rats. When fed a copper-poor high-sucrose diet these develop impaired carbohydrate metabolism. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown 1357179 SS.WKY-(D2N35-Mme),MNS-(D10Mit11-D10M11Mit119)/Mco SS.WKY-(D2N35-Mme)/Mco and SS.MNS-(D10Mit11-D10M11Mit119)/Mco were crossed and the F₁ were backcrossed to SS.WKY-(D2N35-Mme)/Mco. Rats that were homozygous on the chr 2 loci were selected and crossed with the ones that were homozygous on the chr 10 loci. This produced the double congenic strain which was maintained by brother-sister mating Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1357180 SS.LEW-(D8Chm14-D8Rat16)/Ayd Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown Grik4 2734 8 45510258 98878889 1 - by flanking markers 8 45279673 100781055 1 - by flanking markers 8 46804134 101305168 1 - by flanking markers 1357181 CDR/Ygl Cohen rats that had an oral tolerance test with blood glucose levels <180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels <140mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel; Israeli Rat Genome Center, Ashkelon, Israel inbred Unknown 1357182 Eker-Tg(Tsc2)28Hin Wild type Tsc2 transgene was constructed from the Tsc2 cDNA from BN rat and was microinjected into single male pronuclei. Eggs were cultured and tranferred into female wistar which were mated with Eker rats. Department of Experimental Pathology, Cancer Institute, Toshima-ku, Tokyo, Japan transgenic Unknown Tsc2 3908 1357183 SS.MNS-(D10Mco10-Aldoc)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo congenic Unknown Nos2 3185 10 6849272 65072453 1 - by flanking markers 10 5706467 65456957 1 - by flanking markers 10 6908932 66221621 1 - by flanking markers 1357184 Crl:ZUC-Lepr^fa Zucker rats The obese and fatty condition appeared spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960 at the Laboratory of Comparative Pathology in Stow, Massachusetts. These came to Charles River in 1985 from a research colony maintained at a pharmaceutical company. Charles River Laboratories outbred Unknown Lepr^fa 13432153 1357185 RHA.Gunn-Ugt1a1^j/N RHA/N rats were crossed with Gunn rats. F₁ hybrids were intercrossed for 12 cycles while selecting for jaundice loci. Developmental Pharmacology Branch, National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD, USA congenic Unknown 1357186 Gunn-Ugt1a1^j/BluHsd Gunn rat This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. Harlan mutant Unknown Ugt1a1^j 13432064 9 87091241 87098362 1 - by flanking markers 9 94982916 94990037 1 - by flanking markers 9 95295701 95302822 1 - by flanking markers 1357187 WF.BBDR-(D4Rat16-D4Got39)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 56704967 1 - by flanking markers 4 56868238 56868336 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 1357189 SS.LEW-(D8Rat56-D8Rat51)/Ayd Congenic strain produced from a SS/Jr strain and a LEW/CrlBR strain purchased from Charles Rivers, Quebec, Canada Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 8 8294860 29559867 1 - by flanking markers 8 9505886 30947391 1 - by flanking markers 8 9531047 30918267 1 - by flanking markers 1357190 SS.MNS-(Adh1-D2Mit5)/Mco This congenic strain contains an MNS chromosome 2 segment transferred to an SS/Jr background Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Adh1 2044 2 235799396 235811584 1 - by flanking markers 2 262090818 262102977 1 - by flanking markers 2 243550655 243562243 1 - by flanking markers 1357191 CDS/Ygl Cohen diabetic-sensitive rat Cohen rats that had an oral tolerance test with blood glucose levels >180mg/dl were selected. More stringent criteria was set during the secondary inbreeding: rats with blood glucose levels >230mg/dl were selected. Brother and sister mating was carried on for 10 additional generations. Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel inbred Unknown 1357192 WF.BBDR-(D4Got39-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 56704868 121645621 1 - by flanking markers 4 56868238 183837621 1 - by flanking markers 4 57101077 57101175 1 - by flanking markers 1357193 WF.BBDR-(D4Got51-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 70123187 121645621 1 - by flanking markers 4 136548956 183837621 1 - by flanking markers 4 71744558 71744763 1 - by flanking markers 1357194 WF.BBDR-(D4Rat96-D4Rat44)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65434709 121645621 1 - by flanking markers 4 65397099 183837621 1 - by flanking markers 4 65577152 65577249 1 - by flanking markers 1357195 SS.MNS-(Aldoc-D10Mco1)/Jr This congenic strain is derived by introgressing a desired region of chr 10 from MNS to the SS/Jr recipient. Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Nos2 3185 10 67677924 67678060 1 - by flanking markers 10 63366082 63366218 1 - by flanking markers 10 64648175 64648311 1 - by flanking markers 1357196 WF.BBDR-(D4Arb29-D4Rat265)/Wor This congenic was generated by the marker-assisted protocol where a segment of BBDR/Wor is transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 63276741 82266081 1 - by flanking markers 4 63250011 148715224 1 - by flanking markers 4 63537179 84053053 1 - by flanking markers 1357345 DA/K Dark Agouti/Karlsburg Dark agouti rats which were bred and housed in Dept. of Laboratory Animal Science, Karlsburg, Germany Dept. of Laboratory Animal Science, Inst. of Pathology, University of Greifswald,D-17495, Karlsburg, Germany inbred Unknown 1357346 BB.SHR-(D4Mit6-Spr)/K BB/OK lymphopenic rats were crossed with non-lymphopenic, spontaneously hypertensive SHR/Mol rats. Rats heterzygous for D4Mit6, Npy, and Spr and homozygous for BB alleles were selected. After 5 backcross generations, rats were intercrossed. Rats homozygous at SHR loci of interest were selected. Department of Laboratory Animal Science, Inst of Pathophysiology, University of Greifswald, Karlsburg, Germany congenic Unknown Npy|Spr 3197|3753 4 75732943 119369308 1 - by flanking markers 4 141978848 181496612 1 - by flanking markers 4 77307388 116916073 1 - by flanking markers 1357417 SD-Tg(Npy)400Mcwi 14.5 kb lambda clone of the rat Npy gene was subcloned with a polylinker that had NotI and EcoRI restriction sites. This transgene that was released by NotI digestion contained ~5kb 5'and ~1kb 3' and was injected into the pronuclei of fertilized SD rats. Founders were mated with SD females. F1 animals were mated with SD females till line 400 hemizygous animals were developed that had 5 copies of the Npy gene. Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1357953 WAG/RijHfr Substrain of WAG, from AL Bacharach, Glaxo Ltd from Wistar stock in 1924, from Rij to Envigo (Harlan France) Envigo (Harlan France) inbred Unknown 1357954 F344/NHfr Strain originated from Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To Heston 1949 (Billingham and Silvers 1959). To National Institutes of Health in 1951 (Hansen et al 1982), Supplied by Harlan, France. Harlan France inbred Unknown 1357955 WF/NHfr Wistar-Furth Substrain of Wistar Furth stock, inbred by National Institute of Health, Bethesda, MD and now available at Harlan, France. Harlan France inbred Unknown 1357957 LEW/HanHfr Inbreeding of the Lewis rat is begun by Dr. Margaret Lewis from a Wistar stock. In 1924, at F20 to Aptekmanm and Bogdon. In 1958, at F31 to Silvers, who distributed this strain. subsequently. To Central Institute for Laboratory Animal Breeding, Hannover, in 1973 at F58. In 1994, to Harlan Netherlands through acquisition of Central Institute for Laboratory Animal Breeding. Harlan became Envigo in 2015 ENVIGO France inbred Unknown The LEW/HanHsd is very susceptible to the induction of EAE, while the LEW/SsNHsd is not susceptible to the induction of EAE 1357958 BN/RijHfr Substrain of BN, from Billingham and Silvers 1958, from Harlan Rijnswijk, supplied by Harlan France. Harlan France inbred Unknown 1357959 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi The Rf-2 region of chromosome 1 is transferred from BN to the genomic background of FHH. Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin congenic Live Animals Ctsc|Grm5|Nox4|Rab38|Tyr 2445|2746|620600|628752|1589755 1 157084760 158516775 1 - by flanking markers 1 150775310 152202960 1 - by flanking markers 1357960 LE/CpbHfr Substrain of LE which was bred at Harlan CPB now at Harlan France. Envigo (Harlan France) inbred Unknown 1357974 BB.SHR-(D4Got41-Gimap5)/K Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown Gimap5 628871 4 60262965 76843214 1 - by flanking markers 4 60179409 143073003 1 - by flanking markers 4 60439127 78386683 1 - by flanking markers 1357975 SS.LEW-(D1Mco4-D1Rat18)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 29841428 43747532 1 - by flanking markers 1 33073397 50297622 1 - by flanking markers 1 31647701 49454378 1 - by flanking markers 1357976 BB.SHR-(D4Got41-D4Rat171)/K Originated from BB.SHR-(D4Got41-Tacr1) rats crossed with BB/OK rats to create a congenic substrain. Department of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 4 60262965 87996003 1 - by flanking markers 4 60179409 154162556 1 - by flanking markers 4 60439127 89342035 1 - by flanking markers 1357977 SS.LEW-(D1Mco8-D1Rat213)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 32329137 81548909 1 - by flanking markers 1;9 84537073;7947583 84537228;7947744 1 - by flanking markers;1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 1357978 SS.MNS-(D2Mit6-D2Rat303)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 131522430 1 - by flanking markers 2 98037122 155130826 1 - by flanking markers 2 78321410 135646395 1 - by flanking markers 1357979 SS.MNS-(Mme-D2Rat131)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Mme 3098 2 153031724 179302663 1 - by flanking markers 2 173193501 206015340 1 - by flanking markers 2 153799203 186612024 1 - by flanking markers 1357980 BB.SHR-(D4Got41-Tacr1)/K Congenic BB.LL rats were established as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats and marker-aided selection in 1997. Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Metabolism Tacr1 3811 4 60262965 116780394 1 - by flanking markers 4 60179409 178095041 1 - by flanking markers 4 60439127 113416139 1 - by flanking markers 1357981 SS.LEW-(D3Mco21-D3Rat17)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 68499987 121619110 1 - by flanking markers 3 79183926 133513825 1 - by flanking markers 3 72672290 127023997 1 - by flanking markers 1357982 SS.LEW-(D3Rat52-D3Chm63)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 51161895 1 - by flanking markers 3 19410399 61857467 1 - by flanking markers 3 14090411 55245509 1 - by flanking markers 1357983 SS.LEW-(D1Mco75-D1Rat18)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 43747374;2897342 43747532;2897591 1 - by flanking markers;1 - by flanking markers 1 36805624 50297622 1 - by flanking markers 1 35406399 49454378 1 - by flanking markers 1357984 SS.MNS-(D2Mit6-D2Rat166)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 77630629 145701148 1 - by flanking markers 2 98037122 165313939 1 - by flanking markers 2 78321410 145903673 1 - by flanking markers 1357985 LOU/Ins originated from Universite Catholique de Louvain. INSERM, C.H.U. Bichat-Claude Bernard, Paris, France inbred Unknown 1357986 SS.LEW-(D1Uia8-D1Rat211)/Mco This strain was constructed from the progenitor strain SS.LEW-(D1Uia8-D1Rat18)/Mco by crossing the progenitor strain to SS rats to get F₁ followed by F₁ X F₁ intercross to get F₂ which was screened for the desired recombinants. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 1147796 1148037 1 - by flanking markers 1 35077728 35077968 1 - by flanking markers 1 33667777 33668017 1 - by flanking markers 1357987 SS.LEW-(D1Uia8-D1Rat18)/Mco A 17 cM segment of chr 1 from Lewis which was obtained from Charles was introgressed into Dahl salt-sensitive strain which is an in-house colony. Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 43747374 43747532 1 - by flanking markers 1 50297465 50297622 1 - by flanking markers 1 49454221 49454378 1 - by flanking markers 1357988 SS.LEW-(D3Rat52-D3Rat17)/Ayd A segment of chromosome 3 was transferred from LEW into the SS background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 121619110 1 - by flanking markers 3 19410399 133513825 1 - by flanking markers 3 14090411 127023997 1 - by flanking markers 1357994 SHR/NCrl To Charles River from NIH in 1973 at F32. To N 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with continued selection for spontaneous hypertension. Charles River Laboratories inbred Live Animals (as of 2020-01-23) 1358112 WKY/NCrl Outbred Wistar stock from Kyoto School of Medicine to NIH in 1971, to Charles River in 1974 from NIH at F11 Charles River Laboratories inbred Unknown 1358114 SS-Chr 5^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Sperm 1358150 SS.LEW-(D16Rat12-D16Chm23)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 350232 1 - by flanking markers 16 751266 1084414 1 - by flanking markers 16 756352 1090164 1 - by flanking markers 1358151 FHH-Chr 8^BN/Mcwi A FHH genomic background with a BN chromosome 8 introgressed. PhysGen consomic Cryopreserved Sperm 1358152 SS-Chr 14^BN/Mcwi A SS genomic background with a BN chromosome 14 introgressed. PhysGen consomic Cryopreserved Sperm 1358153 COP/CrCrl Inbred strain is from Curtis in 1921 at Columbia University Institute for Cancer Research. To National Cancer Institute Animal Production Program (Cr). To Charles River from the National Cancer Institute in 1998. Charles River Laboratories inbred Unknown 1358154 SS-Chr 3^BN/Mcwi A SS genomic background with a BN chromosome 3 introgressed. PhysGen consomic Live Animals; Cryopreserved Sperm 1358155 SS.LEW-(D10Rat119-D10Mgh1)(D16Rat21-D16Rat112)/Ayd This double congenic strain was constructed by using the SS/Jr strain as a donor strain to transfer regions (D10Rat119-D10Mgh1)and (D16Rat21-D16Rat112) from the LEW strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 1358156 SS.MNS-(D2Rat183-D2Chm113)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 144136724 145774334 1 - by flanking markers 2 163731761 165386311 1 - by flanking markers 2 144313532 145975996 1 - by flanking markers 1358157 FHH-Chr 7^BN/Mcwi A FHH genomic background with a BN chromosome 7 introgressed. PhysGen consomic Cryopreserved Sperm 1358158 FHH-Chr 16^BN/Mcwi A FHH genomic background with a BN chromosome 16 introgressed. PhysGen consomic Cryopreserved Sperm 1358159 FHH-Chr 6^BN/Mcwi A FHH genomic background with a BN chromosome 6 introgressed. PhysGen consomic Cryopreserved Sperm 1358160 SS.BN-(D8Rat163-D8Rat81)/Mcwi A SS genomic background with a majority BN chromosome 8 introgressed. The segment of chromosome 8 that caries the BN extends from D8Rat163-D8Rat81. PhysGen congenic Unknown 8 31508524 124926877 1 - by flanking markers 8 32911182 127854519 1 - by flanking markers 8 32888352 128653291 1 - by flanking markers 1358161 SS.LEW-(D16Rat38-D16Chm66)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 3080748 8612621 1 - by flanking markers 16 3405986 11276947 1 - by flanking markers 16 3439525 9316554 1 - by flanking markers 1358162 SS-Chr 12^BN/Mcwi A SS genomic background with a BN chromosome 12 introgressed. PhysGen consomic Live Animals 1358163 SS-Chr 15^BN/Mcwi A SS genomic background with a BN chromosome 15 introgressed. PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1358164 FHH-Chr 17^BN/Mcwi A FHH genomic background with a BN chromosome 17 introgressed. PhysGen consomic Cryopreserved Sperm 1358165 SS.MNS-(D2Chm51-D2Rat341)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-D2Rat166)/Ayd strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 151616735 155664303 1 - by flanking markers 2 171854997 177018102 1 - by flanking markers 2 152460836 157650873 1 - by flanking markers 1358166 SS.LEW-(D16Mit3-D16Rat112)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 47434384 1 - by flanking markers 16 773329 47069744 1 - by flanking markers 16 778415 47346612 1 - by flanking markers 1358167 SS.MNS-(D2Wox27-Adh1)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Adh1 2044 2 202186267 235811584 1 - by flanking markers 2 228956554 262102977 1 - by flanking markers 2 209489455 243562243 1 - by flanking markers 1358168 SS.LEW-(D16Mit2-D16Chm23)/Ayd This congenic strain originated from a SS/Jr parental strain. Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 42656 4304517 1 - by flanking markers 16 751266 5038806 1 - by flanking markers 16 756352 5098704 1 - by flanking markers 1358169 SS.MNS-(D2Chm25-D2Rat131)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Chm90-D2Wox37)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 179302663 1 - by flanking markers 2 199188066 206015340 1 - by flanking markers 2 179779225 186612024 1 - by flanking markers 1358170 FHH-Chr 5^BN/Mcwi A FHH genomic background with a BN chromosome 5 introgressed. PhysGen consomic Cryopreserved Sperm 1358171 SS-Chr 17^BN/Mcwi A SS genomic background with a BN chromosome 17 introgressed. PhysGen consomic Cryopreserved Sperm 1358172 SS.MNS-(D2Chm25-Fgg)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown Fgg 2613 2 172459883 174734594 1 - by flanking markers 2 199188066 201409143 1 - by flanking markers 2 179779225 181994523 1 - by flanking markers 1358173 FHH-Chr 11^BN/Mcwi A FHH genomic background with a BN chromosome 11 introgressed. PhysGen consomic Cryopreserved Sperm 1358174 SS-Chr 19^BN/Mcwi A SS genomic background with a BN chromosome 19 introgressed. PhysGen. Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) 1358175 FHH-Chr 20^BN/Mcwi A FHH genomic background with a BN chromosome 20 introgressed. PhysGen consomic Cryopreserved Sperm 1358176 FHH-Chr 18^BN/Mcwi A FHH genomic background with a BN chromosome 18 introgressed. PhysGen consomic Cryopreserved Sperm 1358177 SS.MNS-(D2Chm25-D2Mit14)/Ayd Congenic strain was created by backcrossing congenic strain SS.MNS-(D2Mit6-Adh1)/Lt strain into the parental Dahl Salt-sensitive (SS) strain. Centre Hospitalier de L'Universite de Montreal (CHUM), Montreal, Quebec,Canada congenic Unknown 2 172459883 197256313 1 - by flanking markers 2 199188066 224018437 1 - by flanking markers 2 179779225 204585731 1 - by flanking markers 1358178 SS-Chr 10^BN/Mcwi A SS genomic background with a BN chromosome 10 introgressed. PhysGen consomic Cryopreserved Sperm 1358179 FHH-Chr 13^BN/Mcwi A FHH genomic background with a BN chromosome 13 introgressed. PhysGen consomic Cryopreserved Sperm 1358180 FHH-Chr 19^BN/Mcwi A FHH genomic background with a BN chromosome 19 introgressed. PhysGen. Rat Resource and Research Center consomic Cryopreserved Sperm (as of 2021-05-07) 1358258 RCS/LavRrrc royal college of surgeons rat Developed before 1965 by Sidman from stock obtained from Sorsby of the Royal College of Surgeons, London. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) 1358259 RCS-p⁺/LavRrrc This strain has homozygous wild type at the pink eye (p+) locus and homozygous for a deletion in the Mertk gene. Developed by intercrossing (brother x sister) two black-eyed p/+ rats from the RCS-p/+ strain. The black-eyed animals were tested for homozygous p locus and then backcrossed to the parental strain. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-11-30) 1358277 RCS-rdy⁺/LavRrrc Developed by crossing an inbred RCS (rdy/rdy) with a cesarian developed Fischer (+/+) rat (from Charles River). The normal rats(+/rdy) were backcrossed to the RCS and the procedure repeated. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-07-16) 1358278 RCS-rdy⁺p⁺/LavRrrc Developed by crossing a pink-eyed control(RCS-rdy⁺/Lav x black-eyed dystrophic(RCS-p⁺/Lav) The F12 progeny was backcrossed to RCS-rdy⁺/Lav. The strain is pigmented (p+) congenic control strain (rdy+, wild-type at the retinal dystrophy locus) for the pigmented RCS-p+ dystrophic (rdy-) strain Retinal Degeneration Rat Model Resource , Rat Resource and Research Center congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12) 1358298 SD-Tg(Rho*P23H)1Lav This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Live Animals (as of 2021-05-07) Rho 11239 1358299 SD-Tg(Rho*P23H)2Lav This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). Retinal Degeneration Rat Model Resource transgenic Unknown 1358300 SD-Tg(Rho*P23H)3Lav This transgenic strain carries a copy of mouse Rhodopsin gene with a proline to histidine substitution at codon 23 (c.68C>A). Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown 1358302 SD-Tg(Rho*S334X)3Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource , Rat Resource and Research Center transgenic Unknown 1358303 SD-Tg(Rho*S334X)4Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource ,Rat Resource and Research Center transgenic Unknown 1358304 SD-Tg(Rho*S334X)5Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic Unknown 1358305 SD-Tg(Rho*S334X)7Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic Unknown 1358306 SD-Tg(Rho*S334X)9Lav This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated opsin protein. Retinal Degeneration Rat Model Resource transgenic Unknown 1358632 MR/Har Maudsely reactive This strain has been selected for high open-field defecation (a test of emotional reactivity). The underlying genetic basis for this phenotype is not known. Originally selected by Broadhurst in 1954 for high open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania. Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-02-20) 1358633 MNRA/Har Originally selected by Broadhurst in 1954 for low open-field defacation (OFD) response in an open field. By Broadhurst to Harrington at the University of Northern Iowa at generation 25 in 1965. Center for Developmental and Health Genetics, Pennsylvania State University, Pennsylvania inbred Unknown 1358918 W-Plp1^md/Nya W-Plp1^md Wistar rats were received in 1957 from Walter Reed Army Medical Center. In 1977, three ofsprings exhibited body tremor. Two of these had hydrocephalus and the brain of the third was normal. The mother rat and four of its clinically mormal youngs along with three adult males were breed as nuclear breeders. Division of Laboratories and Research, New York State Department of Health, Albany, New York mutant Unknown Plp1|Plp1^md 3354|12802346 X 124488627 124503639 1 - by flanking markers X 107379831 107394881 1 - by flanking markers X 107494326 107511355 1 - by flanking markers 1358919 F344/Seac Inbred strain originated from F344 rats SEAC Yoshitomi Co., Fukuoka, Japan inbred Unknown 1358921 WF.DA-(D19Mit1-D19Mit6)/Kop Congenic strain originated from a parental DA/Slc strain. kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nqo1 2503 19 26536747 41612881 1 - by flanking markers 19 35433730 54715514 1 - by flanking markers 19 24455726 43907843 1 - by flanking markers 1358922 BB.WOKW-(D4Got41-Fabp1)/K Congenic strain originated from a BB/OK parental strain. Dept. of Laboratory Animal Science, Medical Faculty, University of Greifswald, Karlsburg, Germany congenic Unknown Fabp1 2590 4 60262965 104415981 1 - by flanking markers 4 60179409 163844105 1 - by flanking markers 4 60439127 99066957 1 - by flanking markers 1358923 LE-Mbp^md A spontaneous tremor rat was originated from in-house breeding colony , after purchased from Charles River Laboratory 12 years earlier, at McMaster University Central Animal Facility, Hamilton, Ontario, Canada. 10-12 days old rats had tremors that were followed by ataxia, hind limb paresis, episodes of immobility, and seizures by 5-14 weeks. Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada mutant Unknown Mbp|Mbp^md 3054|12802351 18 78943608 79057329 1 - by flanking markers 18 78385304 78504226 1 - by flanking markers 18 79326738 79437310 1 - by flanking markers 1358989 WKY.SHR-(D2Rat174-D2Rat28)(D2Rat161-D2Rat185) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 1358990 DA.F344-(D10Mit9-D10Rat24)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 79229233 1 - by flanking markers 10 31740635 78195122 1 - by flanking markers 10 31919397 78343192 1 - by flanking markers 1358991 F344.HTX-(D11Rat4-D11Arb4)/Hcj Congenic strain originated from F344/NHsd parental strain bred to HTX/Hcj Department of Pharmacology, University of Florida, Gainesville congenic Unknown 11 64573222 68235010 1 - by flanking markers 11 66731054 72739915 1 - by flanking markers 11 65352097 69649936 1 - by flanking markers 1358992 SHR.WKY-(D2Rat40-D2Rat50) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the SHR/NCrl recipient strain with selection for chromosome 2 markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 163154227 200390471 1 - by flanking markers 2 189197858 227035367 1 - by flanking markers 2 169852670 207612467 1 - by flanking markers 1358993 WKY.SHR-(D2Rat161-D2Rat185) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 238140155 1 - by flanking markers 2 138120195 264423808 1 - by flanking markers 2 118446646 245893748 1 - by flanking markers 1358994 SHR.WKY-(D2Rat161-D2Rat241) This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) congenic strain to the parental strain SHR/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 118264490 217985582 1 - by flanking markers 2 138120195 242993417 1 - by flanking markers 2 118446646 118446793 1 - by flanking markers 1358995 F344.OLETF-(D1Rat166-D1Rat90)/Tj Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. Laboratory of Animal Breeding and Genetics, Kyoto University, Sakyoku, Kyoto, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 1358996 SHR.WKY-(D2Rat10-D2Mgh13) This congenic strain carries a WKY/NCrl chromosome 2 segment transferred to a SHR/NCrl background Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 35874553 244809764 1 - by flanking markers 2 54092967 270992875 1 - by flanking markers 2 34967269 252466565 1 - by flanking markers 1358997 WKY.SHR-(D2Rat241-D2Rat185) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 217985399 238140155 1 - by flanking markers 2 242993235 264423808 1 - by flanking markers 2 245893572 245893748 1 - by flanking markers 1358998 BUF/NHsd Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. These were bought from Harlan. Harlan inbred Unknown 1358999 WKY.SHR-(D2Rat174-D2Rat28) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185) to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 107574826 1 - by flanking markers 2 83930202 126824737 1 - by flanking markers 2 60746052 107083569 1 - by flanking markers 1359000 DA.F344-(D10Arb27-D10Rat6)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 69160380 106310957 1 - by flanking markers 10 67971352 104746310 1 - by flanking markers 10 68305037 105078045 1 - by flanking markers 1359001 WKY.SHR-(D2Rat42-D2Rat139) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 180768203 232533087 1 - by flanking markers 2 207416346 258769070 1 - by flanking markers 2 188013923 240243929 1 - by flanking markers 1359002 NTac:WKY The Taconic Wistar Kyoto rat was received from the NIH Animal Genetic Resource in 1974 at F10. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1982, Taconic's WKY is randomly bred in a closed colony. Taconic outbred Unknown 1359003 LEW/Jr This strain is maintained by Dr. J Rapp at the Medical College of Ohio (Toledo), USA. Medical College of Ohio, Toledo, Ohio, USA inbred Unknown 1359004 DA.F344-(D10Mit9-D10Rat11)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and F344/Hsd North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030 congenic Unknown 10 31931622 100633982 1 - by flanking markers 10 31740635 99184250 1 - by flanking markers 10 31919397 99492409 1 - by flanking markers 1359005 SHR.WKY-(D2Rat15-D2Rat50) This congenic substrain was constructed by repeated backcrossing the congenic strain SHR.WKY-(D2Rat10-D2Mgh13) to parental strain SHR/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 46251938 200390471 1 - by flanking markers 2 66171293 227035367 1 - by flanking markers 2 47783949 207612467 1 - by flanking markers 1359006 WKY.SHR-(D2Rat27-D2Rat243) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 96481750 221307793 1 - by flanking markers 2 116297660 248110514 1 - by flanking markers 2 96556622 228759752 1 - by flanking markers 1359007 WKY.SHR-(D2Rat174-D2Rat62) This congenic substrain was contructed by repeated backcrossing of congenic strain WKY.SHR-(D2Rat174-D2Rat185)/NCrl to parental strain WKY/NCrl Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 228664122 1 - by flanking markers 2 83930202 254867363 1 - by flanking markers 2 60746052 236318668 1 - by flanking markers 1359008 F344.HTX-(D11Rat4-D11Arb4)(D17Rat23-D17Rat154)/Hcj Double congenic strain originated from a cross between single congenic strains F344.HTX-(D11Rat4-D11Arb4)/Hcj and F344.HTX-(D17Rat23-D17Rat154)/Hcj. Department of Pharmacology, University of Florida, Gainesville congenic Unknown 1359009 WKY.SHR-(D2Rat174-D2Rat185) Congenic strains were constructed by repeated backcross of an (SHR/NCrl x WKY/NCrl)F1 to the WKY/Crl recipient strain with selection for chromosome 2 SHR markers Dept Pharmacology, Univ. of California San Diego, La Jolla, CA USA congenic Unknown 2 60124623 238140155 1 - by flanking markers 2 83930202 264423808 1 - by flanking markers 2 60746052 245893748 1 - by flanking markers 1359010 WF.BBDR-ART2^a/Wor Wistar Furth Congenic strain created by backcrossing WF strain to BBDR strain which are RT1 ^u/u , ART2^a. University of Massachusetts Medical School,Department of Pathology 55 Lake Avenue Worcester, MA 01605 congenic Unknown 1547865 FHH-Chr 3^BN/Mcwi A FHH genomic background with a BN chromosome 3 introgressed. PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1547866 F344/Jcl Inbred strain originated from F344 CLEA Japan, Inc inbred Live Animals (as of 2021-04-22) 1547867 FHH-Chr 4^BN/Mcwi A FHH genomic background with a BN chromosome 4 introgressed. PhysGen consomic Cryopreserved Sperm 1547868 FHH-Chr 2^BN/Mcwi A FHH genomic background with a BN chromosome 2 introgressed. PhysGen consomic Cryopreserved Sperm 1547869 ACI/Eur August x Copenhagen Irish Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH Department of Pediatric Surery, Erasmus Medical Center, Rotterdam, Netherlands inbred Unknown 1547870 FHH-Chr 14^BN/Mcwi A FHH genomic background with a BN chromosome 14 introgressed. PhysGen consomic Live Animals 1547871 ACI.FHH-(D1Rat324-D1Rat156)/Eur Congenic strain created from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229301063 253410500 1 - by flanking markers 1 251109240 279213254 1 - by flanking markers 1 243853559 243853760 1 - by flanking markers 1547872 FHH-Chr X^BN/Mcwi FHH-Chr X^BN/Mcwi A FHH genomic background with a BN chromosome X introgressed. PhysGen consomic Cryopreserved Sperm 1547873 FHH-Chr 15^BN/Mcwi A FHH genomic background with a BN chromosome 15 introgressed. PhysGen consomic Cryopreserved Sperm 1547874 FHH-Chr Y^BN/Mcwi FHH-Chr Y^BN/Mcwi A FHH genomic background with a BN chromosome Y introgressed. PhysGen consomic Cryopreserved Sperm 1547875 ACI.FHH-(D17Rat117-D17Arb5)(D17Rat180-D17Rat51)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 17 31007408 69257442 1 - by flanking markers 17 27537443 67580933 1 - by flanking markers 17 25609692 65831023 1 - by flanking markers 1547876 FHH-Chr 10^BN/Mcwi A FHH genomic background with a BN chromosome 10 introgressed. PhysGen consomic Cryopreserved Sperm 1549794 SS.LEW-(D2Rat199-D2Mco17)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2;4 41032071;157987925 76020140;157987994 1 - by flanking markers;1 - by flanking markers 2;4 60242455;221211532 95618891;221211601 1 - by flanking markers;1 - by flanking markers 2;4 41179255;154125111 75896315;154125180 1 - by flanking markers;1 - by flanking markers 1549795 SS.LEW-(D2Rat199-D2Rat143)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 41032071 106236206 1 - by flanking markers 2 60242455 125885146 1 - by flanking markers 2 41179255 106156987 1 - by flanking markers 1549796 BN/2Hok Transferred from Hokkaido University, Chromosome Research Unit, 1987 F16 National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo 1549797 BUF.ACI-(D16Rat31-D16Arb1)/Ncc This congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method. National BioResource Project for the Rat in Japan congenic Unknown 16 8340080 8340453 1 - by flanking markers 16 11019972 11020174 1 - by flanking markers 16 9055590 9055792 1 - by flanking markers 1549798 BB.PVG-RT1^u/a/Tky A congenic strain with the genetic background of the BB/WorTky strain (RT1.B^u,D^u ) onto which the MHC locus of PVG.R23 strain (RT1.B,D ) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology 1549799 BB.SHR-(D6Rat184-D6Rat3)/K Congenic BB.6S rats were established by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats in 2000. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Metabolism 6 121381065 145279536 1 - by flanking markers 6 130448688 154782041 1 - by flanking markers 6 121224054 145868598 1 - by flanking markers 1549800 BN/KunKtsSlc Kitasato University School of Medicine to Slc (2001) National BioResource Project for the Rat in Japan mutant Live Animals Metabolism 1549801 BN/Seac Seac Yoshitomi, LTD, Fukuoka, Japan Seac Yoshitomi, LTD, Fukuoka, Japan, National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Behavior; Ophthalmology 1549802 BN/1Hok Transferred from Hokkaido University, Chromosome Research Unit, 1987 F15 National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1549803 ACI-Lyst^bg-Kyo/Kyo Spontaneous mutation from ACI/NKyo inbred at Kyoto University in 1999. National BioResource Project for the Rat in Japan coisogenic Cryopreserved Embryo; Cryopreserved Sperm Hematology 1549804 BUF/NacJcl CLEA Japan, Inc., Tokyo Japan Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan inbred Unknown 1549805 BUF.Cg-Foxn1^rnu/Mna BUF/Mna, NN1H-Rnu/Rnu National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Urology 1549806 BUF.ACI-(D3Rat56-D3Rat83)/Ncc This strain was produced by speed congenic methods in which several generations of backcrossing were carried out in order to transfer the ACI chromosome 3 region into the BUF/Nac background recipient strain Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 3 3577905 42635088 1 - by flanking markers 3 2612834 52104192 1 - by flanking markers 3 2631421 46996487 1 - by flanking markers 1549808 SS.LEW-(Prlr-D2Rat143)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown Prlr 3407 2 59507966 106236206 1 - by flanking markers 2 84360850 125885146 1 - by flanking markers 2 60131410 106156987 1 - by flanking markers 1549809 BN/KtsSlc Kitasato University School of Medicine to Slc (2002) National BioResource Project for the Rat in Japan inbred Live Animals Immunology 1549810 AI/Msik amelogenesis imperfecta rat This strain is originated from female rats showing white incisors of an SD rat colony purchased from Charles River Japan, Inc. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dentistry 1549811 ACI/NJcl ACI/N rats that were purchased from CLEA Japan, Inc., Tokyo Japan. Carcinogenesis Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan; National BioResource Project for the Rat in Japan inbred Unknown 1549813 F344.ACI-Lmx1a^qc/Kyo Congenic strain created by backcrosses between ACI/Pas and F344/NSlc strains. The short-tail mutation, âqueue courteâ in French (with qc as a symbol), occurred spontaneously in 1994, in the ACI/Pas inbred strain of rat maintained at the Institute Pasteur (Paris, France), and was kept segregating in this stock. Since importation into the Institute of Laboratory Animals at Kyoto University, it has been maintained as a congenic strain F344.ACI-qc using F344/NSlc as an inbred partner. Institute of Laboratory Animals at Kyoto University, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-11-12) Apoa2|Selp|Lmx1a 2131|3656|1304784 13 79886614 87116372 1 - by flanking markers 13 87308435 94225670 1 - by flanking markers 13 82428914 89598805 1 - by flanking markers 1554301 WKHA/Bord Strain was originated from WHHA/Edh at the University of Vermont College of Medicine Universite Victor Segalen Bordeaux 2, Bordeaux cedex, France inbred Unknown 1554302 HOB-Unc5c^hob/Snk hobble rat Homozygous hobble rats that were taken from the inbred hobble rat colony. National BioResource Project for the Rat in Japan mutant Unknown Unc5c|Unc5c^hob 735109|12802353 2 239365109 239721231 1 - by flanking markers 2 265573406 265926229 1 - by flanking markers 2 247045813 247397483 1 - by flanking markers 1554303 CVD/Opu Cerebellar vermis defect rat Originated from a colony of Lewis rats that were spontaneously ataxic. Maintained by brother-sister mating with phenotypically normal littermates. Department of Veterinary Pathology, Osaka Prefecture University, Sakai, Osaka, Japan mutant Unknown Unc5c 735109 2 239365109 239721231 1 - by flanking markers 2 265573406 265926229 1 - by flanking markers 2 247045813 247397483 1 - by flanking markers 1554304 GAERS/Mave Genetic Absence Epilepsy Rats from Strasbourg 30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Neurobiology 1554305 DA-Tg(CAG-lacZ)30Jmsk lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development 1554306 GK/Slc Goto Kakizaki Rat Spontaneous mutant GK rat which were obtained from Japan SLC, Inc. National BioResource Project for the Rat in Japan mutant Live Animals Diabetes Obesity 1554307 W-Tg(LAC3)Ys These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. This tranasgenic line carries a single copy of 210 kb YAC gene that codes for human lactalbumin and thymidine kinase. YS New Technology Institute, Tochigi, Japan transgenic Unknown 1554308 Gunn-Ugt1a1^j/Slc Gunn Segregated inbred Gunn rat which were obtained from Japan SLC, Inc. National BioResource Project for the Rat in Japan segregating_inbred Live Animals Neurobiology; Metabolism Ugt1a1^j 13432064 1554309 W-Tg(CAG-GFP)184Ys These transgenic rats are produced by the intracytoplasmic sperm injection (ICSI) using a Piezo-driven micromanipulator. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development 1554310 DA-Tg(CAG-lacZ)19Jmsk lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development 1556748 F344/Snk Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan inbred Unknown 1558660 SHRSP/Tkyo Substrain of SHRSP rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown 1558661 WKY/Tkyo Substrain of WKY rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown 1558662 SHR/Tkyo Substrain of SHR rats maintained at International Medical Center of Japan, Tokyo Department of Gene Diagonostics and Therapeutics, Research Institute, International Medical Center of Japan, Tokyo, Japan inbred Unknown 1559030 LEC-Tg(ATP7B)Tohm A 4.5 kb fragment of human ATP7B cDNA was blunt-end ligated into the pCXN2 vector that contained the CAG promoter to generate pCXN2ATP7B which was microinjected into the pronuclei of LEC/Crlj. The transgenic founders were identified by the PCR analysis of the tail-DNA. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 1559031 NE/Mave The control strain of GAERS, free of any spontaneous spike and wave discharges. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology 1559032 SS.LEW-(D17Rat65-D17Chm2)/Ayd This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 82247891 93930006 1 - by flanking markers 17 76483116 88435496 1 - by flanking markers 17 74823053 86731080 1 - by flanking markers 1559033 SS.LEW-(D17Rat65-Prl)/Ayd This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown Prl 3403 17 44699101 93930006 1 - by flanking markers 17 41720751 88435496 1 - by flanking markers 17 39814236 86731080 1 - by flanking markers 1559034 SS.LEW-(D17Chm14-D17Rat97)/Ayd This congenic substrain contains a LEW/CrlBR chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 80182186 1 - by flanking markers 17 60264084 74265481 1 - by flanking markers 17 58467778 72580782 1 - by flanking markers 1559035 SS.LEW-(D17Chm14-D17Rat181)/Ayd This congenic strain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 38257211 80182186 1 - by flanking markers 17 35100574 74265481 1 - by flanking markers 17 33208959 72580782 1 - by flanking markers 1559036 LEW/Jms Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. National BioResource Project for the Rat in Japan, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01) 1559037 SS.LEW-(D17Chm9-D17Rat97)/Ayd This congenic substrain contains a LEW/Crlc chromosome 17 segment transferred to the SS/Jr recipient strain; derived by crossing congenic strain SS.LEW-(D17Rat65-Prl) with SS/Jr, F2 animals were screened with D17Rat65 and Prl to identify regions with crossovers within this chromosome 17 segment Research Centre, Centre Hosp Univ Montreal, Quebec, Canada congenic Unknown 17 73041111 83074398 1 - by flanking markers 17 60264084 77361330 1 - by flanking markers 17 58467778 75705622 1 - by flanking markers 1559039 ODS/Shi Osteogenic disorder Shionogi Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. Shionogi & Co., Ltd. Japan mutant Unknown 1559040 MD/Tama myelin deficient rat X-linked mutant of the Wistar rat. National BioResource Project for the Rat in Japan mutant Live Animals Neurobiology; Development 1559041 SHRSP/Ngsk Substrain of SHRSP developed by Prof. Okamoto at Kinki University, Japan in 1980. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension; Osteosis 1559042 SHR/Nig Originated in the SHR given from Prof. Okamoto at Kinki University, Japan in 1976. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Pharmacology 1559043 MV/Opu myelin vacuolation rat The myelin vacuolation rats showing body tremor were found in an outbred colony of Sprague-Dawley rats at Osaka Osaka Prefecture University in 1999. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrn^mv 40902835 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 1559044 SS.SR-(D3Mco19-D3Mco5)/Jr A region of chr 3 which contains the Edn3 gene was introgressed into the SS rats Medical College of Ohio, Toledo, Ohio, USA congenic Unknown Edn3 2534 7;3 23312460;147799021 23312636;167653069 1 - by flanking markers;1 - by flanking markers 7;3 27325365;158391833 27325541;183008351 1 - by flanking markers;1 - by flanking markers 3;7 153327515;27206010 153327695;27206186 1 - by flanking markers;1 - by flanking markers 1559045 LEW/Crlc LEW substrain obtained from Charles River Laboratories, La Salle, Quebec, Canada Charles River Laboratories, La Salle, Quebec, Canada inbred Unknown 1559046 SHR-Chr Y^W/K Consomic SHR rats were established by crossing of SHR females and one wild rat male captured in northern part of Germany. Male hybrids were repeatedly backcrossed onto SHR females replacing the chromosome Y of SHR/Mol by that of wild rats in 1996. National BioResource Project for the Rat in Japan consomic Unknown 1559047 SHRSP/Ezo Substrain of SHRSP maintained at Hokkaido University School of Medicine, Sapporo, Japan National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Cardio Hypertension 1559048 SHR.ODS-Gulo^od/Shi A congenic strain developed from a recipient, SHR and a donor, ODS. The first generation was backcrossed to SHR and these rats were genotyped and the heterozygous rats were backcrossed to SHR to generate the congenics. Introduced to Nagoya University in 1995. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension; Osteosis Gulo 620701 1566430 SimTac:LE Taconic Long Evans rats originated with Drs. Long and Evans in 1915 by a cross of several Wistar Institute white females with a wild grey male. Rederived in 1975 by Simonsen Laboratories from stock obtained from the University of California at Berkeley in 1949. Derived by Taconic in August 1998. Like all Taconic outbred rats, a monogamous mating system is used to maximize the heterozygosity of the stock. Taconic outbred Unknown 1566431 BN/MolTac The BN/MolTac arrived at M&B A/S in 1993 at F90 from the Zentralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). It was rederived at Taconic, USA in 2003. Taconic inbred Unknown 1566432 WKY/NMolTac Wistar Kyoto The inbred Wistar Kyoto rat was received at Taconic from M&B A/S in 1998 at F61. M&B (formerly Mollegaard) received the strain from the NIH Animal Genetic Resource in 1975 at F13. The NIH-stock was obtained in 1971 as non-inbred Wistar stock from the Kyoto School of Medicine. Cesarean derived in 1999, Taconics Foundation Colony of inbred WKYs is maintained in a plastic-film gnotbiotic isolator. Breeders from the FC are regularly transferred to Taconics WKY Production Colony which is maintained in an MPF Barrier Unit. Taconic inbred Unknown 1566433 HanTac:WH In 1989 RCC Ltd. of Switzerland obtained 156 breeding pairs of Wistar Hannovers from Dr. Willy Heine, Zentralinstitut f?r Versuchstierzucht (ZfV), Hannover, Germany. The stock was hysterectomy derived at RCC in 1989. Genetic drift in RCC?s colony of Wistar Hannovers is minimized through the use of the Poiley rotational breeding system and revitalization of the stock with cryopreserved embryos (most recent revitalization completed in 1998).Each Member of GALAS obtained in excess of fifty (50) Wistar Hannover breeders from RCC in late 1998. The line was cesarean derived in 1999 and Taconic replaced its former WH stock with the GALAS Wistar Hannover rat in June 2000. Taconic outbred Unknown 1566434 NTac:SHR Taconics original SHR breeding stock was obtained in 1972 at F35 from the NIH Animal Genetic Resource. The NIH colony was established with rats from Okamoto in 1966 at F13 (Okamoto, Kyoto School of Medicine, from Wistar Kyoto outbred stock). Cesarean derived in 1984, Taconics SHR is randomly bred in a closed colony. Taconic outbred Unknown 1566437 SS-Chr X^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Cryopreserved Sperm 1566438 DA/MolTac Developed at the Agricultural Research Council, Institute of Animal Physiology, Cambridge, UK; it then went to the Centralinstitut f?r Versuchstierzucht, Hannover, Germany (Han). From Han to M&B in 1990. Inbreeding F + 17 (February 2000). Rederived at Taconic, USA in 2004. Taconic inbred Unknown 1566439 F344/NTac Axenic breeders were obtained at F143 by Taconic in 1984 from the NIH Animal Genetic Resource. Origin of the strain is as follows: to NIH in 1951 from Heston; to Heston in 1949 from Curtis, Columbia University Institute for Cancer Research. To preserve genetic continuity, Taconics F344 foundation colony is maintained in gnotobiotic isolators and the strain is periodically reestablished with breeding pairs from NIH. Taconic inbred Unknown 1566440 NTac:SD Taconic SD rats were first obtained in 1970 from the NIH Animal Genetic Resource. The NIH stock originated from Sprague Dawley, Inc. in 1945 and has since been maintained as an outbred closed colony. To maintain genetic continuity with the SDN:SD strain of NIH, Taconic continually receives axenic breeder stock from the NIH Animal Genetic Resource for systematic introduction into Taconics production colonies. Taconic outbred Unknown 1566443 LEW/MolTac Lewis Scripps Clinic, La Jolla, California to the University of Pennsylvania; to Simonsen Laboratories in 1966 at F20; to the Institute of Pathological Anatomy, University of Copenhagen, Denmark in 1973 at F28. The Lewis rat was obtained from the University of Copenhagen by M&B in 1977, and was received at Taconic, USA in 2002, where it was rederived. Taconic inbred Unknown 1566444 MolTac:SD The SD Hannover was developed at the National Institutes of Health, Bethesda, USA. It later went to the Zentralinstitut fur Versuchstierzucht, Hannover, Germany (Han) and was received by M&B A/S in 1993. Taconic outbred Unknown 1566445 ACI.BN-(D5Mgh17-D5Rat205)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Extinct 5 14730738 14730949 1 - by flanking markers 5 19190627 19190837 1 - by flanking markers 5 14408903 14409113 1 - by flanking markers 1566447 GK/MolTac Goto-Kakizaki Originating at Tohoku University, Sendai, Japan in 1975, the Goto-Kakizaki rat was obtained by Aarhus University Hospital, Denmark in 1994. Received from Aarhus by M&B A/S in 1997. Taconic inbred Unknown 1566448 FHH-Chr 9^BN/Mcwi A FHH genomic background with a BN chromosome 9 introgressed. PhysGen consomic Cryopreserved Sperm 1566453 SD-Tg(HIV-LacZ)AngRrrc Fertilized eggs were microinjected with 300-500 copies of DNA per egg which comprised of an insert (5,230 bp) containing U3R region, the lacZ gene and the SV 40 polyadenylation signal which was excised from the bacterial plasmid. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 1566454 BDIV/Zte BDIV/Zte derived from Berlin-Druckrey strain BDIV Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown 1566455 HTX/HcjRrrc Available at RRRC;these were originally bred by D. F. Kohn, Inst. of Comparative Medicine,Columbia University, New York. Then housed at University of Florida 1992 at F30. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery 1566456 BDIX/Zte derived from Berlin-Druckrey strain BDIX Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany inbred Unknown 1566457 SPRD Sprague-Dawley From outbred Han:SPRD (Sprague-Dawley) rats. Dominant pelage mutation designatedcurly-3 (Cu3) occured in 1975 at the Gesellschaft fur Strahlenforschung, Dortmund, Germany.Mutant animals returned to Hannover where inbreeding begun in 1976 (Greenhouse et al 1990). unknown inbred Unknown 1566458 F344-Tg(ROSA26-ALPP)EpsRrrc F344 embryos were microinjected with R26-hPAP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to human placental alkaline phosphatase (hPAP, ALPP). Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-07-01) ALPP 1314395 1566459 F344-Tg(ROSA26-EGFP)Eps F344 embryos were microinjected with R26-EGFP trangene which comprises of 0.8 kb genomic sequence of ROSA 26 promoter fused to enhanced green fluorescent protein (EGFP). Department of Pathobiological Sciences, University of Wisconsin-Madison, Madison, Wisconsin transgenic Unknown 1566460 SD-Tg(ICAM2-DAF)AngRrrc Embryos were microinjected with DNA containing the human DAF(decay-acceletating factor) gene under control of the human ICAM2 promoter. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 1578692 BN.LEW-(D10Rat32-D10Rat116)/Ciml Congenic strain was bred from BN.LEW-(D10Mco17-D10Mco14)/Ciml backcrossed to BN/Rj. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 54220239 1 - by flanking markers 10 53381898 53807373 1 - by flanking markers 10 53630865 54057745 1 - by flanking markers 1578693 LEW.BN-(D10Mco17-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 1578694 AT Alcohol-Tolerant The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578695 SHA/BruRrrc Syracuse High Avoidance Selective breeding of Long-Evans in active two-way shuttle box for high avoidance resulted in these SHA rats. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578696 LAS1 Low Alcohol Sensitive strain 1 Selectively bred for 24 generations for low sensitivity to ethanol then inbred. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578697 BN.LEW-(D10Rat32-D10Rat31)/Ciml Congenic strain was bred from BN.LEW-(D10Rat32-D10Rat221)/Ciml backcrossed to BN/Rj. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53616237 53786515 1 - by flanking markers 10 53216481 53382065 1 - by flanking markers 10 53465198 53631032 1 - by flanking markers 1578698 LAS2 Low Alcohol Sensitive strain 2 Selectively bred for 24 generations for low hypnotic response to high dose ethanol, then inbred Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578699 BG anemic Belgrade These are descendants of the original Belgrade colony which was obtained by K. Kellar Centers forDisease Control and Prevention, Atlanta, GA. These were backcrossed with Harlan Sprague-Dawley Wistar and then amintained as a closed colony in Buffalo, NY. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery 1578700 HAS1 High Alcohol Sensitive strain 1 Selectively bred for high sensitivity for ethanol hypnosis for 24 generations then inbred Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578701 HAS2 High Alcohol Sensitive strain 2 Selectively bred for high ethanol sensitivity for 24 generations, then inbred. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578702 LEW.BN-(D10Rat32-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 1578703 SLA/BruRrrc Syracuse Low Avoidance Selective breeding of Long-Evans in active two-way shuttle box for low avoidance resulted in these SLA rats. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578704 WLP Warsaw Low Prefering These were bred from albino stock of Wistar rats as lines that had low ethanol preference. Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown 1578705 LEW.BN-(D10Arb4-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 46737116 65668639 1 - by flanking markers 10 46591952 64823355 1 - by flanking markers 10 46835584 46835685 1 - by flanking markers 1578706 LEW.BN-(D10Mco17-D10Mco14)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 1578708 LEW.BN-(D10Mgh7-D10Rat221)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 56170962 56171177 1 - by flanking markers 10 55720558 55720772 1 - by flanking markers 10 55978483 55978697 1 - by flanking markers 1578709 IA incisor absent These rats have incisors and molars formed embryogically but are unable to erupt as no openings in the alveolar bone was created by selective resoption. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 1578710 LEW.1AR1-iddm/Ztm arose through a spontaneous mutation in a congenic Lewis strain with a defined MHC haplotype (RT1.A^aB/D^uC^u) in the intra-MHC recombinant inbred strain LEW.1AR1; mutation was discovered in Fx + 13 of the LEW.1AR1 and has been maintained as a separate strain since Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany coisogenic Unknown Dock8^m1Ztm 13830868 1578711 LEW.BN-(D10Mco17-D10Rat133)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 65668639 1 - by flanking markers 10 44914976 64823355 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 1578712 BN.LEW-(D10Mco17-D10Mco14)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 45106380 1 - by flanking markers 10 44914976 44915377 1 - by flanking markers 10 45157430 45157831 1 - by flanking markers 1578713 BN/Ztm substrain of BN Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany inbred Unknown 1578714 BN.LEW-(D10Mco17-D10Rat80)/Ciml Congenic strain created from parental LEW/Rj and BN/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 45105978 61798393 1 - by flanking markers 10 44914976 61030524 1 - by flanking markers 10 45157430 61300905 1 - by flanking markers 1578715 ANT Alcohol-Nontolerant The parents of the base stock were produced by crossbreeding female AA of the F22 generation of Wistar origin with Helsinki Zoo male albinos. AT rats are selectively bred at ALKO in Finland for ethanol-induced ataxia on the inclined plane. These were moved 1998 to University of Colorado. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Gabra6 61861 1578716 LEW.1AR1/Ztm Lewis strain containing MHC haplotype RT1.A^aB/D^uC^u Institute for Laboratory Animal Science, Hannover Medical School, Hanover, Germany congenic Unknown 1578717 WHP Warsaw High Prefering These were bred from albino stock of Wistar rats as lines that had ethanol preference. Department of Pharmacology and Physiology of the Nervous System, Institute of Psychiatry and Neurology, Sobieskiego 9, Warszawa, Poland inbred Unknown 1579677 FHH-Madd^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G120R mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Madd^m1Mcwi 1578796 3 75498321 75541073 1 - by flanking markers 3 86669054 86711776 1 - by flanking markers 3 79960301 80003023 1 - by flanking markers 1579678 ACI.FHH-(D3Wox2-D3Rat59)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Live Animals; Cryopreserved Sperm 3 46419462 163443738 1 - by flanking markers 3 57173123 176609927 1 - by flanking markers 3 50533100 170534769 1 - by flanking markers 1579680 Wild/Tku Wild These rats were caught wild in Tokyo, Japan, used for experiments and then sacrificed. Caught in Tokyo wild Unknown 1579681 BN-Birc3^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated. PhysGen mutant Extinct (as of 2016-10-24) Birc3^m1Mcwi 1578788 8 4682202 4696856 1 - by flanking markers 8 6047454 6075236 1 - by flanking markers 8 6048590 6076828 1 - by flanking markers 1579682 FHH-Tlr4^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V489A mutation is generated. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tlr4^m1Mcwi 1578785 5 83564100 83577735 1 - by flanking markers 5 86690670 86704302 1 - by flanking markers 5 82587424 82601056 1 - by flanking markers 1579683 FHH-Ghsr^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. codon CAG/TAG mutation is generated which changes the AA Q343Stop. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsr^m1Mcwi 1578794 2 113269623 113272999 1 - by flanking markers 2 132784207 132789319 1 - by flanking markers 2 113065953 113071265 1 - by flanking markers 1579684 FHH-Slc8a2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y213Stop mutation is generated from the codon change TAT/TAA. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc8a2^m1Mcwi 1578786 1 76473938 76498624 1 - by flanking markers 1 79296259 79320746 1 - by flanking markers 1 78029555 78054042 1 - by flanking markers 1579685 FHH-Tgfbr2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E311K mutation is generated from the codon change GAG/AAG. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tgfbr2^m2Mcwi 1578782 8 120593595 120680453 1 - by flanking markers 8 123585765 123671209 1 - by flanking markers 8 124310288 124399345 1 - by flanking markers 1579686 GH/OmrMcwi This colony was established from rats of Wistar origin. This is an hysterectomy-derived colony at the University of Otago, which was established from the Wellcome Institute colony at generation 79. These have been inbred for over 90 generations. These were given to Dr. Howard Jacob in 1999 and have been bred in Medical College of Wisconsin since then. PhysGen inbred Live Animals; Cryopreserved Embryo 1579687 FHH-Proc^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L312P mutation is generated. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Proc^m1Mcwi 1578790 18 24563368 24573715 1 - by flanking markers 18 24633206 24643623 1 - by flanking markers 18 24918402 24928822 1 - by flanking markers 1579688 BN-Tgfbr2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T289M mutation is generated from the codon change ACG/ATG. PhysGen mutant Extinct (as of 2017-01-26) Tgfbr2^m1Mcwi 1578800 8 120593595 120680453 1 - by flanking markers 8 123585765 123671209 1 - by flanking markers 8 124310288 124399345 1 - by flanking markers 1579689 FHH-F10^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V453G mutation is generated from the codon change GTC/GGC. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10^m1Mcwi 1578783 16 81327237 81346544 1 - by flanking markers 16 81288536 81307842 1 - by flanking markers 16 81803169 81822476 1 - by flanking markers 1579690 FHH-Slc27a5^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K196Stop is generated. PhysGen mutant Extinct (as of 2017-01-26) Slc27a5^m1Mcwi 1578799 1 72924630 72935223 1 - by flanking markers 1 66387832 66398425 1 - by flanking markers 1 65576599 65587192 1 - by flanking markers 1579691 SS.SHR-(D11Mgh3-D11Rat31)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 11 8176272 68234949 1 - by flanking markers 11 10373455 72739854 1 - by flanking markers 11 6673351 69649875 1 - by flanking markers 1579692 FHH-Lcat^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H353L mutation is generated from the codon change CAC/CTC. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcat^m1Mcwi 1578793 19 35781507 35784966 1 - by flanking markers 19 48780364 48783830 1 - by flanking markers 19 37913333 37916799 1 - by flanking markers 1579693 T2DN/Mcwi Generated by crossing GK/Swe with female FHH/EurMcwi. During the F1 studies, the GK/Swe started to die out. In order to preserve the GK strain, single male GK was serially crossed to the ongoing GK-FHH cross. This resulted in rapid fixation of the original GK genome except for mitochondrial DNA. In the sixth generation male and female T2DN were intercrossed and strict b x s mating was maintained. Department of Physiology, Medical College of Wisconsin, Milwaukee Wisconsin inbred Unknown 1579694 FHH-Egln3^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E60G mutation is generated. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Egln3^m1Mcwi 1578781 6 74451038 74476506 1 - by flanking markers 6 84592894 84618360 1 - by flanking markers 6 75050329 75075795 1 - by flanking markers 1579695 ACI.FHH-(D1Rat298-D1Rat90)/Eur Congenic strain originated from backcrossing ACI/Eur and FHH/Eur parental strains. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 225625031 267111153 1 - by flanking markers 1 247303036 289137268 1 - by flanking markers 1 240017117 281795785 1 - by flanking markers 1579696 SS.SHR-(D6Wox13-D6Rat84)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 6 136451997 136452267 1 - by flanking markers 6 144273721 144273990 1 - by flanking markers 6 136142742 136143011 1 - by flanking markers 1579697 SS.SHR-(D13Rat63-D13Mit1)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 13 25430110 80482429 1 - by flanking markers 13 14281836 87877411 1 - by flanking markers 13 9016742 82995671 1 - by flanking markers 1579698 FHH-Adra1a^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Adra1a^m1Mcwi 1578792 15 46173429 46263198 1 - by flanking markers 15 48197628 48297316 1 - by flanking markers 15 43296997 43398314 1 - by flanking markers 1579699 WKY.WKHA-(D5Rat45-D5Rat245)/Cfd WKY.WKHA-(D5Rat45-D5Rat245)/Cfd This congenic strain contains a region of WKHA/Cfd chromosome 5 transferred to the WKY/Cfd strain background Experimental Cardiovascular Biology Laboratory, Institut de Recherches Cliniques de Montreal, 119 Pine Ave W, Montreal, Quebec CA congenic Unknown 5 159265355 159265706 1 - by flanking markers 5 162571275 162571427 1 - by flanking markers 5 158854038 158854190 1 - by flanking markers 1579700 ACI.FHH-(D1Rat475-D1Rat90)(D3Rat84-D3Rat59)/Eur Double congenic strain from backcross of ACI.FHH-(D1Rat298-D1Rat90)/Eur and ACI.FHH-(D3Wox2-D3Rat59)/Eur. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1579701 BN-Nos1^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L72Stop mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Nos1^m1Mcwi 1578795 12 39812500 39869484 1 - by flanking markers 12 46049288 46209569 1 - by flanking markers 12 44214949 44405530 1 - by flanking markers 1579702 SS.SHR-(D9Wox16-D9Rat64)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 9 21667066 21667256 1 - by flanking markers 9 27914255 97338238 1 - by flanking markers 9 29075079 97647719 1 - by flanking markers 1579703 SS.SHR-(D2Rat61-D2Mco18)/Mco Congenic strain from the parental SS/Jr and SHR/NHsd inbred strains. Medical College of Ohio, Toledo, Ohio congenic Unknown 2 79796833 227150249 1 - by flanking markers 2 88594475 100298539 1 - by flanking markers 2 68865414 80632096 1 - by flanking markers 1579704 FHH-Agtr1b^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A 3bp deletion generates a mutation at TTC (del251F)of rat Agtr1b. PhysGen, Rat Resource & Research Center mutant Extinct (as of 2016-11-29) Agtr1b^m1Mcwi 1578784 2 105503269 105602591 1 - by flanking markers 2 124879262 124954378 1 - by flanking markers 2 105149020 105224335 1 - by flanking markers 1579705 FHH-Nr0b2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G96R mutation is generated from the codon change GGC/CGC. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nr0b2^m1Mcwi 1578798 5 151524685 151528000 1 - by flanking markers 5 155465275 155468590 1 - by flanking markers 5 151776004 151779319 1 - by flanking markers 1579706 FHH-Nr4a1^m1Mcwi Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA. PhysGen mutant Cryopreserved Sperm (as of 2017-01-26) Nr4a1^m1Mcwi 1578791 7 140012807 140020590 1 - by flanking markers 7 140700242 140721073 1 - by flanking markers 7 142899358 142920216 1 - by flanking markers 1579707 FHH-Adipoq^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I164N mutation is generated in rat Adipoq. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoq^m2Mcwi 1578797 11 79908291 79911065 1 - by flanking markers 11 84363940 84382663 1 - by flanking markers 11 81330845 81344488 1 - by flanking markers 1579708 FHH-Des^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S25T mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Des^m1Mcwi 1578801 9 74637783 74645499 1 - by flanking markers 9 82325835 82333549 1 - by flanking markers 9 82556574 82564288 1 - by flanking markers 1579709 Wild/Mcwi Wild These rats were caught wild in Milwaukee, used for experiments and then sacrificed. Caught in Milwaukee wild Unknown 1579710 GK/Far Goto-Kakizaki Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. James A. Haley Veterans Hospital, Tampa Florida inbred Unknown 1579711 FHH-Adipoq^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.Y162C mutation is generated on rat Adipoq. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoq^m1Mcwi 1578787 11 79908291 79911065 1 - by flanking markers 11 84363940 84382663 1 - by flanking markers 11 81330845 81344488 1 - by flanking markers 1579712 FHH-Klf6^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated. PhysGen mutant Extinct (as of 2017-01-26) Klf6^m1Mcwi 1578789 17 75578498 75585072 1 - by flanking markers 17 69616967 69674031 1 - by flanking markers 17 67887939 67945052 1 - by flanking markers 1579894 SS.LEW-(D10Rat204-D10Rat9)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 94837236 99588446 1 - by flanking markers 10 93421499 93421719 1 - by flanking markers 10 93662786 93663006 1 - by flanking markers 1579895 FHH-Bdkrb2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I214T mutation is generated. PhysGen mutant Extinct (as of 2016-10-24) Bdkrb2^m1Mcwi 1579889 6 129744781 129748851 1 - by flanking markers 6 138615812 138622272 1 - by flanking markers 6 129399468 129429676 1 - by flanking markers 1579896 SS.LEW-(D2Rat18-D2Chm277)/Ayd Congenic strain was created from a SS/Jr parental strain Research Centre Hospitalier de l'Universite de Montreal, Quebec, Canada congenic Unknown 2 40912197 56722286 1 - by flanking markers 2 60126669 76472773 1 - by flanking markers 2 41063439 56736627 1 - by flanking markers 1579897 SS.SR-(D9Rat69-D9Mco14)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 9 66679876 74437140 1 - by flanking markers 9 74640722 82125547 1 - by flanking markers 9 74858383 82356286 1 - by flanking markers 1579898 SS.LEW-(D10Chm128-D10Chm121)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 71365656 1 - by flanking markers 10 69272915 71014829 1 - by flanking markers 10 69638898 70499629 1 - by flanking markers 1579899 SS.LEW-(D5Rat130-D5Rat31)/JrMcwi SS.LEW-(D5Rat130-D5Rat31)/JrMcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 139996194 1 - by flanking markers 5 36590997 142265366 1 - by flanking markers 5 31926122 138454239 1 - by flanking markers 1579900 SS.SR-(D9Rat89-Resp18)/Mco Congenic strain was created by backcrossing SR strain into the parental Dahl Salt-sensitive (SS) strain Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 72257996 74558151 1 - by flanking markers 9 80172493 82246695 1 - by flanking markers 9 80400409 82477136 1 - by flanking markers 1579901 SS.LEW-(D10Chm224-D10Chm6)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76000447 1 - by flanking markers 10 75100237 76438561 1 - by flanking markers 10 75001953 76556637 1 - by flanking markers 1579902 SS.LEW-(D5Rat130-D5Rat108)/JrMcwi SS.LEW-(D5Rat130-D5Rat108)/JrMcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. The strain was originally developed by Drs. Rapp and M. R. Garrett at the Medical University of Ohio and has also been maintained by brother-sister mating at the Medical College of Wisconsin for more than 20 generations. Department of Physiology, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 134872385 1 - by flanking markers 5 36590997 137108002 1 - by flanking markers 5 31926122 133313852 1 - by flanking markers 1579903 SS.LEW-(D10Chm10-D10Rat11)/Ayd A congenic substrain derived from the progenitor strain SS.LEW-(D10Rat119-D10Mgh1)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 97152234 100633982 1 - by flanking markers 10 95701164 99184250 1 - by flanking markers 10 95967019 99492409 1 - by flanking markers 1579904 SS.SR-(D9Mgh11-D9Mco33)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 10 86983905 86984155 1 - by flanking markers 10 85965754 85966003 1 - by flanking markers 10 86168841 86169090 1 - by flanking markers 1579905 SS.SR-(D9Rat89-D9Mco27)/Mco Congenic strain derived from parental strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 9;10 72257996;76477677 72258219;76477875 1 - by flanking markers;1 - by flanking markers 9;10 80172493;74600366 80172715;74600564 1 - by flanking markers;1 - by flanking markers 9;10 80400409;75505821 80400631;75506019 1 - by flanking markers;1 - by flanking markers 1579906 FHH-Adipoq^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L119P mutation is generated from the codon change CTG/CCG of rat Adipoq. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Adipoq^m3Mcwi 1579887 11 79908291 79911065 1 - by flanking markers 11 84363940 84382663 1 - by flanking markers 11 81330845 81344488 1 - by flanking markers 1579907 SS.LEW-(D10Chm128-D10Chm169)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70486334 70654393 1 - by flanking markers 10 69272915 69442411 1 - by flanking markers 10 69638898 69809020 1 - by flanking markers 1579908 SS.SR-(D9Mco95-Resp18)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80867159 82246695 1 - by flanking markers 9 81100315 82477136 1 - by flanking markers 1579909 FHH-Fgl2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA. PhysGen mutant Extinct (as of 2017-01-26) Fgl2^m1Mcwi 1579885 4 9176333 9181976 1 - by flanking markers 4 10315666 10321309 1 - by flanking markers 4 10323598 10329241 1 - by flanking markers 1579910 FHH-Ccr2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N117S mutation is generated from the codon change AAT/AGT. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccr2^m1Mcwi 1579888 8 128892784 128893905 1 - by flanking markers 1579911 SS.LEW-(D5Rat130-D5Rat72)/Mcwi SS.LEW-(D5Rat130-D5Rat72)/Mcwi This congenic strain contains a LEW chromosome 5 segment transferred to the Dahl salt sensitive background. Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee congenic Unknown 5 32701659 120983466 1 - by flanking markers 5 36590997 123028200 1 - by flanking markers 5 31926122 119125145 1 - by flanking markers 1579912 FHH-F10^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C388 Stop mutation is generated from the codon change TGC/TGA PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) F10^m2Mcwi 1579886 16 81327237 81346544 1 - by flanking markers 16 81288536 81307842 1 - by flanking markers 16 81803169 81822476 1 - by flanking markers 1579913 SS.LEW-(D10Chm224-D10Chm222)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Wox51-D10Rat27)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 76477875 1 - by flanking markers 10 74600366 76309841 1 - by flanking markers 10 75505821 75506019 1 - by flanking markers 1579914 SS.LEW-(D10Mco30-D10Got92)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 77956387 1 - by flanking markers 10 73693979 76919627 1 - by flanking markers 10 76420583 77055888 1 - by flanking markers 1580542 PCK-Pkhd1^pck/CrljCrl This model of polycystic kidney disease showing both kidney and liver involvement was identified in a colony of CD rats from the Charles River Japan production facility. The identification of the Pkhd1 gene mutation was reported by Harris and associates in 2002. This autosomal recessive Pkhd1 gene mutation is a model of human autosomal-recessive polycystic kidney disease (ARPKD). Charles River Laboratories coisogenic Unknown Pkhd1^pck 11535943 1581616 DA.ACI-(D15Rat23-D15Rat71)/Kini DA.ACI-(D15Rat23-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 83040937 85456512 1 - by flanking markers 15 87155990 89768452 1 - by flanking markers 15 83647062 86002030 1 - by flanking markers 1581617 SD-Tg(Ubc-eGFP-RNAi:Dazl)16-13Gar This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) University of Texas Southwestern Medical Center, Dallas Texas transgenic Unknown 1581618 SHRSP/Bbb This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at University of Heidelberg, Heidelburg, Germany. Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown 1581619 BN.PD-(D8Rat39-D8Rat35),SHR-(D2Mit4-D2Rat28),SHR-(D2Rat103-D2Rat107)/Cub This triple congenic strain has two segments of chr 2 spanning 53 Mb(centromeric segment) and 92 Mb (telomeric segment) from SHR and a differential segment of chr 8 of PD/Cub introgressed into BN-Lx. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 1581620 SS.SR-(D9Mco61-D9Mco27)/Mco A congenic strain derived from the progenitor strains SS and SR. Department of Physiology and Cardiovascular Genomics, Medical College of Ohio, Toledo, Ohio congenic Unknown 1581621 DA.ACI-(D15Rat6-D15Rat48)/Kini DA.ACI-(D15Rat6-D15Rat48)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 61161186 1 - by flanking markers 15 37103190 65959514 1 - by flanking markers 15 33219101 62301382 1 - by flanking markers 1581622 SD-Tg(Ubc-eGFP-RNAi:Dazl)17-9GarRrrc This transgenic strain was made by injecting the lentivirus vector into SD rat embryos. Founders were identified by PCR and then bred with wild-type SD rats. The vectors are derived from pLL3.7 and contains GFP and short hairpain RNA (shRNA) University of Texas Southwestern Medical Center, Dallas, Texas; Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-17) 1581623 LA/Humd low autotomy Low Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of low autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown 1581624 FHH-Lipe^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L347P mutation is generated from the codon change CTA/CCA. PhysGen mutant Extinct (as of 2017-01-26) Lipe^m1Mcwi 1581495 1 80663791 80682480 1 - by flanking markers 1 83511504 83530200 1 - by flanking markers 1 82248031 82266727 1 - by flanking markers 1581625 BN-Hand1^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S109G mutation is generated from the codon change AGC/GGC. PGA mutant Unknown Hand1^m1Mcwi 1581493 10 43423366 43425933 1 - by flanking markers 10 43050068 43052635 1 - by flanking markers 10 43250729 43253296 1 - by flanking markers 1581626 FHL/EurMcwi Fawn Hooded Low blood pressure The low blood pressure colony was transferred from Erasmus University to Medical College of Wisconsin, Milwaukee, USA. FHL rats do not develop hypertension or renal damage. PGA inbred Unknown 1581627 WF.WKY-(D5Uwm66-D5Uwm67)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 73080117 79919776 1 - by flanking markers 5 76105513 82897734 1 - by flanking markers 5 71940894 78777811 1 - by flanking markers 1581628 DA.ACI-(D15Rat6-D15Rat13)/Kini DA.ACI-(D15Rat 6-D15Rat13)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 43772355 1 - by flanking markers 15 37103190 51565184 1 - by flanking markers 15 33219101 47814460 1 - by flanking markers 1581629 WF.WKY-(D5Wox8-D5Uwm62)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 4291144 61238981 1 - by flanking markers 5 4498411 64739489 1 - by flanking markers 5 4525738 60225339 1 - by flanking markers 1581630 WF.WKY-(D5Uwm63-D5Uwm64)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 57848236 62299211 1 - by flanking markers 5 61271852 65886550 1 - by flanking markers 5 56733010 61370302 1 - by flanking markers 1581631 WF.WKY-(D5Uwm61-D5Uwm37)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 84434303 130527490 1 - by flanking markers 5 87362775 132652105 1 - by flanking markers 5 83268986 128812854 1 - by flanking markers 1581632 WF.WKY-(D5Uwm65-D5Uwm60)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 65553185 76159022 1 - by flanking markers 5 72838045 79426001 1 - by flanking markers 5 68395096 75274687 1 - by flanking markers 1581633 DA.ACI-(D15Rat6-D15Rat71)/Kini DA.ACI-(D15Rat6-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 32638412 85456512 1 - by flanking markers 15 37103190 89768452 1 - by flanking markers 15 33219101 86002030 1 - by flanking markers 1581634 BN-Adora2a^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C249S mutation is generated from the codon change TGT/AGT of rat Adora2a. PhysGen mutant Extinct (as of 2016-10-24) Adora2a^m1Mcwi 1581476 20 13815719 13834131 1 - by flanking markers 20 16449385 16466147 1 - by flanking markers 20 14265251 14282873 1 - by flanking markers 1581635 WKY/Bbb This WKY colony was obtained from the Japanese colony in 1974. Now this is maintained at University of Heidelberg, Heidelburg, Germany. Max - Delbruck - Center for Molecular Medicine, Germany inbred Unknown 1581636 BN-Cebpe^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E37G mutation is generated from the codon change GAG/GGG. PGA mutant Unknown Cebpe^m1Mcwi 1581494 15 32787946 32789344 1 - by flanking markers 15 37241081 37242479 1 - by flanking markers 15 33356119 33357517 1 - by flanking markers 1581637 FHH-Has1^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F55L mutation is generated from the codon change TTT/TTG. PhysGen mutant Extinct (as of 2017-01-26) Has1^m1Mcwi 1581477 1 56503365 56516133 1 - by flanking markers 1 60640270 60652067 1 - by flanking markers 1 59720612 59732409 1 - by flanking markers 1581638 DA.ACI-(D15Rat126-D15Rat71)/Kini DA.ACI-(D15Rat126-D15Rat71)/Kini This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden congenic Unknown 15 85456315 85456512 1 - by flanking markers 15 86610850 89768452 1 - by flanking markers 15 83094829 86002030 1 - by flanking markers 1581639 HAn/Humd high autotomy new Males and females of high autotomy scores from HA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown 1581640 HA/Humd high autotomy High Autotomy segregation line derived from Sabra (Wistar derived) outbred stock. Males and females of high autotomy scores were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown 1581641 WF.WKY-(D5Uwm68-D5Mit4)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 77277626 94516069 1 - by flanking markers 5 80544432 97315322 1 - by flanking markers 5 76401130 93273395 1 - by flanking markers 1581642 FHH-Ccr4^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I133V mutation is generated from the codon change ATA/GTA. PhysGen mutant Extinct (as of 2017-01-26) Ccr4^m1Mcwi 1581492 8 118883148 118884230 1 - by flanking markers 8 121843005 121848545 1 - by flanking markers 8 122530152 122535959 1 - by flanking markers 1581643 LAn/Humd low autotomy new Males and females of low autotomy scores from LA/Humd were coupled randomly. After each generation pairs were randomly selected from the available offspring from different litters. Institute of Life Sciences, Hebrew University of Jerusalem, Jerusalem, Israel segregating_inbred Unknown 1581644 FHH-Htr1a^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. C266Y mutation is generated from the codon change TGT/TAT. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Htr1a^m1Mcwi 1581496 2 36434518 36435786 1 - by flanking markers 2 55362662 55363930 1 - by flanking markers 2 36246628 36247896 1 - by flanking markers 1581645 LL/Mav In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. Laboratoire de Physiologie, 8 Avenue Rockfeller, 69373 Lyon Cedex 08, France inbred Unknown 1582184 SR/JrHsd Dahl Salt-Resistant Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. Envigo inbred Unknown 1582185 SS.SR-(D3Mco36-D3Got166)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 166484910 171009778 1 - by flanking markers 3 178896560 181074971 1 - by flanking markers 3 172850273 177366660 1 - by flanking markers 1582186 FHH.FHH.1^BN-(D1Rat183-D1Rat76)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 131123181 230411453 1 - by flanking markers 1 138077032 252243871 1 - by flanking markers 1 137083889 244992610 1 - by flanking markers 1582187 SS.SR-(D3Mco24-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 166525892 1 - by flanking markers 3 160026579 178936339 1 - by flanking markers 3 155586270 172890235 1 - by flanking markers 1582188 SS.SR-(D3Mco36-D3Mco46)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA, Rat Resource and Research Center, congenic Cryopreserved Sperm (as of 2019-02-18) 3 168983202 171009778 1 - by flanking markers 3 181074759 181830490 1 - by flanking markers 3 175283587 177366660 1 - by flanking markers 1582189 SS.SR-(D3Mco39-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 149823173 1 - by flanking markers 3 160026579 180014700 1 - by flanking markers 3 155586270 176305870 1 - by flanking markers 1582190 SS/JrHsd Dahl Salt-Sensitive Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension (Dahl, 1962), from Dr. John P. Rapp, Medical College of Ohio, Toledo,Ohio; to Harlan in 1986. Envigo inbred Unknown 1582191 FHH.FHH.1^BN-(D1Rat287-D1Rat84)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 190114247 259322833 1 - by flanking markers 1 208389496 281400240 1 - by flanking markers 1 201358068 273987019 1 - by flanking markers 1582192 SS.SR-(D3Mco36-D3Got159)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 162807724 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 1582193 FHH.FHH.1^BN-(D1Mgh13-D1Rat89)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 252340389 265343617 1 - by flanking markers 1 274224224 287349830 1 - by flanking markers 1 266793821 279986079 1 - by flanking markers 1582194 SS.SR-(D3Mco78-D3Got130)/Jr SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 149822571 164079729 1 - by flanking markers 3 160026579 177341735 1 - by flanking markers 3 155586270 171277347 1 - by flanking markers 1582195 FHH.FHH.1^BN-(D1Rat173F6B-D1Rat84)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 259322503 259322833 1 - by flanking markers 1 281400069 281400240 1 - by flanking markers 1 273986848 273987019 1 - by flanking markers 1582196 FHH.FHH.1^BN-(D1Rat234-D1Rat265)/Mcwi FHH-1^BN/Mcwi was backcrossed with FHH/EurMcwi to generate these rats. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 1 41225047 90449243 1 - by flanking markers 1 95453405 95453561 1 - by flanking markers 1 94364073 94364229 1 - by flanking markers 1598797 WF.WKY-(D10Got124-D10Rat187)/Uwm WKY/NHsd females were bred with WF/NHsd males to generate F1 males which were backcrossed with WF/NHsd females. This contains 24.7 Mb region of Mcs7 QTL. Department of Oncology, University of Wisconsin, Madison Wisconsin congenic Unknown 10 89575059 110385665 1 - by flanking markers 10 88338460 109941891 1 - by flanking markers 10 88544136 110355174 1 - by flanking markers 1598798 BBDP/WorN Diabetes prone BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) 1598799 ACI.FHH-(D1Rat384-D1Rat452)(D17Rat61-D1Arb5)(D17Rat51)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf5 QTL region of chr 17 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1598800 ACI.FHH-(D1Rat384-D1Rat156)/Eur Congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 is introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 229184432 253410500 1 - by flanking markers 1 250993318 279213254 1 - by flanking markers 1 243737319 243737466 1 - by flanking markers 1598801 ACI.FHH-(D1Mit18-D1Mit8)(D14Mit11-D14Hmgc14b)(D14Rat65-D14Rat90)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf1 QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1598802 BBDR/WorN Diabetes resistant BB rats maintained in NIH. Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. These were derived from DP rats in the fifth generation NIH Autoimmune Rat Model Repository and Dev Ctr inbred Extinct (as of 2021-02-22) 1598803 BBNB/WorN Developed from a closed colony of outbred wistar rats which spontaneously developed autoimmune diabetes mellitus at the Bio-Breeding Laboratories, Ontario. University of Massachusetts Medical Center started inbreeding these in 1977. In 1983 NIH established a reference colony from this inbred colony. NIH Autoimmune Rat Model Repository and Dev Ctr, Rat Resource and Research Center inbred Unknown (as of 2020-02-24) 1598804 WKY.GHS-(D1Rat32-D1Mit32) GHS females were crossed with WKY males and the heterozygous males were backcrossed to WKY females for 10 generations this resulted in introgressing a 100 cM region of chr 1 which contained the Hc1 QTL Department of Medicine and Physiology, University of Rochester, Rochester New York congenic Unknown 1 112148733 250430505 1 - by flanking markers 1 202649657 272443364 1 - by flanking markers 1 195598053 265002735 1 - by flanking markers 1599674 BBDP.WF-(D8Rat59-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 112242639 128970675 1 - by flanking markers 8 115112735 132425312 1 - by flanking markers 8 133272922 133273132 1 - by flanking markers 1599675 BBDP.WF-(D13Rat124-D13Mgh5)/Sunn The BBDP/WorSunn rats were crossed with inbred WF rats (that share the same MHC haplotype as BBDP/WorSunn rats but differ at the CD45 allele) obtained from Charles River. Introgression of the WF CD45 (RT7.2) allele into BBDP/WorSunn was performed by phenotypic selection of backcross breeders for >10 generations, followed by intercrossing. This led to WF RT7.2 allele introgressed onto the genetic background of BBDP rats and also called BBDP/WorSunn.WF-CD45 inbred line. Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown Ptprc 3451 13 46721037 63301552 1 - by flanking markers 13 55662705 71178960 1 - by flanking markers 13 50609228 66204630 1 - by flanking markers 1599755 F344.BN-(D16Mit5-D16Rat75) BN/Crli was crossed with F344/Crli, F1 animals were backcrossed with F344 females three times to get ~25 cM region which corresponds to Hcs4 segment Department of Biomedical Sciences, Division of Experimental Pathology and Oncology, University of Sassari, Sassari, Italy congenic Unknown 16 24131965 24132402 1 - by flanking markers 16 24112631 24112769 1 - by flanking markers 16 24228228 24228366 1 - by flanking markers 1599756 BN-Has2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y344Stop mutation is generated from the codon change TAT/TAA. PGA mutant Unknown Has2^m1Mcwi 1599566 7 93230135 93256139 1 - by flanking markers 7 97055458 97081461 1 - by flanking markers 7 96438046 96464049 1 - by flanking markers 1599757 BN-Adora2a^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q310L mutation is generated from the codon change CAG/CTG of rat Adora2a. PhysGen mutant Extinct (as of 2016-10-24) Adora2a^m2Mcwi 1599561 20 13815719 13834131 1 - by flanking markers 20 16449385 16466147 1 - by flanking markers 20 14265251 14282873 1 - by flanking markers 1599758 SS-Sod3^m1Mcwi Male founders were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. The E124D mutation was generated from the codon change GAG/GAT. PhysGen , Rat Resource and Research Center mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Sod3^m1Mcwi 1599567 14 63381447 63387180 1 - by flanking markers 14 61071304 61083776 1 - by flanking markers 14 60958583 60971143 1 - by flanking markers 1599759 GRY/Idr groggy rat Groggy (gry) mutation was found in wistar rats at the Institute for Developmental Research, Aichi, in 1991. These were moved from the Institute for Developmental Research, Aichi Human Service Center to Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University , Kyoto in September 2003. National BioResource Project for the Rat in Japan, Graduate School of Medicine, Kyoto University Institute of Laboratory Animals, Kyoto Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-12) Neurobiology Cacna1a^gry 12880382 19 25188170 25424495 1 - by flanking markers 19 36502533 36727039 1 - by flanking markers 19 25453236 25749550 1 - by flanking markers 1599760 SPRD.WKY-(D18Wox8-D18Rat44)/Ibmm SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 18 19892650 86863412 1 - by flanking markers 18 20030289 86114102 1 - by flanking markers 18 20285758 87080053 1 - by flanking markers 1599761 BN-Lcat^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D359E mutation is generated from the codon change GAC/GAG. PGA mutant Unknown Lcat^m2Mcwi 1599570 19 35781507 35784966 1 - by flanking markers 19 48780364 48783830 1 - by flanking markers 19 37913333 37916799 1 - by flanking markers 1599762 SS-Bdkrb2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E178V mutation is generated from the codon change GAA/GTA. PGA mutant Unknown Bdkrb2^m2Mcwi 1599568 6 129744781 129748851 1 - by flanking markers 6 138615812 138622272 1 - by flanking markers 6 129399468 129429676 1 - by flanking markers 1599763 SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm SPRD/HanZtm were crossed with WKY/Han and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 5 24978084 24978263 1 - by flanking markers 5 29109097 29109277 1 - by flanking markers 1599764 COP.DA-(D16Rat12-D16Rat90)/Mco Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 16 350121 85734479 1 - by flanking markers 16 1084304 85597057 1 - by flanking markers 16 1090054 86162972 1 - by flanking markers 1599765 SS-Klf4^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I150N mutation is generated from the codon change ATC/AAC. PGA mutant Unknown Klf4^m2Mcwi 1599559 5 73446928 73451286 1 - by flanking markers 5 76447643 76452001 1 - by flanking markers 5 72283311 72287669 1 - by flanking markers 1599766 SS-Hps6^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. L67R mutation is generated from the codon change CTG/CGG. PGA mutant Unknown Hps6^m1Mcwi 1599564 1 251226344 251228953 1 - by flanking markers 1 273191755 273194364 1 - by flanking markers 1 265761818 265764427 1 - by flanking markers 1599767 SS-Htr1a^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G76R mutation is generated from the codon change GGC/CGC. PGA mutant Unknown Htr1a^m2Mcwi 1599562 2 36434518 36435786 1 - by flanking markers 2 55362662 55363930 1 - by flanking markers 2 36246628 36247896 1 - by flanking markers 1599768 SS-Klf4^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V243I mutation is generated from the codon change GTC/ATC. PGA mutant Unknown Klf4^m1Mcwi 1599569 5 73446928 73451286 1 - by flanking markers 5 76447643 76452001 1 - by flanking markers 5 72283311 72287669 1 - by flanking markers 1599769 COP.DA-(D3Rat233-D3Mgh14)/Mco Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. University of Toledo College of Medicine, Toledo, Ohio congenic Unknown 3 118863100 118863223 1 - by flanking markers 3 130198712 130198834 1 - by flanking markers 3 123700322 123700444 1 - by flanking markers 1600337 F344.GK-(D1Mgh14-D1Rat90)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 263698966 267111153 1 - by flanking markers 1 285604773 289137268 1 - by flanking markers 1 278228767 281795785 1 - by flanking markers 1600338 SHR.F344-(D12Mgh5-D12Mgh6)/Snk Segment of chr 12 was introgressed from normotensive F344/Snk into SHR/Snk by the speed congenic technique Medicinal Safety Research Laboratories, Sankyo Co. Ltd., Shizuoka, Japan congenic Unknown 12 29130180 42387195 1 - by flanking markers 12 33647399 33647522 1 - by flanking markers 12 31723565 31723688 1 - by flanking markers 1600339 BN.GK-(D1Wox18-D1Got254)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 1 94626541 264367394 1 - by flanking markers 1 101198387 286341689 1 - by flanking markers 1 100133276 278978026 1 - by flanking markers 1600340 DA/BklArbNsi Originally purchased from Bantin and Kingman, Fremont, California, maintained at the National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH. This was then transferred to Feinstein Institute for Medical Research at North Shore-LIJ, which was formerly known as North Shore-LIJ Research Institute, NSI. Feinstein Institute for Medical Research at North Shore-LIJ, Manhasset, NY, Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 1600341 LEW-Tg(Ren2)27/Jmul This is a transgenic hypertensive rat strain, the mouse Ren2, renin gene is microinjected into fertilized eggs of LEW/Crl rats Wake Forest University School of Medicine, Winston-Salem, North Carolina transgenic Unknown 1600342 F344.GK-(D1Got250-D1Rat90)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 259168938 267111153 1 - by flanking markers 1 281200731 289137268 1 - by flanking markers 1 273787505 281795785 1 - by flanking markers 1600343 SHRSP.WKY-(D1Wox29-D1Arb21)/Izm This congenic strain contains an WKY/Izm chromsome 1 segment containing a blood pressure QTL transferred to a SHRSP/Izm background by using speed congenic strategy National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 1600344 F344.GK-(D1Rat175-D1Rat90)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 267110921 267111153 1 - by flanking markers 1 289137107 289137268 1 - by flanking markers 1 281795624 281795785 1 - by flanking markers 1600345 F344.GK-(D1Rat83-D1Rat376)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 252133623 252133935 1 - by flanking markers 1 274017004 274017147 1 - by flanking markers 1 266587077 266587220 1 - by flanking markers 1600346 F344.GK-(D1Swe4-D1Rat85)/Swe This is a congenic substrain derived by intercrossing female F344/Crl and male F344.GK-(D1Arb42a-D1Rat90)/Swe. F2 progeny carried the homozygous GK/Swe genome in different segments. These were then maintained by bxs breeding. Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 255386328 258599658 1 - by flanking markers 1 277075545 280845045 1 - by flanking markers 1 269633949 273433763 1 - by flanking markers 1600490 SS-Chr 1^BN/Mcwi A cross of SS and BN strains which results in a SS genomic background with a BN chromosome introgressed PhysGen consomic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 1625284 Wild1/Hubr This rat was caught in the canals of Utrecht, The Netherlands and sacrificed for DNA isolation Hubrecht Laboratory, Utrecht, The Netherlands wild Unknown 1626207 BN-Adora2a^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. E207K mutation is generated from the codon change GAG/AAG of rat Adora2a. PhysGen mutant Extinct (as of 2016-10-24) Adora2a^m3Mcwi 1642070 20 13815719 13834131 1 - by flanking markers 20 16449385 16466147 1 - by flanking markers 20 14265251 14282873 1 - by flanking markers 1626210 BN-Lipe^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Q52L mutation is generated from the codon change CTG/CAG. PGA mutant Unknown Lipe^m2Mcwi 1642169 1 80663791 80682480 1 - by flanking markers 1 83511504 83530200 1 - by flanking markers 1 82248031 82266727 1 - by flanking markers 1626211 SS-Cpf2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. PGA mutant Unknown 1626213 BN-Oxtr^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F225Y mutation is generated from the codon change TTC/TAC. PGA mutant Unknown Oxtr^m1Mcwi 1642173 4 148314089 148326797 1 - by flanking markers 4 207701360 207717840 1 - by flanking markers 4 144399326 144417598 1 - by flanking markers 1626214 BN-Slc27a5^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K160E mutation is generated from the codon change AAA/GAA. PGA mutant Unknown Slc27a5^m2Mcwi 1642170 1 72924630 72935223 1 - by flanking markers 1 66387832 66398425 1 - by flanking markers 1 65576599 65587192 1 - by flanking markers 1641831 MWF-Chr 6^SHR/Rkb MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown 1641849 SS.LEW-(D10Mit1-D10Mgh1)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 95368898 95369088 1 - by flanking markers 10 93929621 93929812 1 - by flanking markers 1641850 SHR.WKY-(D1Got158-D1Got161)/Njs This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region Department of Cardiovascular Sciences , University of Leicester, Glenfield Hospital, UK congenic Unknown Spon1 619918 1 169571535 169571693 1 - by flanking markers 1 183593063 183593220 1 - by flanking markers 1 176611942 176612099 1 - by flanking markers 1641851 SHR.PD-(D8Rat42-D8Arb23)/Cub A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv by narrowing down the segment in SHR-Lx strain Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16^Lx 727921|12910834 8 51376771 52822796 1 - by flanking markers 8 51046971 52459221 1 - by flanking markers 8 52446316 53840120 1 - by flanking markers 1641852 WF.BBDR-(D4Got48-D4Got43)/Wor This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown 4 65628995 68036772 1 - by flanking markers 4 65594194 133430955 1 - by flanking markers 4 65776688 68645203 1 - by flanking markers 1641853 SS.LEW-(D10Mco38-D10Mgh1)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 65122086 1 - by flanking markers 10 65339106 66856515 1 - by flanking markers 1641854 HAS.LAS-(D5Rat70-D5Rat37)/Rar HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado congenic Unknown 5 36386126 148460381 1 - by flanking markers 5 40446731 151220567 1 - by flanking markers 5 35788756 147487820 1 - by flanking markers 1641855 BBDP.WF-(D8Rat73-D8Rat20)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 94870319 1 - by flanking markers 8 94761016 96840283 1 - by flanking markers 8 95257972 97339444 1 - by flanking markers 1641856 P.NP-(D4Rat119-D4Rat55)/Iusm P and NP rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 1641857 BBDP.WF-(D8Rat16-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 98878516 128970675 1 - by flanking markers 8 100780886 132425312 1 - by flanking markers 8 101304999 133273132 1 - by flanking markers 1641858 SHR.WKY-(D1Rat420-D1Rat278)/Njs This is a congenic substrain developed by crossing SHR.WKY-(D1Wox34-D1Rat164)/Njs to SHR to get F2 which were again crossed with SHR to duplicate the recombinant region Department of Cardiovascular Sciences, University of Leicester, Glenfield Hospital, UK congenic Unknown 1 167931247 168930831 1 - by flanking markers 1 181904343 182965674 1 - by flanking markers 1 174905726 175980872 1 - by flanking markers 1641859 SS.MNS-(D10Bra1-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 101848470 101848683 1 - by flanking markers 1641860 SS.MNS-(D10Mco62-D10Mit1)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 95369088 1 - by flanking markers 10 70763267 93929812 1 - by flanking markers 1641861 HAS.LAS-(D2Rat53-D2Rat138)/Rar HAS1 (RGD:1578700) and LAS1(RGD:1578696) rats were reciprocally mated to produce an F1 generation. Congenics were bred by backcrossing F1 male to HAS1 and the offsprings were genotyped, Department of Pharmaceutical Sciences, University of Colorado at Denver, Denver, Colorado, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 2 204077549 230157845 1 - by flanking markers 2 230770662 256283467 1 - by flanking markers 2 211301116 237742948 1 - by flanking markers 1641862 F344-Apc^Pirc/Uwm Male F344/NTac rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were screened. A to T transversion at nucleotide 3409 of the coding sequence. (AAG.TAG) Amino acid 1137 (K.Xam) University of Wisconsin-Madison, Madison, Wisconsin, Rat Resource and Research Center mutant Live Animals; Cryopreserved Sperm (as of 2018-07-16) Apc^Pirc 1554322 18 26732147 26790383 1 - by flanking markers 18 26725560 26820837 1 - by flanking markers 18 27011710 27106323 1 - by flanking markers 1641863 SHR.PD-(D8Mgh9-D8Rat149)/Cub A differential segment of chr 8 from PD/Cub is introgressed onto the genetic background of SHR/OlaIpcv. Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown Zbtb16|Zbtb16^Lx 727921|12910834 8 58692901 58693265 1 - by flanking markers 8 58297648 58297798 1 - by flanking markers 8 59716199 59716349 1 - by flanking markers 1641864 WF/CrCrli J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a high leukemia rat strain. To Charles River in 1998 from the National Cancer Institute. Charles River Laboratories Italy inbred Unknown 1641865 SD-Brca2^m1Uwm 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. Nonsense transversion mutation at nucleotide T4254 that converted TAT (tyrosine) to TAA (stop codon). University of Wisconsin-Madison, Madison, Wisconsin, Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca2^m1Uwm 728326 12 4282952 4323693 1 - by flanking markers 12 490733 535090 1 - by flanking markers 12 503660 544754 1 - by flanking markers 1641866 SS.LEW-(D10Mit10-D10Rat24)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 27184741 79229233 1 - by flanking markers 10 27082535 78195122 1 - by flanking markers 10 27237530 78343192 1 - by flanking markers 1641867 P/Iusm alcohol-preferring These were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Snca 3729 1641868 WF.BBDR-(D4Rat93-D4Rat228)/Wor This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown Tcrb 3834 4 67390393 67390598 1 - by flanking markers 4 67470286 67470490 1 - by flanking markers 4 67663300 67663504 1 - by flanking markers 1641869 SS.MNS-(D10Mco31-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 84284413 101848683 1 - by flanking markers 10 83219971 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 1641870 BBDP.WF-(D8Rat73-D8Rat121)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 118705380 1 - by flanking markers 8 94761016 121648073 1 - by flanking markers 8 95257972 95258175 1 - by flanking markers 1641871 SS.MNS-(D10Mco62-D10Mco31)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 84284667 1 - by flanking markers 10 70763267 83220224 1 - by flanking markers 10 83411403 83411656 1 - by flanking markers 1641872 SS.LEW-(D10Mco38-D10Mco41)/Jr This is a congenic substrain developed by crossing SS.LEW-(D10Mit10-D10Mgh1/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 65068360 85793448 1 - by flanking markers 10 65339106 84798381 1 - by flanking markers 10 85007626 85007896 1 - by flanking markers 1641873 NP/Iusm alcohol-nonpreferring These were developed at Indiana University for low-alcohol-preferring behavior through bidirectional selective breeding of Wistar rats. At 30th generation these were intercrossed to generate the substrains. Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana inbred Unknown Snca 3729 1641874 BBDP.WF-(D8Rat73-D8Rat90)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 114974688 1 - by flanking markers 8 94761016 118204000 1 - by flanking markers 8 95257972 118862813 1 - by flanking markers 1641875 SHR-Chr Y^BN/Cub BN-Lx/Cub males were crosssed with SHR/OlaIpcv females to get F1 animals, the hybrid animals were backcrossed with female SHR/OlaIpcv for 8 generations Czech Academy of Sciences, Prague, Czech Republic consomic Unknown 1641876 BBDP.WF-(D8Rat73-D8Sunn1467)/Sunn WF RT7.2 allele was introgressed onto the genetic background of BBDP rats and these were crossed with BBDP Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 8 92863340 128970675 1 - by flanking markers 8 94761016 132425312 1 - by flanking markers 8 95257972 133273132 1 - by flanking markers 1641877 NP.P-(D4Rat119-D4Rat55)/Iusm Male P and female NP rats were backcrossed to get F1 animals which were further backcrossed to NP rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown Akr1b1|Npy|Snca|Grid2|Dgki|Zfp212|Ppm1k|Sos1|Baiap1 2092|3197|3729|68368|735049|1307836|1308501|1310949|1311418 4 62832008 127941994 1 - by flanking markers 4 190188458 190188644 1 - by flanking markers 4 62947687 125671711 1 - by flanking markers 1641878 WF.BBDR-(Clcn1-D4Rat228)/Wor This congenic substrain was generated by the marker-assisted protocol where a segment of WF.BBDR-(D4Rat96-D4Rat44)/Wor were transferred to WF background and the animals were screened using microsatellite markers. University of Massachusetts Medical School, Worcerster, MA congenic Unknown Clcn1 2360 4 70052319 70081449 1 - by flanking markers 4 136479719 136509472 1 - by flanking markers 4 71674218 71704318 1 - by flanking markers 1641879 SS-Chr 19^SHR/Rkb SS/JrRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female SS/JrRkb to preserve the Y chromosome, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown 1641880 SD-Brca1^m1Uwm 9 week-old male rats were injected with ENU (N-ethyl-N-nitrosourea) and then bred. Phenotypically variant pups were visually identified and screened. mutation from A to G at the exon 21/22 border causes a frameshift and premature stop codon. University of Wisconsin-Madison, Madison, Wisconsin, Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-12-01) Brca1|Brca1^m1Uwm 2218|728298 10 90513630 90572676 1 - by flanking markers 10 89192653 89252760 1 - by flanking markers 10 89394821 89455093 1 - by flanking markers 1642017 BBDR/WorBrm Diabetes resistant BB rats maintained in BRM. This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. These are derived from a viral antibody free (VAF)colony which was maintained at University of Massachusetts and is now at Biomedical Research Models, Inc. Biomedical Research Models, Inc. inbred Unknown 1642018 BBDP/WorBrm This strain has been maintained by brother and sister mating for 40 generations. These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Biomedical Research Models, Inc. got these from Worcester. Biomedical Research Models, Inc. inbred Unknown 1642036 SHR/OlaIpcv-mt^BN/Crl Mitochodrial genome of SHR/OlaIpcv was selectively replaced by BN/Crl to create this conplastic strain using the supersonic breeding strategy; these have the mitochondrial genome of BN/Crl on SHR/OlaIpcv nuclear genetic background Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic conplastic Unknown 1642269 SS-Birc3^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K170E mutation is generated from the codon change AAG/GAG. PhysGen mutant Extinct (as of 2017-01-26) Birc3^m2Mcwi 1642178 8 4682202 4696856 1 - by flanking markers 8 6047454 6075236 1 - by flanking markers 8 6048590 6076828 1 - by flanking markers 1642270 BN-Lcat^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H316N mutation is generated from the codon change CAC/AAC. PGA , Rat Resource & Research Center mutant Cryopreserved Sperm; Cryorecovery Lcat^m3Mcwi 1642175 19 35781507 35784966 1 - by flanking markers 19 48780364 48783830 1 - by flanking markers 19 37913333 37916799 1 - by flanking markers 1642271 SS-Klf4^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H344L mutation is generated from the codon change CAT/CTT. PhysGen , Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klf4^m3Mcwi 1642179 5 73446928 73451286 1 - by flanking markers 5 76447643 76452001 1 - by flanking markers 5 72283311 72287669 1 - by flanking markers 1642272 SS.LEW-(D10Mco84-D10Got93)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 72827158 1 - by flanking markers 10 69542746 71779712 1 - by flanking markers 10 69910832 71870652 1 - by flanking markers 1642273 SS-Thbd^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N256K mutation is generated from the codon change AAC/AAA. PhysGen mutant Extinct (as of 2017-01-26) Thbd^m1Mcwi 1642182 3 137158955 137162607 1 - by flanking markers 3 149159895 149163547 1 - by flanking markers 3 142748673 142752325 1 - by flanking markers 1642274 SS-Has1^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V155L mutation is generated from the codon change GTC/CTC. PhysGen mutant Extinct (as of 2017-01-26) Has1^m2Mcwi 1642171 1 56503365 56516133 1 - by flanking markers 1 60640270 60652067 1 - by flanking markers 1 59720612 59732409 1 - by flanking markers 1642275 SS.LEW-(D10Rat29-D10Mco88)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Rat29-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 71513333 1 - by flanking markers 10 67642121 71109330 1 - by flanking markers 10 67988035 70647306 1 - by flanking markers 1642276 SS-Kcna5^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N152K mutation is generated from the codon change AAT/AAA. PhysGen , Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcna5^m1Mcwi 1642177 4 162896283 162898091 1 - by flanking markers 4 226075051 226076859 1 - by flanking markers 4 159077195 159079003 1 - by flanking markers 1642277 SS-Cpt2^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. F475L mutation is generated from the codon change TTC/CTC. PhysGen , Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cpt2^m1Mcwi 1642174 5 129007685 129025501 1 - by flanking markers 5 131353542 131370821 1 - by flanking markers 5 127505646 127523016 1 - by flanking markers 1642278 SS-Ghsr^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S342P mutation is generated from the codon change TCC/CCC. PhysGen mutant Extinct (as of 2017-01-26) Ghsr^m2Mcwi 1642180 2 113269623 113272999 1 - by flanking markers 2 132784207 132789319 1 - by flanking markers 2 113065953 113071265 1 - by flanking markers 1642279 SS.LEW-(D10Arb9-D10Rat161)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 97589703 1 - by flanking markers 10 66048908 96133217 1 - by flanking markers 10 65590122 65590250 1 - by flanking markers 1642281 SS-Podxl^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA. PhysGen mutant Extinct (as of 2017-01-26) Podxl^m1Mcwi 1642176 4 58611904 58658598 1 - by flanking markers 4 58581513 58645671 1 - by flanking markers 4 58829049 58893353 1 - by flanking markers 1642282 SS-Cacna1g^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. S490T mutation is generated from the codon change TCT/ACT. PGA mutant Unknown Cacna1g^m1Mcwi 1642168 10 83043636 83112886 1 - by flanking markers 10 81950594 82017885 1 - by flanking markers 10 82129071 82197828 1 - by flanking markers 1642283 SS.LEW-(D10Rat29-D10Got93)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 68842878 72827158 1 - by flanking markers 10 67642121 71779712 1 - by flanking markers 10 67988035 71870652 1 - by flanking markers 1642284 SS-Fgl2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. K129N mutation is generated from the codon change AAG/AAT. PGA mutant Unknown Fgl2^m2Mcwi 1642181 4 9176333 9181976 1 - by flanking markers 4 10315666 10321309 1 - by flanking markers 4 10323598 10329241 1 - by flanking markers 1642285 SS.LEW-(D10Arb9-D10Rat57)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 74388696 1 - by flanking markers 10 66048908 73484175 1 - by flanking markers 10 65590122 73582866 1 - by flanking markers 1642287 SS.LEW-(D10Arb9-D10Mco84)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 64308668 70757419 1 - by flanking markers 10 66048908 69542910 1 - by flanking markers 10 65590122 69910996 1 - by flanking markers 1642288 SS.LEW-(D10Mco89-D10Got101)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Arb9-D10Got101)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72684998 78262332 1 - by flanking markers 10 71638135 77223025 1 - by flanking markers 10 71727774 77360263 1 - by flanking markers 1642289 SS-Serpina5^m1Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H24R mutation is generated from the codon change CAT/CGT. PGA mutant Unknown Serpina5^m1Mcwi 1642167 6 128156901 128161334 1 - by flanking markers 6 136972583 136990812 1 - by flanking markers 6 127753152 127772403 1 - by flanking markers 1642362 SS-Has1^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. D167D mutation is generated from the codon change GAT/GAC. PGA mutant Unknown Has1^m3Mcwi 1642359 1 56503365 56516133 1 - by flanking markers 1 60640270 60652067 1 - by flanking markers 1 59720612 59732409 1 - by flanking markers 1642363 BN-Fgl2^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N353H mutation is generated from the codon change AAT/CAT. PGA mutant Unknown Fgl2^m3Mcwi 1642355 4 9176333 9181976 1 - by flanking markers 4 10315666 10321309 1 - by flanking markers 4 10323598 10329241 1 - by flanking markers 1642364 SS-Ghsr^m3Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. N26K mutation is generated from the codon change AAC/AAA. PhysGen , Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ghsr^m3Mcwi 1642357 2 113269623 113272999 1 - by flanking markers 2 132784207 132789319 1 - by flanking markers 2 113065953 113071265 1 - by flanking markers 1642365 SS-Fgl2^m4Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. H338P mutation is generated from the codon change CAT/CCT. PhysGen , Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fgl2^m4Mcwi 1642354 4 9176333 9181976 1 - by flanking markers 4 10315666 10321309 1 - by flanking markers 4 10323598 10329241 1 - by flanking markers 1642366 SS-Lcat^m4Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT. PhysGen , Rat Resource & Research Center mutant Extinct (as of 2017-01-26) Lcat^m4Mcwi 1642358 19 35781507 35784966 1 - by flanking markers 19 48780364 48783830 1 - by flanking markers 19 37913333 37916799 1 - by flanking markers 1642367 BN-Ccr2^m2Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. I99T mutation is generated from the codon change ATC/ACC. PhysGen mutant Extinct (as of 2017-01-26) Ccr2^m2Mcwi 1642356 8 128892784 128893905 1 - by flanking markers 1642439 SS-Lcat^m5Mcwi Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y297Stop mutation is generated from the codon change TAC/TAA. PhysGen , Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lcat^m5Mcwi 1642438 19 35781507 35784966 1 - by flanking markers 19 48780364 48783830 1 - by flanking markers 19 37913333 37916799 1 - by flanking markers 1642689 BN.OLETF-(D1Rat169-D1Rat90)/Got OLETF/Got females were crossed with BN/Crlj to produce F₁ which were backcrossed to BN/Crlj, animals with Dmo1 locus (~28.8 cM) were genotyped Otsuka Pharmacuetical Company, Tokushima, Japan congenic Unknown Prlhr 71037 1 229876870 267111153 1 - by flanking markers 1 251652807 289137268 1 - by flanking markers 1 244401175 281795785 1 - by flanking markers 1642690 LA-cp/NJcr Originated from a cross between ALB/N and a hooded stock of unknown origin; maintained at University of Alberta. Department of Surgery, University of Alberta, Edmonton, Canada congenic Unknown 1642968 SS.LEW-(D10Mco84-D10Rat58)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 71067824 1 - by flanking markers 10 69542746 70966782 1 - by flanking markers 10 69910832 70202084 1 - by flanking markers 1642969 SS.LEW-(D10Mco84-D10Mco134)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 1642970 SS.LEW-(D10Mco113-D10Got93)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72827032 72827158 1 - by flanking markers 10 71779587 71779712 1 - by flanking markers 10 71870527 71870652 1 - by flanking markers 1642971 SS.LEW-(D10Mco84-D10Mco129)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 1642972 SS.LEW-(D10Mco84-D10Mco143)/Mco This is a congenic substrain developed by crossing SS.LEW-(D10Mco84-D10Got93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 70757255 70757419 1 - by flanking markers 10 69542746 69542910 1 - by flanking markers 10 69910832 69910996 1 - by flanking markers 1642989 SS-Tg(CAG-EGFP)1Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Cryopreserved Sperm (as of 2019-04-04) 1642990 SD-Tg(CAG-EGFP)63Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1642991 SS-Tg(CAG-eGFP)18Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1642992 SS-Tg(CAG-EGFP)28Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1642993 SD-Tg(CAG-EGFP)97Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SD rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1642994 SS-Tg(CAG-EGFP)43Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1642995 SS-Tg(CAG-eGFP)10Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1642996 SS-Tg(CAG-EGFP)2Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1642997 SS-Tg(CAG-EGFP)23Mcwi This transgenic strain contains the enhanced green fluorescent protein gene drived by ubiquitous CAG promoter. This vector contains long terminal repeats with self-inactivating mutation, a central polypurine tract of HIV-1, a human cytomegalovirus and a composite intron from rabbit beta-globin. This transgenic strain was made by injecting the lentivirus vector containing the eGFP construct (lentiviral-CAG-eGFP) into SS rat embryos. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 1643001 FH/Unc Fawn-hooded A substrain of fawn hooded rat, maintained at Universtiy of North Carolina, Chapel Hill Department of Psychiatry, University of North Carolina, Chapel Hill, North Carolina inbred Unknown 1643002 SHR.WKY-(D1Rat420-D1Got161)/Njs Fragment of the chromosome 1 derived from WKY and repeated backcross to SHR Dept. Cardiology, Univ of Leicester, Clinical Sciences Wing. Glenfield Hospital, Groby Rd, Leicester, UK congenic Unknown Spon1 619918 1 167931247 167931390 1 - by flanking markers 1 181904343 181904486 1 - by flanking markers 1 174905726 174905869 1 - by flanking markers 1643007 DA.ACI-(D12Wox12-D12Rat53)/Arb ACI/SegHsd and DA/OlaHsd were crossed to get F₂ animals which were backcrossed with DA/OlaHsd and the progeny genotyped then backcrossed with DA/OlaHsd The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 12 20932555 43863270 1 - by flanking markers 12 24663002 50380790 1 - by flanking markers 12 22650721 48598906 1 - by flanking markers 1643010 F344.OLETF-(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj double congenic strain generated by intercrossing F344.OLETF-(D7Rat18-D7Mit2)/Tj and F344.OLETF-(D14Rat23-D14Rat12)/Tj and F₂ rats screened for homozygosity University of Tokushima Graduate School, Kuramato-cho, Tokushima, Japan congenic Unknown 2289819 SS.MNS-(D10Mco62-D10Got99)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 76465800 1 - by flanking markers 10 70763267 74612561 1 - by flanking markers 10 75493824 75493944 1 - by flanking markers 2289820 SS.MNS-(D10Mco30-D10Got91)/1Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 2289821 SS.MNS-(D10Mco30-D10Got91)/3Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 2289822 SS.MNS-(D10Mco30-D10Got112)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 79857935 1 - by flanking markers 10 73693979 78816367 1 - by flanking markers 10 76420583 78970405 1 - by flanking markers 2289823 SS.MNS-(D10Mco62-D10Mco30)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10M11Mit119-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 72063231 77547622 1 - by flanking markers 10 70763267 73694285 1 - by flanking markers 10 76420583 76420889 1 - by flanking markers 2289824 SS.MNS-(D10Mco30-D10Got101)/Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78262332 1 - by flanking markers 10 73693979 77223025 1 - by flanking markers 10 76420583 77360263 1 - by flanking markers 2289825 SS.MNS-(D10Rat24-D10Mco31)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 79229067 84284667 1 - by flanking markers 10 78194957 83220224 1 - by flanking markers 10 78343027 83411656 1 - by flanking markers 2289826 SS.MNS-(D10Mco30-D10Got91)/2Mco This is a congenic substrain developed by crossing SS.MNS-(D10Mco30-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 78112169 1 - by flanking markers 10 73693979 77074440 1 - by flanking markers 10 76420583 77211758 1 - by flanking markers 2289827 SS.MNS-(D10Mco30-D10Mco31)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Mco62-D10Mco31)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 10 77547289 84284667 1 - by flanking markers 10 73693979 83220224 1 - by flanking markers 10 76420583 83411656 1 - by flanking markers 2289913 SS.MNS-(D10Rat13-D10Rat12)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic Unknown 10 97152234 99198997 1 - by flanking markers 10 95701164 97759008 1 - by flanking markers 10 95967019 98044833 1 - by flanking markers 2289916 SS.MNS-(D10Mco15-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic Unknown 10 98392296 101848683 1 - by flanking markers 10 97028717 97028928 1 - by flanking markers 10 97308358 97308569 1 - by flanking markers 2289917 SS.MNS-(D10Mco70-D10Mit11)/Jr This is a congenic substrain developed by crossing SS.MNS-(D10Rat13-D10Mit11)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo congenic Unknown 10 101355656 101848683 1 - by flanking markers 10 99976910 99977168 1 - by flanking markers 10 100287441 100287699 1 - by flanking markers 2290056 F344-Elmod3^{Tn(sb-T2/Bart3)2.42Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4^th intron of the Rbed1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Elmod3^{Tn(sb-T2/Bart3)2.42Mcwi} 2290055 4 105866419 106099850 1 - by flanking markers 4 165192607 165237016 1 - by flanking markers 4 100422256 100465152 1 - by flanking markers 2290057 F344-TgTn(T2/Bart3)1Ceb The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. PGA transgenic Cryopreserved Sperm 2290064 F344-Trpc4^{Tn(sb-T2/Bart3)2.192Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Trpc4^{Tn(sb-T2/Bart3)2.192Mcwi} 2290060 2 143350286 143485716 1 - by flanking markers 2 163115873 163282223 1 - by flanking markers 2 143433102 143605757 1 - by flanking markers 2290065 F344-CA338503^{Tn(sb-T2/Bart3)2.196Mcwi} this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD: 2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). PGA mutant Unknown CA338503^{Tn(sb-T2/Bart3)2.196Mcwi} 2290059 2290066 F344-Nell1^{Tn(sb-T2/Bart3)2.195Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the second intron of the Nell1. PGA mutant Unknown Nell1^{Tn(sb-T2/Bart3)2.195Mcwi} 2290061 1 99805922 100758002 1 - by flanking markers 1 106397933 107260905 1 - by flanking markers 1 105348577 106218970 1 - by flanking markers 2290067 F344-BI285226^{Tn(sb-T2/Bart3)2.193Mcwi} this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). PGA mutant Unknown BI285226^{Tn(sb-T2/Bart3)2.193Mcwi} 2290062 2290078 F344-Myo9a^{Tn(sb-T2/Bart3)2.186Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Myo9a gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Myo9a^{Tn(sb-T2/Bart3)2.186Mcwi} 2290068 8 63578001 63783813 1 - by flanking markers 8 64335907 64534890 1 - by flanking markers 8 64573248 64777607 1 - by flanking markers 2290079 F344-BI285226^{Tn(sb-T2/Bart3)2.194Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI285226^{Tn(sb-T2/Bart3)2.194Mcwi} 2290069 2290080 F344-BI284938^{Tn(sb-T2/Bart3)2.187Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI284938^{Tn(sb-T2/Bart3)2.187Mcwi} 2290074 2290081 F344-BI284934^{Tn(sb-T2/Bart3)2.185Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource & Research Center mutant Cryopreserved Sperm BI284934^{Tn(sb-T2/Bart3)2.185Mcwi} 2290072 2290082 F344-Brinp3^{Tn(sb-T2/Bart3)2.189Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Brinp3 gene. PhysGen , Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Brinp3^{Tn(sb-T2/Bart3)2.189Mcwi} 2290071 13 60584348 61024196 1 - by flanking markers 13 68507826 68938032 1 - by flanking markers 13 63526486 63959390 1 - by flanking markers 2290083 F344-Slc24a3^{Tn(sb-T2/Bart3)2.188Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene. PGA mutant Unknown Slc24a3^{Tn(sb-T2/Bart3)2.188Mcwi} 2290073 3 133734890 134249326 1 - by flanking markers 3 145760074 146259491 1 - by flanking markers 3 139333942 139835728 1 - by flanking markers 2290100 F344-Entpd6^{Tn(sb-T2/Bart3)2.174Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1^st intron of the Entpd6 gene. PGA mutant Unknown Entpd6^{Tn(sb-T2/Bart3)2.174Mcwi} 2290086 3 141385480 141407860 1 - by flanking markers 3 152905464 152927857 1 - by flanking markers 3 146546424 146568828 1 - by flanking markers 2290101 F344-CB706876^{Tn(sb-T2/Bart3)2.181Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown CB706876^{Tn(sb-T2/Bart3)2.181Mcwi} 2290092 2290102 F344-Klhl13^{Tn(sb-T2/Bart3)2.176Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Klhl13 gene. PGA mutant Unknown Klhl13^{Tn(sb-T2/Bart3)2.176Mcwi} 2290085 X 10344050 10424665 1 - by flanking markers X 121716856 121876640 1 - by flanking markers X 121578965 121735014 1 - by flanking markers 2290103 F344-Nrg1^{Tn(sb-T2/Bart3)2.183Mcwi} this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb and F344-Tg(PGK2-sb11)Ceb. This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Nrg1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrg1^{Tn(sb-T2/Bart3)2.183Mcwi} 2290090 16 63937796 64126183 1 - by flanking markers 16 62632432 63718738 1 - by flanking markers 16 62969573 64065063 1 - by flanking markers 2290104 F344-Cadm2^{Tn(sb-T2/Bart3)2.180Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Cadm2 gene. PGA mutant Unknown Cadm2^{Tn(sb-T2/Bart3)2.180Mcwi} 2290088 11 4273771 5330393 1 - by flanking markers 11 7871257 8090100 1 - by flanking markers 11 4175078 4397335 1 - by flanking markers 2290105 F344-Sptbn4^{Tn(sb-T2/Bart3)2.179Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. PGA mutant Unknown Sptbn4^{Tn(sb-T2/Bart3)2.179Mcwi} 2290097 1 82436626 82523827 1 - by flanking markers 1 85379609 85467354 1 - by flanking markers 1 84168494 84254679 1 - by flanking markers 2290106 F344-BQ195794^{Tn(sb-T2/Bart3)2.182Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BQ195794^{Tn(sb-T2/Bart3)2.182Mcwi} 2290070 2290107 F344-Cyss^{Tn(sb-T2/Bart3)2.173Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1^st intron of the Cyss gene. PGA mutant Unknown Cyss^{Tn(sb-T2/Bart3)2.173Mcwi} 2290095 3 138826625 138830963 1 - by flanking markers 3 150801395 150805733 1 - by flanking markers 3 144427430 144431768 1 - by flanking markers 2290108 F344-LOC290071^{Tn(sb-T2/Bart3)2.170Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the LOC290071 gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) LOC290071^{Tn(sb-T2/Bart3)2.170Mcwi} 2290089 15 30634899 32273880 1 - by flanking markers 2290109 F344-CA338503^{Tn(sb-T2/Bart3)2.168Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown CA338503^{Tn(sb-T2/Bart3)2.168Mcwi} 2290087 2290110 F344-Lims1^{Tn(sb-T2/Bart3)2.169Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Lims1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lims1^{Tn(sb-T2/Bart3)2.169Mcwi} 2290096 20 37349188 37397427 1 - by flanking markers 20 29715580 29824252 1 - by flanking markers 20 27895981 28004767 1 - by flanking markers 2290111 F344-Cst3^{Tn(sb-T2/Bart3)2.172Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1^st intron of the Cst3 gene. PGA mutant Unknown Cst3^{Tn(sb-T2/Bart3)2.172Mcwi} 2290093 3 137650903 137654776 1 - by flanking markers 3 149628692 149632565 1 - by flanking markers 3 143219671 143223544 1 - by flanking markers 2290112 F344-CA338503^{Tn(sb-T2/Bart3)2.175Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown CA338503^{Tn(sb-T2/Bart3)2.175Mcwi} 2290094 2290113 F344-Fam19a2^{Tn(sb-T2/Bart3)2.184Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam19a2 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam19a2^{Tn(sb-T2/Bart3)2.184Mcwi} 2290098 7 63388665 63566226 1 - by flanking markers 7 66221368 66695803 1 - by flanking markers 7 66017066 66496690 1 - by flanking markers 2290114 F344-Slc24a3^{Tn(sb-T2/Bart3)2.178Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Slc24a3 gene. PGA mutant Unknown Slc24a3^{Tn(sb-T2/Bart3)2.178Mcwi} 2290091 3 133734890 134249326 1 - by flanking markers 3 145760074 146259491 1 - by flanking markers 3 139333942 139835728 1 - by flanking markers 2290135 F344-Chsy1^{Tn(sb-T2/Bart3)2.165Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2^nd intron of the Chsy1. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Chsy1^{Tn(sb-T2/Bart3)2.165Mcwi} 2290123 1 120539002 120600102 1 - by flanking markers 1 128095353 128156041 1 - by flanking markers 1 127010587 127071570 1 - by flanking markers 2290136 F344-Slc24a4^{Tn(sb-T2/Bart3)2.145Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2^nd intron of the Slc24a4 gene. PGA mutant Unknown Slc24a4^{Tn(sb-T2/Bart3)2.145Mcwi} 2290127 6 126403837 126538501 1 - by flanking markers 6 135226112 135364945 1 - by flanking markers 6 126015799 126158727 1 - by flanking markers 2290137 F344-BF522453^{Tn(sb-T2/Bart3)2.166Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA , Rat Resource & Research Center mutant Cryopreserved Sperm BF522453^{Tn(sb-T2/Bart3)2.166Mcwi} 2290126 2290138 F344-Glis1^{Tn(sb-T2/Bart3)2.149Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Glis1 gene. PGA mutant Extinct (as of 2016-12-12) Glis1^{Tn(sb-T2/Bart3)2.149Mcwi} 2290128 5 128736183 128739369 1 - by flanking markers 5 130891667 131081696 1 - by flanking markers 5 127043344 127233395 1 - by flanking markers 2290139 F344-AW527406^{Tn(sb-T2/Bart3)2.156Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown AW527406^{Tn(sb-T2/Bart3)2.156Mcwi} 2290122 2290140 F344-BI285110^{Tn(sb-T2/Bart3)2.167Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI285110^{Tn(sb-T2/Bart3)2.167Mcwi} 2290115 2290141 F344-Abat^{Tn(sb-T2/Bart3)2.163Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Abat gene. PGA , Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2016-11-11) Abat^{Tn(sb-T2/Bart3)2.163Mcwi} 2290121 10 7040725 7137154 1 - by flanking markers 10 5894187 6002068 1 - by flanking markers 10 7093406 7200439 1 - by flanking markers 2290142 F344-LOC681893^{Tn(sb-T2/Bart3)2.161Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. PGA mutant Unknown LOC681893^{Tn(sb-T2/Bart3)2.161Mcwi} 2290118 2290143 F344-Napb^{Tn(sb-T2/Bart3)2.162Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Napb gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Napb^{Tn(sb-T2/Bart3)2.162Mcwi} 2290116 3 137447072 137490500 1 - by flanking markers 3 149431212 149473190 1 - by flanking markers 3 143017571 143063904 1 - by flanking markers 2290144 F344-Adgrl3^{Tn(sb-T2/Bart3)2.151Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Adgrl3 gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-13) Adgrl3^{Tn(sb-T2/Bart3)2.151Mcwi} 2290129 14 28385112 28854677 1 - by flanking markers 14 28183727 29040121 1 - by flanking markers 14 28362176 29226085 1 - by flanking markers 2290145 F344-BI284938^{Tn(sb-T2/Bart3)2.155Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PGA mutant Unknown BI284938^{Tn(sb-T2/Bart3)2.155Mcwi} 2290120 2290146 F344-Plce1^{Tn(sb-T2/Bart3)2.146Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Plce1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plce1^{Tn(sb-T2/Bart3)2.146Mcwi} 2290125 1 242794858 243103437 1 - by flanking markers 1 264652842 264956664 1 - by flanking markers 1 257156023 257465440 1 - by flanking markers 2290147 F344-Sptlc3^{Tn(sb-T2/Bart3)2.147Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6^th intron of the Sptlc3 gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Sptlc3^{Tn(sb-T2/Bart3)2.147Mcwi} 2290124 3 127691668 127825206 1 - by flanking markers 3 139023075 139151792 1 - by flanking markers 3 132560437 132689313 1 - by flanking markers 2290148 F344-Map2k5^{Tn(sb-T2/Bart3)2.150Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Map2k5 gene. PGA mutant Extinct (as of 2016-12-21) Map2k5^{Tn(sb-T2/Bart3)2.150Mcwi} 2290117 8 67313472 67542723 1 - by flanking markers 8 67784868 68010809 1 - by flanking markers 8 68055976 68282656 1 - by flanking markers 2290159 F344-Spetex-2H^{Tn(sb-T2/Bart3)2.136Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Spetex-2H gene. PGA mutant Unknown Spetex-2H^{Tn(sb-T2/Bart3)2.136Mcwi} 2290150 15 5180002 5186910 1 - by flanking markers 2290160 F344-Rph3a^{Tn(sb-T2/Bart3)2.104Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Rph3a gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Rph3a^{Tn(sb-T2/Bart3)2.104Mcwi} 2290154 12 36678613 36753316 1 - by flanking markers 12 42938832 43014142 1 - by flanking markers 12 41073296 41149799 1 - by flanking markers 2290161 F344-Tmco1^{Tn(sb-T2/Bart3)2.135Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene. PGA mutant Extinct (as of 2017-01-30) Tmco1^{Tn(sb-T2/Bart3)2.135Mcwi} 2290156 13 82971926 82995262 1 - by flanking markers 13 90108152 90202246 1 - by flanking markers 13 85465015 85559113 1 - by flanking markers 2290162 F344-Inpp4b^{Tn(sb-T2/Bart3)2.143Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Inpp4b^{Tn(sb-T2/Bart3)2.143Mcwi} 2290149 19 27722430 28363639 1 - by flanking markers 19 40508684 41132035 1 - by flanking markers 19 29592889 30341528 1 - by flanking markers 2290163 F344-TgTn(T2/Bart3)2Ceb transposon sleeping beauty The Sleeping Beauty transposon construct, T2/Bart3 consists of inverted terminal repeats separated by a gene trap cassette. The gene trap cassette consists of two splice acceptors, one from Adenovirus and one from the mouse Hox9a gene, situated in opposite orientations. Each splice acceptor is followed by stop codons in each reading frame and a polyadenylation signal. Furthermore, the T2/Bart3 transposon harbors a mouse tyrosinase minigene which rescues the phenotype of albino rats, but demonstrates position effect variegated expression. PGA transgenic Extinct (as of 2016-11-14) 2290164 F344-Syne1^{Tn(sb-T2/Bart3)2.68Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 109^th intron of the Syne1 gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Syne1^{Tn(sb-T2/Bart3)2.68Mcwi} 2290153 1 35803552 36269628 1 - by flanking markers 1 42947742 43158478 1 - by flanking markers 1 41608287 42086662 1 - by flanking markers 2290165 F344-Ntm^{Tn(sb-T2/Bart3)2.130Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3th intron of the Ntm gene. PGA mutant Extinct (as of 2017-01-24) Ntm^{Tn(sb-T2/Bart3)2.130Mcwi} 2290157 8 28587019 29019888 1 - by flanking markers 8 30073163 31070882 1 - by flanking markers 8 30039332 31041755 1 - by flanking markers 2290166 F344-Plcb3^{Tn(sb-T2/Bart3)2.69Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th exon of the Plcb3 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Plcb3^{Tn(sb-T2/Bart3)2.69Mcwi} 2290155 1 209628425 209643694 1 - by flanking markers 1 229198739 229215831 1 - by flanking markers 1 222207887 222224993 1 - by flanking markers 2290167 F344-Dlg1^{Tn(sb-T2/Bart3)2.133Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6^th intron of the Dlg1 gene. PGA mutant Unknown Dlg1^{Tn(sb-T2/Bart3)2.133Mcwi} 2290152 11 70735283 70930374 1 - by flanking markers 11 75239783 75454358 1 - by flanking markers 11 72164566 72378895 1 - by flanking markers 2290168 F344-Pde5a^{Tn(sb-T2/Bart3)2.144Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). The trap construct targeted to the 4th intron of the Pde5a gene. PGA mutant Extinct (as of 2017-01-24) Pde5a^{Tn(sb-T2/Bart3)2.144Mcwi} 2290151 2 219410394 219550910 1 - by flanking markers 2 246260843 246406296 1 - by flanking markers 2 226899604 227044916 1 - by flanking markers 2290169 F344-Tg(PGK2-sb11)Ceb Sleeping beauty transposase transgenic sb11 cDNA linked to human PGK2 promoter was used. PGA transgenic Extinct (as of 2016-11-14) 2290170 F344-Cd226^{Tn(sb-T2/Bart3)2.141Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3^rd intron of the Cd226 gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Cd226^{Tn(sb-T2/Bart3)2.141Mcwi} 2290158 18 86064574 86157909 1 - by flanking markers 18 85337942 85433295 1 - by flanking markers 18 86299392 86394772 1 - by flanking markers 2290171 F344-LOC681893^{Tn(sb-T2/Bart3)2.159Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the LOC681893 gene. PGA mutant Unknown LOC681893^{Tn(sb-T2/Bart3)2.159Mcwi} 2290119 2290186 SD-Tg(SOD1*G93A)39 SD rats were microinjected with a linear 11.5 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 2290187 SD-Tg(SOD1*H46R)4 SD rats were microinjected with a linear NdeI-Xba1 fragment containing the coding sequence and promoter region of human SOD1 gene with H46R mutation Department of Neuroscience, Tohoku University Graduate School of Medicine, Sendai, Japan transgenic Unknown SOD1 730855 2290272 SS/JrNgs strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 2290273 SHRSP.WKY-(D1Mgh5-D1Wox10)(D9Rat83-D9Mit6)/IzmTkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 2290274 SHRSP.WKY-(D15Rat2-D15Rat94)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 11832728 76115762 1 - by flanking markers 15 15643978 80627247 1 - by flanking markers 15 11605245 77072316 1 - by flanking markers 2290275 SHRSP.WKY-(D3Tkyo7-D3Rat1)/Tkyo The desired fragment is transferred from WKY to SHRSP National Bio Resource Project Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 170016252 170016653 1 - by flanking markers 3 180127863 180128021 1 - by flanking markers 3 176417943 176418101 1 - by flanking markers 2290276 SHRSP.WKY-(D3Mgh16-D3Mgh15)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 118757096 1 - by flanking markers 3 11361699 130099054 1 - by flanking markers 3 6000748 123599709 1 - by flanking markers 2290277 SHRSP.WKY-(D3Rat227-D3Rat166)/Tkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 101359980 1 - by flanking markers 3 50522686 113470358 1 - by flanking markers 3 45406058 106900596 1 - by flanking markers 2290278 SR/JrNgs strain from Disease Model Cooperative Research Association Kyoto, Japan now maintained at Nagasaki University School of Medicine, Nagasaki Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 2290279 SHRSP.WKY-(D15Rat68-D15Rat106)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 106177917 1 - by flanking markers 15 67139660 109944957 1 - by flanking markers 15 63498932 106550657 1 - by flanking markers 2290280 SHRSP.WKY-(D3Mgh16-D3Rat110)/Tkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 2290281 SHRSP.WKY-(D3Rat227-D3Rat1)/Tkyo This congenic strain was established from WKY purchased from Japan SLC, Inc. and SHRSP at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 41054012 170016653 1 - by flanking markers 3 50522686 180128021 1 - by flanking markers 3 45406058 176418101 1 - by flanking markers 2290282 SHRSP.WKY-(D1Mgh5-D1Rat71)(D13Tkyo1-D13Rat51)/IzmTkyo The desired fragment is transferred from WKY to SHRSP National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 2290298 SHR-Tg(Thy1-MAPT)318 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 2290299 SHR-Tg(Thy1-MAPT)72 SHR embryos were microinjected with mouse Thy1 promoter and cDNA coding for human tau protein truncated at amino acid positions 151-391 Axon-Neuroscience GmbH, Vienna, Austria transgenic Unknown MAPT 736496 2290311 SD-Tg(SOD1*G93A)26Dwc SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation Ludwig Institute of Cancer Research, University of California at San Diego, La Jolla, California transgenic Unknown SOD1 730855 2290386 SD-Tg(Wld^s)23Cole SD rats were microinjected with a mouse Wld^s with a Ube4b-derived domain with A46R and M60T amino acid changes University of Cologne, Cologne, Germany transgenic Unknown 2290387 SD-Tg(UbC-APPswe)6590 SD embryos were microinjected with a DNA construct containing a UbC promoter and human APPswe gene containing the Swedish APP670/671 mutation Karolinska Institutet, Stockholm, Sweden transgenic Unknown APP 736021 2290391 SD-Tg(Wld^s)79Cole SD rats were microinjected with a mouse Wld^s with a Ube4b-derived domain with A46R and M60T amino acid changes University of Cologne, Cologne, Germany transgenic Unknown 2290429 SS-Tg(ApoC3-CETP)53Opaz SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 2291840 F344-Dzank1^{Tn(sb-T2/Bart3)2.164Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Dzank1 gene. PGA mutant Extinct (as of 2016-10-17) Dzank1^{Tn(sb-T2/Bart3)2.164Mcwi} 2291839 3 133021912 133073987 1 - by flanking markers 3 145054445 145114445 1 - by flanking markers 3 138624517 138684530 1 - by flanking markers 2292168 ISIAH Inherited stress-induced arterial hypertension Selected from an outbred population of Wistar rats at the Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia, for increased response of blood pressure (systolic) which was induced by restraining the animals in a cylindrical wire mess that caused a mild emotional stress Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown 2292384 SS.LEW-(D10Chm167-D10Chm257)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70589279 71366998 1 - by flanking markers 10 69375493 71016171 1 - by flanking markers 10 69742043 70500971 1 - by flanking markers 2292385 SS.LEW-(D10Mco30-D10Got107)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 77547289 78712717 1 - by flanking markers 10 73693979 77664589 1 - by flanking markers 10 76420583 77803328 1 - by flanking markers 2292386 SS.LEW-(D10Chm155-D10Rat127)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 87272312 100040883 1 - by flanking markers 10 86214887 98591695 1 - by flanking markers 10 86418952 98888676 1 - by flanking markers 2292387 SS.LEW-(D10Chm224-D10Chm259)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 74705355 75291923 1 - by flanking markers 10 75776633 76309841 1 - by flanking markers 10 74325927 74326153 1 - by flanking markers 2292388 SS.LEW-(D10Chm246-D10Chm257)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm128-D10Chm182)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 71262405 71366998 1 - by flanking markers 10 70027256 71016171 1 - by flanking markers 10 70396378 70500971 1 - by flanking markers 2292389 SS.LEW-(D10Chm10-D10Chm14)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat13-D10Rat11)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 96778676 99233951 1 - by flanking markers 10 95351725 97793613 1 - by flanking markers 10 95617075 98079438 1 - by flanking markers 2292390 SS.LEW-(D10Rat194-D10Chm243)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 75706467 76081753 1 - by flanking markers 10 75018615 75388855 1 - by flanking markers 10 74712046 75083773 1 - by flanking markers 2292451 F344-Stxbp5l^{Tn(sb-T2/Bart3)2.202Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Stxbp5l gene. PhysGen , Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Stxbp5l^{Tn(sb-T2/Bart3)2.202Mcwi} 2292450 11 65129572 65455115 1 - by flanking markers 11 69337663 69661463 1 - by flanking markers 11 66246624 66566331 1 - by flanking markers 2292452 F344-Syndig1^{Tn(sb-T2/Bart3)2.171Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Syndig1 gene. PhysGen , Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Syndig1^{Tn(sb-T2/Bart3)2.171Mcwi} 2292449 3 139434170 139834916 1 - by flanking markers 3 151405855 151571801 1 - by flanking markers 3 145031427 145199273 1 - by flanking markers 2292453 F344-BE329202^{Tn(sb-T2/Bart3)2.198Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen , Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm BE329202^{Tn(sb-T2/Bart3)2.198Mcwi} 2292448 2292454 F344-RGD1564304^{Tn(sb-T2/Bart3)2.201Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene. PhysGen mutant Extinct (as of 2017-01-26) RGD1564304^{Tn(sb-T2/Bart3)2.201Mcwi} 2292447 2292459 WF.LEW-RVFV This rat strain was developed by classical breeding technique inserting the gene for resistance to lethal RVFV infection from the LEW rat strain into the genetic background of the WF rat strain. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-11-15) 2292526 SS-Tg(Atp1a1)48Opaz SS/Jr rats were microinjected with rat alpha1 Na,K-ATPase promoter (-1288) 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24) 2292527 SS-Tg(RA1V9)64Opaz Dahl Sensitive rats were microinjected with AngII/AVP receptor gene and SV40 PolyA signal. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 2292528 F344-Tg(APPswe)Opaz F344 embryos were microinjected with a DNA construct containing human amyloid precursor protein with Swedish variant (APPswe; K670N/M671L) under control of platelet-derived growth factor-B (PDGF-b promoter) as a promoter Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 2292529 LEW-Tg((ROSA)26Sor-luc)11Jmsk LEW/Crlj were microinjected with luciferase cDNA with ROSA26 promoter in the NcoI and XbaI site Rat Resource and Research Center, National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-08) Development 2292530 SD-Tg(Pou5f1-Dsred) This transgenic strain carries a random insertion of a construct containing mouse Oct 4 promoter and DsRed. This results in DsRed expression in germ and early embryonic cells. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 2292531 SD-Tg(Pou5f1-EGFP) This transgenic strain carries a random insertion of a construct containing mouse promoter Pou5f1 to drive the expression of EGFP. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-04-23) 2292532 F344-Tg(betaCTF-l45F) F344 embryos were microinjected with human beta-C-terminal fragment of the amyloid protein Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 2292564 ACI.COP-(D6Rat80-D6Rat146)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 6 16302145 16302283 1 - by flanking markers 6 26052697 26052834 1 - by flanking markers 6 16100120 16100257 1 - by flanking markers 2292565 ACI.COP-(D3Mgh16-D3Rat119)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 6373335 52643538 1 - by flanking markers 3 11361699 63334520 1 - by flanking markers 3 6000748 56715367 1 - by flanking markers 2292566 ACI.COP-(D3Rat130-D3Rat114)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 3 44551252 149496698 1 - by flanking markers 3 55227530 160347840 1 - by flanking markers 3 48561928 155263151 1 - by flanking markers 2292567 ACI.COP-(D10Mgh20-D10Rat4)/Shul Female COP/CrCrl and male ACI/SegHsd were crossed to get F₁ progeny which were in turn backcrossed with female ACI/SegHsd; the offsprings were genotyped Department of Genetics, Cell Biology and Anatomy, University Of Nebraska Medical Center, Omaha, Nebraska congenic Unknown 10 53781126 107033716 1 - by flanking markers 10 53376677 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 2292647 SS.LEW-(D1Mco36-D1Rat106)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 139471673 1 - by flanking markers 1 130267716 146282094 1 - by flanking markers 1 129208943 145354344 1 - by flanking markers 2292648 SS.LEW-(D1Mco36-D1Mco77)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 122992360 1 - by flanking markers 1 130267716 130268180 1 - by flanking markers 1 129208943 129209407 1 - by flanking markers 2292649 SS.LEW-(D1Mco36-D1Rat131)/1Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 2292650 SS.LEW-(D1Mco36-D1Rat131)/2Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 145648920 1 - by flanking markers 1 130267716 159182239 1 - by flanking markers 1 129208943 152871103 1 - by flanking markers 2292651 SS.LEW-(D1Mco99-D1Rat49)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 2292652 SS.LEW-(D1Mco85-D1Rat49)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 157497884 157498254 1 - by flanking markers 1 171330622 171330794 1 - by flanking markers 1 165129767 165129939 1 - by flanking markers 2292653 SS.LEW-(D1Mco36-D1Mco101)/Mco This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Rat49)/Jr to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 97174943 122992360 1 - by flanking markers 1 103735751 130268180 1 - by flanking markers 1 102658741 129209407 1 - by flanking markers 2293012 ACI.BBDP-(RT1^u)(Gimap5)/Sunn 2 BBDP regions (Iddm1 and Iddm2) were introgressed into the ACI/SegHsd background Sunnybrook Research Institute, Toronto, Ontario, Canada, Rat Resource and Research Center congenic Unknown 2293120 LOU.BN-(D10Mgh1-D10Mgh14)/Ins segment of chr 10 from BN which contained the Ace gene was introgressed into the genetic background of LOU Cardiovascular Physiopathology, INSERM, Montpellier, France congenic Unknown Ace 2493 10 65379850 65379965 1 - by flanking markers 10 65109232 65109346 1 - by flanking markers 10 66539729 66539843 1 - by flanking markers 2293143 SS.BN-(D13Rat20-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13 38329089 55373537 1 - by flanking markers 13 23200281 47267192 1 - by flanking markers 13 17996178 42155682 1 - by flanking markers 2293144 SS.BN-(D13Rat91-D13Rat179)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46911975 60669696 1 - by flanking markers 13 55853015 68592209 1 - by flanking markers 13 50799478 63611529 1 - by flanking markers 2293145 SS.BN-(D13Hmgc64-RN34_13048990782)/Mcwi SS/JrHsdMcwi were crossed with SS-Chr 13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Ren 3554 13;13;13 49428397;48990782;45215472 49428577;48990782;45215667 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13 58314588;54170894 58314767;54171089 1 - by flanking markers;1 - by flanking markers 13;13 49102205;53264698 49102400;53264877 1 - by flanking markers;1 - by flanking markers 2293146 SS.BN-(D13Rat20-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 38329089;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 47267053;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 42155543;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 2293354 LEW.WKY-(D16Rat88-D16Rat40)/Tja segment of interest of chr 16 from WKY/NCrl was introgressed into LEW/SsNHsd Imperial College, London, UK. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 2293355 WKY.LEW-(D16Rat88-D16Rat40)/Tja 22.6 cM segment of chr 16 from LEW/SsNHsd was introgressed into WKY/NCrl Imperial College, London, UK congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16 819225 60432230 1 - by flanking markers 16 1534408 59992088 1 - by flanking markers 16 1550187 60316851 1 - by flanking markers 2293729 SHR-Gja8^m1Cub This strain is derived from SHR/OlaIpcv where a mutation is observed in the NH₂-terminal cytosolic domain of Cx50, L7Q Department of Biology, Charles University in Prague, Prague, Czech Republic coisogenic Unknown Gja8|Gja8^m1Cub 628890|12791992 2293761 LH-Chr 17^BN/Mav Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown 2293770 SHHF/Bbb Initial breeders were from the original colony of S.A. McCune, University of Colorado, Boulder. These are maintained under strict breeding Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown 2293832 LOU.BN-(D6Rat128-D6Rat115)/Ins segment of interest from chr 6 of BN/Rj was introgressed on LOU/Ins by performing 8 backcrosses followed by 1 intercross INSERM, Paris, France congenic Unknown 6 76613351 116550459 1 - by flanking markers 6 86645162 125802733 1 - by flanking markers 6 77111071 116576287 1 - by flanking markers 2298494 Kini:DA,PVG-G10 Two breeding pairs from inbred DA/Han and PVG.1AV1 that share the RT.1AV1 MHC haplotype were bred to create F₁ generation, 7 couples of F₁ with DA/Han and PVG.1AV1 females founders generated F₂. F₃ generation originated from breeding 50 random couples Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown 2298498 W/Gaox Generated by selective breeding of a spontaneously mutant male from the inbred colony of Wistar rats at the Animal Research Center of Guangzhou Traditional Chinese Medicine University Department of Urology, Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China inbred Unknown 2298772 WF^fzHsd Fuzzy rat Sparse fuzzy hair animals with Wistar Furth background found at Tulane University to Skin and Cancer Hospital, Temple University, Philadelphia to Harlan (1987) Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm 2299122 F344-Tasp1^{Tn(sb-T2/Bart3)2.219Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tasp1 gene. PhysGen mutant Extinct (as of 2017-01-26) Tasp1^{Tn(sb-T2/Bart3)2.219Mcwi} 2299101 3 128002479 128228127 1 - by flanking markers 3 139347611 139588372 1 - by flanking markers 3 132888785 133131213 1 - by flanking markers 2299123 F344-AW921689^{Tn(sb-T2/Bart3)2.209Mcwi} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen mutant Unknown AW921689^{Tn(sb-T2/Bart3)2.209Mcwi} 2299108 2299124 F344-Ubqln4^{Tn(sb-T2/Bart3)2.230Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Ubqln4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ubqln4^{Tn(sb-T2/Bart3)2.230Mcwi} 2299109 2 180669525 180684724 1 - by flanking markers 2 207318101 207333435 1 - by flanking markers 2 187915701 187931035 1 - by flanking markers 2299125 F344-Ccdc85a^{Tn(sb-T2/Bart3)2.248Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ccdc85a gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ccdc85a^{Tn(sb-T2/Bart3)2.248Mcwi} 2299113 14 109197317 109434306 1 - by flanking markers 14 112609601 112636341 1 - by flanking markers 14 112719482 112900724 1 - by flanking markers 2299126 F344-Kcnip4^{Tn(sb-T2/Bart3)2.225Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnip4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnip4^{Tn(sb-T2/Bart3)2.225Mcwi} 2299100 14 66284290 67452628 1 - by flanking markers 14 65635533 66780362 1 - by flanking markers 14 65549362 66749181 1 - by flanking markers 2299127 F344-Eva1a^{Tn(sb-T2/Bart3)2.233Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. PhysGen mutant Extinct (as of 2017-01-26) Eva1a^{Tn(sb-T2/Bart3)2.233Mcwi} 2299094 4 116280880 116330122 1 - by flanking markers 4 177461600 177511382 1 - by flanking markers 4 112714023 112823659 1 - by flanking markers 2299128 F344-Lama2^{Tn(sb-T2/Bart3)2.2013Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 38th intron of the Lama2 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lama2^{Tn(sb-T2/Bart3)2.2013Mcwi} 2299103 1 18203466 18885462 1 - by flanking markers 1 20002787 20647256 1 - by flanking markers 1 18491264 19143486 1 - by flanking markers 2299129 F344-Lrrc4c^{Tn(sb-T2/Bart3)2.224Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Lrrc4c^{Tn(sb-T2/Bart3)2.224Mcwi} 2299107 3 80921606 82413671 1 - by flanking markers 3 92119546 93502229 1 - by flanking markers 3 85421169 86821783 1 - by flanking markers 2299130 F344-Ada^{Tn(sb-T2/Bart3)2.237Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Ada gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-13) Ada^{Tn(sb-T2/Bart3)2.237Mcwi} 2299093 3 154636530 154660637 1 - by flanking markers 3 166306001 166330108 1 - by flanking markers 3 160115840 160139947 1 - by flanking markers 2299131 F344-Grk1^{Tn(sb-T2/Bart3)2.234Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Grk1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Grk1^{Tn(sb-T2/Bart3)2.234Mcwi} 2299115 16 80979323 80991796 1 - by flanking markers 16 80641991 80657693 1 - by flanking markers 16 81153489 81165442 1 - by flanking markers 2299132 F344-Cadm1^{Tn(sb-T2/Bart3)2.229Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cadm1 gene. PhysGen mutant Extinct (as of 2017-01-26) Cadm1^{Tn(sb-T2/Bart3)2.229Mcwi} 2299116 8 50765645 51108962 1 - by flanking markers 8 50460752 50796128 1 - by flanking markers 8 51858906 52200591 1 - by flanking markers 2299133 F344-Rap1gds1^{Tn(sb-T2/Bart3)2.251Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rap1gds1^{Tn(sb-T2/Bart3)2.251Mcwi} 2299098 2 236522381 236638692 1 - by flanking markers 2 262787595 262899803 1 - by flanking markers 2 244258550 244370983 1 - by flanking markers 2299134 F344-Ppapdc1a^{Tn(sb-T2/Bart3)2.207Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppapdc1a gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppapdc1a^{Tn(sb-T2/Bart3)2.207Mcwi} 2299105 1 188518590 188643804 1 - by flanking markers 1 209449940 209577459 1 - by flanking markers 1 202432366 202560628 1 - by flanking markers 2299135 F344-Mgat4c^{Tn(sb-T2/Bart3)2.244Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mgat4c^{Tn(sb-T2/Bart3)2.244Mcwi} 2299106 7 40171454 40383441 1 - by flanking markers 7 43829446 44052611 1 - by flanking markers 7 43249369 44024278 1 - by flanking markers 2299136 F344-Snph^{Tn(sb-T2/Bart3)2.214Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Snph gene. PhysGen mutant Extinct (as of 2017-01-26) Snph^{Tn(sb-T2/Bart3)2.214Mcwi} 2299117 3 141921547 141961697 1 - by flanking markers 3 153455882 153496985 1 - by flanking markers 3 147102394 147143576 1 - by flanking markers 2299137 F344-Erbb4^{Tn(sb-T2/Bart3)2.208Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Erbb4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Erbb4^{Tn(sb-T2/Bart3)2.208Mcwi} 2299110 9 66843898 67967970 1 - by flanking markers 9 74804287 75310350 1 - by flanking markers 9 75021790 76178936 1 - by flanking markers 2299138 F344-Nrxn2^{Tn(sb-T2/Bart3)2.250Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 16th intron of the Nrxn2 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nrxn2^{Tn(sb-T2/Bart3)2.250Mcwi} 2299118 1 209211740 209318064 1 - by flanking markers 1 228789462 228899340 1 - by flanking markers 1 221792191 221908047 1 - by flanking markers 2299139 F344-Dnhd1^{Tn(sb-T2/Bart3)2.243Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Dnhd1 gene. PhysGen mutant Extinct (as of 2017-01-26) Dnhd1^{Tn(sb-T2/Bart3)2.243Mcwi} 2299114 1 163380065 163467261 1 - by flanking markers 1 177487073 177576072 1 - by flanking markers 1 170473792 170570220 1 - by flanking markers 2299140 F344-Dcc^{Tn(sb-T2/Bart3)2.205Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Dcc gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Dcc^{Tn(sb-T2/Bart3)2.205Mcwi} 2298938 18 68026795 69140741 1 - by flanking markers 18 65688901 66793126 1 - by flanking markers 18 66518213 67629801 1 - by flanking markers 2299141 F344-Ppp2r2b^{Tn(sb-T2/Bart3)2.239Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Ppp2r2b gene. PhysGenTn(sb-T2/Bart3)2.239Mcwi 2299104 18 35865837 36318308 1 - by flanking markers 18 36647298 37076455 1 - by flanking markers 18 36985709 37421383 1 - by flanking markers 2299142 F344-Inpp4b^{Tn(sb-T2/Bart3)2.232Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Inpp4b^{Tn(sb-T2/Bart3)2.232Mcwi} 2299095 19 27722430 28363639 1 - by flanking markers 19 40508684 41132035 1 - by flanking markers 19 29592889 30341528 1 - by flanking markers 2299143 F344-Kif16b^{Tn(sb-T2/Bart3)2.200Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Kif16b gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kif16b^{Tn(sb-T2/Bart3)2.200Mcwi} 2299111 3 130967515 131250402 1 - by flanking markers 3 143103727 143381598 1 - by flanking markers 3 136596621 136936809 1 - by flanking markers 2299144 F344-Trdn^{Tn(sb-T2/Bart3)2.238Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Trdn^{Tn(sb-T2/Bart3)2.238Mcwi} 2299099 1 24514752 24925948 1 - by flanking markers 1 26865461 27248423 1 - by flanking markers 1 25403390 25787664 1 - by flanking markers 2299145 F344-Rprd1a^{Tn(sb-T2/Bart3)2.247Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. PhysGen mutant Extinct (as of 2017-01-26) Rprd1a^{Tn(sb-T2/Bart3)2.247Mcwi} 2299096 18 16283291 16328357 1 - by flanking markers 18 16209135 16256883 1 - by flanking markers 18 16450160 16497913 1 - by flanking markers 2299146 F344-Ptpre^{Tn(sb-T2/Bart3)236Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene. PhysGen mutant Extinct (as of 2017-01-26) Ptpre^{Tn(sb-T2/Bart3)236Mcwi} 2299097 1 195263489 195303249 1 - by flanking markers 1 214818446 214920034 1 - by flanking markers 1 207820719 207987123 1 - by flanking markers 2299147 F344-Prr5l^{Tn(sb-T2/Bart3)2.228Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Prr5l gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Prr5l^{Tn(sb-T2/Bart3)2.228Mcwi} 2299112 3 86868129 86948468 1 - by flanking markers 3 97950297 98119477 1 - by flanking markers 3 91290207 91461208 1 - by flanking markers 2299148 F344-Immp1l^{Tn(sb-T2/Bart3)2.246Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Immp1l^{Tn(sb-T2/Bart3)2.246Mcwi} 2299102 3 91408864 91436603 1 - by flanking markers 3 102575250 102646194 1 - by flanking markers 3 95955126 96024316 1 - by flanking markers 2300018 SHRSP.ZUC-(D5Rat4-D5Rat36)/IzmDmcr Selective back cross breeding was done with SHRSP/Izm and Zucker fatty rats for 12 generations to introduce Lepr locus of chr 5 from Zucker fatty rats into SHRSP/Izm Mukogawa Women's University, Nishinomiya, Hyogo Japan, National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension 2300195 EHC.BN-(D14Rat43-D14Rat132)/Kyu EHC/Seac and BN/Seac were crossed to get F₁ progeny which were in turn backcrossed with EHC/Seac and genotyped. Animals with completely replaced background were identified and mated to get homozygous congenics Kyushu University, Fukuoka, Japan congenic Unknown 14 79256324 107101727 1 - by flanking markers 14 78419915 110102984 1 - by flanking markers 14 78446303 110402569 1 - by flanking markers 2300215 SHR.BN-(D10Mgh3-D10Rat85)/Ipcv Congenic substrain derived from SHR.BN-(D10Mgh3-Srebf1)/Ipcv Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 10 48994688 100090454 1 - by flanking markers 10 49018990 98640289 1 - by flanking markers 10 49239646 98939361 1 - by flanking markers 2300216 SHR-Tg(PEPCK-SREBF1)1Ipcv SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1c isoform) and human growth hormone poly-A signal Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 2300217 SHR.BN-(D10Mgh3-Srebf1)/Ipcv 53.7Mbp segment of chr 10 including Srebf1 gene from BN/Crl was introgressed into the SHR/OlaIpcv background Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic congenic Unknown Srebf1 69423 10 46461684 100090454 1 - by flanking markers 10 46326015 98640289 1 - by flanking markers 10 46570996 98939361 1 - by flanking markers 2301079 F344-Lrrc7^{Tn(sb-T2/Bart3)2.253Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Lrrc7. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc7^{Tn(sb-T2/Bart3)2.253Mcwi} 2301078 2 256228792 256644029 1 - by flanking markers 2 283549882 283934360 1 - by flanking markers 2 264910594 265300860 1 - by flanking markers 2301080 F344-Lrrc4c^{Tn(sb-T2/Bart3)2.254Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Lrrc4c gene. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Lrrc4c^{Tn(sb-T2/Bart3)2.254Mcwi} 2301076 3 80921606 82413671 1 - by flanking markers 3 92119546 93502229 1 - by flanking markers 3 85421169 86821783 1 - by flanking markers 2301081 F344-Mmel1^{Tn(sb-T2/Bart3)2.255Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1. PhysGen, Rat Resource and Research Center, Transposagen mutant Cryopreserved Sperm (as of 2017-01-26) Mmel1^{Tn(sb-T2/Bart3)2.255Mcwi} 2301077 5 171675007 171703353 1 - by flanking markers 5 175729143 175759868 1 - by flanking markers 5 172273450 172303905 1 - by flanking markers 2301246 SS.LEW-(D3Rat61-D3Wox1)/Ayd A segment of chromosome 3 was transferred from LEW/Crlc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 147852788 168149595 1 - by flanking markers 3 158115782 182470017 1 - by flanking markers 3 153381237 174632112 1 - by flanking markers 2301247 SS.LEW-(D16Got3-D16Rat112)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Mit2-D16Chm23)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 16 64718 3531727 1 - by flanking markers 16 773329 4149422 1 - by flanking markers 16 778415 4203372 1 - by flanking markers 2301248 SS.LEW-(D3Got33-D3Chm68)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat17)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 45100293 60708929 1 - by flanking markers 3 55769295 71451283 1 - by flanking markers 3 49115270 64892832 1 - by flanking markers 2301249 SS.LEW-(D18Rat30-D18Chm29)/Ayd A segment of chromosome 3 was transferred from LEW/Clrc into the SS/Jr background. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 5682011 12249935 1 - by flanking markers 18 5795276 15461904 1 - by flanking markers 18 5825946 15691464 1 - by flanking markers 2301315 LE/Orl Long-Evans/Cryptorchid Obtained from Centre Nationale de la Researche Scientifique, Orleans, France Centre Nationale de la Researche Scientifique, Orleans, France inbred Unknown 2301330 KH Develped at the International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGENE) Oklahoma City, Oklahoma International Foundation for the Study of Rat Genetics and Rodent Pest Control (INTROGEN) Oklahoma City, Oklahoma inbred Unknown 2301367 SHRSP.WKY-(D2Mit5-D2Rat133)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 66680022 170817807 1 - by flanking markers 2 86560119 197513270 1 - by flanking markers 2 66828049 178177553 1 - by flanking markers 2301368 SHRSP.WKY-(D2Wox15-D2Rat133)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 170817613 170817807 1 - by flanking markers 2 197513076 197513270 1 - by flanking markers 2 178177359 178177553 1 - by flanking markers 2301369 SHRSP.WKY-(D2Rat132-D2Rat53)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 196277776 204077687 1 - by flanking markers 2 223058573 230770799 1 - by flanking markers 2 203613889 211301253 1 - by flanking markers 2301370 SHRSP.WKY-(D2Wox9-D2Rat231)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 2 141259937 190384899 1 - by flanking markers 2 161271919 216143762 1 - by flanking markers 2 141583337 196645063 1 - by flanking markers 2301371 SHRSP.WKY-(D2Mit21-D2Rat157)/Gcrc Congenic substrain generated by crossing SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc males with SHRSP/Gcrc females then intercrossed to fix the small congenic fragment University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown Gstm1|Vcam1|S1pr1 2755|3952|61958 2 182724363 216711836 1 - by flanking markers 2 209270725 241761983 1 - by flanking markers 2301381 SS.LEW-(D18Chm41-D18Rat92)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 53898282 1 - by flanking markers 18 30797572 52299753 1 - by flanking markers 18 31109532 53083766 1 - by flanking markers 2301382 SS.LEW-(D18Chm91-D18Rat67)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 12677191 23780206 1 - by flanking markers 18 15053338 23867696 1 - by flanking markers 18 15274408 24147513 1 - by flanking markers 2301383 SS.LEW-(D18Chm31-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 54856651 1 - by flanking markers 18 2761846 53346447 1 - by flanking markers 18 2745212 54108474 1 - by flanking markers 2301384 SS.LEW-(D18Chm41-D18Rat45)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 30891173 77511190 1 - by flanking markers 18 30797572 76318715 1 - by flanking markers 18 31109532 77212332 1 - by flanking markers 2301385 SS.LEW-(D18Rat29-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 13904295 54856651 1 - by flanking markers 18 13042236 53346447 1 - by flanking markers 18 13257458 54108474 1 - by flanking markers 2301386 SS.LEW-(D18Rat61-D18Rat45)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 61571526 77511190 1 - by flanking markers 18 60167906 76318715 1 - by flanking markers 18 60971508 77212332 1 - by flanking markers 2301387 SS.LEW-(D18Rat67-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 23779885 54856651 1 - by flanking markers 18 23867550 53346447 1 - by flanking markers 18 24147367 54108474 1 - by flanking markers 2301388 SS.LEW-(D18Chm56-D18Rat55)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 49014933 54856651 1 - by flanking markers 18 47711090 53346447 1 - by flanking markers 18 48499359 54108474 1 - by flanking markers 2301700 F344-Spata13^{Tn(sb-T2/Bart3)2.267Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Spata13 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spata13^{Tn(sb-T2/Bart3)2.267Mcwi} 2301697 15 39722469 39849214 1 - by flanking markers 15 44749770 44878760 1 - by flanking markers 15 40937652 41066645 1 - by flanking markers 2301701 F344-Ptpra^{Tn(sb-T2/Bart3)2.261Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ptpra gene. PhysGen,Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ptpra^{Tn(sb-T2/Bart3)2.261Mcwi} 2301698 3 118061713 118171300 1 - by flanking markers 3 129475237 129582992 1 - by flanking markers 3 122976066 123084585 1 - by flanking markers 2301702 F344-Sf4^{Tn(sb-T2/Bart3)2.264Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Sf4^{Tn(sb-T2/Bart3)2.264Mcwi} 2301696 16 19835921 19866795 1 - by flanking markers 16 20950430 21047301 1 - by flanking markers 16 21100923 21131795 1 - by flanking markers 2301937 BN.GH-(D18Rat41-D18Mgh4)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 18 59279066 79585133 1 - by flanking markers 18 57699045 79012652 1 - by flanking markers 18 58476128 79948741 1 - by flanking markers 2301938 BN.GH-(D6Mit12-D6Rat15)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 3158401 105011726 1 - by flanking markers 6 2916444 113050815 1 - by flanking markers 6 104890044 104890216 1 - by flanking markers 2301939 BN.GH-(D2Rat22-D2Mgh11)/Mcwi Male GH/Omr were intercrossed with female BN/Elh then F1 male offspring was backcrossed to female BN/Elh, marker-assisted selection strategy was used to select the males who were backcrossed to BN for 10 generations Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2 69302718 69303085 1 - by flanking markers 2 88968735 223460027 1 - by flanking markers 2 69243686 204022555 1 - by flanking markers 2301986 BN.GH-(D2Rat22-D2Mgh11)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 2 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2301987 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)/Mcwi desired segments from chr 2 and 6 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2301988 BN.GH-(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 6 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2301989 BN.GH-(D2Rat22-D2Mgh11)(D6Mit12-D6Rat15)(D18Rat41-D18Mgh4)/Mcwi desired segments from chr 2, 6 and 18 from GH/Omr were introgressed in BN/Elh background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 2302067 F344/DuCrlSwe Substrain of Fischer rats maintained at Malmo, Sweden Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden inbred Unknown 2302080 Rhd:F344,GK-G21 GK/Swe and F344/Swe were bred to create F₁ generation, couples of F₁ with GK/Swe and F344/Swe females founders generated F₂. F₃ generation originated from breeding random couples which were intercrossed to get further generations Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden advanced_intercross_line Unknown 2302081 DA.E3-(D11Got79-D11Wox5)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA/ZtmRhd strain with positive selection of microsatellite markers. The region corresponding with he production of RF-Igl ambda antibodies was mapped to a narrower region 'D11Got79-D11Rat50.' Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 11 82238710 85432136 1 - by flanking markers 11 86800287 90495881 1 - by flanking markers 11 83727048 87444587 1 - by flanking markers 2302106 SHRSP.WKY-(D1Rat44-D1Arb21)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 2302108 SHRSP.WKY-(D1Mgh5-D1Wox29)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 124614852 1 - by flanking markers 1 80946174 131822376 1 - by flanking markers 1 79689548 130779320 1 - by flanking markers 2302109 SHRSP.WKY-(D1Mgh5-D1Rat44)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 153754250 1 - by flanking markers 1 80946174 167707569 1 - by flanking markers 1 79689548 161493868 1 - by flanking markers 2302110 SHRSP.WKY-(Apbb1-D1Arb21)/Izm SHRSP.WKY-(Klk1-D1Rat116)/Izm was backcrossed with SHRSP/Izm, resulting F₁ were intercrossed to obtain F₂ recombinant individuals were selected by marker assisted selection National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension Apbb1 2122 1 163282918 187092492 1 - by flanking markers 1 177393531 206277202 1 - by flanking markers 1 170387625 199254774 1 - by flanking markers 2302132 SHRSP-Tg(Tagln-ACE2)6918Bdr Trangenic line generated by microinjecting 2.8 kb fragment of smooth muscle 22 alpha promoter and cDNA for human ACE2 gene into SHRSP embryos Max-Delbruck-Center for Molecular Medicine, Berlin-Buch, Germany transgenic Unknown Tagln|ACE2 3723|1347174 2302141 F344-Tg(Cyp1a1-Ren2)10Jmul Generated by using cytochrome P-450 promoter, rat Cyp1a1 to drive mouse Ren2 gene expression. The integration site was on Y chromosome as suggested by Southern blot analysis. University of Edinburgh Medical School, Edinburgh, UK transgenic Unknown Cyp1a1|Ren2 2458|1622375 2302148 SHR-Tg(Ef1a-Cd36)10Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 2302149 SHR-Tg(Ef1a-Cd36)19Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 2302150 SHR-Tg(Ef1a-Cd36)93Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 2302151 SHR-Tg(Ef1a-Cd36)106Ipcv Generated by microinjecting SHR/OlaIpcv zygotes with wild type Cd36 DNA from WKY cloned into Invitrogen pEF1/V5-HisA vector Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown Cd36 2301 2302279 F344.SDT-(D3Wox9-D3Arb20)/Kbe Female F344/NSlc were crossed with male SDT/CrljJcl, then female F₁ were backcrossed to male F344/NSlc; male and female heterozygous carriers were backcrossed to male F344/NSlc, desired region was checked by SSLP markers Kobe University School of Medicine, Chuo-ku, Kobe, Japan congenic Unknown 3 47722501 47722628 1 - by flanking markers 3 58456360 58456486 1 - by flanking markers 3 51821710 51821836 1 - by flanking markers 2302387 DA.ACI-(D2Mit12-D2Mgh29)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd which resulted in introgressing a 52.6 Mb from ACI into DA/BklArbNsi North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 174730375 227310008 1 - by flanking markers 2 74640967 201405160 1 - by flanking markers 2 181990297 235290110 1 - by flanking markers 2302649 F344-Nsun4^{Tn(sb-T2/Bart3)2.286Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Nsun4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nsun4^{Tn(sb-T2/Bart3)2.286Mcwi} 2302645 5 136277224 136297339 1 - by flanking markers 5 138152068 138689234 1 - by flanking markers 5 134885377 134905492 1 - by flanking markers 2302650 F344-Enox1^{Tn(sb-T2/Bart3)2.282Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Enox1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Enox1^{Tn(sb-T2/Bart3)2.282Mcwi} 2302641 15 58555747 58762870 1 - by flanking markers 15 63013519 63564418 1 - by flanking markers 15 59331134 59884512 1 - by flanking markers 2302651 F344-Klra1^{Tn(sb-T2/Bart3)2.279Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Klra1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Klra1^{Tn(sb-T2/Bart3)2.279Mcwi} 2302638 4 168892865 168928286 1 - by flanking markers 4 227986994 228022556 1 - by flanking markers 4 165426365 165460140 1 - by flanking markers 2302652 F344-Pde4d^{Tn(sb-T2/Bart3)2.285Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pde4d gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pde4d^{Tn(sb-T2/Bart3)2.285Mcwi} 2302644 2 40196097 41311012 1 - by flanking markers 2 59292847 60521358 1 - by flanking markers 2 40219999 41468551 1 - by flanking markers 2302653 F344-Mov10^{Tn(sb-T2/Bart3)2.281Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Mov10 gene. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Mov10^{Tn(sb-T2/Bart3)2.281Mcwi} 2302647 2 200053185 200075536 1 - by flanking markers 2 226696252 226717551 1 - by flanking markers 2 207277088 207301245 1 - by flanking markers 2302654 F344-Csmd3^{Tn(sb-T2/Bart3)2.288Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 23rd intron of the Csmd3 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Csmd3^{Tn(sb-T2/Bart3)2.288Mcwi} 2302637 7 83586771 84932392 1 - by flanking markers 7 86689912 87802035 1 - by flanking markers 7 86695703 88072106 1 - by flanking markers 2302655 F344-Tmtc2^{Tn(sb-T2/Bart3)2.276Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Tmtc2 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Tmtc2^{Tn(sb-T2/Bart3)2.276Mcwi} 2302646 7 43667983 44133854 1 - by flanking markers 7 47197110 47603261 1 - by flanking markers 7 47179596 47586777 1 - by flanking markers 2302656 F344-Casp7^{Tn(sb-T2/Bart3)2.280Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. PhysGen mutant Extinct (as of 2017-01-26) Casp7^{Tn(sb-T2/Bart3)2.280Mcwi} 2302642 1 262689300 262721591 1 - by flanking markers 1 284572208 284623736 1 - by flanking markers 1 277190557 277242779 1 - by flanking markers 2302657 F344-Orc3^{Tn(sb-T2/Bart3)2.275Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Orc3 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Orc3^{Tn(sb-T2/Bart3)2.275Mcwi} 2302648 5 51172243 51226644 1 - by flanking markers 5 54588113 54644440 1 - by flanking markers 5 50019159 50075533 1 - by flanking markers 2302658 F344-Bbx^{Tn(sb-T2/Bart3)2.291Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Bbx^{Tn(sb-T2/Bart3)2.291Mcwi} 2302640 11 51655446 51799132 1 - by flanking markers 11 56153038 56397255 1 - by flanking markers 11 52983286 53228557 1 - by flanking markers 2302659 F344-Snx25^{Tn(sb-T2/Bart3)2.270Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Snx25 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Snx25^{Tn(sb-T2/Bart3)2.270Mcwi} 2302636 16 49415658 49518663 1 - by flanking markers 16 49051539 49159381 1 - by flanking markers 16 49328958 49432415 1 - by flanking markers 2302660 F344-Nectin1^{Tn(sb-T2/Bart3)2.284Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Pvrl1. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Nectin1^{Tn(sb-T2/Bart3)2.284Mcwi} 2302639 8 46739657 46799051 1 - by flanking markers 8 46714981 46777484 1 - by flanking markers 8 48094233 48198499 1 - by flanking markers 2302661 F344-Gramd1b^{Tn(sb-T2/Bart3)2.287Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gramd1b gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gramd1b^{Tn(sb-T2/Bart3)2.287Mcwi} 2302635 8 43260379 43429258 1 - by flanking markers 8 61200537 61378124 1 - by flanking markers 8 44160634 44399110 1 - by flanking markers 2302662 F344-Slc7a11^{Tn(sb-T2/Bart3)2.266Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a11^{Tn(sb-T2/Bart3)2.266Mcwi} 2302643 2 139241142 139317101 1 - by flanking markers 2 158930294 159004937 1 - by flanking markers 2 139453774 139528479 1 - by flanking markers 2302666 Scr:sP Sardinian alcohol-preferring rats sP/Scr rats are derived from the selectively bred Sardinian alcohol-preferring rats (sP). This colony began with founders obtained after 32 generations of selective breeding for ethanol preference from Wistar stock by Prof. G.L. Gessa (University of Cagliari). Since receipt, this substrain has been maintained at the Scripps Institute for 24 generations of intra-line, unselected breeding. The Scripps Research Institute, LaJolla, California outbred Unknown 2302984 SS.BN-(D13Rat151-D13Rat197)/Mcwi SS/JrHsdMcwi were crossed with SS-Chr 13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 64083138 80109632 1 - by flanking markers 13 71941043 87516988 1 - by flanking markers 13 66971778 66971975 1 - by flanking markers 2302985 SS.BN-(D13Rat111-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;13;13;5 32030139;42627610;45828608;97701780 32030259;42627837;45828716;97703112 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13;13;13;5 54791498;40421740;51509286;100631702 54791605;40421859;51509512;100633034 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 5;13;13;13 96601805;49720575;46444570;35301263 96603137;49720682;46444796;35301382 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 2302986 SS.BN-(D13Rat88-D13Rat91)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 46912163 1 - by flanking markers 13 51509286 55853202 1 - by flanking markers 13 46444570 50799665 1 - by flanking markers 2302987 SS.BN-(D13Rat7-D13Rat60)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 13053933 1 - by flanking markers 13 19518130 32069874 1 - by flanking markers 13 14279081 26919398 1 - by flanking markers 2302989 SS.BN-(D13Rat57-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 80109432 100133413 1 - by flanking markers 13 87516787 109040616 1 - by flanking markers 13 104392076 104392271 1 - by flanking markers 2302994 SS.BN-(D13Rat127-D13Rat61)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 63301678 1 - by flanking markers 13 23200281 71179041 1 - by flanking markers 13 17996178 66204711 1 - by flanking markers 2302995 SS.BN-(D13Rat115-D13Rat101)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 35719010 49428577 1 - by flanking markers 13 44763184 58314767 1 - by flanking markers 13 39639775 53264877 1 - by flanking markers 2302996 SS.BN-(D13Rat7-D13Rat88)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 38329229 1 - by flanking markers 13 19518130 47267192 1 - by flanking markers 13 14279081 42155682 1 - by flanking markers 2302997 SS.BN-(D13Rat91-D13Got45)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 63301678 1 - by flanking markers 13 53846466 71179041 1 - by flanking markers 13 48776655 66204711 1 - by flanking markers 2302999 SS.BN-(D13Rat178-D13Got45)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 57566232 64083335 1 - by flanking markers 13 65516837 71941240 1 - by flanking markers 13 60528276 66971975 1 - by flanking markers 2303000 SS.BN-(D13Rat123-D13Rat150)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 44872181 57566359 1 - by flanking markers 13 53846466 65516963 1 - by flanking markers 13 48776655 60528402 1 - by flanking markers 2303001 SS.BN-(D13Rat111-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 49428577 1 - by flanking markers 13 40421740 58314767 1 - by flanking markers 13 35301263 53264877 1 - by flanking markers 2303002 SS.BN-(D13Rat123-D13Rat197)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 42627610 76779489 1 - by flanking markers 13 51509286 83929327 1 - by flanking markers 13 46444570 79034003 1 - by flanking markers 2303003 SS.BN-(D13Rat7-D13Rat127)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 1084268 49428577 1 - by flanking markers 13 19518130 58314767 1 - by flanking markers 13 14279081 53264877 1 - by flanking markers 2303004 SS.BN-(D13Rat115-D13Rat61)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 67752598 1 - by flanking markers 13 71178814 75143303 1 - by flanking markers 13 66204484 70172216 1 - by flanking markers 2303005 SS.BN-(D13Rat127-D13Rat77)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 57922038 1 - by flanking markers 13 23200281 65861506 1 - by flanking markers 13 17996178 60876578 1 - by flanking markers 2303006 SS.BN-(D13Rat101-D13Rat46)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46269934 72638941 1 - by flanking markers 13 55560677 79943775 1 - by flanking markers 13 75026588 75026713 1 - by flanking markers 2303007 SS.BN-(D13Rat127-D13Rat46)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 55373161 72638941 1 - by flanking markers 13 23200281 79943775 1 - by flanking markers 13 17996178 75026713 1 - by flanking markers 2303008 SS.BN-(D13Rat61-D13GRat197)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 63301384 76779489 1 - by flanking markers 13 71178814 83929327 1 - by flanking markers 13 66204484 79034003 1 - by flanking markers 2303009 SS.BN-(D13Rat183-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 77336098 100133413 1 - by flanking markers 13 84460970 109040616 1 - by flanking markers 13 79567081 104392271 1 - by flanking markers 2303010 SS.BN-(D13Got51-D13Rat192)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 100133413 1 - by flanking markers 13 76974692 109040616 1 - by flanking markers 13 72031440 104392271 1 - by flanking markers 2303011 SS.BN-(D13Got51-D13Rat57)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 80109632 1 - by flanking markers 13 76974692 87516988 1 - by flanking markers 13 72031440 72031708 1 - by flanking markers 2303099 F344-Kcnh7^{Tn(sb-T2/Bart3)2.295Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 8th intron of the Kcnh7 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnh7^{Tn(sb-T2/Bart3)2.295Mcwi} 2303095 3 44657361 45153509 1 - by flanking markers 3 55325680 55822973 1 - by flanking markers 3 48662450 49168716 1 - by flanking markers 2303100 F344-Slc16a12^{Tn(sb-T2/Bart3)2.298Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Slc16a12 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Slc16a12^{Tn(sb-T2/Bart3)2.298Mcwi} 2303097 1 238643040 238665699 1 - by flanking markers 1 260197556 260275962 1 - by flanking markers 1 252976071 253054500 1 - by flanking markers 2303101 F344-Kcnab1^{Tn(sb-T2/Bart3)2.300Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Kcnab1 gene. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Kcnab1^{Tn(sb-T2/Bart3)2.300Mcwi} 2303094 2 154837841 155145882 1 - by flanking markers 2 174966379 175400010 1 - by flanking markers 2 155555798 156011438 1 - by flanking markers 2303102 F344-Dnah11^{Tn(sb-T2/Bart3)2.293Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 25th intron of the Dnah11 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Dnah11^{Tn(sb-T2/Bart3)2.293Mcwi} 2303098 6 145190931 145516859 1 - by flanking markers 6 154698519 155011384 1 - by flanking markers 6 145784893 146099212 1 - by flanking markers 2303103 F344-Pebp4^{Tn(sb-T2/Bart3)2.299Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Pebp4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pebp4^{Tn(sb-T2/Bart3)2.299Mcwi} 2303096 15 50225405 50460627 1 - by flanking markers 15 55252902 55466149 1 - by flanking markers 15 51528587 51740626 1 - by flanking markers 2303116 SPRD.WKY-(D10Rat91-D10Rat135)/Ibmm SPRD/HanZtm were crossed with WKY/HanZtm and F1 males were backcrossed with SPRD/HanZtm. Heterozygous carriers were bred to SPRD/HanZtm. Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 10 9762188 108776963 1 - by flanking markers 10 8619955 108145987 1 - by flanking markers 10 9841807 108540162 1 - by flanking markers 2303117 SPRD.WKY-(D5Rat190-D5Rat114)(D18Rat102-D18Rat44)/Ibmm Double congenic strain generated by intercrossing SPRD.WKY-(D5Rat190-D5Rat114)/Ibmm and SPRD.WKY-(D18Rat102-D18Rat44)/Ibmm; F₁ animals were intercrossed and F₂ screened for heterozygousity by markers Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium congenic Unknown 2303148 SS.SHR-(D9Wox16-D9Rat76)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 33497026 1 - by flanking markers 9 24681016 40929956 1 - by flanking markers 9 25819185 41261265 1 - by flanking markers 2303149 SS.SHR-(D9Wox16-D9Mco73)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region. Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 47764357 1 - by flanking markers 9 24681016 55323208 1 - by flanking markers 9 25819185 55627498 1 - by flanking markers 2303150 SS.SHR-(D9Mco74-D9Rat64)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 25174989 91131755 1 - by flanking markers 9 31484855 98715585 1 - by flanking markers 9 32677807 99041268 1 - by flanking markers 2303151 SS.SHR-(D9Wox16-D9Mco77)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 54083264 1 - by flanking markers 9 24681016 64294638 1 - by flanking markers 9 25819185 64491201 1 - by flanking markers 2303152 SS.SHR-(D9Mco72-D9Mco93)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 90249887 1 - by flanking markers 9 52352690 97845437 1 - by flanking markers 9 52686874 98164303 1 - by flanking markers 2303153 SS.SHR-(D9Rat7-D9Mco93)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77170797 90249887 1 - by flanking markers 9 83451810 97845437 1 - by flanking markers 9 83686153 98164303 1 - by flanking markers 2303154 SS.SHR-(D9Wox16-D9Mco85)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Wox16-D9Rat64)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 18476042 76456066 1 - by flanking markers 9 24681016 82659881 1 - by flanking markers 9 25819185 82890620 1 - by flanking markers 2303504 LEW/JmsNgs congenital hydrocephalus rat Lewis rats from Tokyo Medical Insitute to Seiwa Institute of Experimental Animals, Hydrocephalus was found the rats at F27 in 1980, these were sent to Dr. Yasutaka Noda at Center for Animal Experiments, Kurume University, The hydrocephalus rat strains have been maintained out by selective breeding. National BioResource Project for the Rat in Japan National BioResource Project for the Rat in Japan mutant Live Animals Metabolism 2303759 WT/Jtt whitish teeth rat In 2001, abnormal incisors that had deteriorated and had a whitish chalk-like appearance were unexpectedly discovered in one male rat among Sprague-Dawley [Crj:CD(SD)IGS] rats (Masuyama, 2005). After that, this mutant phenotype was maintained by sib-mating. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dentistry 2303761 SD-Tg(CAG-EGFP)4Osb Green rat This transgenic strain carries the enhanced green fluorescent protein (EGFP) gene driven by ubiquitous CAG promoter. This transgenic strain was established by Japan SLC, Inc. National BioResource Project for the Rat in Japan transgenic Live Animals 2303779 OLETF-Chr 14^F344/Tj Chromosome 14 from F344 is introgressed in OLETF background National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity 2303784 SHR-Chr 4^WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2303785 SHRSP-Chr 3^WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2303792 WTC.ZI-Atrn^zi/Kyo Zitter rat was detected in a Sprague Dawley colony (SD) in Hannover in 1978 by Rehm. 1983 introduced to Kyoto University and established ZI/Kyo. A second zi allele carrying line with WTC backgrund was established at Kyoto University National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology Atrn^zi 40902832 2303793 WTC.DMY-dmy/Kyo Congenic strain derived by transferring dmy locus from DMY/Kyo on WTC/Kyo background at Kyoto University National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Neurobiology 2303971 OLETF.F344-(D7Mgh16-D7Mgh20)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 96492203 1 - by flanking markers 7 100584458 100584693 1 - by flanking markers 7 100004559 100004794 1 - by flanking markers 2303972 BN-Chr 13^SS/Mcwi A cross of BN and SS strains which results in a BN genomic background with a SS chromosome introgressed PhysGen consomic Unknown 2303973 OLETF.F344-(D10Wox7-D10Wox6)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999-2000. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 10 103550924 103551039 1 - by flanking markers 10 102101261 102101375 1 - by flanking markers 10 102427604 102427718 1 - by flanking markers 2303976 F344-Cyp7b1^{Tn(sb-T2/Bart3)2.306Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Cyp7b1 gene. PhysGen , Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyp7b1^{Tn(sb-T2/Bart3)2.306Mcwi} 2303974 2 103102679 103271273 1 - by flanking markers 2 122442002 122610354 1 - by flanking markers 2 102701903 102871257 1 - by flanking markers 2303977 F344-Ano3^{Tn(sb-T2/Bart3)2.307Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene. PhysGen , Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ano3^{Tn(sb-T2/Bart3)2.307Mcwi} 2303975 3 96123925 96237157 1 - by flanking markers 3 108441370 108751911 1 - by flanking markers 3 101843516 102203368 1 - by flanking markers 2303978 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2303979 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2303986 WKAH.LEC-Atp7b^hts/Tj A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-11) Cancer Atp7b^hts 11532742 16 74607988 74680080 1 - by flanking markers 16 74495179 74575822 1 - by flanking markers 16 74865516 74944935 1 - by flanking markers 2303987 F344.OLETF-(D17Mgh4-Edn1)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity Edn1 2532 17 28303886 28309775 1 - by flanking markers 17 24117499 24124188 1 - by flanking markers 17 22136814 22143745 1 - by flanking markers 2303988 F344.OLETF-(D14Rat23-D14Rat12)(D8Rat54-D8Mgh17)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2303989 F344.OLETF-(D9Mgh8-D9Mit2)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 2303990 F344.OLETF-(D1Mit20-D1Mgh26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 2303991 F344.OLETF-(D7Rat31-D7Rat35)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 20307479 28488710 1 - by flanking markers 7 24326613 32338830 1 - by flanking markers 7 24175337 32258115 1 - by flanking markers 2303992 F344.OLETF-(D5Mgh29-D5Mgh22)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 157584332 157584492 1 - by flanking markers 5 160953624 160953783 1 - by flanking markers 5 157212263 157212422 1 - by flanking markers 2303993 OLETF.F344-(D9Mgh8-D9Mit2)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 2303994 F344.OLETF-(D5Mgh4-D5Rat21)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 99344678 99344842 1 - by flanking markers 5 102264251 102264414 1 - by flanking markers 5 98224053 98224216 1 - by flanking markers 2303995 F344.OLETF-(D8Rat54-D8Mgh17)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 2303996 F344.Cg-Foxn1^rnu/Kyo This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1^rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Immunology; Cancer Foxn1 3970 10 64243323 64256847 1 - by flanking markers 10 66004940 66030134 1 - by flanking markers 10 65621142 65634666 1 - by flanking markers 2303997 F344.OLETF-(D7Mgh8-D7Mgh16)(D14Rat23-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2303998 WKAH.LEC-Ptprk^thid/Tj A congenic strain produced by 8 generation backcrosses to WKAH strain in 1989. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Ptprk 619706 1 17328563 17752200 1 - by flanking markers 1 18602550 19574958 1 - by flanking markers 1 17445052 18058266 1 - by flanking markers 2303999 F344.OLETF-(D14Rat8-D14Rat26)(D14Rat18-D14Rat22)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2304000 F344.OLETF-(D12Wox5-D12Rat21)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 2304001 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2304002 F344.OLETF-(D11Mgh4-D11Mgh1)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 2304003 F344.OLETF-(D16Rat19-D16Rat13)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 35339929 77968799 1 - by flanking markers 16 35126908 77759249 1 - by flanking markers 16 35307110 78172206 1 - by flanking markers 2304004 F344.OLETF-(D7Mit2-D7Mgh16)(D14Rat23-D14Rat26)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2304016 BUF.ACI-(D4Rat192-D4Rat66)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 161023350 161023765 1 - by flanking markers 4 224435359 224435481 1 - by flanking markers 4 157417581 157417703 1 - by flanking markers 2304017 F344.CVD-Unc5c^cvd/Kyo CVD ( Cerebellar vermis defect) rat originated from spontanious mutation of LEW inbred at Osaka Prefecture University in 1992. A mutation in Unc5c has been identified in CVD rats. A congenic strain was produced by backcrossing CVD to F344/NSlc strain at Kyoto University. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-05) Neurobiology Unc5c|Unc5c^cvd 735109|12802355 2 239365109 239721231 1 - by flanking markers 2 265573406 265926229 1 - by flanking markers 2 247045813 247397483 1 - by flanking markers 2304018 BUF.ACI-(D4Rat226-D4Rat109)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 4 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 4 61542056 117094107 1 - by flanking markers 4 61331785 178404466 1 - by flanking markers 4 61612433 113728420 1 - by flanking markers 2304019 BUF.ACI-(D15Rat68-D15Rat29)/Ncc This congenic strain in the BUF background that had homozygous ACI chr 15 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 62521452 108387411 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 2304020 ACI.BUF-(D15Rat97-D15Rat29)/Ncc This congenic strain in the ACI background that had homozygous BUF/Nac chr 15 was developed by speed congenic method. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 15 78048029 108387411 1 - by flanking markers 15 82573157 82573380 1 - by flanking markers 15 79033484 79033707 1 - by flanking markers 2304037 DDI/Ddia dokkyo diabetes insipidus rat Strain developed at Dokkyo University, School of Medicine, Tochigi, Japan National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Metabolism; Urology 2304038 OP/Jtt Opacitas Maintained in sib mating between opacitas rats (heterozygoutes) and normal rats. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Ophthalmology 2304039 WIC-Tg^rdw/Kts Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. This strain has a spontaneous missense mutation, G2320R, in the thyroglobul gene. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism Tg^rdw 12879860 7 104035776 104220754 1 - by flanking markers 7 107399165 107602400 1 - by flanking markers 7 107467260 107652897 1 - by flanking markers 2304040 F344.OP-Op/Jtt Opacitas rats (heterozygtes) are backcorssed with F344/DuCrj. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Ophthalmology 2304041 SD-Tg(CAG-Rgn)Slc Transgenic srain derived by injecting SD rats with a vector containing ubiquitous CAG promoter and the rat Rgn gene National BioResource Project for the Rat in Japan transgenic Live Animals Osteosis Rgn 3560 2304045 F344.ZUC-Lepr^fa(D14Rat23-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 41707592 1 - by flanking markers 14 2222207 61886417 1 - by flanking markers 14 2227825 61783215 1 - by flanking markers 2304046 F344.ZUC-(Lepr^fa)(D7Rat16-D7Mgh20)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2002. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 108647236 108647376 1 - by flanking markers 7 112143411 112143550 1 - by flanking markers 7 112204378 112204517 1 - by flanking markers 2304047 F344.ZUC-Lepr^fa/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 2001. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity Lepr|Lepr^fa 3001|13432153 2304050 F344.OLETF-(D14Rat23-D14Rat55)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 27571792 1 - by flanking markers 14 2222207 27510976 1 - by flanking markers 14 2227825 27686562 1 - by flanking markers 2304051 F344.OLETF-(D14Rat8-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 41707592 1 - by flanking markers 14 32389647 61886417 1 - by flanking markers 14 32593926 61783215 1 - by flanking markers 2304052 F344.OLETF-(D14Rat55-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 27571487 41707592 1 - by flanking markers 14 27510756 61886417 1 - by flanking markers 14 27686342 61783215 1 - by flanking markers 2304053 F344.OLETF-(D14Rat23-D14Rat5)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 11589751 1 - by flanking markers 14 2222207 11868597 1 - by flanking markers 14 2227825 11926177 1 - by flanking markers 2304054 F344.OLETF-(D14Rat23-D14Rat10)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 33157602 1 - by flanking markers 14 2222207 32957654 1 - by flanking markers 14 2227825 33163485 1 - by flanking markers 2304055 F344.OLETF-(D14Wox1-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 41707423 41707592 1 - by flanking markers 14 61886249 61886417 1 - by flanking markers 14 61783047 61783215 1 - by flanking markers 2304056 F344.OLETF-(D14Rat23-D14Wox14)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 21885861 1 - by flanking markers 14 2222207 21925011 1 - by flanking markers 14 2227825 22009966 1 - by flanking markers 2304057 F344.OLETF-(D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in JapanD14Rat143-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 19738306 41707592 1 - by flanking markers 14 19754557 61886417 1 - by flanking markers 14 19847829 61783215 1 - by flanking markers 2304059 F344.OLETF-(D14Rat5-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 11589293 41707592 1 - by flanking markers 14 11868448 61886417 1 - by flanking markers 14 11926028 61783215 1 - by flanking markers 2304060 F344.OLETF-(D14Wox14-D14Rat12)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1998. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 21885743 41707592 1 - by flanking markers 14 21924894 61886417 1 - by flanking markers 14 22009849 61783215 1 - by flanking markers 2304061 F344.OLETF-(D14Rat23)/Tj Established as speed congenics (5 generations, microsatellite marker) at the University of Tokushima School of Medicine, Institute for Animal Experimentation in 1999. Afterwards, maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 1764386 1764554 1 - by flanking markers 14 2222207 2222374 1 - by flanking markers 14 2227825 2227992 1 - by flanking markers 2304063 KDP-Tg(H2Kd-Cblb)2Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 2304064 KDP-Tg(H2Kd-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 2304065 KDP-Tg(INS-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 2304066 KDP-Tg(CAG-Cblb)1Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan transgenic Unknown Cblb 620535 2304074 WKY.BUF-Tsr1d/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus susceptible gene of rat-1, Tsr-1 (on chr.7) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 2304075 ACI.BUF-Pur1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the proteinuria-susceptible gene, Pur1 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology 2304076 WKY.BUF-Thym1, Thym2/Mna This double congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (Thym1) (on chr.1) and Ten2 (Thym2)(on chr. 13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2018-03-14) Cancer 2304077 WKY.BUF-Pur1s/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology 2304078 ACI.BUF-Ten1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 2304079 WKY.BUF-Ten1/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten1 (on chr.1) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 2304080 ACI.BUF-Aftm1/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm 2304081 WKY.BUF-Pur1w/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the proteinuria-susceptible locus, on chr.13 has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology 2304082 WKY.BUF-Ten2/Mna This congenic strain was established as a strain with the genetic background of WKY onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Urology 2304083 ACI.BUF-Ten2/Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna containing the thymus enlargement, Ten2 (on chr.13) has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 2304093 SHRSP.WKY-(D1Rat106-D1Arb21)/Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 139471535 187092492 1 - by flanking markers 1 146068162 206277202 1 - by flanking markers 1 145140412 199254774 1 - by flanking markers 2304094 SHRSP.WKY-(D1Smu12-D1Rat44)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Unknown Cardio Hypertension 1 153754139 153754250 1 - by flanking markers 1 167707459 167707569 1 - by flanking markers 1 161493758 161493868 1 - by flanking markers 2304095 W-Tg(Plcb2-WGA-EGFP)F1Abek This is a transgenic strain developed by the depositor. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo 2304096 SHRSP.WKY-(D1Rat49-D1Arb21)/1Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 2304097 SHRSP.WKY-(D1Rat49-D1Arb21)/2Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 157497884 187092492 1 - by flanking markers 1 171330622 206277202 1 - by flanking markers 1 165129767 199254774 1 - by flanking markers 2304098 SHRSP.WKY-(D1Smu13-D1Arb21)/Izm Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 2304099 SHRSP.WKY-(D1Smu12-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 199254518 199254774 1 - by flanking markers 2304100 SHRSP.WKY-(D1Rat39-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 125983422 187092492 1 - by flanking markers 1 133172202 206277202 1 - by flanking markers 1 132134307 199254774 1 - by flanking markers 2304101 SHRSP.WKY-(D1Rat43-D1Arb21)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 144634295 199254774 1 - by flanking markers 2304102 SHRSP.WKY-(D1Mgh5-D1Rat106)/Izm This is a congenic strain developed by the depositor. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 2304104 W-Tg(Plcb2-WGA-EGFP)M1Abek This is a transgenic strain developed by the depositor. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo 2304120 SHRSP/2Ta Kyo > Ta (1972) National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 2304121 DA.WF-(D1Mit1-D1Mit3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 1 146971846 146971983 1 - by flanking markers 1 162692213 162692800 1 - by flanking markers 1 156446196 156446783 1 - by flanking markers 2304122 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 2304123 DA.WF-(D4Mit11-Nos3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer Nos3 3186 4 6158847 91330856 1 - by flanking markers 4 7333272 157291359 1 - by flanking markers 4 7321908 92484312 1 - by flanking markers 2304124 DA.WF-(D1Mgh21-D1Mgh10)(D4Mit11-Nos3)(D1Mit1-D1Mit3)/Kop This congenic strain in the DA background by introgressing a segment from WF National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 2304125 DRH.F344-(D1Mgh8-D1Mgh12)/Shigm desired fragment from F344 was introgressed into DRH background National BioResource Project for the Rat in Japan, Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer 1 156124624 247322277 1 - by flanking markers 1 169999389 270717037 1 - by flanking markers 1 163796316 163796432 1 - by flanking markers 2304200 W-Tg(CAG-ABO*A)32Jmsk This transgenic strain expresses the transferase A of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 2304201 F344-Galntl6^{Tn(sb-T2/Bart3)2.311McwiRrrc} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Galntl6 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Galntl6^{Tn(sb-T2/Bart3)2.311Mcwi} 2304194 16 34557663 35853849 1 - by flanking markers 16 34380195 35619972 1 - by flanking markers 16 34551052 35803840 1 - by flanking markers 2304202 F344-RGD1565323^{Tn(sb-T2/Bart3)2.312Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of RGD1565323. PhysGen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1565323^{Tn(sb-T2/Bart3)2.312Mcwi} 2304193 17 38022396 38039975 1 - by flanking markers 17 34865901 34882646 1 - by flanking markers 17 32973695 32990440 1 - by flanking markers 2304203 W-Tg(CAG-DsRed2/GFP)1Jmsk DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development 2304204 W-Tg(CAG-ABO*B)13Jmsk This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 2304205 W-Tg(Alb-DsRed2)34Jmsk This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Development 2304206 W-Tg(CAG-DsRed2/GFP)15Jmsk DsRed2/GFP double-reporter transgenic rat driven under a ubiquitous CAG promoter. In this system, DsRed2 expression was replaced with GFP expression after Cre recombinase-mediated excision established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development 2304207 F344-Lzic^{Tn(sb-T2/Bart3)2.309Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Lzic gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lzic^{Tn(sb-T2/Bart3)2.309Mcwi} 2304196 5 166567412 166579423 1 - by flanking markers 5 170076617 170089776 1 - by flanking markers 5 166430305 166443485 1 - by flanking markers 2304208 F344-Rapgef4^{Tn(sb-T2/Bart3)2.314Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 11th intron of the Rapgef4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rapgef4^{Tn(sb-T2/Bart3)2.314Mcwi} 2304197 3 54396312 54717148 1 - by flanking markers 3 65122705 65409814 1 - by flanking markers 3 58632338 58925127 1 - by flanking markers 2304209 F344-Rorb^{Tn(sb-T2/Bart3)2.304Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rorb gene. PhysGen mutant Extinct (as of 2017-01-26) Rorb^{Tn(sb-T2/Bart3)2.304Mcwi} 2304199 1 222545682 222726307 1 - by flanking markers 1 241354340 241541103 1 - by flanking markers 1 234252757 234442597 1 - by flanking markers 2304210 W-Tg(Alb-DsRed2)42Jmsk This transgenic strain expresses the DsRed2 (DsRed: red fluorescent protein) liver-specific under the direction of the mouse albumin enhancer/promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Development 2304211 W-Tg(CAG-cre)81Jmsk This strain expresses the cre recombinase ubiquitously driven by CAG promoter. The majority of expression of the transgene is detected in the skeletal muscles established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo (as of 2018-07-16) Development 2304212 F344-RGD1563503^{Tn(sb-T2/Bart3)2.313Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of RGD1563503. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) RGD1563503^{Tn(sb-T2/Bart3)2.313Mcwi} 2304198 17 21066144 21067040 1 - by flanking markers 17 17584757 17585688 1 - by flanking markers 17 15526295 15527253 1 - by flanking markers 2304213 F344-P3h3^{Tn(sb-T2/Bart3)2.310Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Leprel2 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) P3h3^{Tn(sb-T2/Bart3)2.310Mcwi} 2304195 4 160964297 160978321 1 - by flanking markers 4 224377005 224392881 1 - by flanking markers 4 157359331 157375186 1 - by flanking markers 2304214 W-Tg(CAG-ABO*B)2Jmsk This transgenic strain expresses the transferase B of the ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase ) driven by the CAG promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Hematology Abo3 628609 2304215 F344-Tg(XPO1)1Hik F344/DuCrj Tg rat inoculated with human crm1 genome (BAC) National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Cancer; Infectious 2304221 WTC-swh/Kyo The rat showed abnormal hair texture and mammary gland hypoplasia which occurred in the WTC.ZI-Atrn^zi colony at the National Cancer Center Research Institute in 1998. After elimination of zi allele, this strain has been maintained by sib mating and transferred to Kyoto Univ. in April 2002. In 2011, Kuramoto et al. (RGD:14398762) identified a missense mutation in the Edaradd gene. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-12-11) Dermatology Edaradd^swhKyo 14398765 17 67056373 67143933 1 - by flanking markers 17 92462305 92503399 1 - by flanking markers 17 90802280 90843476 1 - by flanking markers 2304222 WIST/Iar Inbred Wistar-Imamichi Strain developed by the depositor National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-21) Metabolism; Development 2304241 F344-Tg(CXCR4)1Hik Transgenic rat developed by microinjection of a human CXCR4: chemokine (C-X-C motif) receptor 4, containing BAC clone into F344/DuCrj. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious CXCR4 732176 2304242 WTC-Kcnq1^dfkKyo Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-Atrn^zi congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-Kcnq1^dfk/Kyo rat is a mutant for circling behavior. although the Atrn^zi allele of WTC.ZI-Atrn^zi congenic rats was eliminated, the circling behavior remained. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-04-05) Otorhinology; Internal Organ Kcnq1|Kcnq1^dfk 621503|12802344 1 203383401 203803687 1 - by flanking markers 1 223154713 223490458 1 - by flanking markers 1 216293087 216630339 1 - by flanking markers 2304277 SHRSP.WKY-(D1Rat36-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 128874534 139471673 1 - by flanking markers 1 136045631 146282094 1 - by flanking markers 1 135022396 145354344 1 - by flanking markers 2304278 DA-Tg(Alb-HSVtk)5Jmsk This strain expresses HSVtk (herpes simplex virus thymidine kinase) liver-specific driven by mouse albumin enhancer/promoter established at Jichi Medical School. Administration of injection ganciclovir (GCV) in these transgenic rats causes hepatitis. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development 2304279 W-Tg(MT2A-Myc)1Ys This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 2304280 SHR/Shi Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 2304281 SERC/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology 2304282 IEW/Ihr mutant of Ihara epileptic rat. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Neurobiology; Ophthalmology 2304283 SHRSP.WKY-(D1Mgh5-D1Wox18)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 2304284 SHRSP.WKY-(D1Mgh5-D1Rat116)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 218467340 1 - by flanking markers 1 80946174 239429964 1 - by flanking markers 1 79689548 232297227 1 - by flanking markers 2304285 BDIX/NemOda This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 and to Department of Agricultural, Nagoya University in 1992. National BioResource Project for the Rat in Japan inbred Unknown Cancer 2304286 DMYC/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan coisogenic Cryopreserved Sperm 2304287 ACI.F344-(D16Rat17-D16Rat15)/Nkg F344 rats are susceptible and ACI rats are resistant to PhIP(2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF formation (Nagao, 1998). Targeting on susceptible gene for colon tumor on rat chromosome 16 (Nakagama, 1999), this congenic strain was established by backcrossing F344/Jcl, as a donor strain, and ACI/NJcl, as a recipient strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cancer 2304288 ACI.BUF-(D20Img2-D20Rat5)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 2304289 SHRSP.WKY-(D1Mgh5-D1Rat349)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 130788777 1 - by flanking markers 1 80946174 137735636 1 - by flanking markers 1 79689548 136742994 1 - by flanking markers 2304290 BUF.ACI-(D20Img2-D20Rat5)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer 20 18411845 18411969 1 - by flanking markers 20 21025611 21025734 1 - by flanking markers 20 18872150 18872273 1 - by flanking markers 2304291 LEW-Tg(CAG-EGFP)1Ys This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Development 2304292 LEW-Tg((ROSA)26Sor-luc)21Jmsk This strain expresses luciferase ubiquitously driven by the gene trap ROSA 26 promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development 2304293 F344.LEC-xhs1/1Nrs LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2304294 MPOD/Kyo Myeloperoxidase deficient rat was detected in Std:Wistar rats which purchased Japan SLC, Inc. in 2001. The causative gene is inherited as an autosomal recessive trait. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cancer; Immunology 2304295 SHRSP.WKY-(Igf1r-D1Rat36)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Igf1r 2869 1 122704976 128874670 1 - by flanking markers 1 129985761 136045766 1 - by flanking markers 1 128924921 135022531 1 - by flanking markers 2304296 KB/Oda Maintained by crossing heterozygotes of the albino locus (segregating inbred strain). National BioResource Project for the Rat in Japan segregating_inbred Cryopreserved Embryo 2304297 TM.KDP-Cblb/Nyo Homozygous Cblb rats are usually infertile in both sexes and are therefore maintained by crossing heterozygous individuals (segregating inbred strain). National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Immunology Cblb 620535 11 49690402 49856762 1 - by flanking markers 11 54218260 54383403 1 - by flanking markers 11 51037383 51202761 1 - by flanking markers 2304298 SD-Tg(Tuba1a-EYFP)Okn This strain expresses the enhanced yellow fluorescent protein (YGFP) neuron-specific driven by the Tubulin, alpha 1A promoter. National BioResource Project for the Rat in Japan transgenic Unknown 2304299 LEW-Tg(Alb-GFP)6Jmsk This strain expresses the green fluorescent protein (GFP) liver-specific driven by the Albumin promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development 2304300 W-Tg(S100b-EGFP)Scell Developed by microinjecting the transgene into Wistar rats National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology; Metabolism 2304301 SHRSP.WKY-(Slco3a1-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Slco3a1 620227 1 129580126 139471673 1 - by flanking markers 1 136793300 146282094 1 - by flanking markers 1 135790854 145354344 1 - by flanking markers 2304302 SHRSP.WKY-(D1Rat44-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 153754139 187092492 1 - by flanking markers 1 167707459 206277202 1 - by flanking markers 1 161493758 199254774 1 - by flanking markers 2304303 W-Tg(MT2A-Myc)2Ys This transgenic rat is expressing the rat c-myc gene under the control of the human metallothionein II A promoter, established at the YS Institute, Inc. (present: PhoenixBio Co., Ltd.). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Reproduction; Development Myc 3130 2304304 SHRSP.WKY-(D1Rat209-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 187092235 187092492 1 - by flanking markers 1 206276946 206277202 1 - by flanking markers 1 142486986 199254774 1 - by flanking markers 2304305 DOB/Oda This strain was derived from wild specimens of the Rattus norvegicus trapped at goat shed in Sitara-cho, Kita-shitara-gun, Aichi, Japan, 2000. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo 2304306 BUF.ACI-(D20Img2-Cdkn1a)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 2304307 ACI.BUF-(D20Img2-Cdkn1a)/Ncc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Cancer Cdkn1a 69328 20 7376325 7386778 1 - by flanking markers 20 8592437 8602879 1 - by flanking markers 20 6348422 6358864 1 - by flanking markers 2304308 ICR/Ihr A new rat strain has been developed, in which a spontaneous cataract occurs without exception at 3-4 months after birth and matures completely at 4-6 months of age, indicating that this strain possesses a maturity-onset cataract. National BioResource Project for the Rat in Japan inbred Live Animals (as of 2019-08-05) Neurobiology; Ophthalmology 2304309 SHRSP.WKY-(D1Mgh5-D1Rat106)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 139471673 1 - by flanking markers 1 80946174 146282094 1 - by flanking markers 1 79689548 145354344 1 - by flanking markers 2304310 SD-Tg(Nes/Hspa1b-EGFP)Okn This strain expresses green fluorescent protein (GFP) neural-specific driven by Nestin enhancer and Hspa1b promoter. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Neurobiology 2304311 LEW-Tg((ROSA26)Sor-lacZ)44JmskRrrc This strain expresses LacZ ubiquitously driven by the gene trap ROSA26 promoter established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-08) Development 2304312 SHRSP.WKY-(D1Mgh5-D1Rat36)(D1Rat44-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2304313 SHRSP.WKY-(D1Mgh5-D1Rat178)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 2304314 BDIX.Cg-Tal/NemOda Mating among heterozygoutes or between heterozygoute and normal individuals (segregating inbred strain). National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Osteosis 2304315 SHRSP.WKY-(Calca-D1Arb21)/IzmTkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension Calca 2254 1 172686168 187092492 1 - by flanking markers 1 191158061 206277202 1 - by flanking markers 1 184184018 199254774 1 - by flanking markers 2304316 F344.LEC-xhs1/2Nrs LEC rats which had high X-ray susceptibility were backcrossed to F344. In every generation, highly X-ray susceptible rats were selected with the radiation susceptibility assay National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2304329 WKY/Ezo Deposited by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio Hypertension 2304330 SD-Tg(HRAS)128Ncc This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-04-30) Cancer 2304331 F344-Tg(CCR5)1Hik Deposited by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm Infectious 2304332 HER/Wkmt Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals Neurobiology 2305934 F344-Spta1^{Tn(sb-T2/Bart3)2.315Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 48th intron of the Spta1 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Spta1^{Tn(sb-T2/Bart3)2.315Mcwi} 2305932 13 89951924 90028592 1 - by flanking markers 13 96782387 96860327 1 - by flanking markers 13 92264231 92340091 1 - by flanking markers 2305935 F344-Rtn4^{Tn(sb-T2/Bart3)2.316Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rtn4 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Rtn4^{Tn(sb-T2/Bart3)2.316Mcwi} 2305933 14 110725089 110772578 1 - by flanking markers 14 113792257 113839936 1 - by flanking markers 14 114126931 114174459 1 - by flanking markers 2305939 SHRSP.WKY-(D9Mit6-D9Rat83)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305940 SHRSP-Chr 7^WKY/Tkyo Chromosome 7 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305941 SHR-Chr 15^WKY/Tkyo Chromosome 15 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305942 SHR-Chr 3^WKY/Tkyo Chromosome 3 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305943 SHRSP-Chr 15^WKY/Tkyo Chromosome 15 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305944 SHRSP-Chr 4^WKY/Tkyo Chromosome 4 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305945 SHRSP-Chr 13^WKY/Tkyo Chromosome 13 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305946 SHR-Chr 1^WKY/Tkyo Chromosome 1 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305947 SHR-Chr 19^WKY/Tkyo Chromosome 19 from WKY is introgressed into the genomic background of SHR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305948 SHRSP.WKY-(D8Rat77-D8Rat16)(D8Tkyo10)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305949 SHRSP-Chr 1^WKY/Tkyo Chromosome 1 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2305966 SHR.SHRSP-(D1Rat93-D1Rat269)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 2305967 SHR.SHRSP-(D18Rat73-D18Rat11)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 2305968 SHRSP.WKY-(D1Wox18-D1Rat39)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 94626541 125983558 1 - by flanking markers 1 101198387 133172336 1 - by flanking markers 1 100133276 132134441 1 - by flanking markers 2305969 SHRSP.WKY-(D1Mgh5-D1Rat178)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 85128763 1 - by flanking markers 1 80946174 89601109 1 - by flanking markers 1 79689548 79689689 1 - by flanking markers 2305970 DA-Tg(Alb-TTR*V30M)7Jmsk This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development 2305971 SHRSP.SHR-(D18Rat73-D18Rat11)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 18 52290789 71692408 1 - by flanking markers 18 50804228 69942605 1 - by flanking markers 18 51609032 70803264 1 - by flanking markers 2305972 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)(Bcl2-D13Mgh7)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305973 SHRSP.SHR-(D1Rat93-D1Rat269)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm Diabetes Obesity 1 63990899 126292805 1 - by flanking markers 1 63244295 133485967 1 - by flanking markers 1 64252881 132448306 1 - by flanking markers 2305974 WKY.SHRSP-(D1Wox29-D1Arb21)(D9Mit6-D9Wox4)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305975 SHRSP.WKY-(D1Mgh5-D1Wox18)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 78134304 94626661 1 - by flanking markers 1 80946174 101198506 1 - by flanking markers 1 79689548 100133395 1 - by flanking markers 2305976 DA-Tg(Alb-TTR*V30M)9Jmsk This is the strain expresses human Amyloidogenic transthyretin (ATTR) V30M driven by the mouse albumin enhancer/promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan, Rat Resource & Research Center transgenic Cryopreserved Embryo Development 2305977 ACI.F344-(D16Rat12-D16Mco2)/Nkg F344 rats are susceptible and ACI rats are resistant to PhIP (2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine)-induced ACF (aberrant crypt foci) formation (Nagao, 1998). This congenic strain was established using 'speed congenic' method by backcrossing (F344/JclxACI/NJcl)F1 onto ACI/NJcl, followed by intercrossing in N8 generation. Thereafter this strain is maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 350121 67547357 1 - by flanking markers 16 1084304 67099528 1 - by flanking markers 16 1090054 1090164 1 - by flanking markers 2305978 LEW-Tg((ROSA)26Sor-DsRed*)7Jmsk This strain expresses DsRed monomer ubiquitously driven by the gene trap ROSA 26 promoter, established at Jichi Medical School. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo (as of 2017-08-08) Development 2305979 WKY.SHRSP-(D1Wox29-D1Arb21)(Bcl2-D13Mgh7)/Izm Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305987 F344.OLETF-(D7Mgh16-D7Wox46)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 113050225 1 - by flanking markers 7 100584458 116158165 1 - by flanking markers 7 100004559 116255796 1 - by flanking markers 2305988 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Cg-Lepr^fa(D7Mgh16-D7Mgh20))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305989 (F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj x F344.Z-Lepr^fa/Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305990 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305991 (F344.OLETF-(D7Mgh16-D7Mgh20)/Tj X F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305992 F344.OLETF-(D7Mit16-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 2305993 F344.OLETF-(D14Rat23)(D14Rat12)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305994 F344.OLETF-(D14Rat23-D14Rat23)(D14Rat8-D14Rat12)/1Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity 2305995 F344.OLETF-(D7Got130-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305996 F344.Cg-Lepr^fa(D7Rat18-D7Mit2)(D14Rat23-D14Rat12)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305997 (F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12)/2Tj x F344.OLETF-(D8Rat54-D8Mgh17)/2Tj)F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2305998 F344.Cg-Lepr^fa(D8Rat54-D8Mgh17)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 2305999 F344.OLETF-(D7Mgh16-D7Rat70)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 117397170 1 - by flanking markers 7 100584458 120641361 1 - by flanking markers 7 100004559 120648531 1 - by flanking markers 2306000 F344.OLETF-(D7Rat70-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 117396947 117397170 1 - by flanking markers 7 120641139 120641361 1 - by flanking markers 7 120648309 120648531 1 - by flanking markers 2306001 F344.OLETF-(D7Rat176-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 111200727 111200952 1 - by flanking markers 7 114641525 114641749 1 - by flanking markers 7 114708083 114708307 1 - by flanking markers 2306002 F344.OLETF-(D14Rat23)(D14Rat12)/1Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2306003 F344.OLETF-(D7Wox46-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 113050053 113050225 1 - by flanking markers 7 116157993 116158165 1 - by flanking markers 7 116255624 116255796 1 - by flanking markers 2306004 F344.OLETF-(D7Mgh16-D7Mit16)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 96491967 120746007 1 - by flanking markers 7 100584458 123587717 1 - by flanking markers 7 100004559 123602998 1 - by flanking markers 2306013 F344.OLETF-(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 14 32584630 70077314 1 - by flanking markers 14 32389647 69559504 1 - by flanking markers 14 32593926 69517234 1 - by flanking markers 2306014 F344.OLETF-(D8Rat54-D8Mgh17)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 8 19796514 73102155 1 - by flanking markers 8 21850030 79245063 1 - by flanking markers 8 74917593 80840067 1 - by flanking markers 2306015 F344.OLETF-(D12Wox5-D12Rat21)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 12 43801711 43801909 1 - by flanking markers 12 17721341 50319569 1 - by flanking markers 12 15714609 48536609 1 - by flanking markers 2306016 F344.OLETF-(D11Mgh4-D11Mgh1)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 11 61504311 84560241 1 - by flanking markers 11 65784365 89808503 1 - by flanking markers 11 62653194 86714631 1 - by flanking markers 2306017 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Lepr^fa(D14Rat23-D14Rat12))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2306018 F344.OLETF-(D9Mgh8-D9Mit2)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 9 33374546 63705951 1 - by flanking markers 9 40808491 70797404 1 - by flanking markers 9 41139089 71771476 1 - by flanking markers 2306019 F344.OLETF-(D1Mit20-D1Mgh26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 94356875 176616212 1 - by flanking markers 1 100372156 194998184 1 - by flanking markers 1 188051098 188051234 1 - by flanking markers 2306020 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Lepr^fa(D7Mgh16-D7Mgh20)(D14Rat23-D14Rat12))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2306021 SHR-Chr 2^WKY/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity; Cardio Hypertension 2306022 KCI/Kyo Rats showing abnormal behaviors characterized by constant circling movements were found in the F3 generation of Crl:CD(SD) rats purchased from Charles River Laboratory Japan in 2003. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology Pcdh15 1590969 20 14507804 15240479 1 - by flanking markers 20 17138580 19021206 1 - by flanking markers 20 14952213 15334745 1 - by flanking markers 2306023 F344-Tg(CCNT1)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious CCNT1 1322457 2306024 FOK/Ncu Furuyama rat These are resistant to hot environment. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm 2306025 WMN/Nrs Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism 2306026 F344.OLETF-(D16Wox4-D16Rat13)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 16 51452966 77968799 1 - by flanking markers 16 51050772 77759249 1 - by flanking markers 16 51339600 78172206 1 - by flanking markers 2306027 WM/Nrs Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo Cancer; Metabolism 2306028 F344.OLETF-(D14Rat23-D14Rat12)(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2306029 (F344.OLETF-(D8Rat54-D8Mgh17)/2Tj x F344.Cg-Lepr^fa(D7Mgh16-D7Mgh20))F1 Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2306030 F344.OLETF-(D7Mgh16-D7Mgh20)(D14Rat8-D14Rat26)/2Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 2306033 SHR.Cg-Lepr^cp/NDmcr Nonsense mutation of leptin receptor gene in the obese spontaneously hypertensive Koletsky rat was transferred to SHR/N strain at NIH. This strain has been maintained at Disease Model Cooperative Research Association (DMCRA) scince 1999. National BioResource Project for the Rat in Japan congenic Live Animals Diabetes Obesity; Cardio Hypertension Lepr^cp 11570565 2306034 NER.F344-(D1Mgh6-D1Rat132)(D5Rat100-D5Rat234)/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 2306035 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)/Kyo This double congenic strain was established by crossing F344.NER-(D1Mgh6-D1Rat73)/Kyo and F344.NER-(D5Mgh4-D5Rat36)/Kyo National BioResource Project for the Rat in Japan congenic Live Animals Neurobiology 2306036 F344-Apc^m1Kyo F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-03-14) Cancer Apc|Apc^m1Kyo 2123|12792252 18 26732147 26790383 1 - by flanking markers 18 26725560 26820837 1 - by flanking markers 18 27011710 27106323 1 - by flanking markers 2306037 F344-Tg(CD4)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious 2306041 F344-Scn1a^m2Kyo Established by ENU mutagenesis. A point mutation in Scn1a gene. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology Scn1a^m2Kyo 12792284 3 48238528 48364143 1 - by flanking markers 3 59016641 59135580 1 - by flanking markers 3 52388811 52533365 1 - by flanking markers 2306042 F344-Scn1a^m1Kyo Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Neurobiology Scn1a^m1Kyo 12792283 3 48238528 48364143 1 - by flanking markers 3 59016641 59135580 1 - by flanking markers 3 52388811 52533365 1 - by flanking markers 2306043 SHR/4Dmcr Developed by the DEPOSITOR, this is one of the SHR substrains, CL line, which shows lower blood pressure National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 2306044 SHRSP/3Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, A4 line National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 2306045 SHR/2Dmcr Developed by the DEPOSITOR, one of the SHR substrains from B2 line National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 2306046 W-Tg(CAG-EGFP)3Ys This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene ubiquitously driven by CAG promoter. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo 2306047 W-Tg(Gnrh1-EGFP)Nphy This transgenic strain contains the enhanced green fluorescent protein (EGFP) gene driven by gonadotropin-releasing hormone 1 (Gnrh1) promoter. EGFP fluorescence is observed only in Gnrh1-immunoreactive neurons, approximately one third of which has strong EGFP fluorescence. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Gnrh1 2720 2306048 SHR/3Dmcr Developed by the DEPOSITOR, this is one of the SHR substrains, CH line, which shows high blood pressure National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 2306049 SHRSP/4Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, CT line, which shows cardiac thrombosis National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 2306050 SHRSP/5Dmcr Developed by the DEPOSITOR, This is one of the SHRSP substrains, ALR line, which is prone to arteiolipidosis National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 2306051 SHRSP/2Dmcr Developed by the DEPOSITOR, this is one of the SHRSP substrains, A1sb line National BioResource Project for the Rat in Japan inbred Live Animals Cardio Hypertension Cd36 2301 2306058 LEC.W-Tg(CAG-Zfml)30Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2306059 DA.Cg-Foxn1^rnu Lyst^bg/Slc Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Immunology; Hematology Foxn1|Lyst 3970|621837 2306060 LEC.W-Tg(CAG-Zfml)26Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2306061 ACI.BUF-Pur1, Thym2/Mna The proteinuria-susceptible gene, Pur1 (on chr.13) and the thymus enlargement, Ten2 (Thym2) (on chr.13) loci of BUF/Mna were transferred to ACI by backcrossing from Matsuyama et al. Congenic rats are established in 2002. National BioResource Project for the Rat in Japan congenic Unknown Metabolism 2306062 W-Tg(Per1-luc)1Oa Developed by the DEPOSITOR National BioResource Project for the Rat in Japan, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 2306063 LEC.W-Tg(CAG-Zfml)21Ncms/Ncms Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2306064 MPR/Iar Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Metabolism; Osteosis Arsb|Arsb^MPR 2158|12792967 2 24067560 24223821 1 - by flanking markers 2 42559079 42717753 1 - by flanking markers 2 23385154 23543028 1 - by flanking markers 2306070 WIC-Tg(Wap-GH1)1Mni Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism 2306071 F344-Tg(CAG-EGFP)Ncco Transgenic rat: CAG promoter, Enhanced Green Fluorescent Protein gene, microinjection method National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity; Cancer; Metabolism 2306072 ACI.F344-(D16Nkg74)/Nkg A sub congenic strain of ACI/N.F344-(D16Rat12-D16Mco2)/Nkg National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 2306073 WIC-Tg(Wap-GH1)2Mni Ikeda developed transgenic rats carrying the human growth hormone (GH1) driven by murine Wap promoter, originated from Wistar-Imamichi (Ikeda, 1994). Two lines of this transgenic strain were established named Line 1: characterized by relatively high level of serum Gh1 (high line, NBRPNo.0490), and Line 2: relatively low level of serum Gh1 (low line, NBRPNo.0491). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Diabetes Obesity; Metabolism 2306076 ACI.F344-(D16Nkg9-D16Nkg38)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N8 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 2306077 ACI.F344-(D16Rat64-D16Nkg105)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by sib mating. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 16 59398206 59398647 1 - by flanking markers 16 58966446 58966664 1 - by flanking markers 16 59285775 59285993 1 - by flanking markers 2306078 KFRS4A/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Behavior 2306079 ACI.F344-(D16Nkg87-D16Nkg105)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat64-D16Nkg105)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation. maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cancer 2306085 TCR/Ibu Toyoda Circling Rat A male rat shows circling behavior was found in the Wistar rats purchaced from Kiwa Laboratory Animals Co., Ltd. in 2007. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Behavior 2306089 ACI.BUF-(D7Wox16-D7Rat69)/Mna The thymoma susceptible locus of rat-1, Tsr1 (on Chr.7) was transferred from BUF/Mna to ACI/NMs by repeated backcrossing. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer 7 64611964 113044228 1 - by flanking markers 7 67991394 116151991 1 - by flanking markers 7 67801457 67801690 1 - by flanking markers 2306090 ExHC/Ta Exogenously hypercholesterolemic rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Live Animals (as of 2017-04-19) Metabolism 2306098 ACI.F344-(D16Nkg30-D16Mgh6)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 16 49150370 49150515 1 - by flanking markers 16 48766016 48766115 1 - by flanking markers 16 49051407 49051506 1 - by flanking markers 2306099 SHR.WKY-(D15Tkyo3-D15Rat68)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 62521452 62521592 1 - by flanking markers 15 67139660 67139799 1 - by flanking markers 15 63498932 63499071 1 - by flanking markers 2306100 SHR.WKY-(D3Tkyo7-D3Rat1)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 99858951 170016653 1 - by flanking markers 3 112038782 180128021 1 - by flanking markers 3 105465332 176418101 1 - by flanking markers 2306101 LEC.BN-(D4Mgh16-D4Rat233)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 61646674 108329449 1 - by flanking markers 4 61427427 170105737 1 - by flanking markers 4 61708103 105384025 1 - by flanking markers 2306102 BN.LEC-(D4Rat128-D4Rat106)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 117887968 1 - by flanking markers 4 145335315 179959894 1 - by flanking markers 4 80666353 115372927 1 - by flanking markers 2306103 SHRSP/Sums Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 2306104 BN.LEC-(D4Rat184-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 120665583 142160377 1 - by flanking markers 4 182854846 203361566 1 - by flanking markers 4 118283596 138891201 1 - by flanking markers 2306105 BN.LEC-(D4Rat128-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 4 79189959 142160377 1 - by flanking markers 4 145335315 203361566 1 - by flanking markers 4 80666353 138891201 1 - by flanking markers 2306106 CLX/Ta Circling behavior linked to the X-chromosome (CLX) Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Behavior 2306107 SD-Tg(Sp6)58Tj The transgenic construct carrying rat Sp6 coding region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-22) Dentistry; Development Sp6 1306768 2306108 SHR.WKY-(D3Mit9-D3Wox16)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 26674018 89245110 1 - by flanking markers 3 39535971 100667805 1 - by flanking markers 3 34394121 94028641 1 - by flanking markers 2306109 SHR.WKY-(D3Mgh6-D3Rat1)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 50522618 170016653 1 - by flanking markers 3 61249840 180128021 1 - by flanking markers 3 54630948 176418101 1 - by flanking markers 2306110 IER/Sums Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Neurobiology 2306111 LEC.BN-(D4Mgh16-D4Rat233)(D4Rat271-D4Rat238)/Hkv Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2306112 ZDF-Lepr^faCrlCrlj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo Diabetes Obesity Lepr 3001 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 2306113 SD-Tg(Sp6)6Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 2306114 SHR.WKY-(D3Mgh16-D3Rat110)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 42729760 1 - by flanking markers 3 11361699 53824856 1 - by flanking markers 3 6000748 47155284 1 - by flanking markers 2306115 SHR.WKY-(D3Mgh16-D3Rat166)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 3 6373335 101359980 1 - by flanking markers 3 11361699 113470358 1 - by flanking markers 3 6000748 106900596 1 - by flanking markers 2306116 SD-Tg(Sp6)5Tj The transgenic construct carrying rat Sp6 cording region was introduced to Slc:SD. Established at YS institute (PhoenixBio) in 2006 and introduced to the University of Tokushima. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Dentistry; Development Sp6 1306768 2306117 ACI.F344-(D16Nkg9-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2/Nkg onto ACI/NJcl, followed by intercrossing in N9 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2306118 SHR.WKY-(D15Rat95-D15Rat106)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 15 69469532 106177917 1 - by flanking markers 15 74166614 109944957 1 - by flanking markers 15 70559420 106550657 1 - by flanking markers 2306119 F344-Tg(CD4,CCNT1)1Hik Developed by the DEPOSITOR National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Infectious 2306120 SHR.WKY-(D4Wox27-D4Rat15)/Tkyo This congenic strain was established from WKY/Izm purchased from Japan SLC, Inc. and SHR/Izm at the Research Institute International Medical Center of Japan in 2001. The rats which have the heterozygous consomic segment were established in 2004, and were bred homozygous in 2005. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity; Cardio Hypertension 4 460493 47890193 1 - by flanking markers 4 3096322 48448808 1 - by flanking markers 4 3044017 48656399 1 - by flanking markers 2306276 F344-Exoc4^{Tn(sb-T2/Bart3)2.317Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 7th intron of the Exoc4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Exoc4^{Tn(sb-T2/Bart3)2.317Mcwi} 2306273 4 60406942 61284294 1 - by flanking markers 4 60287465 61081401 1 - by flanking markers 4 60549128 61358305 1 - by flanking markers 2306277 F344-Gng12^{Tn(sb-T2/Bart3)2.320Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Gng12 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Gng12^{Tn(sb-T2/Bart3)2.320Mcwi} 2306274 4 96622363 96624479 1 - by flanking markers 4 162420268 162549350 1 - by flanking markers 4 97634925 97763478 1 - by flanking markers 2306278 F344-AW915325^{Tn(sb-T2/Bart3)2.319Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the EST AW915325. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-31) AW915325^{Tn(sb-T2/Bart3)2.319Mcwi} 2306272 2306279 F344-Diaph3^{Tn(sb-T2/Bart3)2.318Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Diaph3^{Tn(sb-T2/Bart3)2.318Mcwi} 2306275 15 68905784 69267707 1 - by flanking markers 15 73538942 74007617 1 - by flanking markers 15 69928507 70400077 1 - by flanking markers 2306529 BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Parental strain BBDR.BBDP-(D4Rhw17-ss99306861)(D4Rhw11-D4Rhw10)/Rhw were backcrossed to BBDR/Rhw, carefully DNA between D4Rhw17-ss99306861 was removed giving the desired congenic Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75808584 77809321 1 - by flanking markers 4 142052025 144005977 1 - by flanking markers 4 77380565 79326833 1 - by flanking markers 2306532 BBDR.F344-(D4Rat27-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306533 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/2Rhw Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306534 BBDR.F344-(D4Rat102-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306535 BBDR.F344-(D4Rat253-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains identified in F2 crosses of BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR/Rhw with BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306536 BBDR.F344-(D4Arb11-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains generated by intercrossing male BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw and female BBDR/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306537 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/1Rhw Congenic substrains generated by intercrossing BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306538 BBDR.F344-(D4Rat153-D4Rat27),BBDP-(D4Rhw11-D4Rhw10)/Rhw Congenic substrains generated by intercrossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw and BBDR.BBDP-(D4Rhw11-D4Rhw10)/Rhw to reduce the proximal end of F344 DNA while retaining the Gimap5 mutation Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306539 BBDR.F344-(D4Rat102-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/3Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306540 BBDR.F344-(D4Got33-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306541 BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed Department of Medicine, University of Washington, Seattle, Washington, Rat Resource and Research Center congenic Unknown 2306542 BBDR.F344-(D4Rat253-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306543 BBDR.F344-(D4Got59-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw BBDR.BBDP-(D4Mit6-D4Mit7)/Rhw were intercrossed with F344 giving a recombination proximal to Gimap1 fragment. Whole-genome scan, STS and SSLP analyses were done to determine the region introgressed Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306544 BBDR.F344-(D4Rat26-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw Congenic substrains developed by crossing BBDR.F344-(D4Rat153-D4Rhw8),BBDP-(D4Rhw6-D4Rat62)/Rhw to BBDR/Rhw producing animals which were intercrossed to produce F2 lymphonic rats that had reduced F344 DNA Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 2306709 BBDR.BBDP-(D4Mit6-D4Mit7)/3Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 2306710 F344-Lmln^{Tn(sb-T2/Bart3)2.322Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 12th intron of the Lmln gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Lmln^{Tn(sb-T2/Bart3)2.322Mcwi} 2306701 11 69481117 69547133 1 - by flanking markers 11 73980288 74048100 1 - by flanking markers 11 70895141 70963121 1 - by flanking markers 2306711 F344-FM117003^{Tn(sb-T2/Bart3)2.321McwiRrrc} this Sleeping Beauty mutants were derived by crossing F344-Tg(T2/Bart3)2Ceb and F344-Tg(PGK2-SB11)Ceb PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm FM117003^{Tn(sb-T2/Bart3)2.321Mcwi} 2306703 2306712 BBDR.BBDP-(D4Mit6-D4Mit7)/2Rhw This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene. Department of Medicine, University of Washington, Seattle, Washington congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 2306717 BBDP/WorSunn These originated from the Worcester colony from the rats that were sent from Ottawa to Worcester in 1977. Now maintained at University of Toronto, Canada. Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada, Rat Resource and Research Center inbred Cryopreserved Sperm; Cryorecovery (as of 2018-11-12) 2306784 Kini:DA,PVG-G12 Two breeding pairs from inbred DA/Han and PVG/OlaHsd that share the RT1^a MHC haplotype were bred to create F₁ generation, 7 couples of F₁ with DA/Han and PVG/OlaHsd females founders generated F₂. F₃ generation originated from breeding 50 random couples Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden advanced_intercross_line Unknown 2306815 SS.SR-(D7Rat67-D7Mco7)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111506104 113014423 1 - by flanking markers 7 114961803 116100169 1 - by flanking markers 7 115041287 115041463 1 - by flanking markers 2306816 SS.SR-(D7Mco19-D7Mco7)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112800232 113014423 1 - by flanking markers 7 115828017 116100169 1 - by flanking markers 7 115922628 115922885 1 - by flanking markers 2306817 SS.SR-(D7Uia1-D7Mco19)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 112800489 1 - by flanking markers 7 112367543 115828274 1 - by flanking markers 7 112429186 115922885 1 - by flanking markers 2306818 SS.SR-(D7Rat131-D7Mco7)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 111882387 113014423 1 - by flanking markers 7 115334997 116100169 1 - by flanking markers 7 115421039 115421228 1 - by flanking markers 2306819 SS.SR-(D7Uia1-D7Rat131)/Jr Congenic substrain developed by crossing SS.SR-(D7Uia1-D7Mco7)/Jr to SS/Jr to produce F₁ which were intercrossed and genotyped Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108875615 111882577 1 - by flanking markers 7 112367543 115335186 1 - by flanking markers 7 112429186 115421228 1 - by flanking markers 2306820 SS.SR-(D3Arb14-D3Mco36)/Mco SS.SR-(D3Mco19-D3Mco5)/Jr rats were crossed with SS to yield F1, these heterozygous rats were intercrossed to obtain F2 which were screened to identify the SR-rat derived region, these were then crossed with SS to duplicate the recombinant chromosome Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 171009566 171009778 1 - by flanking markers 3 181074759 181074971 1 - by flanking markers 3 177366448 177366660 1 - by flanking markers 2306823 SS.SR-(D3Arb14-D3Mco36)(D7Mco19-D7Mco7)/Mco SS.SR-(D3Arb14-D3Mco36)/Mco were crossed with SS.SR-(D7Mco19-D7Mco7)/Jr and then F₁ rats were backcrossed with SS.SR-(D3Arb14-D3Mco36)/Mco, animals heterozygous for chr 7 and homozygous for chr 3 were crossed and the resulting progeny homozygous for both segments were bred Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 2306840 E3.DA-(D4Wox22-D4Got132)(D12Wox5-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 2306841 E3.DA-(D12Wox5-D12Rat26)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 12 23845554 23845733 1 - by flanking markers 12 17721341 27718984 1 - by flanking markers 12 15714609 25711626 1 - by flanking markers 2306842 E3.DA-(D20Rat45-D20Rat47)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental strain with positive selection of microsatellite markers Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 6;20 133455626;1616332 133455718;5447494 1 - by flanking markers;1 - by flanking markers 20 4059279 8810333 1 - by flanking markers 20 2018654 6567533 1 - by flanking markers 2306874 F344-Intu^{Tn(sb-T2/Bart3)2.324Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Intu gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Intu^{Tn(sb-T2/Bart3)2.324Mcwi} 2306873 2 127564813 127639564 1 - by flanking markers 2 147063971 147216092 1 - by flanking markers 2 127459089 127521327 1 - by flanking markers 2306875 F344-Faslg^{Tn(sb-T2/Bart3)2.325Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Faslg gene. PhysGen mutant Extinct (as of 2017-01-26) Faslg^{Tn(sb-T2/Bart3)2.325Mcwi} 2306872 13 77472950 77480210 1 - by flanking markers 13 84590119 84605900 1 - by flanking markers 13 79696811 79717581 1 - by flanking markers 2306892 SHR.BN-(D2Rat114-D2Rat123)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 36432989 112326568 1 - by flanking markers 2 55361257 131889716 1 - by flanking markers 2 36245223 112175725 1 - by flanking markers 2306893 SHR.BN-(D16Rat87-D16Mgh1)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 16 3464719 46137590 1 - by flanking markers 16 4082652 45651269 1 - by flanking markers 16 4136355 45905331 1 - by flanking markers 2306894 SHR.BN-(D4Rat33-D4Rat54)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 4 80205349 121829076 1 - by flanking markers 4 146540904 184799673 1 - by flanking markers 4 81874073 119546974 1 - by flanking markers 2306895 SHR.BN-(D2Rat226-D2Rat294)/Jk Backcross marker-assisted method was used to fix the BN fragment onto SHR genome, once selection was done using markers, male and female were crossed to get homozygous animals Heart Institute (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil. Genetica congenic Unknown 2 170338294 236153712 1 - by flanking markers 2 197020226 262435073 1 - by flanking markers 2 177680772 243901375 1 - by flanking markers 2306961 RLA/Verh Roman low avoidance Bignami selected for low avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown 2306962 RHA/Verh Roman high avoidance Bignami selected for high avoidance conditioning with light as a conditioned stimulus and electric shock as the unconditioned stimulus,these are now at Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium Laboratory for Experimental Medicine and Endocrinology, Catholic University of Leuven, Belgium inbred Unknown 2307077 HXB4/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307078 HXB27/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307079 HXB3/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307080 HXB20/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307081 HXB31/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307082 HXB18/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307083 HXB10/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307084 HXB24/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307085 HXB17/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307086 HXB7/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307087 SHR.BN-(D18Rat32-D18Rat12)/Ipcv A segment of chr 18 from BN was introgressed into the SHR background Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 2307088 HXB22/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307089 HXB29/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307090 SHR.BN10/Ipcv A segment of chr 10 from BN was introgressed into the SHR background Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 2307091 HXB13/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307092 HXB14/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307093 HXB23/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307094 HXB1/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307095 HXB15/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307096 HXB2/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307097 HXB21/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307098 HXB25/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307099 HXB5/Ipcv Derived from founder strains SHR/OlaIpcv and BN-Lx/Cub Czech Academy of Sciences, Prague, Czech Republic recombinant_inbred Unknown 2307115 BXH5/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307116 PXO3-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307117 PXO5-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307118 PXO9/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307119 PXO7-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307120 PXO7-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307121 BXH2/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307122 PXO8-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307123 BXH13/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307124 BXH10/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307125 PXO6-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307126 BXH8/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307127 BXH11/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307128 PXO5-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307129 BXH9/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307130 PXO6-3/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307131 PXO8-2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307132 PXO10/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307133 BXH12-2/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307134 BXH3/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307135 PXO4/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307136 BXH6/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307137 PXO6-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307138 PXO1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307139 BXH12-1/Cub Derived from founder strains BN-Lx/Cub and SHR/OlaIpcv Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307155 SHR/1NCrl To Charles River from NIH in 1973 at F32. MRC Clinical Sciences Centre, College School of Medicine, London, UK inbred Unknown 2307156 DA/ZtmKini Substrain of DA, to Hannover after 1965, now at Stockholm, Sweden. Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden inbred Unknown 2307157 PVG.1AV1/Kini Originally derived by Dr. Hans J. Hendrich at Versuchstierzucht, Hannover, Germany, now at Stockholm, Sweden. Center for Molecular Medicine, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 2307159 SHRSR.SHRSP-(Klk1-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 2307160 SHRSR.SHRSP-(Klk1-D1Mit3)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 2307161 SHRSR.SHRSP-(D1Rat134-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 2307166 SHRSP.SHRSR-(Klk1-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1|Klk1c12 3118|1303192 1 94355758 185690396 1 - by flanking markers 1 100371040 204941832 1 - by flanking markers 1 99298965 197963072 1 - by flanking markers 2307167 SHRSP.SHRSR-(Klk1-D1Mit3)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Klk1c12 1303192 1 94355758 146971983 1 - by flanking markers 1 100371040 162692800 1 - by flanking markers 1 99298965 156446783 1 - by flanking markers 2307168 SHRSR/Bbb Spontaneously Hypertensive Rat, Stroke Resistant This SHRSP colony as obtained from the original Japanese stock from Okamoto and Aoki in 1974 and is propagated by strict inbreeding. Now this colony is maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany. Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown 2307169 SHRSP.SHRSR-(D1Rat134-Mt1-ps1)/Bbb SHRSP were crossed with SHRSR to give heterozygous F₂ animals, these were backcrossed and heterozygotes with desired segment of interest selected and backcrossed to fix the allele of interest Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown Mt1-ps1 3118 1 135467526 185690396 1 - by flanking markers 1 142390027 204941832 1 - by flanking markers 1 141429089 197963072 1 - by flanking markers 2307298 BN/HanKini Substrain of BN derived from BN/Han (Dr. H.J. Hedrich, Hannover, Germany) Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown 2307299 ACI/ZtmKini substrain of ACI derived from ACI/Ztm Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden inbred Unknown 2307300 LEW.1AV1/Kini Substrain of LEW.1AV1 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 2307301 DA.LEW.RT1f-(D20Wox15-D20Wox13)/Rhd RT1f Haplotype on DA background, congenic strain was obtained by conventional backcross breeding to the parental DA/Ztm from LEW.1F/Ztm with positive selection of microsatellite markers Section for Medical Inflammation Research, Biomedical Center, Lund University, Sweden congenic Unknown 20 2790524 6695696 1 - by flanking markers 20 5249993 10234922 1 - by flanking markers 20 3151827 8034632 1 - by flanking markers 2307317 MHS Milan Hypertensive Strain Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure Department of Sciences and Biomedical Technologies, University of Milan, Milan, Italy outbred Unknown 2307318 BDIX/Ifz derived from Berlin-Druckrey strain BDIX Duisburg-Essen University Medical School, Essen, Germany inbred Unknown 2307319 MNS/N Milan normotensive strain Wistar rats with brother x sister mating and selection for low systolic blood pressure as a normotensive control for MHS. Rat Resource and Research Center inbred Cryopreserved Embryo 2307355 PXO3-1/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307356 PXO2/Cub Derived from polydactylous (P) SHR.Lx congenic strain and oligodactylous (O) BXH2 recombinant inbred strain. These are homozygous in the Lx allele. Charles University, Department of Biology, Prague, Czech Republic recombinant_inbred Unknown 2307357 BDV/Ztm Developed from a cross of a single BDI x BDII mating pair, with subsequent selection for coat colour alleles. Zentralinstitut fur Versuchstierzucht, Hannover, Germany inbred Unknown 2307358 LUDW/OlaHsd Ludwig Wistar stock to Ludwig Institute, Sutton.From Ludwig Institute to Harlan in 1979. Envigo inbred Cryorecovery 2307359 BUF/SimRijHsd Developed by Heston in 1946 from a Buffalo Harlan Sprague Dawley, Inc., Indianapolis, IN inbred Unknown 2307360 DA.BI.RT1i-(D20Rat42-D20Rat31)/Rhd RT1i Haplotype on DA background, congenic strain originates from BI, formerly B3 (extinct strain) and was produced at Zentralinstitut for Versuchstierzucht, Hannover, Germany). It has been maintained by conventional backcross breeding to the parental DA/Han. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 4582054 10410227 1 - by flanking markers 20 6265460 12972703 1 - by flanking markers 20 4186104 10800530 1 - by flanking markers 2307441 F344-Cyyr1^{Tn(sb-T2/Bart3)2.328Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Cyyr1 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Cyyr1^{Tn(sb-T2/Bart3)2.328Mcwi} 2307440 11 25036792 25157304 1 - by flanking markers 11 28591553 28702298 1 - by flanking markers 11 24967936 25078740 1 - by flanking markers 2307442 F344-Robo1^{Tn(sb-T2/Bart3)2.327Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Robo1 gene. PhysGen,Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Robo1^{Tn(sb-T2/Bart3)2.327Mcwi} 2307439 11 10784947 11720646 1 - by flanking markers 11 13314508 13808775 1 - by flanking markers 11 9079291 10146302 1 - by flanking markers 2308816 Crl:WI(Han) Rederived by GlaxoWellcome from Han Wistar stock supplied by BRL (under structural changed to RCC). Transferred to Charles River UK in 1996. Transferred to Charles River in 1997 and rederived into isolator maintained Foundation Colony. IGS refers to animals bred using the Charles River International Genetic Standard system. Charles River Laboratories outbred Unknown 2308851 Crl:OP(CD) Obese Prone Rats Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD(Obese Prone) and OR-CD (Obese Resistant). This model becomes obese when fed high-fat diets. Obesity develops despite having a fully functioning leptin receptor. The control for this model is the Crl:OR(CD). Charles River Laboratories outbred Unknown 2308852 Crl:LE Long-Evans Rats Originated by Drs. Long and Evans in 1915 by crossing several Wistar white females with a wild gray male. To Charles River from Canadian Breeding Farm and Laboratories in 1978. Charles River Laboratories outbred Unknown 2308853 Crl:OR(CD) Obese Resistant Rats Developed from a line of Crl:CD(SD) rats. Two lines were developed from this outbred colony, the OP-CD (Obese Prone) and OR-CD (Obese Resistant). This model does not become obese when fed high-fat diets. Charles River Laboratories outbred Unknown 2308885 GK/CskCrljCrl The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. To Charles River in 2006. Charles River Laboratories inbred Unknown 2308886 SS/HsdMcwiCrl Inbred from a congenic control group of Dahl/SS rats (SS/JrHsd) obtained from Dr. Theodore Kurtz (UCSF, CA) which were originally derived from the Harlan SS/Jr colony. Maintained at the Medical College of Wisconsin since 1991, this strain has undergone considerable marker-selected breeding to eliminate residual heterozygosity and genetic contamination. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested. (Cowley et al. 2000, Physiol. Genomics 2:107-115). To Charles River in 2001. Charles River Laboratories inbred Unknown 2311049 SHROB/KolGmiCrl-Lepr^cp/Crl This mutation occurred in the laboratory of Dr. Simon Koletsky in 1969 at Case Western Reserve University School of Medicine. It was developed from a cross between a hypertensive female rat and a normotensive male Sprague Dawley rat. The colony was maintained as brother x sister matings in a closed colony at Case Western Reserve University School of Medicine since 1971. To Genetic Models, Inc. in 2000. To Charles River in 2001. Charles River Laboratories coisogenic Unknown Lepr^cp 11570565 2311051 SHRSP/A3NCrl Stroke Prone Rats The Spontaneously Hypertensive Stroke Prone Rat (SHRSP) was isolated from Wistar-Kyoto rats by Okamoto and Aoki in 1963. The A3 subline was transferred to the National Institutes of Health in 1975 from Yamori at generation F36. To Charles River in 2002. Charles River Laboratories inbred Unknown 2311070 BUF/CrCrl Buffalo Rat Heston in 1946 from Buffalo stock of H. Morris. To NIH in 1951 at F10. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred Unknown 2311071 ZDF-Lepr^fa/Crl A mutation occurred in a colony of outbred Zucker rats in the laboratory of Dr. Walter Shaw at Eli Lilly Research Laboratories in Indianapolis, IN in 1974???75. Part of this colony containing the mutation was moved to Indiana University Medical School (IUMS), to the laboratory of Dr. Julia Clark in 1977. Several groups of animals with diabetic lineage were identified and rederived in 1981. Inbreeding of selected pairs from this rederivation was done in the laboratory of Dr. Richard Peterson at IUMS. An inbred line of ZDF rat was established in 1985. To Genetic Models, Inc. in 1991. To Charles River in 2001. Charles River Laboratories coisogenic Unknown Lepr 3001 2311072 FHH/EurMcwiCrl An outbred stock of fawn hooded rats was introduced into Europe by Tschopp in the early 1970s. Maintained as an outbred stock until the mid-1980s, when brother x sister mating was initiated by A.P. Provoost to produce two strains designated FHH (also known as FHR) and FHL, which differ in expression of hypertension and proteinuria. The colony was transferred to Erasmus University in Rotterdam, The Netherlands, then to the Medical College of Wisconsin in the 1990s. To Charles River in 2001. Charles River Laboratories inbred Unknown 2311073 NBL/CrCrl Bogden in the mid-1970s from Noble strain rats (brother x sister mated but not descended from a single pair, and therefore not necessarily isogenic). To National Cancer Institute Animal Production Program (Cr) in 1978. To Charles River in 1998. Charles River Laboratories inbred Unknown 2311074 BDIX/CrCrl Druckrey from a cross between BDI and BDVIII with subsequent selection of brother-sister pairs for agouti coat color and dark, pigmented eyes. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred Unknown 2311078 Crl:CD-Hr^hr CD hairless rats This spontaneous mutation model was isolated from a Crl:CD(SD) colony in Charles River, Wilmington, MA in the late 1980s. Rederived in 1993 and subsequently transferred to Charles River, Raleigh, NC for barrier room production. The model does not exhibit the typical characteristics of hair growth and loss found in other hairless models. Specific genetic analysis to identify the mutation has not been undertaken. Histopathology has determined the model is euthymic. Charles River Laboratories outbred Unknown 2311079 WF/CrCrl J. Furth in 1945 from a commercial Wistar stock in an attempt to develop a rat strain with a high incidence of leukemia. To Charles River in 1998 from the National Cancer Institute Animal Production Program (Cr). Charles River Laboratories inbred Unknown 2311082 SS-Chr 13^BN/McwiCrl Developed at the Medical College of Wisconsin. To Charles River in 2003. Charles River Laboratories consomic Unknown 2311692 F344-Myo1d^{Tn(sb-T2/Bart3)2.334Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Myo1d^{Tn(sb-T2/Bart3)2.334Mcwi} 2311691 10 68720729 68997721 1 - by flanking markers 10 67520649 67811744 1 - by flanking markers 10 67866939 68142864 1 - by flanking markers 2311693 F344-Tmem22^{Tn(sb-T2/Bart3)2.332Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem22 gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Tmem22^{Tn(sb-T2/Bart3)2.332Mcwi} 2311689 8 105416072 105443969 1 - by flanking markers 8 108269643 108297339 1 - by flanking markers 8 108854134 108881519 1 - by flanking markers 2311694 F344-Fam227a^{Tn(sb-T2/Bart3)2.333Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Fam227a^{Tn(sb-T2/Bart3)2.333Mcwi} 2311687 7 117441099 117469873 1 - by flanking markers 7 120839737 120881869 1 - by flanking markers 7 120846166 120891738 1 - by flanking markers 2312352 LEW.1N These congenic rats carry the RTlⁿ haplotype on the LEW strain genetic background. Zentralinstitut fur Versuchstierzucht, Hannover, Germany congenic Unknown 2312447 SD-Tg(Pmp22)Kan This transgenic strain was derived by pronuclear microinjection of fertilized SD rats with a 43 kb fragment containing Pmp22 gene which was isolated from mouse SV129 cosmid library Max Planck Institute for Experimental Medicine, Gottingen, Germany transgenic Unknown Pmp22 11125 2312466 Crl:LIS Lister Hooded Rat These rats have taken their names from the Lister Institute, where the stocks first originated. From Glaxo to Charles River UK in 1990 and again in 1996. To Charles River Geramny in 2007. Noted for its docility and good breeding performance. Charles River Laboratories outbred Unknown 2312471 Crl:ZUC(Orl)-Lepr^fa The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961. The strain was introduced in Orleans at CSEAL, France in 1970; then transferred to Charles River France in 1991. Charles River Laboratories outbred Unknown Lepr^fa 13432153 2312472 Crl:WI(WU) Wistar Wu Rat Selection by H.H. Donalson at the Wistar-Institute, USA, at the begining of 19th century. To Glaxo-lab. in 1927, continued as inbred. To Nederlands-Institute voor Volksfoending in 1993, to Unilever, Vlaardingen in 1941 and Institut Centraale Proefdierenbedrijf TNO in 1958. Caesarean rederived in 1963. As an outbred to SAVO, Kiblegg in 1975. Caesarean rederived at Charles River in 1987. Charles River Laboratories outbred Unknown 2312473 BDIX/OrlCrl BDIX Rats Rats selected in 1937 by H. Druckrey in Berlin from a strain of yellow coated, pink-eyed rats. It is part of a series of BD I to X strains produced at Max Planck Institute, Freiburg and was introduced to France in 1971 to the INSERM unit, Immunology Laboratory, Dijon where it was maintained in strict brother-sister inbreeding. Developed and studied by Dr. Ms. Martin, CNRS/CSEAL, Orleans who obtained it from Dijon in 1983. To Charles River France in 1991. Charles River Laboratories inbred Unknown 2312474 Crl:OFA(SD) The original strain was composed in 1925 by Robert Worthington Dawley. Carworth Farms obtained it in 1955 and renamed it CFE (Carworth Farms Elias). Transferred to Charles River France in 1967, it then became known as OFA (Oncins France Strain A), in 1968. Charles River Laboratories outbred Unknown 2312498 WAG/RijCrl WAG Rats A.L. Bacharach, Glaxo Labs., U.K., 1924, from a Wistar stock. To Harrington in 1964 at F83. To MBL-TNO in 1953, after that to REP Institutes TNO, Rijswijk. To Charles River Germany from REP Institutes TNO in 1993. Charles River Laboratories inbred Unknown 2312499 Crl:NIH-Foxn1^rnu Nude Rats The NIH nude rat was developed in 1979/80 through a series of matings involving 8 inbred rat strains. To Charles River USA from the NIH Animal Genetic Resources. Caesarian derived in 2001. This athymic model shows depleted cell populations in thymus-dependent areas of peripheral lymphoid organs. Charles River Laboratories outbred Unknown 2312504 Crlj:WI Wistar Institute to Scientific Products Farm, Ltd to CRLUS(1975) to CRLJ(1981) Charles River Laboratories outbred Unknown 2312511 WF/IcoCrl Wistar Rats Furth developed this strain at Roswell Park Memorial Institute, Buffalo, NY, USA in 1945 starting from a commercial colony of Wistar rats. Acquired by Charles River from the MIcrobiological Associates, Bethesda, Maryland, USA. Introduced to Charles River France in 1970. Charles River Laboratories inbred Unknown 2312512 ZSF1-Lepr^fa Lepr^cp/Crl This hybrid rat is a cross between a ZDF female and a SHHF male rat. This model was developed at Genetic Models International, Indianapolis. To Charles River in 2001. Charles River Laboratories hybrid Unknown 2312513 Crlj:DON Dr. Sato(1952) to Nippon Rat to CRLJ(1990) Charles River Laboratories outbred Unknown 2312514 Crlj:LEC Hokkaido Univ.(1975) to Otsuka Pharma. (1988) to CRLJ (1991). Charles River Laboratories outbred Unknown 2312518 Crlj:ZUC-Lepr^fa Zucker(1961) to Roche to CRLUS(1985) to CRLJ(2000) Charles River Laboratories outbred Unknown Lepr^fa 13432153 2312577 SHR.BN-(D18Rat99-D18Rat82)/Ipcv F₂ rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 31654683 73666623 1 - by flanking markers 18 32165265 72695235 1 - by flanking markers 18 32487692 73016546 1 - by flanking markers 2312578 SHR.BN-(D18Rat82)/Ipcv F₂ rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 73016379 73016546 1 - by flanking markers 2312579 SHR.BN-(D18Rat40-D18Rat82)/Ipcv F₂ rats from SHR x SHR.BN-(D18Rat113-D18Rat82)/Ipcv were genotyped and backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes to get homozygosity Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 62106066 73666623 1 - by flanking markers 18 60695794 72695235 1 - by flanking markers 18 61499531 73016546 1 - by flanking markers 2312580 SHR.BN-(D18Rat113-D18Rat82)/Ipcv SHR/OlaIpcv were crossed with BN/Crl, F₁ animals were backcrossed with SHR/OlaIpcv and genotyped; heterozygotes with the region of interest were backcrossed with SHR/OlaIpcv and segment of interest fixed by intercrossing heterozygotes Czech Academy of Sciences, Prague, Czech Republic congenic Unknown 18 73666205 73666623 1 - by flanking markers 18 72695068 72695235 1 - by flanking markers 18 3719547 73016546 1 - by flanking markers 2312609 MWF-Chr 8^SHR/Rkb MWF/FubRkb male was crossed with female SHR/FubRkb to get F1 animals which in turn were backcrossed with female MWF/FubRkb and the desired consomic selected by marker assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown 2312644 DA.WOKW-(D3Mit10-D3Rat189)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 35797577 35797756 1 - by flanking markers 3 44863125 44863303 1 - by flanking markers 3 39773247 39773425 1 - by flanking markers 2312645 DA.WOKW-(D16Rat88-D16Wox7)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 16 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 16 819225 63306215 1 - by flanking markers 16 1534408 62873174 1 - by flanking markers 16 1550187 63210301 1 - by flanking markers 2312646 DA.WOKW-(D5Mgh6-D5Mit5)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 5 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 5 71814715 109163425 1 - by flanking markers 5 75334610 112058005 1 - by flanking markers 5 71154828 108092802 1 - by flanking markers 2312647 DA.WOKW-(D3Mgh5-D3Rat1)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 3 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 3 97523869 170016653 1 - by flanking markers 3 109733850 180128021 1 - by flanking markers 3 103141814 176418101 1 - by flanking markers 2312648 DA.WOKW-(D10Mgh2-D10Rat4)/K A cross of DA/K and WOKW/K which resulted in a segment of chr 10 from WOKW/K introgressed in DA/K background Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown 10 106422174 107033716 1 - by flanking markers 10 105533457 105533612 1 - by flanking markers 10 105875105 105875260 1 - by flanking markers 2312733 BN-Chr 13^SS Chr 18^SS/Mcwi A cross of BN and SS strains which results in a BN genomic background with a SS chromosomes 13 and 18 introgressed PhysGen consomic Cryopreserved Sperm 2313181 LEW.1WR1/WorBrm Obtained from Hanover Institute, Hanover, Germany in 1989; then maintained in a closed colony by sibling mating at Universtiy of Massachusetts, Worcester, MA then moved to Biomedical Research Models, Inc. Biomedical Research Models, Inc. congenic Unknown 2313209 WF.ART2/Wor developed at the Universtiy of Massachusetts, Medical School Universtiy of Massachusetts, Worcester, MA congenic Unknown 2313221 SHHF-Lepr^cp/Crl Developed by bx SHROB to SHR/N. 1983 from JE Miller, Searle, to McCune after 7th bx, she continued to inbreed to fix congestive heart failure trait. To GMI in 1994, to CR in 2001. Charles River Laboratories congenic Unknown Lepr^cp 11570565 2313222 BN/HsdMcwiCrl BN/NHsdMcwi colony directly from Medical College of Wisconsin by brother-sister mating then to Charles River Charles River Laboratories inbred Unknown 2313231 LEWBNF1/Crl This hybrid rat is a cross between a LEW female and a BN male rat. Charles River Laboratories hybrid Unknown 2313232 WFF344F1/Crl This hybrid rat is a cross between a WF female and a F344 male rat. Charles River Laboratories hybrid Unknown 2313342 BN-Chr 17^LH/Mav Chr 17 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown 2313343 LH-Chr 13^BN/Mav Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Laboratoire de Physiologie, Lyon Cedex , France consomic Unknown 2313384 Wild/Nov These are wild-caught rats selected on the basis of level of tameness and defensive aggression at every generation since 1972 at Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia Institute of Cytology and Genetics, Siberian Branch of the Academy of Sciences, Novosibirsk, Russia wild Unknown 2313463 F344-Ppfia2^{Tn(sb-T2/Bart3)2.339Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 5th intron of the Ppfia2 gene. PhysGen, Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Ppfia2^{Tn(sb-T2/Bart3)2.339Mcwi} 2313459 7 45140154 45616620 1 - by flanking markers 7 48563521 49058116 1 - by flanking markers 7 48548932 49045852 1 - by flanking markers 2313464 F344-Large^{Tn(sb-T2/Bart3)2.336Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Large gene. PhysGen, Transposagen mutant Extinct (as of 2017-01-26) Large^{Tn(sb-T2/Bart3)2.336Mcwi} 2313460 19 12043818 12497663 1 - by flanking markers 19 23595328 24054765 1 - by flanking markers 19 12481563 12945320 1 - by flanking markers 2313465 F344-Pld5^{Tn(sb-T2/Bart3)2.340Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene. PhysGen,Transposagen, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Pld5^{Tn(sb-T2/Bart3)2.340Mcwi} 2313462 13 91715000 92058036 1 - by flanking markers 13 98486317 98812030 1 - by flanking markers 13 94025696 94355219 1 - by flanking markers 2313466 F344-Agbl4^{Tn(sb-T2/Bart3)2.337Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Agbl4 gene. PhysGen, Transposagen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Agbl4^{Tn(sb-T2/Bart3)2.337Mcwi} 2313461 5 134582789 135484937 1 - by flanking markers 5 130742297 131656581 1 - by flanking markers 2313588 SD-Tg(Ins2-IAPP)Soel Crl:SD rats were microinjected with cDNA encompassing the human IAPP was fused with rat insulin II promoter Pfizer, Inc, Groton, Connecticut transgenic Unknown 2313693 SHR-Tg(PEPCK-SREBF1)2Ipcv SHR/OlaIpcv zygotes were microinjected with a construct containing rat PEPCK promoter fused to truncated human cDNA encoding SREBF1 (SREBP-1a isoform) and human growth hormone poly-A signal Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic transgenic Unknown SREBF1 69473 2313734 SD-Tg(H1/tetO-RNAi:Insr)29Bdr Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown 2313735 SD-Tg(H1/tetO-RNAi:Insr)14Bdr Fertilized eggs of NTac:SD were microinjected with a construct containing shRNA cassette containing the insulin receptor under the control of H1 promoter with a tetO site and a cassette driving tetR from CAGGS promoter Max-Delbruck Center for Molecular Medicine, Berlin, Germany transgenic Unknown 2313922 F344-Tg(Cyp1a1-Ren2)10.LEW-(D10Rat142-D10Rat15)/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to F344 females to produce BC-F344. After 12 backcross nerations, males and females heterozygous for F344/Lew in the reduced MOD QTLregion were brother-sister mated to generate aimals that were homozygous Lew/Lew for the MOD QTL region but homozygous F344/F344 for the rest of the genome. Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 92448353 96667338 1 - by flanking markers 10 91113514 95243104 1 - by flanking markers 10 91345679 95508221 1 - by flanking markers 2313923 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10.F344-(D10Rat99-D10Rat11)/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul (also named Ren2.F) males (carrying the transgene Ren2 on chr Y) and Lewis females were bred to produce F1 rats.F1 males were backcrossed to Lew females to produce BC-Lew. After 12 backcross generations, males and females heterozygous for F344/Lew in the MOD QTLregion were brother-sister mated to generate aimals that were homozygous F344/F344 for the MOD QTL region but homozygous LEW/LEW for the rest of the genome. Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK congenic Unknown 10 89278229 100633982 1 - by flanking markers 10 88043769 99184250 1 - by flanking markers 10 88250522 99492409 1 - by flanking markers 2313924 LEW-Chr YF344-Tg(Cyp1a1-Ren2)10/Jmul F344-Tg(Cyp1a1-Ren2)10Jmul males (carrying the transgene Ren2 on chr Y) were backcrossed with LEW females to generate this consomic strain, confirmed by microsatellite markers Molecular Physiology Lab, CVS, QMRI, University of Edinburgh, Edinburgh, UK consomic Unknown 2314001 N:HS Heterogeneous stock Originated from a colony established in 1980 at NIH, animals were bred for 50 generations in a rotational outbreeding regime comprising of 8 inbred progenitors: BN/SsN, MR/N, BUF/N, M520/N, WN/N, ACI/N, WKY/N and F344/N; then to Dr. Eva Redei, Northwestern University (Chicago); 40 breeding pairs were sent from Northwestern University (Chicago) to Barcelona and 25 pairs to Dr. Solberg Woods, Medical College of Wisconsin Dept. of Psychiatry & Forensic Medicine, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain outbred Unknown 2314009 NMcwi:HS Heterogeneous stock 25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy were two parameters are used: The first is the number of cages used for breeding and the second is the spacing between each cage (containing a female for mating) and the cage to which it is mated (containing a male for mating). This spacing is called the rotational delay. A rotational delay of 1 is used, in which a female from cage 1 mates with a male from cage 2, a male from cage 2 mates with a female from cage 3, etc. Department of Pediatrics, Medical College of Wisconsin, Milwaukee, Wisconsin outbred Unknown 2314027 SDT.Cg-Lepr^fa/Jtt SDT fatty Lepr^fa allele from ZDF was introgressed into SDT rats using the speed congenic method Japan Tobacco Inc., Central Pharmaceutical Research Institute, Kanagawa, Japan congenic Unknown 2314161 F344-Kuru1/Kyo Kuru1 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm 2314162 F344-Oune/Kyo Oune A mutant rat showing abnormal tail was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Tbx6 1307716 2314163 F344-Kcna1^Adms/Kyo ADMS (autosomal dominant myokymia and seizures) rat This strain was established by phenotype-driven ENU mutagenesis. A Kcna1 S309T mutation was identified in this model. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-05-04) Kcna1^Adms 12880383 4 163011777 163013522 1 - by flanking markers 4 226188851 226190596 1 - by flanking markers 4 159190781 159192526 1 - by flanking markers 2314164 F344-Kuru2/Kyo Kuru2 A mutant rat showing circling phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm 2314165 ACI-Chib/Kyo Chibi This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology 2314166 F344-Tbr2/Kyo Tsubura2 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm 2314167 F344-Kmch/Kyo Komachi This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm 2314168 F344-Tbr1/Kyo Tsubura1 A mutant rat showing abnormal eyes was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm 2314169 WTC.F344-Scn1a^m1Kyo/Kyo This congenic strain was established by backcrossing F344-Scn1a^m1Kyo onto WTC/Kyo. National BioResource Project for the Rat in Japan congenic Live Animals; Cryopreserved Sperm 2314170 F344-Egr^m1Kyo EGR (Excessive Grooming Rat), Kaikai, Kyo1897 This strain was established by phenotype-driven ENU mutagenesis. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm 2314224 F344.OLETF-(D1Rat166-D1Rat90)/2Tj Congenic strain originated from backcrossing parental F344/Crlj and OLETF/Otk animals. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 1 255026793 267111153 1 - by flanking markers 1 276721459 289137268 1 - by flanking markers 1 269279863 281795785 1 - by flanking markers 2314225 F344-Chr 15^OLETF/Tj Developed by the depositor National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity 2314226 WI-Tg(WSCD2)3Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 2314227 WI-Tg(WSCD2)4Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 2314228 WI-Tg(WSCD2)5Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 2314229 F344.OLETF-(D7Uwm22-D7Mgh20)/Tj Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 7 123733466 123733601 1 - by flanking markers 7 126334525 126334660 1 - by flanking markers 7 126622888 126623023 1 - by flanking markers 2314230 F344-Hr^krh/Kyo Hairless Kyoto, Hanako A mutant rat showing abnormal skin phenotype was found in the G1 rats produced by ENU mutagenesis (phenotype-driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology; Urology 2314231 F344.OLETF-(D5Mgh5-D5Mgh23)/2Tj Male OLETF was crossed with female F344. F1 were backcrossed to female F344 for 5 generations. Microsatellite-based genotyping was performed to select the best male that had the best OLETF donor genome. Once the region was fixed the resultant congenic strain was maintained by brother-sister mating.37.4 cM segment of the OLETF genome was transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 45499364 115361927 1 - by flanking markers 5 49028773 117961491 1 - by flanking markers 5 44404276 114014945 1 - by flanking markers 2314232 WI-Tg(WSCD2)1Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 2314243 SHR.WKY-(D1Mgh2-D1Wox10)/IzmTkyo Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio Hypertension 1 22842898 220639653 1 - by flanking markers 1 24875821 244066407 1 - by flanking markers 1 23406428 236763528 1 - by flanking markers 2314244 BCR/Nn In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology 2314245 WI-Tg(WSCD2)6Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm WSCD2 1605710 2314246 SHRSP.WKY-(D1Rat117-D1Rat90)/IzmTkyo Developed by the Depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Cardio Hypertension 1 219629755 267111153 1 - by flanking markers 1 240604381 289137268 1 - by flanking markers 1 233490105 281795785 1 - by flanking markers 2314247 WI-Tg(Prl-EGFP)Yamp A transgenic construct was designed with the rat prolactin promoter (-3221 - 3233) controlling EGFP. Transgenic rats originated from Crlj:WI (Wistar) rats National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Metabolism; Development 2314313 NER.F344-(D5Rat100-D5Rat234)/Kyo The Ner3 region (D5Rat100-D5Rat234) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 5 68843563 68843964 1 - by flanking markers 5 70180341 70180484 1 - by flanking markers 5 65696672 65696815 1 - by flanking markers 2314314 NER.F344-(D1Mgh6-D1Rat132)/Kyo The Ner1 region (D1Mgh6-D1Rat132) was introgressed from F344/NSlc onto NER/Kyo by backcross breeding. National BioResource Project for the Rat in Japan congenic Unknown Neurobiology 1 87656636 165996388 1 - by flanking markers 1 92524380 179788206 1 - by flanking markers 1 91394009 172789257 1 - by flanking markers 2314315 F344.NER-(D5Mgh4-D5Rat36)/Kyo The Ner3 region (D5Mgh4-D5Rat36) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 5 145186817 145187034 1 - by flanking markers 5 147610023 147610238 1 - by flanking markers 5 143846157 143846372 1 - by flanking markers 2314316 F344.NER-(D1Mgh6-D1Rat73)/Kyo The Ner1 region (D1Mgh6-D1Rat73) was introgressed from NER/Kyo onto F344/NSlc by backcross breeding. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 87656636 224420760 1 - by flanking markers 1 92524380 246113473 1 - by flanking markers 1 91394009 238824901 1 - by flanking markers 2314317 WTC.GRY-Cacna1a^gry/Kyo Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-05-04) Neurobiology Cacna1a|Cacna1a^gry 2244|12880382 2314339 F344-Patj^{Tn(sb-T2/Bart3)2.343Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene. PhysGen, Rat Resource & Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Patj^{Tn(sb-T2/Bart3)2.343Mcwi} 2314335 5 118806744 119131114 1 - by flanking markers 5 120981525 121281044 1 - by flanking markers 5 117038548 117340308 1 - by flanking markers 2314340 F344-Acoxl^{Tn(sb-T2/Bart3)2.342Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 10th intron of the Acoxl gene. PhysGen mutant Extinct (as of 2016-10-24) Acoxl^{Tn(sb-T2/Bart3)2.342Mcwi} 2314337 3 115365279 115687566 1 - by flanking markers 3 126606586 126919666 1 - by flanking markers 3 120414311 120724809 1 - by flanking markers 2314341 F344-Auts2^{Tn(sb-T2/Bart3)2.344Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 14th intron of the Auts2 gene. PhysGen mutant Extinct (as of 2016-10-24) Auts2^{Tn(sb-T2/Bart3)2.344Mcwi} 2314338 12 25518248 25541023 1 - by flanking markers 2314342 F344-Palld^{Tn(sb-T2/Bart3)2.341Mcwi} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 19th intron of the Palld gene. PhysGen mutant Extinct (as of 2017-01-26) Palld^{Tn(sb-T2/Bart3)2.341Mcwi} 2314336 16 31144028 31144544 1 - by flanking markers 16 31198863 31240064 1 - by flanking markers 16 31349140 31390340 1 - by flanking markers 2314360 ACI.F344-(D16Mit5-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Rat12-D16Mco2)Nkg onto ACI/NJcl, followed by intercrossing in N6 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer 2314361 W-Tg(Slc32a1-YFP*)1Yyan This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development 2314362 F344-Hrdk/Kyo Hairless dominant Kyoto Hairless mutation was found in the G1 rats that established by ENU mutagenesis (phenotype driven). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm 2314363 W-Tg(Slc32a1-YFP*)2Yyan This transgenic rat was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm Neurobiology; Development 2314364 ACI.F344-(D16Nkg112-D16Nkg27)/Nkg This congenic strain was established by backcrossing ACI.F344-(D16Nkg9-D16Nkg27)Nkg onto ACI/NJcl, followed by intercrossing in N3 generation, thereafter maintained by crossing homozygous individuals. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cancer 2314365 KFRS2/Kyo A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology Tyr|Tyr^siaKyo 1589755|13207345 1 143641257 143746315 1 - by flanking markers 1 157322968 157416594 1 - by flanking markers 1 151012598 151106802 1 - by flanking markers 2314368 F344-Trdk/Kyo Tremor dominant Kyoto Tremor dominant Kyoto (Trdk) mutation is an autosomal dominant mutation that appeared in 2008 in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU) (Mashimo et al., 2008). Rats heterozygous for Trdk (Trdk/+) exhibited tremor behavior that was evident around weaning. To remove latent ENU-induced mutations, the laboratory established an F344-Trdk/+ congenic strain by nine rounds of backcrossing. Using positional candidate approach, Trdk mutation was identified as a missense substitution (c. 866 T > A, p. I289N) in Kcnn2,. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-15) Neurobiology Kcnn2^Trdk 149735330 18 39560962 39705037 1 - by flanking markers 18 38822146 38864110 1 - by flanking markers 18 39331894 39479574 1 - by flanking markers 2314375 LE.AR-Ednrb^sl/Okkm AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008). National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-03-28) Internal Organ Ednrb|Ednrb^sl 2536|10755424 15 87893141 87898700 1 - by flanking markers 15 91500400 91531979 1 - by flanking markers 15 88004775 88036354 1 - by flanking markers 2314376 KFRS4/Kyo A male rat "TSR Louis" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "TSR Louis" and a female PVG/Seac. This strain carries two mutations, head spot (hs) which causes white spotting on the head, and dumbo (dmbo) which causes abnormal ear morphology (Kuramoto, 2010, RGD:7800655). Ears are set lower on the head, and are larger and rounder. Genetic analyses mapped hs to Chr 15 and dmbo to Chr 14. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Embryo (as of 2021-10-05) Ophthalmology; Dermatology 2314377 KFRS3B/Kyo A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology 2314378 AR-Ednrb^sl/Okkm Aganglionosis rat Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR) National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-10-31) Internal Organ Ednrb|Ednrb^sl 2536|10755424 15 87893141 87898700 1 - by flanking markers 15 91500400 91531979 1 - by flanking markers 15 88004775 88036354 1 - by flanking markers 2314379 KFRS6/Kyo A male rat "SRR Tustin" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Tustin" and a female TM/Kyo. National BioResource Project for the Rat in Japan mutant Live Animals Dermatology 2314380 SD-Tg(CAG-lacZ)541Htsu Developed by the depositor National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 2314381 KFRS5A/Kyo A male rat "SRR Coming Home" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR Coming Home" and a female TM/Kyo. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Dermatology Krt71^Rex 11570416 2314382 SD-Tg(CAG-HRAS*G12V)250Htsu This transgenic strain was established by CLEA Japan, Inc. The construct is as follows: CAG promoter, loxP sequence, neomycin resistance gene, loxP sequence and Ha-ras*G12V (HrasV12). It was injected into Jcl:SD embryos, the transgene is regulated by the Cre/loxP system. Human Ha-ras*G12V oncogene is driven by CAG promoter National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Cancer HRAS 730881 2314383 KFRS3A/Kyo A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Ophthalmology; Dermatology 2314396 LCR/Mco Low-capacity runners Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. Medical College of Ohio, Toledo, Ohio, USA inbred Unknown 2314397 HCR/Mco High-capacity runners Artificially selected for intrinsic aerobic running capacity from the heterogenous stock (N:HS); these were selected for high capacity based on distance run to exhaustion on a motorized treadmill. Medical College of Ohio, Toledo, Ohio, USA inbred Unknown 2314414 LEW-Tg(H1/tetO-RNAi:Insr)87Hrjb LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 2314415 LEW-Tg(H1/tetO-RNAi:Insr)4Hrjb LEW/Crl rat embryos were microinjected with an lentiviral single vector system comprising of Insr-specific shRNA construct under the control of H1t promoter Department of Cellular and Molecular Immunology, University of Gottingen, Gottingen, Germany transgenic Unknown Insr 2917 2314477 LEW-RT1^DA/Rrrc Sprague-Dawley RT1^u haplotype backcrossed onto Lewis inbred strain. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm 2314478 LEW-RT1.B^m1Trg/Rrrc RT1.B ENU induced mutation in a Sprague Dawley rat resulting in a phenotypic change at the RT1.B MHC locus such that antibody binding to the RT1.B locus is no longer present. Animals carrying this mutation fail to have OX-6 antibody binding to the RT1.B locus. The exact nature of the mutation has not been genetically characterized. Mutation was backcrossed onto the Lewis strain. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm 2314492 SBN.SBH-(D1Rat148-D1Rat89)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 16325337 265343617 1 - by flanking markers 1 18951160 287349830 1 - by flanking markers 1 16470664 279986079 1 - by flanking markers 2314493 SBH.SBN-(D1Mgh2-D1Rat74)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 227005733 1 - by flanking markers 1 24875821 248763894 1 - by flanking markers 1 23406428 241482368 1 - by flanking markers 2314494 SBH.SBN-(D1Rat137-D1Rat123)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 223729371 1 - by flanking markers 1 95325941 245519018 1 - by flanking markers 1 94225372 238220385 1 - by flanking markers 2314495 SBN.SBH-(D1Rat27-D1Mit7)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90282040 240980321 1 - by flanking markers 1 95301716 262617374 1 - by flanking markers 1 94201400 94201552 1 - by flanking markers 2314496 SBH.SBN-(D1Mgh2-D1Mgh11)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 22843363 1 - by flanking markers 1 24875821 24875970 1 - by flanking markers 1 23406428 23406577 1 - by flanking markers 2314497 SBN.SBH-(D1Rat101-D1Rat74)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing male SBN/Ygl with female SBH/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 97174943 227005733 1 - by flanking markers 1 103735751 248763894 1 - by flanking markers 1 102658741 241482368 1 - by flanking markers 2314498 SBH.SBN-(D1Rat137-D1Rat83)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 90306033 252133935 1 - by flanking markers 1 95325941 274017147 1 - by flanking markers 1 94225372 266587220 1 - by flanking markers 2314499 SBN.SBH-(D1Mgh17-D1Mgh14)/Ygl Segment of interest from chr 1 of SBH/Ygl was introgressed onto the genetic background of SBN/Ygl this was done by crossing female SBN/Ygl with male SBH/Ygl fixing the Y chr to SBH/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 9082836 263699089 1 - by flanking markers 1 10007292 285604895 1 - by flanking markers 1 8387052 278228889 1 - by flanking markers 2314500 SBH.SBN-(D1Mgh2-D1Rat101)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing female SBH/Ygl with male SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 22842898 97175101 1 - by flanking markers 1 24875821 103735908 1 - by flanking markers 1 23406428 102658898 1 - by flanking markers 2314501 SBH.SBN-(D1Wox11-D1Rat137)/Ygl Segment of interest from chr 1 of SBN/Ygl was introgressed onto the genetic background of SBH/Ygl this was done by crossing male SBH/Ygl with female SBN/Ygl fixing the Y chr to SBN/Ygl Ben Gurion University Barzilai Medical Center, Ashkelon, Israel congenic Unknown 1 64145811 90306478 1 - by flanking markers 1 63399232 95326185 1 - by flanking markers 1 64407177 94225616 1 - by flanking markers 2314530 SS.SHR-(D8Uia1-D8Rat90)/Mco SS/Jr females were bred with SHR/NHsd males and their female F₁ were backcrossed to SHR/NHsd males; this ensured that the mitochondrial genome came from SS/Jr; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 2314531 SHR.SS-(D13Rat1-D13Mgh6)/Mco SS/Jr females were bred with SHR/NHsd males and their male F₁ were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic Unknown 13 10555730 101704301 1 - by flanking markers 13 29679984 108279142 1 - by flanking markers 13 24501968 103613733 1 - by flanking markers 2314532 SHR.SS-(D8Uia1-D8Rat90)/Mco SS/Jr females were bred with SHR/NHsd males and their male F₁ were backcrossed to SHR/NHsd females; this ensured that the mitochondrial genome came from SHR/NHsd; further selection was done using microsatellite markers Medical College of Ohio, Toledo, Ohio congenic Unknown 8 19055857 114974688 1 - by flanking markers 8 20954930 118204000 1 - by flanking markers 8 118862625 118862813 1 - by flanking markers 2314655 BRAT-Avp^di/BluHsd Brattleboro Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) Avp^di 13627261 3 118205007 118206985 1 - by flanking markers 3 129615610 129627147 1 - by flanking markers 3 123117482 123119460 1 - by flanking markers 2314861 WAG/RijYcb Substrain of WAG/Rij; from Netherlands to Yale University. Comparative Medicine, Yale University, Connecticut inbred Unknown 2314904 WAG-F8^m1Ycb This mutant strain carrying a naturally occurring missense mutation displays inherited coagulopathy was arising in an inbred colony of WAG/RijYcb (RGD:2314861). Mutation in the nucleotide 578 of the rat F8 gene changes amino acid 193 in the rat protein(amino acid 176 in human)from Leucine to Proline. Comparative Medicine, Yale University, Connecticut mutant Unknown F8^m1Ycb 2314903 18 121134 162008 1 - by flanking markers 18 413447 444491 1 - by flanking markers 18 367862 399242 1 - by flanking markers 2314928 Slc:W Slc: Wistar Institute of Medical Science, University of Tokyo(1974). Hysterectomy and fostering are used for obtaining SPF animals of this strain. SLC, Japan outbred Unknown 2314934 WST.F344-Ker/Kyo Wistar/ST-Boo This congenic strain was established by backcrossing F344-Ker/Kyo (NBRP No.0458) onto Slc:WST National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2314935 WST.F344-Kmch/Kyo Wistar/ST-Komachi This congenic strain was established by backcrossing F344-Kmch/Kyo (NBRP No.0458) onto Slc:WST. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm 2314936 WI-Tg(WSCD2)Tkyo A transgenic construct consisting of the human WSC domain containing 2 (WSCD2, also known as KIAA0789) within pEF6/Myc-HisA (downstream of the EF-1a promoter and upstream of the bovine growth hormone polyA signal) was injected into Wistar rat (Crlj:WI) embryos. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-24) 2314937 F344.OLETF-(D5Mgh20-D5Mgh22)/Tj Developed by the depositor National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity 5 140925168 157584492 1 - by flanking markers 5 143051962 160953783 1 - by flanking markers 5 139267814 157212422 1 - by flanking markers 2316631 F344.GK-(D1Swe8-D1Gpam-1)/Swe This sub-congenic strain is generated from an F₂- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown Adra2a|Pdcd4|Shoc2 2056|620816|1308146 1 259866528 259866737 1 - by flanking markers 1 281763458 281763667 1 - by flanking markers 1 274353782 274353991 1 - by flanking markers 2316632 NEDH/KSim New England Deaconess Hospital Inbred from Wistar rats by S. Warren then to Simonsen Laboratories in 1987 by B. Hoffman Simonsen Laboratories inbred Unknown 2316633 F344.GK-(D1Got251-D1Gpam-1)/Swe This sub-congenic strain is generated from an F₂- intercross between F344/DuCrlSwe and F344.GK-(D1Arb42a-D1Rat90)/Swe Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 260641680 260641846 1 - by flanking markers 1 282550224 282550389 1 - by flanking markers 1 275138749 275138914 1 - by flanking markers 2316653 SS.LEW-(D1Mco102-D1Got46)/Mco A sub-congenic strain derived from SS.LEW-(D1Uia8-D1Rat18)/Mco contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1;17 38394289;2374083 38394434;2374266 1 - by flanking markers;1 - by flanking markers 1 36290530 45656739 1 - by flanking markers 1 34888392 44326906 1 - by flanking markers 2316654 SS.LEW-(D1Mco102-D1Mco129)/1Mco A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 2316655 SS.LEW-(D1Mco102-D1Mco129)/2Mco A sub-congenic strain derived from SS.LEW-(D1Mco102-D1Got46)/Mco contributing to the introgressed LEW allele crossed to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 17 2374083 3178843 1 - by flanking markers 1 36290530 37078065 1 - by flanking markers 1 34888392 35680732 1 - by flanking markers 2316925 SHR.BN-(D3Rat159-D3Rat1)/Mco 50.6 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 3 119437175 170016653 1 - by flanking markers 3 130776038 180128021 1 - by flanking markers 3 124284647 176418101 1 - by flanking markers 2316927 SHR.BN-(D6Rat40-D6Rat170)/Mco 45.5 Mb region of BN/SsNHsd is introgressed into the genomic background of SHR/NHsd Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 6 1301952 46792623 1 - by flanking markers 6 1111498 56881356 1 - by flanking markers 6 1120393 48179481 1 - by flanking markers 2316928 SHR.BN-(D3Rat159-D3Rat1)(D6Rat40-D6Rat170)/Mco this double congenic strain is bred by crossing female SHR.BN-(D6Rat40-D6Rat170)/Mco with male SHR.BN-(D3Rat159-D3Rat1)/Mco and selecting heterozygous animals in the F1 progeny; these were then mated to fix the BN allele Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 2317196 DA.PVG.1AV1-(D8Rat146-D8Got145) Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (73.1-91.3 Mb) region that has the region of interest Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 73105403 91329867 1 - by flanking markers 8 76885501 93261060 1 - by flanking markers 8 74920991 93746162 1 - by flanking markers 2317197 DA.PVG.1AV1-(D8Rat41-D8Rat24) Males with PVG.1AV1 allele were selected from the G8 advanced intercross line (AIL) and mated with DA females to tranfer a short well-defined (50.4-82.2 Mb) region that has the region of interest Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 50354908 82247243 1 - by flanking markers 8 50240107 84140836 1 - by flanking markers 8 51633707 84569318 1 - by flanking markers 2317201 DA.PVG.1AV1-(D8Rat24-D8Got145) DA.PVG.1AV1-(D8Rat146-D8Got145) was backcrossed to the recipient DA for 9 generations to create this congenic with less than 0.1% genome outside the desired locus Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden congenic Unknown 8 82246890 91329867 1 - by flanking markers 8 84140683 93261060 1 - by flanking markers 8 84569165 93746162 1 - by flanking markers 2317278 Taiep/Dun These mutants were found in Sprague-Dawley rats at University of Puebla in 1989 Dept of Medical Sciences, University of Wisconsin-Madison, Madison, Wisconsin mutant Unknown 2317590 DA.PVG.1AV1-(D4Rat23-D4Rat108)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 82090355 1 - by flanking markers 4 58518376 148552304 1 - by flanking markers 4 83889402 83889539 1 - by flanking markers 2317595 DA.PVG.1AV1-(D4Rat23-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 58550170 104416171 1 - by flanking markers 4 58518376 163844298 1 - by flanking markers 4 99066972 99067150 1 - by flanking markers 2317596 DA.PVG.1AV1-(D4Rat103-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 82700691 104416171 1 - by flanking markers 4 149135946 163844298 1 - by flanking markers 4 84475257 99067150 1 - by flanking markers 2317598 DA.PVG.1AV1-(D4Rat231-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 88462327 104416171 1 - by flanking markers 4 154593964 163844298 1 - by flanking markers 4 89777552 99067150 1 - by flanking markers 2317599 DA.PVG.1AV1-(D4Got211-D4Mit12)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 79604076 104416171 1 - by flanking markers 4 145804154 163844298 1 - by flanking markers 4 81136696 99067150 1 - by flanking markers 2317791 DA.PVG.1AV1-(D4Got60-D4Kini1)/Kini Congenic substrain established by intercrossing DA.PVG.1AV1-(D4Rat155-Spr) with parental DA/Kini Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 80704779 81729771 1 - by flanking markers 4 147125280 148194009 1 - by flanking markers 4 83531021 83531176 1 - by flanking markers 2317812 AT.ANT-(D1Uia12-D1Rat288)/Rar F₂ males with desired fragment of ANT were selected by genotyping and backcrossed to AT rats, this process was repeated for 6 generations and offsprings were tested University of Colorado Denver, Colorado, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-26) 1 134007903 192038535 1 - by flanking markers 1 140949643 211567839 1 - by flanking markers 1 139972085 139972231 1 - by flanking markers 2317813 AT.ANT-(D1Rat234-D1Rat47)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 158511230 1 - by flanking markers 1 172296302 172296459 1 - by flanking markers 1 166100317 166100474 1 - by flanking markers 2317814 AT.ANT-(D1Rat273-D1Rat158)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 140644473 153578547 1 - by flanking markers 1 147436666 167535765 1 - by flanking markers 1 146507930 161321256 1 - by flanking markers 2317815 AT.ANT-(D1Rat35-D1Rat47)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 124748920 158511230 1 - by flanking markers 1 131958920 172296459 1 - by flanking markers 1 130917121 166100474 1 - by flanking markers 2317816 AT.ANT-(D1Rat234-D1Rat158)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 153578547 1 - by flanking markers 1 167535661 167535765 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 2317817 AT.ANT-(D1Rat183-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 131123181 192038535 1 - by flanking markers 1 138077032 211567839 1 - by flanking markers 1 137083889 137084126 1 - by flanking markers 2317818 AT.ANT-(D1Rat273-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 140644473 192038535 1 - by flanking markers 1 147436666 211567839 1 - by flanking markers 1 146507930 146508090 1 - by flanking markers 2317819 AT.ANT-(D1Rat35-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 124748920 192038535 1 - by flanking markers 1 131958920 211567839 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 2317820 AT.ANT-(D1Rat158-D1Rat288)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat288)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 153578442 192038535 1 - by flanking markers 1 167535661 211567839 1 - by flanking markers 1 161321152 161321256 1 - by flanking markers 2317822 AT.ANT-(D1Rat35-D1Rat38)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 124748920 133567105 1 - by flanking markers 1 131958920 140507239 1 - by flanking markers 1 130917121 139524104 1 - by flanking markers 2317825 AT.ANT-(D1Rat234-D1Rat35)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 124749065 1 - by flanking markers 1 131958920 131959064 1 - by flanking markers 1 130917121 130917265 1 - by flanking markers 2317827 AT.ANT-(D1Rat234-D1Rat38)/Rar This sub-congenic was developed by crossing AT.ANT-(D1Rat234-D1Rat228)/Rar with AT University of Colorado Denver, Colorado congenic Unknown 1 41225047 133567105 1 - by flanking markers 1 140507063 140507239 1 - by flanking markers 1 139523928 139524104 1 - by flanking markers 2317891 SHR-Chr 6^MWF/Rkb SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown 2324631 DA.E3-(D4Wox49-D4Got136)/Rhd This congenic strain was obtained by the conventional backcross breeding to the parental DA strain with the negative selection of all known Pia QTLs and positive selection of microsatellite markers. Medical Inflammation Research, Karolinska Institutet, Stockholm, Sweden. congenic Unknown Clec4a3 1359528 4 159060677 160528447 1 - by flanking markers 4 222438489 223964695 1 - by flanking markers 4 155414290 156945571 1 - by flanking markers 2325143 SHR/NHsdMco Spontaneously Hypertensive Rat SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown 2325145 LEW/CrlMco Lewis These were obtained from Charles River and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown 2325146 MNS/NMco Milan normotensive strain These were originally obtained from Veterinary Resource Branch, National Institutes of Health (Bethesda, MD) and maintained at University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. University of Toledo, College of Medicine (Medical College of Ohio), Toledo, Ohio. inbred Unknown 2325202 SS/JrSeac Dahl Salt-Sensitive Substrain of Dahl SS, from a Sprague-Dawley outbred colony, selected for sensitivity to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio- Hypertension 2325206 LEW/Seac Substrain of LEW, from Dr Margaret Lewis from Wistar stock in early 1950s to Seac Yoshitomi, LTD Japan Seac Yoshitomi, LTD Japan inbred Unknown 2325209 SHRSP/Hos Substrain of SHRSP purchased from Sankyo Lab Service, Japan. Sankyo Lab Service, Japan. inbred Unknown 2325724 PVG.LEW-(D1Rat270-D1Rat68)/Kini 63-Mb fragment was selectively transferred from LEW.1AV1 to PVG.1AV1 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 130290073 193070197 1 - by flanking markers 1 136616460 212591221 1 - by flanking markers 1 135611773 205603226 1 - by flanking markers 2325754 SD-Pax6^Sey/Mce Autosomal dominant mutation that arose spontaneously in SD rats. Genomic DNA analysis from mutants revealed a single base(G) insertion in the exon generating a novel 5' donor splice site. This led to the internal a 602-bp deletion of Pax6 mRNA. Department of Ophthalmology, Okayama University Medical School, Okayama, Japan mutant Unknown Pax6|Pax6^Sey 3258|737688 3 91127605 91149178 1 - by flanking markers 3 102320059 102348223 1 - by flanking markers 3 95700241 95728682 1 - by flanking markers 2325773 WKY.LEW-(D13Arb15-D13Rat58)/Tja Segment of interest from chr 13 of LEW/SsNHsd was introgressed into WKY/NCrl Imperial College, London, UK congenic Unknown 13 71116479 96441728 1 - by flanking markers 13 78673431 103987907 1 - by flanking markers 13 73748382 98985851 1 - by flanking markers 2325774 WKY.LEW-(D13Arb10-D13Arb15)(D16Rat88-D16Rat40)/Tja WKY.LEW-(D13Arb10-D13Arb15) were crossed with WKY.LEW-(D16Rat88-D16Rat40), the F₁ were backcrossed to WKY.LEW-(D13Arb10-D13Arb15) and then the offsprings were intercrossed Imperial College, London, UK, Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 2325796 SS.LEW-(D3Rat52-D3Chm57)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Rat130)/Ayd Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 3 14051872 24716931 1 - by flanking markers 3 19410399 34290625 1 - by flanking markers 3 14090411 29084626 1 - by flanking markers 2325798 SS.LEW-(D10Got112-Igfbp4)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Rat27-Igfbp4)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown Igfbp4 2875 10 79857808 87834315 1 - by flanking markers 10 78816241 86759484 1 - by flanking markers 10 78970279 86962563 1 - by flanking markers 2325801 SS.LEW-(D16Chm36-D16Mit2)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 890512 4304517 1 - by flanking markers 16 1604056 5038806 1 - by flanking markers 16 1619835 5098704 1 - by flanking markers 2325803 SS.LEW-(D16Rat112-D16Chm60)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D16Rat12-D16Chm23)/Ayd Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 16 64718 3165043 1 - by flanking markers 16 773329 3491557 1 - by flanking markers 16 778415 3525217 1 - by flanking markers 4107048 SS.SR-(D7Rat16-D7Rat189)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 120385575 1 - by flanking markers 7 112143411 123228091 1 - by flanking markers 7 112204378 123243402 1 - by flanking markers 4107052 SS.SR-(D7Rat16-D7Mgh5)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 115820414 1 - by flanking markers 7 112143411 119125830 1 - by flanking markers 7 112204378 119131068 1 - by flanking markers 4107055 SS.SR-(D7Rat16-D7Rat176)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 108647236 111200952 1 - by flanking markers 7 112143411 114641749 1 - by flanking markers 7 112204378 114708307 1 - by flanking markers 4107057 SS.SR-(D7Mco7-D7Rat81)/Jr Congenic substrain derived by crossing the congenic strain SS.SR-Cyp11b1/Jr to SS/Jr to isolate which contains a smaller SR/Jr derived chromosome 7 segment Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7 112979256 129500555 1 - by flanking markers 7 116059683 131926277 1 - by flanking markers 7 132252091 132252361 1 - by flanking markers 4107063 SS.LEW-(D1Uia8-D1Rat124)/Mco A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 4107065 SS.LEW-(D1Uia8-D1Rat213)/Mco A sub-congenic strain derived from SS.LEW-(D1Rat268-D1Got35)/Jr contributing to the introgressed LEW allele Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio congenic Unknown 1 81548753 81548909 1 - by flanking markers 1 84537073 84537228 1 - by flanking markers 1 83282659 83282814 1 - by flanking markers 4139872 SS-Nckap5^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5^em2Mcwi 4139862 13 38444115 39275959 1 - by flanking markers 13 47369687 48273649 1 - by flanking markers 13 42265875 43049232 1 - by flanking markers 4139873 SS-Rag1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Rag1^em2Mcwi 4139866 3 86780782 86791878 1 - by flanking markers 3 97866048 97877145 1 - by flanking markers 3 91206394 91217491 1 - by flanking markers 4139874 SS-Ets1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ets1^em1Mcwi 4139856 8 32481694 32545237 1 - by flanking markers 8 33798598 33921593 1 - by flanking markers 8 33756634 33879625 1 - by flanking markers 4139875 FHH-Chr 1^BN-Sorcs1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1^BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs1^em1Mcwi 4139864 1 255767411 256279565 1 - by flanking markers 1 277404996 277912261 1 - by flanking markers 1 269965824 270473097 1 - by flanking markers 4139877 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rab38^em1Mcwi 4139867 1 144783919 144864573 1 - by flanking markers 1 158385888 158466621 1 - by flanking markers 1 152072716 152153449 1 - by flanking markers 4139878 SS-Mmp2^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Unknown (as of 2017-07-18) Mmp2^em2Mcwi 4139869 19 15246036 15275061 1 - by flanking markers 19 26629728 26658966 1 - by flanking markers 19 15542771 15570589 1 - by flanking markers 4139879 SS-Nckap5^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct Nckap5^em1Mcwi 4139859 13 38444115 39275959 1 - by flanking markers 13 47369687 48273649 1 - by flanking markers 13 42265875 43049232 1 - by flanking markers 4139880 SS-Ren^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Ren^em1Mcwi 4139863 13 46262936 46275213 1 - by flanking markers 13 55555583 55566812 1 - by flanking markers 13 50502724 50513953 1 - by flanking markers 4139881 SS-Nckap5^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Nckap5^em3Mcwi 4139861 13 38444115 39275959 1 - by flanking markers 13 47369687 48273649 1 - by flanking markers 13 42265875 43049232 1 - by flanking markers 4139882 SS-Nppa^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Nppa^em4Mcwi 4139857 5 165074518 165075827 1 - by flanking markers 5 168466309 168467618 1 - by flanking markers 5 164808407 164809716 1 - by flanking markers 4139883 SS-Nox4^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Nox4^em2Mcwi 4139868 1 143415816 143603554 1 - by flanking markers 1 157106652 157285107 1 - by flanking markers 1 150796359 150976186 1 - by flanking markers 4139884 SS-Rag1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Rag1^em1Mcwi 4139865 3 86780782 86791878 1 - by flanking markers 3 97866048 97877145 1 - by flanking markers 3 91206394 91217491 1 - by flanking markers 4139885 SS-Sh2b3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Sh2b3^em1Mcwi 4139858 12 35954679 35958446 1 - by flanking markers 12 42132947 42136714 1 - by flanking markers 12 40261990 40265757 1 - by flanking markers 4139889 BHD/Dspe Birt-Hogg-Dube rat A rat showing hereditary renal cell carcinoma was found in a Jcl:SD rat colony and named Nihon rat. In this rat strain mutation was identified as an insertion of a cytosine (C) in a C tract within exon 3 of Flcn . This germline mutation results in a frameshift and produces a stop codon 26 amino-acids downstream. Thereafter they have been maintained at Dainippon Sumitomo Pharma Co., Ltd. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2018-06-06) Flcn 735088 4139890 TT/Sgn Rats with bilateral small testes were found in a Wistar-Imamichi derived inbred strain in 1986 at the Institute for Animal Reproduction. TT was established from these mutant rats as known as aspermia rats. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Fkbp6 1308926 12 22474002 22544784 1 - by flanking markers 12 26363264 26435311 1 - by flanking markers 12 24365941 24438088 1 - by flanking markers 4139891 F344-Chr 3^SDT/Nyo This consomic strain carries Chromosome 3 of SDT/Jcl on F344/NSlc background. National BioResource Project for the Rat in Japan consomic Cryopreserved Embryo Diabetes Obesity 4139892 ALD/Hyo acid lipase deficiency rat In a colony of Donryu rats, Yoshida found a male rat showing hepatomegaly and splenomegaly in 1981. These mutant rats were transferred to Kagoshima University and maintained in heterozygous condition so far. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Metabolism Lipa 3008 4140402 W-Tg(Gh1as)Nibs The construct which contains of rat growth hormone (Gh1) promoter, 4 copies of thyroid hormone response element (TRE), and antisense sequences for rat Gh1 cDNA was injected into Jcl:Wistar embryo (Matsumoto, 1993). This transgenic rat was established at NT Science in 1992, and transferred to Japan Bio Science Laboratory Co., Ltd. in 2003. This strain has been maintained at Nagasaki University Graduate School of Biomedical Science. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 4140403 SD-Tg(Eno2-ATXN3*64Q)29Kakiz Background strain is Slc:SD. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology 4140404 ODS-Gulo^od/od/ShiJcl Osteogenic disorder Shionagi rat Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. CLEA Japan, Inc inbred Live Animals (as of 2021-04-29) Gulo^od 126848761 4140405 LEXF6A/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo 4140406 SHRSP.WKY-(D1Wox29-D1Arb21)/IzmDmcr To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from WKY/Izm to SHRSP/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 4140407 SDT.BN-Gluco13/Nyo The Gluco13 (Gisdt1) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N9F6, May 2010) Please refer to STD.BN-Gluco14/Nyo (NBRP No. 0602). National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity 4140408 LEXF8C/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo 4140409 COP-Chr 16^DA/McoRrrc Transfer of the DA-rat chromosome 16 (RNO16) into the COP-rat background University of Toledo College of Medicine, Toledo, Ohio consomic Unknown 4140410 SD-Tg(Eno2-ATXN3*64Q)16Kakiz Background strain is Slc:SD. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology 4140411 SDT.BN-Gluco14/Nyo The Gluco14 (Gisdt2) region of BN/Seac was transferred onto the genetic background of SDT/Jcl strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N10F6, May 2010) Please refer to STD.BN- Gluco13/Nyo (NBRP No. 0601). National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity 4140412 LEXF1D/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo 4140413 LEXF1B/Stm The LEXF/FXLE RI strain set has been established by Shisa et al at Saitama Cancer Center Research Institute since 1985. National BioResource Project for the Rat in Japan recombinant_inbred Cryopreserved Embryo 4140414 WKY.SHRSP-(D1Wox29-D1Arb21)/IzmDmcr To establish this congenic strain, the genetic region in which contains a QTL that is responsible for hypertension in SPRSP was introgressed from SHRSP/Izm to WKY/Izm by repeated backcrossing following sib-mating. This congenic strain was established to cover the QTL region between D1Wox29 and D1Arb21. National BioResource Project for the Rat in Japan congenic Unknown 1 124614679 187092492 1 - by flanking markers 1 131822204 206277202 1 - by flanking markers 1 130779148 199254774 1 - by flanking markers 4140415 TRMRC/Kyo The coisogenic control strain for the TRMR strain (NBRP No.0016). National BioResource Project for the Rat in Japan coisogenic Live Animals; Cryopreserved Sperm 4140416 SD-Tg(Eno2-Vcp)16Kakiz This transgenic strain was generated by microinjection into Slc:SD fertilized eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Neurobiology 4140469 F344-Kmch/NSlc Komachi from NBRP National BioResource Project for the Rat in Japan mutant Unknown 4142540 SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 26280781 47890193 1 - by flanking markers 4 26659360 48448808 1 - by flanking markers 4 26753655 48656399 1 - by flanking markers 4142541 W-Tg(Tek-GFP)1Soh This transgenic strain was generated by microinjection into fertilized oocytes of Wistar rats. The vector containing the Tek/GFP plasmid (pSP14/15.t2hgfpPan5) was a gift from Dr. TN Sato of University of Texas Southwestern Medical Center at Dallas. The transgene was excised from the plasmid vector by Sal I digestion. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm 4142542 BN.SDT-Gluco14/Nyo The Gluco14 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F10, July 2010) Please refer to STD.BN-Gluco14/Nyo. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity 4142543 BN.SDT-Gluco13/Nyo The Gluco13 region, one of the significant QTL for glucose intolerance of SDT/Jcl was transferred onto the genetic background of BN/Seac strain. Established by speed congenic method since 2003 and afterwards maintained by sib mating (N6F11, July 2010). Please refer to STD.BN-Gluco13/Nyo. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Diabetes Obesity 4142544 WKY/Kiha A WKY rat showing higher serum adiponectin concentration was found in Department of Pathology, Kinki University School of Medicine. In 1974, this strain was transferred from Dr. Okamoto to Kyoto University. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo 4142545 SHR.WKY-(D3Rat108-D3Rat166)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 3 59676608 101359980 1 - by flanking markers 3 70419858 113470358 1 - by flanking markers 3 63849481 106900596 1 - by flanking markers 4142546 AMI/Tj Rats which showed a dental mutation such as morphological abnormalities of the teeth were found in the SHR-SP rats at Daiichi Seiyaku, Co., Ltd. in 1981. Transferred to Tokushima University in 2003. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Dentistry 4142547 SHR.WKY-(D4Wox27-D4Rat11)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 33407710 1 - by flanking markers 4 3096322 34240072 1 - by flanking markers 4 3044017 34379894 1 - by flanking markers 4142548 SHR.WKY-(D4Wox27-D4Rat10)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 26280949 1 - by flanking markers 4 3096322 26659527 1 - by flanking markers 4 3044017 26753822 1 - by flanking markers 4142549 SHR.WKY-(D4Wox27-D4Rat4)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 460493 3237361 1 - by flanking markers 4 3096322 4400584 1 - by flanking markers 4 3044017 4364885 1 - by flanking markers 4142550 SHR.WKY-(D4Rat101-D4Rat15)/IzmTkyo This congenic strain was established by crossing between WKY/Izm and SHR/Izm in 2001. Heterozygous consomic rats were established in 2004, homozygous consomic rats were established in 2005, and homozygous congenic rats were established by crossing among consomic heterozygous rats in 2009. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 4 46605924 47890193 1 - by flanking markers 4 46704280 48448808 1 - by flanking markers 4 46898276 48656399 1 - by flanking markers 4142799 LEW.SS-(D2Uia5-D2Rat143)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 2 13909383 106236206 1 - by flanking markers 2 13186164 125885146 1 - by flanking markers 2 13328947 106156987 1 - by flanking markers 4142800 LEW.SS-(D18Chm31-D18Mit8)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with SS/Jr to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 2848113 62229060 1 - by flanking markers 18 2761846 61177004 1 - by flanking markers 18 2745212 61985812 1 - by flanking markers 4143165 SD-Tg(Aqp5-GFP)ZboroRrrc Aqp5EGFP This rat model was developed by perivitelline injection of one cell SD embryos with packaged lentiviral particles containing the pFUGW vector containing the Aqp5 promoter and the EGFP gene. Resulting transgenic founders with mated to wild-type SD rats and heterozygous offspring were obtained. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm Aqp5 2144 4143456 BN.GK-(D2Wox30-D2Wox68)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 4143457 BN.GK-(D2Rat40-D2Wox35)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 163154358 1 - by flanking markers 2 189197858 189197988 1 - by flanking markers 2 169852670 244719662 1 - by flanking markers 4143458 BN.GK-(D2Wox49-D2Rat70)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 191000085 254933362 1 - by flanking markers 2 217822782 281850471 1 - by flanking markers 2 198335799 263179188 1 - by flanking markers 4143459 BN.GK-(D2Rat40-D2Got149)/Ox This congenic strain is derived from GK rats which were from a colony in Paris (CNRS) obtained in 1995. BN rats were initially obtained from Charles River Laboratories, Margate, UK. The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK congenic Unknown 2 163154227 222343164 1 - by flanking markers 2 189197858 248391122 1 - by flanking markers 2 169852670 229036415 1 - by flanking markers 4145088 SS.BN-(D6Rat119-D6Arb3)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 111239053 138260635 1 - by flanking markers 6 120420333 147057860 1 - by flanking markers 6 111134524 138065254 1 - by flanking markers 4145089 SS.BN-(D6Rat149-D6Rat18)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 93374504 1 - by flanking markers 6 6959479 103168177 1 - by flanking markers 6 7009971 93706327 1 - by flanking markers 4145090 SS.BN-(D6Rat149-D6Got171)/Mcwi SS/JrHsdMcwi were crossed with SS-6BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 123782965 1 - by flanking markers 6 6959479 132827005 1 - by flanking markers 6 7009971 123598338 1 - by flanking markers 4145091 SS.BN-(D6Rat149-D6Arb3)/Mcwi SS/JrHsdMcwi were crossed with SS-6^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 6 7161389 138260635 1 - by flanking markers 6 6959479 147057860 1 - by flanking markers 6 7009971 138065254 1 - by flanking markers 4145374 ACI.FHH-(D1Mit18-D1Rat90)(D14Rat98-D14Hmgc18)/Mcwi Congenic strain developed by crossing ACI.FHH-(D1Rat74-D1Rat90)/Eur (Rf-1a) males to ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi (Rf-1a+4) double congenic females Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 4889411 SHRSP.WKY-(D1Smu13-D1Wox33)/Izm About 100 male pups were obtained by breeding SHRSP/Izm and SHRSP.WKY-(D1Smu13-D1Arb21)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio- Hypertension 1;2 160754901;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 2;1 224991853;173074640 224991955;174300801 1 - by flanking markers;1 - by flanking markers 1 166884926 166885141 1 - by flanking markers 4889414 WKY.SHRSP-(D1Rat171-D1Wox33)/Izm About 100 male pups were obtained by breeding SHRSP/Izm and WKY.SHRSP-(D1Smu13-D1Smu11)/Izm; one pup that had the right recombination was found and backcrossed to the parental strain to get the hetrozygotes, which were then mated brother-sister to get the desired congenic strain Department of Functional Pathology, Shimane University School of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1;2 158964262;198300754 160755065;198300855 1 - by flanking markers;1 - by flanking markers 1;2 172767534;224991853 174300801;224991955 1 - by flanking markers;1 - by flanking markers 1 166577232 166577467 1 - by flanking markers 4889450 DA.PVG.1AV1-(D1Rat248-D1Rat10)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males that had PVG allele within the Eae29 region, one breeding pair from N7 generation was intercrossed to give homozygous congenic that had PVG allele from the begining of chr1 to D1Rat10 (approximately 25.4 Mb) Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 1 6253932 25271177 1 - by flanking markers 1 7306802 86917075 1 - by flanking markers 1 5655772 85706974 1 - by flanking markers 4889464 GK/Ox Original breeders are from a colony in Paris (CNRS URA 307, Paris, France) which were obtained in 1995 and since then bred locally in Oxford, UK The Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK inbred Unknown 4889499 CDS-Chr 4^CDR/Ygl Homozygous male CDS/Ygl were bred with CDR/Ygl females; F₁ heterozygotes were mated with parental female CDS/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889817 SBN-Chr 1^SBH/Ygl Homozygous male SBN/Ygl were bred with SBH/Ygl females; F₁ heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889820 SBH-Chr 1^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889822 SBN-Chr 17^SBH/Ygl Homozygous male SBN/Ygl were bred with SBH/Ygl females; F₁ heterozygotes were mated with parental female SBN/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889875 SBH-Chr 2^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889877 SBH-Chr 20^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889879 SBH-Chr X^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889882 SBH-Chr 17^SBN/Ygl Homozygous male SBH/Ygl were bred with SBN/Ygl females; F₁ heterozygotes were mated with parental female SBH/Ygl and backcrossed again for 8 times till the allele was fixed Hebrew University Hospital and Hadassah-Hebrew Medical College, Jerusalem, Israel consomic Unknown 4889890 DA.PVG.1AV1-(D17Rat8-D17Rat37)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males and offsprings were selected for the PVG allele of interest, one breeding pair from N8 generation was intercrossed to give homozygous congenic that had PVG allele from D17Rat8 to D17Rat37 Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Immunology 17 27618789 75802944 1 - by flanking markers 17 25486196 69844594 1 - by flanking markers 17 23522321 68114865 1 - by flanking markers 4891048 SS.LEW-(D7Rat73-D7Rat128)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 4891051 LEW.SS-(D7Rat73-D7Rat128)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown Avpr1a|Cyp11b1|Cyp11b2|Tac3|Trhr|Cox6c|Kcnv1|Kcns2|Nxph4|Cyp11b3 2185|2453|2454|3809|3904|620616|621264|621525|628723|727886 7 57326196 121524220 1 - by flanking markers 7 61044919 124236725 1 - by flanking markers 7 61047589 124246733 1 - by flanking markers 4891103 WMI/Eer WKY most immobile 3 pairs of WKY males and females with highest immobility and lowest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown 4891107 WLI/Eer WKY least immobile 3 pairs of WKY males and females with lowest immobility and highest climbing scores in the forced swim test were mated. Dept. of Psychiatry and Behavioral Sciences, Northwestern University Feinberg School of Medicine, Chicago, Illinois inbred Unknown 4891165 Wig/Ymas wiggling These are congenic wiggling rats established by transferring the wiggling gene from Long-Evans Cinnamon (LEC) to Wistar King-Aptekman/Hokkaido (WKAH) strain Human Stress Signal Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan congenic Unknown 4891380 SS.SR-(D9Mco95-D9Mco98)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 80946065 1 - by flanking markers 9 81100315 81180041 1 - by flanking markers 4891383 SS.SR-(D9Mco98-Resp18)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 4891386 SS.SR-(D9Mco98-Resp18)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 80945872 82246695 1 - by flanking markers 9 81179848 82477136 1 - by flanking markers 4891388 SS.SR-(D9Mco95-D9Mco100)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 4891390 SS.SR-(D9Mco95-D9Mco100)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81453493 1 - by flanking markers 9 81100315 81688944 1 - by flanking markers 4891392 SS.SR-(D9Mco95-D9Mco102)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 80867159 81641213 1 - by flanking markers 9 81100315 81878831 1 - by flanking markers 4891394 SS.SR-(D9Mco101-Resp18)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74551809 74558151 1 - by flanking markers 9 81611825 82246695 1 - by flanking markers 9 81847677 82477136 1 - by flanking markers 4891396 SS.SR-(D9Mco72-Resp18)/Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 44842118 74558151 1 - by flanking markers 9 52352690 82246695 1 - by flanking markers 9 52686874 82477136 1 - by flanking markers 4891400 SS.SR-(D9Mco14-Resp18)/1Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 4891402 SS.SR-(D9Mco14-Resp18)/2Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 4891404 SS.SR-(D9Mco14-Resp18)/3Mco SS.SR-(D9Mco95-Resp18)/Mco was crossed with SS/Jr to generate F₁ which were intercrossed to generate F₂, these were genotyped using markers throughout 73140156-74554694 region Medical College of Ohio, Toledo, Ohio congenic Unknown Resp18 3555 9 74436883 74558151 1 - by flanking markers 9 82125291 82246695 1 - by flanking markers 9 82356030 82477136 1 - by flanking markers 4892563 WF.WKY-(D5Rat26-D5Uwm42)/Uwm WKY/NHsd rats were mated with WF/NHsd and the progeny was backcrossed to WF for 8-9 generations, selecting for Mcs5 region. University of Wisconsin-Madison congenic Unknown 5 119332868 153554465 1 - by flanking markers 5 121495621 156871691 1 - by flanking markers 5 117554114 153097789 1 - by flanking markers 5130721 HXB1/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131094 BN-Lx/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California mutant Unknown 5131095 BXH13/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131097 BXH12/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131099 BXH11/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131101 BXH10/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131104 BXH9/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131106 BXH8/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131108 BXH6/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131110 BXH5/CubPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131113 HXB31/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131115 HXB29/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131118 HXB27/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131120 HXB26/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131122 HXB25/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131124 HXB23/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131126 HXB20/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131128 HXB17/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131130 HXB15/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131132 HXB13/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131134 HXB10/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained by Printz laboratory for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131136 HXB7/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131138 HXB4/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131140 HXB3/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131142 HXB2/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131144 HXB18/IpcvPrin Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, maintained for over 20 generations and verified by PLS phenotyping and microsatellite genotyping. Dept. of Pharmacology, University of California, San Diego, La Jolla, California recombinant_inbred Unknown 5131910 SS-Acad10^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryorecovery (as of 2017-07-18) Acad10^em2Mcwi 5131905 12 36070275 36075844 1 - by flanking markers 12 42285817 42328189 1 - by flanking markers 12 40417918 40460562 1 - by flanking markers 5131911 SS-Alms1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Alms1^em1Mcwi 5131906 4 119846037 119946085 1 - by flanking markers 4 181947469 182048235 1 - by flanking markers 4 117371544 117472310 1 - by flanking markers 5131912 SS-Aldh2^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence AACGGCAAGCCTTATGtcatcTCCTACCTGGTGGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Aldh2^em2Mcwi 5131907 12 36081778 36116445 1 - by flanking markers 12 42334057 42366049 1 - by flanking markers 12 40466418 40498813 1 - by flanking markers 5131920 SS-Apoe^em8Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct Apoe^em8Mcwi 5131915 1 79003634 79006387 1 - by flanking markers 1 81878372 81882298 1 - by flanking markers 1 80612894 80616820 1 - by flanking markers 5131921 SS-Apoe^em7Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct Apoe^em7Mcwi 5131918 1 79003634 79006387 1 - by flanking markers 1 81878372 81882298 1 - by flanking markers 1 80612894 80616820 1 - by flanking markers 5131922 SS-Cdh13^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Cdh13^em1Mcwi 5131919 19 48507173 49575123 1 - by flanking markers 19 61621434 62720155 1 - by flanking markers 19 50848793 51971618 1 - by flanking markers 5131932 SS-Cyp1a1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cyp1a1^em1Mcwi 5131928 8 61462207 61468237 1 - by flanking markers 8 62249046 62255081 1 - by flanking markers 8 62472087 62478122 1 - by flanking markers 5131933 SS-Cyba^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Cyba^em1Mcwi 5131930 19 52713150 52721609 1 - by flanking markers 19 65959818 65967224 1 - by flanking markers 19 55249634 55257824 1 - by flanking markers 5131934 SS-Cyp1a1^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Cyp1a1^em5Mcwi 5131929 8 61462207 61468237 1 - by flanking markers 8 62249046 62255081 1 - by flanking markers 8 62472087 62478122 1 - by flanking markers 5131950 SS-Msra^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Msra^em3Mcwi 5131945 15 43509775 43756283 1 - by flanking markers 15 51307920 51550758 1 - by flanking markers 15 47488333 47800662 1 - by flanking markers 5131951 SS-Prokr1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 126-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Prokr1^em2Mcwi 5131947 4 121750651 121758116 1 - by flanking markers 4 183939201 183949822 1 - by flanking markers 4 119375790 119386551 1 - by flanking markers 5131952 SS-Mas1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) Mas1^em1Mcwi 5131946 1 42154786 42185750 1 - by flanking markers 1 51644462 51675365 1 - by flanking markers 1 48076761 48108218 1 - by flanking markers 5131953 SS-Prokr1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCCATGACCCTGTGCtatgcCAGGGTGTCCCGAGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Prokr1^em1Mcwi 5131948 4 121750651 121758116 1 - by flanking markers 4 183939201 183949822 1 - by flanking markers 4 119375790 119386551 1 - by flanking markers 5131954 SS-Mstn^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 18-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Mstn^em2Mcwi 5131949 9 45426831 45431658 1 - by flanking markers 9 52977371 52982198 1 - by flanking markers 9 53310977 53315804 1 - by flanking markers 5131963 SS-Nox4^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nox4^em1Mcwi 5131428 1 143415816 143603554 1 - by flanking markers 1 157106652 157285107 1 - by flanking markers 1 150796359 150976186 1 - by flanking markers 5131964 SS-Mstn^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mstn^em3Mcwi 5131962 9 45426831 45431658 1 - by flanking markers 9 52977371 52982198 1 - by flanking markers 9 53310977 53315804 1 - by flanking markers 5131965 SS-Mthfr^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mthfr^em1Mcwi 5131961 5 165112850 165126885 1 - by flanking markers 5 168502556 168522350 1 - by flanking markers 5 164844642 164864360 1 - by flanking markers 5131966 SS-Plod1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CATCGCTGCCGAATCttccagAACCTGGATGGAGCCTTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Plod1^em1Mcwi 5131960 5 164987252 165012581 1 - by flanking markers 5 168379092 168405534 1 - by flanking markers 5 164720629 164747071 1 - by flanking markers 5131974 SS-Rasgrp3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net insertion of 5-bp frameshift deletion in exon 12. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rasgrp3^em1Mcwi 5131968 6 19808453 19871923 1 - by flanking markers 6 30966364 31065175 1 - by flanking markers 6 21072634 21171619 1 - by flanking markers 5131975 SS-Ptpn11^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ptpn11^em1Mcwi 5131970 12 36501886 36558055 1 - by flanking markers 12 42762630 42822760 1 - by flanking markers 12 40895515 40955999 1 - by flanking markers 5131976 SS-Ptpn11^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTCCGTCCGCACTggtgaTGACAAAGGGGAGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Ptpn11^em4Mcwi 5131969 12 36501886 36558055 1 - by flanking markers 12 42762630 42822760 1 - by flanking markers 12 40895515 40955999 1 - by flanking markers 5131987 SS-Tgfb1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Tgfb1^em1Mcwi 5131986 1 80894705 80911020 1 - by flanking markers 1 83742151 83758472 1 - by flanking markers 1 82480875 82497196 1 - by flanking markers 5131988 SS-Wdr72^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 5-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Wdr72^em2Mcwi 5131978 8 78891358 79050751 1 - by flanking markers 8 80586841 80744090 1 - by flanking markers 8 80965734 81125710 1 - by flanking markers 5131989 SS-Tgfb1^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCTCCCACTCCCGTGGcttctAGTGCTGACGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tgfb1^em3Mcwi 5131980 1 80894705 80911020 1 - by flanking markers 1 83742151 83758472 1 - by flanking markers 1 82480875 82497196 1 - by flanking markers 5131990 SS-Slc30a8^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc30a8^em2Mcwi 5131981 7 88583770 88617145 1 - by flanking markers 7 92476024 92512365 1 - by flanking markers 7 91832988 91869329 1 - by flanking markers 5131991 SS-Slc30a8^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc30a8^em1Mcwi 5131979 7 88583770 88617145 1 - by flanking markers 7 92476024 92512365 1 - by flanking markers 7 91832988 91869329 1 - by flanking markers 5134683 WF.WKY-(D7Rat171-D7Rat128)/1Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 121524220 1 - by flanking markers 7 26490428 124236725 1 - by flanking markers 7 26359973 124246733 1 - by flanking markers 5134685 WF.WKY-(D7Rat171-D7Rat128)/2Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 121524220 1 - by flanking markers 7 26490428 124236725 1 - by flanking markers 7 26359973 124246733 1 - by flanking markers 5134687 WF.WKY-(D7Rat51-D7Rat128)/Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 50833677 121524220 1 - by flanking markers 7 54558231 124236725 1 - by flanking markers 7 54534996 124246733 1 - by flanking markers 5134689 WF.WKY-(D7Uwm25-D7Rat128)/Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 121523977 121524220 1 - by flanking markers 7 89318050 124236725 1 - by flanking markers 7 89283487 124246733 1 - by flanking markers 5134692 WF.WKY-(D7Rat171-D7Rat45)/Uwm Chromosome 7 segment from WKY that had the Mcs6 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 22382724 68057251 1 - by flanking markers 7 26490428 71522360 1 - by flanking markers 7 26359973 71352127 1 - by flanking markers 5134951 WF.COP-(D7Rat39-D7Uwm12)/1Uwm Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 4936703 86007499 1 - by flanking markers 7 6276388 89299904 1 - by flanking markers 7 89265543 89265715 1 - by flanking markers 5134953 WF.COP-(D7Rat39-D7Uwm12)/2Uwm Chromosome 7 segment from WKY that had the Mcs2 QTL was introgressed into a WF genetic background University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 7 4936703 86007499 1 - by flanking markers 7 6276388 89299904 1 - by flanking markers 7 89265543 89265715 1 - by flanking markers 5135031 BN.MES-Cyba/Sna mutant Cyba gene from the MES/Slc strain is introduced into the background of BN/SsNSlc by standard procedures with seven backcrosses to BN/SsNSlc Department of Aging Biology, Institute on Aging and Adaptation, Shinshu University, Matsumoto, Japan congenic Unknown 5135472 ACI.BN-(D5Uwm70-D5Rat32)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 139659415 139659574 1 - by flanking markers 5 141933225 141933383 1 - by flanking markers 5 138123799 138123957 1 - by flanking markers 5135473 ACI.BN-(D5Uwm70-D5Got42)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 130756424 130756605 1 - by flanking markers 5 132878119 132878299 1 - by flanking markers 5 129038716 129038896 1 - by flanking markers 5135475 ACI.BN-(D5Rat60-D5Rat115)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 106262697 118138413 1 - by flanking markers 5 109291409 120337480 1 - by flanking markers 5 105304453 116395137 1 - by flanking markers 5135477 ACI.BN-(D5Uwm70-D5Mgh15)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 167844579 167844737 1 - by flanking markers 5 171364494 171364652 1 - by flanking markers 5 167739539 167739697 1 - by flanking markers 5135479 ACI.BN-(D5Rat113-D5Rat36)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 76707366 145187034 1 - by flanking markers 5 79957402 147610238 1 - by flanking markers 5 75809470 143846372 1 - by flanking markers 5135481 ACI.BN-(D5Mgh17-D5Rat98)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 14730738 100017265 1 - by flanking markers 5 19190627 103451257 1 - by flanking markers 5 14408903 99421638 1 - by flanking markers 5143940 ACI.FHH-(D1Rat74-D1Rat90)/Eur Congenic substrain that originated from ACI.FHH-(D1Rat298-D1Rat90)/Eur Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 1 227005311 267111153 1 - by flanking markers 1 248763714 289137268 1 - by flanking markers 1 241482188 281795785 1 - by flanking markers 5143941 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi Triple congenic ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur from Erasmus Medical Center, Rotterdam, Netherlands now bred and housed at Medical College of Wisconsin Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 5143942 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1 and Rf4 QTL region of chr 14 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 5143943 ACI.FHH-(D14Mit11-D14Rat82)/Eur Congenic strain generated by using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf4 QTL region of chr 14 is introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Cryopreserved Sperm 14 4995006 30258439 1 - by flanking markers 14 4874267 30225437 1 - by flanking markers 14 4878162 30412508 1 - by flanking markers 5143984 SS-Plekha7^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plekha7^em1Mcwi 5143978 1 174249022 174316226 1 - by flanking markers 1 192397589 192463974 1 - by flanking markers 1 185427600 185493985 1 - by flanking markers 5143985 SS-Mstn^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTATTCCTTTGCAGCTGActttctAATGCAAGCGGATGGA into SS/JrHsdMcwi rat embryos. The resulting mutation deletes part of exon 2 and its splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mstn^em1Mcwi 5143964 9 45426831 45431658 1 - by flanking markers 9 52977371 52982198 1 - by flanking markers 9 53310977 53315804 1 - by flanking markers 5143986 SS-Ulk3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk3^em1Mcwi 5143968 8 61343722 61348824 1 - by flanking markers 8 62146130 62152150 1 - by flanking markers 8 62368548 62375229 1 - by flanking markers 5143987 SS-Gpr183^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183^em3Mcwi 5143961 15 107056367 107067887 1 - by flanking markers 15 111751148 111763869 1 - by flanking markers 15 108364701 108376221 1 - by flanking markers 5143988 SS-Gpr183^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183^em2Mcwi 5143955 15 107056367 107067887 1 - by flanking markers 15 111751148 111763869 1 - by flanking markers 15 108364701 108376221 1 - by flanking markers 5143989 SS-Agtrap^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 84-bp mutation deleting part of exon 3 and the splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtrap^em4Mcwi 5143963 5 165154252 165164570 1 - by flanking markers 5 168546202 168556520 1 - by flanking markers 5 164888069 164898387 1 - by flanking markers 5143990 SS-Ulk3^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 88-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk3^em4Mcwi 5143971 8 61343722 61348824 1 - by flanking markers 8 62146130 62152150 1 - by flanking markers 8 62368548 62375229 1 - by flanking markers 5143991 SS-Gpr183^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gpr183^em1Mcwi 5143957 15 107056367 107067887 1 - by flanking markers 15 111751148 111763869 1 - by flanking markers 15 108364701 108376221 1 - by flanking markers 5143992 SS-Rasgrp3^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCCCACAACACCTAATaagcctGTGGTACCCCTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 20-bp frameshift deletion in exon 12. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Rasgrp3^em3Mcwi 5143946 6 19808453 19871923 1 - by flanking markers 6 30966364 31065175 1 - by flanking markers 6 21072634 21171619 1 - by flanking markers 5143993 SS-Plcd3^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 161-bp deletion in exon 1 including the splice donor PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plcd3^em4Mcwi 5143954 10 92234651 92275433 1 - by flanking markers 10 90937117 90958001 1 - by flanking markers 10 91164778 91186067 1 - by flanking markers 5143994 SS-Plcd3^em7Mcwi This strain was produced by injecting ZFNs targeting the sequence GCCCGCGTCATCCGAtagcagCACCAAAAGGCCCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 142-bp deletion, overlapping the start codon PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Plcd3^em7Mcwi 5143976 10 92234651 92275433 1 - by flanking markers 10 90937117 90958001 1 - by flanking markers 10 91164778 91186067 1 - by flanking markers 5143995 SS-Plekha7^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CCTCTGCCCAGCTACgtcatcTCCCCGGTGGCCCCCGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 8. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Plekha7^em4Mcwi 5143979 1 174249022 174316226 1 - by flanking markers 1 192397589 192463974 1 - by flanking markers 1 185427600 185493985 1 - by flanking markers 5143996 SS-Agtrap^em8Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtrap^em8Mcwi 5143970 5 165154252 165164570 1 - by flanking markers 5 168546202 168556520 1 - by flanking markers 5 164888069 164898387 1 - by flanking markers 5144101 SS-Kcnq1^em14Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Kcnq1^em14Mcwi 5144083 1 203383401 203803687 1 - by flanking markers 1 223154713 223490458 1 - by flanking markers 1 216293087 216630339 1 - by flanking markers 5144102 ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asip^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Asip^em1Mcwi 5144099 3 145445175 145536831 1 - by flanking markers 3 156860395 156949277 1 - by flanking markers 3 150492010 150579870 1 - by flanking markers 5144103 SS-Ldlr^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ldlr^em1Mcwi 5144090 8 20824040 20846920 1 - by flanking markers 8 22804325 22827199 1 - by flanking markers 8 22750425 22773305 1 - by flanking markers 5144104 SS-Ncf2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Ncf2^em1Mcwi 5144089 13 67806516 67834105 1 - by flanking markers 13 75197561 75229600 1 - by flanking markers 13 70226441 70259019 1 - by flanking markers 5144105 SS-Hexim2^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGCCCACTCGGCCCggcctcTCCCCGCGCCCGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Hexim2^em4Mcwi 5144095 10 92306494 92312256 1 - by flanking markers 10 90988728 90994491 1 - by flanking markers 10 91212296 91222841 1 - by flanking markers 5144106 SS-Kcnq1^em9Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGCAGGCTGCCGCagcaagTACGTGGGCATCTGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnq1^em9Mcwi 5144076 1 203383401 203803687 1 - by flanking markers 1 223154713 223490458 1 - by flanking markers 1 216293087 216630339 1 - by flanking markers 5144107 SS-Itga9^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCGGAGCCTTCCTGTCCgacagcGTGGTTCTCCTCAGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 87-bp deletion containing part of exon 13 and its splice acceptor. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Itga9^em1Mcwi 5144077 8 123526904 123838241 1 - by flanking markers 8 126493359 126795566 1 - by flanking markers 8 127271029 127576709 1 - by flanking markers 5144108 SS-Ldlr^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ldlr^em4Mcwi 5144075 8 20824040 20846920 1 - by flanking markers 8 22804325 22827199 1 - by flanking markers 8 22750425 22773305 1 - by flanking markers 5144110 ACI.BN-(D5Mgh17-D5Mgh15)/Shul This congenic strain is developed by further genotyping ACI.BN-(D5Mgh17-D5Rat205)/Shul. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 14730738 167844737 1 - by flanking markers 5 19190627 171364652 1 - by flanking markers 5 14408903 167739697 1 - by flanking markers 5147594 FHH.PCK-(D9Rat35-D9Rat70)/Mcwi A FHH/EurMcwi male was crossed with a PCK/CrljCrl-Pkhd1^pck/Crl female, and the male progeny were backcrossed to FHH/EurMcwi females for five generations by marker assisted breeding. In each generation, males were genotyped by fluorescent genotyping for three markers within the Pkhd1 gene, and 98 markers evenly spaced throughout the genome. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown Pkhd1^pck 11535943 9 12916127 21667256 1 - by flanking markers 9 18672124 27914444 1 - by flanking markers 9 19794101 29075268 1 - by flanking markers 5490515 FHH.BN(D1Rat265-D1Rat76)/Mcwi desired segments from BN were introgressed in FHH background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Extinct 1 90448902 230411453 1 - by flanking markers 1 95453405 252243871 1 - by flanking markers 1 94364073 244992610 1 - by flanking markers 5490516 FHH.BN(D14Rat80-D14Hmgc4)/Mcwi desired segments from BN were introgressed in FHH background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Live Animals; Cryopreserved Sperm 14 13778105 21435476 1 - by flanking markers 14 13914610 21463742 1 - by flanking markers 14 13971208 21555302 1 - by flanking markers 5490517 FHH.BN(D14Rat78-D14Hmgc4)/Mcwi desired segments from BN were introgressed in FHH background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Live Animals; Cryopreserved Sperm 14 17564855 21435476 1 - by flanking markers 14 17417347 21463742 1 - by flanking markers 14 17499969 21555302 1 - by flanking markers 5508304 WUN-Abcc2^TR-/HsdRrrc Spontaneous 1-bp deletion mutation occurred on a Wistar Unilever maintained at the Amsterdam Academic Medical Center (AMC). This mutation at amino acid 393 resulting a frameshift and premature stop at position 401. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-08-02) Abcc2|Abcc2^TR- 2366|12792941 1 270999832 271057750 1 - by flanking markers 1 263554426 263612556 1 - by flanking markers 5508305 F344-Dpp4^DPPIV-/DchcHsdRrrc The DPP4 mutant rat was a spontaneous mutation in Fischer 344 rats, which caused a deficiency in DPPIV, was identified by Dr. Douglas C. Hixson at Rhode Island Hospital. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-16) Dpp4^DPPIV 12792942 3 44279255 44360283 1 - by flanking markers 3 54957146 55038628 1 - by flanking markers 3 48291055 48372672 1 - by flanking markers 5508356 SS-Gucy1a3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCTGCTTCTCCCCGGTAtcattAAAGCGGCTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Extinct Gucy1a3^em1Mcwi 5508351 2 173756824 173818316 1 - by flanking markers 2 200453480 200515219 1 - by flanking markers 2 181045694 181103321 1 - by flanking markers 5508357 SS-Tfdp2^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tfdp2^em2Mcwi 5508332 8 101256112 101392512 1 - by flanking markers 8 103489105 103629520 1 - by flanking markers 8 104040795 104181228 1 - by flanking markers 5508358 SS-Wdr72^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCTTCCTTACAGGCATActgccaTCTGCGTAAGTGCATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 3 and intron 3 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Wdr72^em1Mcwi 5508327 8 78891358 79050751 1 - by flanking markers 8 80586841 80744090 1 - by flanking markers 8 80965734 81125710 1 - by flanking markers 5508359 SS-Prune^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Prune^em3Mcwi 5508348 2 190165356 190192807 1 - by flanking markers 2 215924545 215954221 1 - by flanking markers 2 196427714 196457105 1 - by flanking markers 5508360 SS-Dguok^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCGGTTCCTTCTGCgtagacTCCGAGCGTCTTTCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Dguok^em4Mcwi 5508323 4 117697251 117725383 1 - by flanking markers 4 179770727 179798683 1 - by flanking markers 4 115180433 115208061 1 - by flanking markers 5508361 SS-Bcas3^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence TGGATCTGTACTCACttcgtACGGGGGAGATGGTCAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 9. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Bcas3^em4Mcwi 5508329 10 73617547 74078190 1 - by flanking markers 10 72660671 73177317 1 - by flanking markers 10 72756548 73271851 1 - by flanking markers 5508362 SS-Ncf2^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCTACTACAGCATGgagaagTAAGTGGTGTCGGAGTGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 139-bp deletion of part of intron 1 and exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ncf2^em4Mcwi 5508342 13 67806516 67834105 1 - by flanking markers 13 75197561 75229600 1 - by flanking markers 13 70226441 70259019 1 - by flanking markers 5508363 SS-Sorcs2^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CACATCAGCTTCCGCTCTgactggGAGCTGGTCAAGGTGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 15. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs2^em4Mcwi 5508326 14 79968072 80344330 1 - by flanking markers 14 79176694 79547823 1 - by flanking markers 14 79538911 79912333 1 - by flanking markers 5508364 SS-Prune^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Prune^em1Mcwi 5508341 2 190165356 190192807 1 - by flanking markers 2 215924545 215954221 1 - by flanking markers 2 196427714 196457105 1 - by flanking markers 5508365 SS-Agtr1a^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Agtr1a^em5Mcwi 5508318 17 40629318 40684982 1 - by flanking markers 17 37217810 37270540 1 - by flanking markers 17 35907102 35958136 1 - by flanking markers 5508366 SS-Tfdp2^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct Tfdp2^em5Mcwi 5508334 8 101256112 101392512 1 - by flanking markers 8 103489105 103629520 1 - by flanking markers 8 104040795 104181228 1 - by flanking markers 5508367 SS-Ulk4^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTACCTTGTAGCTACccaggtGAGGCTGTCTGATGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 15 and intron 15 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ulk4^em3Mcwi 5508340 8 125992455 126284263 1 - by flanking markers 8 128829597 129125286 1 - by flanking markers 8 129631003 129919080 1 - by flanking markers 5508368 SS-Trafd1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGTGGTGCCCGGACagagcTGTGTGGCAGCTGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Trafd1^em1Mcwi 5508352 12 36301824 36315741 1 - by flanking markers 12 42562635 42576553 1 - by flanking markers 12 40695520 40709438 1 - by flanking markers 5508369 SS-Myadml2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Myadml2^em1Mcwi 5508317 10 110039330 110040967 1 - by flanking markers 10 109418559 109420196 1 - by flanking markers 10 109822170 109827328 1 - by flanking markers 5508370 SS-Nppb^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp deletion of part of intron 1 and exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nppb^em2Mcwi 5508324 5 165062348 165063650 1 - by flanking markers 5 168454278 168455640 1 - by flanking markers 5 164796176 164797538 1 - by flanking markers 5508371 SS-Mylip^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Extinct Mylip^em3Mcwi 5508336 17 25308147 25329887 1 - by flanking markers 17 21703590 21725205 1 - by flanking markers 17 19682040 19703681 1 - by flanking markers 5508380 SS-TgTn(T2ONC)2Mcwi These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands. PhysGen Knockouts transgenic Cryopreserved Sperm 5508381 SS-TgTn(T2ONC)1Mcwi These rats were made by pronuclear injection of a linear plasmid fragment containing a Sleeping Beauty oncogenic transposon harboring the CAG (chicken beta-actin/rabbit beta-globin hybrid promoter), the mouse Foxf2 exon 1 splice donor, and two Adenovirus 2 splice acceptors on opposite DNA strands. PhysGen Knockouts transgenic Cryopreserved Sperm 5508392 HsdHlr:ZUC-Lepr^fa Derived from a colony obtained in 1992 Harlan outbred Unknown 5508393 BN/RijHsd These were derived from a nucleus colony obtained directly from the TNO Institute, the Netherlands now available at Envigo. Envigo inbred Unknown 5508394 FBNF1/Hsd Offspring of a cross between the F344/NHsd inbred female and a BN male rat. Harlan hybrid Unknown 5508395 Hsd:RH-Foxn1^rnu Athymic Nude Derived from animals obtained from the Rowett Research Institute, Aberdeen, Scotland. Harlan outbred Unknown 5508396 HsdRccHan:WIST Derived at Biological Research Laboratories Limited (BRL), formerly RCC, now Harlan Laboratories Ltd., Fullinsdorf, Switzerland from original colony at Zentralinstitute fur Versuchstierzucht, Hannover in 1989. Transferred to Harlan Sprague-Dawley, Inc. in 1993 (nomenclature HsdHan:WIST). Harlan became Envigo in 2015. In 2004 Envigo acquired RCC Ltd. and new breeding stock was transferred in 2008 (nomenclature RccHan:WIST). Unlike competitive models, the RccHan:WIST rat has been maintained from the original nucleus of 156 breeding pairs in Hannover, Germany. ENVIGO outbred Unknown 5508397 HotHsd:SD Sprague Dawley Originally developed by the Holtzman Company in Madison, Wisconsin, from Sprague Dawley stock in 1947; to Harlan through acquisition in 1986. Harlan outbred Unknown 5508398 BluHsd:LE Long Evans (Blue Spruce) From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988. Harlan became Envigo in 2015. Harlan/Envigo outbred Unknown 5509086 ACI.BN-(D5Rat72-D5Rat36)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 120983238 145187034 1 - by flanking markers 5 123027973 147610238 1 - by flanking markers 5 119124918 143846372 1 - by flanking markers 5509087 ACI.BN-(D5Rat113-D5Rat159)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 76707366 76707563 1 - by flanking markers 5 79957402 79957599 1 - by flanking markers 5 75809470 75809667 1 - by flanking markers 5509988 SS-Nppb^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Nppb^em4Mcwi 5509979 5 165062348 165063650 1 - by flanking markers 5 168454278 168455640 1 - by flanking markers 5 164796176 164797538 1 - by flanking markers 5509989 SS-Msra^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCATCTTCGAAGGTCatcagcGCGGAGGAAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 1-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Msra^em4Mcwi 5509977 15 43509775 43756283 1 - by flanking markers 15 51307920 51550758 1 - by flanking markers 15 47488333 47800662 1 - by flanking markers 5509990 SS-Cyp1a1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGGTAACCAACCCTAGGatacagAGAAAGATCCAGGAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 188-bp deletion encompassing exon 4 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cyp1a1^em2Mcwi 5509976 8 61462207 61468237 1 - by flanking markers 8 62249046 62255081 1 - by flanking markers 8 62472087 62478122 1 - by flanking markers 5509991 SS-Mylip^em2Mcwi This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mylip^em2Mcwi 5508333 17 25308147 25329887 1 - by flanking markers 17 21703590 21725205 1 - by flanking markers 17 19682040 19703681 1 - by flanking markers 5509992 SS-Ube2q2^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCTAGATCAACcactaCCCACGGGTCAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ube2q2^em3Mcwi 5509987 8 58688257 58749088 1 - by flanking markers 8 58292660 58349722 1 - by flanking markers 8 59709972 59754102 1 - by flanking markers 5509993 SS-Tcf7l2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GGAAGCCTCCAGAGCagacaaGCCCTCAAGGATGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 169-bp deletion of exon5 and intron 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tcf7l2^em1Mcwi 5509981 1 262031823 262226710 1 - by flanking markers 1 283387566 284118928 1 - by flanking markers 1 276686911 276730517 1 - by flanking markers 5509994 SS-Sh2b3^em2Mcwi This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Sh2b3^em2Mcwi 5509982 12 35954679 35958446 1 - by flanking markers 12 42132947 42136714 1 - by flanking markers 12 40261990 40265757 1 - by flanking markers 5509995 SS-Adra2a^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Adra2a^em1Mcwi 5509986 1 282178475 282181275 1 - by flanking markers 1 274766283 274769083 1 - by flanking markers 5509996 SS-Stk39^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence AACAGCCATTGAattagCAACGGGAGCAGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Extinct Stk39^em2Mcwi 5509978 3 50249626 50517085 1 - by flanking markers 3 60973443 61244306 1 - by flanking markers 3 54359449 54625702 1 - by flanking markers 5509997 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Extinct Nckap5^em4Mcwi 5509975 13 38444115 39275959 1 - by flanking markers 13 47369687 48273649 1 - by flanking markers 13 42265875 43049232 1 - by flanking markers 5529230 ACI.FHH-(D1Hmgc16-D1Rat225)/Mcwi desired segments from FHH/EurMcwi were introgressed in ACI/Eur background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 261180160 261180301 1 - by flanking markers 1 275301183 283061559 1 - by flanking markers 1 267871151 271693968 1 - by flanking markers 5529529 ACI.FHH-(D1Hmgc1-D1Hmgc19)/Mcwi desired segments from FHH/EurMcwi were introgressed in ACI/Eur background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 249745626 249745784 1 - by flanking markers 1 271889649 277901651 1 - by flanking markers 1 264446896 270462479 1 - by flanking markers 5529731 ACI.FHH-(D1Hmgc20-D1Hmgc21)/Mcwi desired segments from FHH/EurMcwi were introgressed in ACI/Eur background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Cryopreserved Sperm 1 274674350 276466399 1 - by flanking markers 1 267241552 269024803 1 - by flanking markers 5683886 SS-Chr 12^BN.SS-(D12Arb13-D12Mit2)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 12^BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 7382721 20932776 1 - by flanking markers 12 10334114 24663199 1 - by flanking markers 12 8249608 22650918 1 - by flanking markers 5683888 SS-Chr 12^BN.SS-(D12Hmgc3-D12Rat79)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 12^BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 36223785 36224090 1 - by flanking markers 12 17102817 42485122 1 - by flanking markers 12 15085585 40618007 1 - by flanking markers 5683890 SS-Chr 12^BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 12^BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 17102817 24300160 1 - by flanking markers 12 15085585 22283507 1 - by flanking markers 5685369 SS-Agtr1a^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTTGCCCCTGTGGGCAGtctatACCGCTATGGAGTACCGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Agtr1a^em1Mcwi 5508331 17 40629318 40684982 1 - by flanking markers 17 37217810 37270540 1 - by flanking markers 17 35907102 35958136 1 - by flanking markers 5686300 SS-Adra2a^em1Mcwi-/- SS-Adra2a^em1Mcwi-/Adra2a^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Adra2a^em1Mcwi 5509986 1 282178475 282181275 1 - by flanking markers 1 274766283 274769083 1 - by flanking markers 5686302 SS-Adra2a^em1Mcwi+/+ SS-Adra2a^em1Mcwi+/Adra2a^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686304 SS-Agtrap^em4Mcwi-/- SS-Agtrap^em4Mcwi-/Agtrap^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Embryo (as of 2018-09-05) 5686306 SS-Agtrap^em4Mcwi+/+ SS-Agtrap^em4Mcwi+/Agtrap^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686308 SS-Hexim2^em4Mcwi-/- SS-Hexim2^em4Mcwi-/Hexim2^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686311 SS-Hexim2^em4Mcwi+/+ SS-Hexim2^em4Mcwi+/Hexim2^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686314 SS-Rasgrp3^em1Mcwi-/- SS-Rasgrp3^em1Mcwi-/Rasgrp3^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686316 SS-Rasgrp3^em1Mcwi+/+ SS-Rasgrp3^em1Mcwi+/Rasgrp3^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686318 SS-Sh2b3^em1Mcwi-/- SS-Sh2b3^em1Mcwi-/Sh2b3^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is an in-frame 6-bp deletion in exon 2 . PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Sh2b3^em1Mcwi 4139858 12 35954679 35958446 1 - by flanking markers 12 42132947 42136714 1 - by flanking markers 12 40261990 40265757 1 - by flanking markers 5686320 SS-Sh2b3^em1Mcwi+/+ SS-Sh2b3^em1Mcwi+/Sh2b3^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686322 SS-Sh2b3^em1Mcwi-/+ SS-Sh2b3^em1Mcwi-/Sh2b3^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2019-07-26) Sh2b3^em1Mcwi 4139858 12 35954679 35958446 1 - by flanking markers 12 42132947 42136714 1 - by flanking markers 12 40261990 40265757 1 - by flanking markers 5686326 SS-Ulk3^em4Mcwi-/- SS-Ulk3^em4Mcwi-/Ulk3^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686328 SS-Ulk3^em4Mcwi+/+ SS-Ulk3^em4Mcwi+/Ulk3^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686330 SS-Ulk3^em4Mcwi-/+ SS-Ulk3^em4Mcwi-/Ulk3^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686332 SS-Wdr72^em2Mcwi-/- SS-Wdr72^em2Mcwi-/Wdr72^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686335 SS-Wdr72^em2Mcwi+/+ SS-Wdr72^em2Mcwi+/Wdr72^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686652 SS-Agtr1a^em1Mcwi-/- SS-Agtr1a^em1Mcwi-/Agtr1a^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) 5686654 SS-Agtr1a^em1Mcwi+/+ SS-Agtr1a^em1Mcwi+/Agtr1a^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686657 SS-Agtr1a^em5Mcwi-/- SS-Agtr1a^em5Mcwi-/Agtr1a^em5Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686659 SS-Agtrap^em8Mcwi-/- SS-Agtrap^em8Mcwi-/Agtrap^em8Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686662 SS-Agtrap^em8Mcwi+/+ SS-Agtrap^em8Mcwi+/Agtrap^em8Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686664 SS-Aldh2^em2Mcwi-/- SS-Aldh2^em2Mcwi-/Aldh2^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686666 SS-Aldh2^em2Mcwi+/+ SS-Aldh2^em2Mcwi+/Aldh2^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686668 SS-Cdh13^em1Mcwi-/- SS-Cdh13^em1Mcwi-/Cdh13^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) 5686670 SS-Cdh13^em1Mcwi+/+ SS-Cdh13^em1Mcwi+/Cdh13^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686672 SS-Cyp1a1^em1Mcwi-/- SS-Cyp1a1^em1Mcwi-/Cyp1a1^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-11-06) 5686676 SS-Cyp1a1^em1Mcwi+/+ SS-Cyp1a1^em1Mcwi+/Cyp1a1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686678 SS-Cyp1a1^em2Mcwi-/- SS-Cyp1a1^em2Mcwi-/Cyp1a1^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686680 SS-Cyp1a1^em2Mcwi+/+ SS-Cyp1a1^em2Mcwi+/Cyp1a1^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686684 SS-Cyp1a1^em5Mcwi-/- SS-Cyp1a1^em5Mcwi-/Cyp1a1^em5Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) 5686687 SS-Cyp1a1^em5Mcwi+/+ SS-Cyp1a1^em5Mcwi+/Cyp1a1^em5Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686689 SS-Prokr1^em1Mcwi-/- SS-Prokr1^em1Mcwi-/Prokr1^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) 5686692 SS-Prokr1^em1Mcwi+/+ SS-Prokr1^em1Mcwi+/Prokr1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686695 SS-Prokr1^em2Mcwi-/- SS-Prokr1^em2Mcwi-/Prokr1^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) 5686697 SS-Prokr1^em2Mcwi+/+ SS-Prokr1^em2Mcwi+/Prokr1^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686700 SS-Kcnq1^em14Mcwi-/- SS-Kcnq1^em14Mcwi-/Kcnq1^em14Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) 5686702 SS-Kcnq1^em14Mcwi+/+ SS-Kcnq1^em14Mcwi+/Kcnq1^em14Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686704 SS-Msra^em3Mcwi-/- SS-Msra^em3Mcwi-/Msra^em3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686706 SS-Msra^em3Mcwi+/+ SS-Msra^em3Mcwi+/Msra^em3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686708 SS-Msra^em4Mcwi-/- SS-Msra^em4Mcwi-/Msra^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686710 SS-Msra^em4Mcwi+/+ SS-Msra^em4Mcwi+/Msra^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686713 SS-Mstn^em1Mcwi-/- SS-Mstn^em1Mcwi-/Mstn^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Mstn^em1Mcwi 5143964 9 45426831 45431658 1 - by flanking markers 9 52977371 52982198 1 - by flanking markers 9 53310977 53315804 1 - by flanking markers 5686715 SS-Mstn^em1Mcwi+/+ SS-Mstn^em1Mcwi+/Mstn^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686718 SS-Mstn^em3Mcwi-/- SS-Mstn^em3Mcwi-/Mstn^em3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2019-07-26) Mstn^em3Mcwi 5131962 9 45426831 45431658 1 - by flanking markers 9 52977371 52982198 1 - by flanking markers 9 53310977 53315804 1 - by flanking markers 5686721 SS-Mstn^em3Mcwi+/+ SS-Mstn^em3Mcwi+/Mstn^em3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686723 SS-Mstn^em3Mcwi-/+ SS-Mstn^em3Mcwi-/Mstn^em3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686725 SS-Nppa^em4Mcwi-/- SS-Nppa^em4Mcwi-/Nppa^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) 5686728 SS-Nppa^em4Mcwi+/+ SS-Nppa^em4Mcwi+/Nppa^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686730 SS-Nppb^em2Mcwi-/- SS-Nppb^em2Mcwi-/Nppb^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown Nppb^em2Mcwi 5508324 5 165062348 165063650 1 - by flanking markers 5 168454278 168455640 1 - by flanking markers 5 164796176 164797538 1 - by flanking markers 5686732 SS-Nppb^em2Mcwi+/+ SS-Nppb^em2Mcwi+/Nppb^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686734 SS-Nppb^em4Mcwi-/- SS-Nppb^em4Mcwi-/Nppb^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) 5686736 SS-Nppb^em4Mcwi+/+ SS-Nppb^em4Mcwi+/Nppb^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686738 SS-Plcd3^em4Mcwi-/- SS-Plcd3^em4Mcwi-/Plcd3^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686740 SS-Plcd3^em4Mcwi+/+ SS-Plcd3^em4Mcwi+/Plcd3^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686742 SS-Plcd3^em7Mcwi-/- SS-Plcd3^em7Mcwi-/Plcd3^em7Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686744 SS-Plcd3^em7Mcwi+/+ SS-Plcd3^em7Mcwi+/Plcd3^em7Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686747 SS-Plekha7^em1Mcwi-/- SS-Plekha7^em1Mcwi-/Plekha7^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686749 SS-Plekha7^em1Mcwi+/+ SS-Plekha7^em1Mcwi+/Plekha7^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686758 SS-Plekha7^em4Mcwi-/- SS-Plekha7^em4Mcwi-/Plekha7^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Plekha7^em4Mcwi 5143979 1 174249022 174316226 1 - by flanking markers 1 192397589 192463974 1 - by flanking markers 1 185427600 185493985 1 - by flanking markers 5686760 SS-Plekha7^em4Mcwi+/+ SS-Plekha7^em4Mcwi+/Plekha7^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686762 SS-Plod1^em1Mcwi-/- SS-Plod1^em1Mcwi-/Plod1^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2018-09-05) 5686764 SS-Plod1^em1Mcwi+/+ SS-Plod1^em1Mcwi+/Plod1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686766 SS-Sh2b3^em2Mcwi-/- SS-Sh2b3^em2Mcwi-/Sh2b3^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Sh2b3^em2Mcwi 5509982 12 35954679 35958446 1 - by flanking markers 12 42132947 42136714 1 - by flanking markers 12 40261990 40265757 1 - by flanking markers 5686768 SS-Slc30a8^em1Mcwi-/- SS-Slc30a8^em1Mcwi-/Slc30a8^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686770 SS-Slc30a8^em1Mcwi+/+ SS-Slc30a8^em1Mcwi+/Slc30a8^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686772 SS-Slc30a8^em2Mcwi-/- SS-Slc30a8^em2Mcwi-/Slc30a8^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686776 SS-Slc30a8^em2Mcwi+/+ SS-Slc30a8^em2Mcwi+/Slc30a8^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686778 SS-Stk39^em2Mcwi-/- SS-Stk39^em2Mcwi-/Stk39^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) Stk39^em2Mcwi 5509978 3 50249626 50517085 1 - by flanking markers 3 60973443 61244306 1 - by flanking markers 3 54359449 54625702 1 - by flanking markers 5686780 SS-Stk39^em2Mcwi+/+ SS-Stk39^em2Mcwi+/Stk39^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686782 SS-Stk39^em2Mcwi-/+ SS-Stk39^em2Mcwi-/Stk39^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) Stk39^em2Mcwi 5509978 3 50249626 50517085 1 - by flanking markers 3 60973443 61244306 1 - by flanking markers 3 54359449 54625702 1 - by flanking markers 5686784 SS-Tcf7l2^em1Mcwi-/- SS-Tcf7l2^em1Mcwi-/Tcf7l2^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686786 SS-Tcf7l2^em1Mcwi+/+ SS-Tcf7l2^em1Mcwi+/Tcf7l2^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686788 SS-Tcf7l2^em1Mcwi-/+ SS-Tcf7l2^em1Mcwi-/Tcf7l2^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686790 SS-Ulk3^em1Mcwi-/- SS-Ulk3^em1Mcwi-/Ulk3^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686792 SS-Ulk3^em1Mcwi+/+ SS-Ulk3^em1Mcwi+/Ulk3^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686794 SS-Ulk3^em1Mcwi-/+ SS-Ulk3^em1Mcwi-/Ulk3^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686797 SS-Wdr72^em1Mcwi-/- SS-Wdr72^em1Mcwi-/Wdr72^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5686799 SS-Wdr72^em1Mcwi+/+ SS-Wdr72^em1Mcwi+/Wdr72^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5686826 ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI/Eur and FHH/Eur parental strains. Rf-1A QTL region of chr 1, Rf-3 QTL region of chr 3, and Rf4 QTL region of chr 14 are introgressed in this strain. Department of Pediatric Surgery, Erasmus Medical Center, Rotterdam, Netherlands congenic Unknown 5686829 ACI.FHH-(D1Mit18-D1Rat90)(D3Rat6-D3Got149)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Mcwi Triple congenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur and ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 5686832 ACI.FHH-(D1Mit18-D1Rat90)(D3Got102-D3Got149)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Mcwi Multicongenic strain which was generated using the speed congenic strategy by backcrossing ACI.FHH-(D1Mit18-D1Rat90)(D3Rat84-D3Rat59)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/Eur and ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 5687688 FHH-Tg(CAG-Rab38)1Mcwi A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion mapped to chromosome 14, roughly 13.2-Mbp, and was more than 100-kbp away from the nearest gene (downstream of Antrx2). Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 5687689 FHH-Tg(CAG-Rab38)2Mcwi A Sleeping Beauty transposon expressing the wild type (BN strain) Rab38 coding sequence under the control of the ubiquitous chicken-actin-globin (CAG) promoter was injected into FHH embryos with a mRNA source of transposase to produce (CAG-Rab38) transgenic on FHH background. This transgene insertion in line 2 was found to be within a long interspersed nuclear element (LINE) sequence and could not be unambiguously mapped to a specific chromosome location. Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 5687969 ACI.BN-(D2Rat251-D2Mgh3)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 2 6332896 63001078 1 - by flanking markers 2 6118364 81156651 1 - by flanking markers 2 6155132 63538449 1 - by flanking markers 5687971 ACI.BN-(D2Rat10-D2Rat202)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 2 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 2 35874553 51821161 1 - by flanking markers 2 54092967 70871600 1 - by flanking markers 2 34967269 52507805 1 - by flanking markers 5687973 ACI.BN-(D18Rat30-D18Rat89)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 18 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 18 5682011 63697215 1 - by flanking markers 18 5795276 62092559 1 - by flanking markers 18 5825946 62905769 1 - by flanking markers 5687974 SS-Chr 5^BN-Cyp4a2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5^BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2. PhysGen Knockouts mutant Extinct Cyp4a2^em1Mcwi 5687724 5 135765673 135773006 1 - by flanking markers 5 137989327 138000302 1 - by flanking markers 5 134196910 134207888 1 - by flanking markers 5687975 SS-Prex1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGTACTTCCGCTTCcatgcgGACGAGGAGATGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 16. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Prex1^em2Mcwi 5687719 3 157693897 157863943 1 - by flanking markers 3 169494331 169575981 1 - by flanking markers 3 163329580 163477822 1 - by flanking markers 5687977 SS-Acad10^em2Mcwi+/+ SS-Acad10^em2Mcwi+/Acad10^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5687979 SS-Acad10^em2Mcwi-/- SS-Acad10^em2Mcwi-/Acad10^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The homozygous mutant carries a 10-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-07-18) Acad10^em2Mcwi 5131905 12 36070275 36075844 1 - by flanking markers 12 42285817 42328189 1 - by flanking markers 12 40417918 40460562 1 - by flanking markers 5687981 SS-Alms1^em1Mcwi-/- SS-Alms1^em1Mcwi-/Alms1^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5687983 SS-Alms1^em1Mcwi+/+ SS-Alms1^em1Mcwi+/Alms1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5687985 SS-Apoe^em7Mcwi+/+ SS-Apoe^em7Mcwi+/Apoe^em7Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct 5687987 SS-Apoe^em7Mcwi-/- SS-Apoe^em7Mcwi-/Apoe^em7Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct 5687989 SS-Apoe^em8Mcwi-/- SS-Apoe^em8Mcwi-/Apoe^em8Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct 5687992 SS-Apoe^em8Mcwi+/+ SS-Apoe^em8Mcwi+/Apoe^em8Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct 5687994 SS-Bcas3^em4Mcwi+/+ SS-Bcas3^em4Mcwi+/Bcas3^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5687996 SS-Bcas3^em4Mcwi-/- SS-Bcas3^em4Mcwi-/Bcas3^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5687998 SS-Cyba^em1Mcwi-/- SS-Cyba^em1Mcwi-/Cyba^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) 5688000 SS-Cyba^em1Mcwi+/+ SS-Cyba^em1Mcwi+/Cyba^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688002 SS-Chr 5^BN-Cyp4a2^em1Mcwi+/+ SS-Chr 5^BN-Cyp4a2^em1Mcwi+/Cyp4a2^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct 5688004 SS-Chr 5^BN-Cyp4a2^em1Mcwi-/- SS-Chr 5^BN-Cyp4a2^em1Mcwi-/Cyp4a2^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct 5688006 SS-Chr 5^BN-Cyp4a2^em1Mcwi-/+ SS-Chr 5^BN-Cyp4a2^em1Mcwi-/Cyp4a2^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct 5688008 SS-Ets1^em1Mcwi+/+ SS-Ets1^em1Mcwi+/Ets1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688010 SS-Ets1^em1Mcwi-/+ SS-Ets1^em1Mcwi-/Ets1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) Ets1^em1Mcwi 4139856 8 32481694 32545237 1 - by flanking markers 8 33798598 33921593 1 - by flanking markers 8 33756634 33879625 1 - by flanking markers 5688012 SS-Gpr183^em1Mcwi-/- SS-Gpr183^em1Mcwi-/Gpr183^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688014 SS-Gpr183^em1Mcwi+/+ SS-Gpr183^em1Mcwi+/Gpr183^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688016 SS-Gpr183^em2Mcwi-/- SS-Gpr183^em2Mcwi-/Gpr183^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688018 SS-Gpr183^em2Mcwi+/+ SS-Gpr183^em2Mcwi+/Gpr183^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688020 SS-Gpr183^em3Mcwi-/- SS-Gpr183^em3Mcwi-/Gpr183^em3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688022 SS-Gpr183^em3Mcwi+/+ SS-Gpr183^em3Mcwi+/Gpr183^em3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688024 SS-Itga9^em1Mcwi+/+ SS-Itga9^em1Mcwi+/Itga9^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688026 SS-Mas1^em1Mcwi+/+ SS-Mas1^em1Mcwi+/Mas1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688028 SS-Mas1^em1Mcwi-/- SS-Mas1^em1Mcwi-/Mas1^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryorecovery (as of 2017-07-18) 5688039 SS-Mthfr^em1Mcwi+/+ SS-Mthfr^em1Mcwi+/Mthfr^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688041 SS-Mthfr^em1Mcwi-/+ SS-Mthfr^em1Mcwi-/Mthfr^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688043 SS-Nckap5^em1Mcwi-/- SS-Nckap5^em1Mcwi-/Nckap5^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) Nckap5^em1Mcwi 4139859 13 38444115 39275959 1 - by flanking markers 13 47369687 48273649 1 - by flanking markers 13 42265875 43049232 1 - by flanking markers 5688045 SS-Nckap5^em1Mcwi+/+ SS-Nckap5^em1Mcwi+/Nckap5^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688047 SS-Nckap5^em2Mcwi-/- SS-Nckap5^em2Mcwi-/Nckap5^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) Nckap5^em2Mcwi 4139862 13 38444115 39275959 1 - by flanking markers 13 47369687 48273649 1 - by flanking markers 13 42265875 43049232 1 - by flanking markers 5688049 SS-Nckap5^em2Mcwi+/+ SS-Nckap5^em2Mcwi+/Nckap5^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688051 SS-Nckap5^em3Mcwi-/- SS-Nckap5^em3Mcwi-/Nckap5^em3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Extinct (as of 2018-09-05) Nckap5^em3Mcwi 4139861 13 38444115 39275959 1 - by flanking markers 13 47369687 48273649 1 - by flanking markers 13 42265875 43049232 1 - by flanking markers 5688053 SS-Nckap5^em3Mcwi+/+ SS-Nckap5^em3Mcwi+/Nckap5^em3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688059 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5^em4Mcwi-/- SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5^em4Mcwi-/Nckap5^em4Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688061 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5^em4Mcwi+/+ SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5^em4Mcwi+/Nckap5^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688063 SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5^em4Mcwi-/+ SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5^em4Mcwi-/Nckap5^em4Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688066 SS-Ncf2^em1Mcwi-/- SS-Ncf2^em1Mcwi-/Ncf2^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) Ncf2^em1Mcwi 5144089 13 67806516 67834105 1 - by flanking markers 13 75197561 75229600 1 - by flanking markers 13 70226441 70259019 1 - by flanking markers 5688069 SS-Ncf2^em1Mcwi+/+ SS-Ncf2^em1Mcwi+/Ncf2^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688074 SS-Nox4^em2Mcwi-/- SS-Nox4^em2Mcwi-/Nox4^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. This homozygous mutant carries an 8-bp frameshift deletion in exon 7 of rat Nox4. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2019-01-03) Nox4^em2Mcwi 4139868 1 143415816 143603554 1 - by flanking markers 1 157106652 157285107 1 - by flanking markers 1 150796359 150976186 1 - by flanking markers 5688077 SS-Nox4^em2Mcwi+/+ SS-Nox4^em2Mcwi+/Nox4^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688080 SS-Nox4^em2Mcwi-/+ SS-Nox4^em2Mcwi-/Nox4^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2019-07-26) Nox4^em2Mcwi 4139868 1 143415816 143603554 1 - by flanking markers 1 157106652 157285107 1 - by flanking markers 1 150796359 150976186 1 - by flanking markers 5688083 SS-Prex1^em2Mcwi-/- SS-Prex1^em2Mcwi-/Prex1^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688087 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38^em1Mcwi-/- FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38^em1Mcwi-/Rab38^em1Mcwi- ZFN mutant founders were backcrossed with FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown Rab38^em1Mcwi 4139867 1 144783919 144864573 1 - by flanking markers 1 158385888 158466621 1 - by flanking markers 1 152072716 152153449 1 - by flanking markers 5688090 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38^em1Mcwi+/+ FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38^em1Mcwi+/Rab38^em1Mcwi+ ZFN mutant founders were backcrossed with FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown Rab38 628752 1 144783919 144864573 1 - by flanking markers 1 158385888 158466621 1 - by flanking markers 1 152072716 152153449 1 - by flanking markers 5688092 SS-Rag1^em1Mcwi-/- SS-Rag1^em1Mcwi-/Rag1^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) 5688094 SS-Rag1^em1Mcwi+/+ SS-Rag1^em1Mcwi+/Rag1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688096 SS-Rag1^em2Mcwi-/- SS-Rag1^em2Mcwi-/Rag1^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) 5688098 SS-Rag1^em2Mcwi+/+ SS-Rag1^em2Mcwi+/Rag1^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688100 SS-Ren^em1Mcwi+/+ SS-Ren^em1Mcwi+/Ren^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688102 SS-Ren^em1Mcwi-/- SS-Ren^em1Mcwi-/Ren^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) 5688107 FHH-Chr 1^BN-Sorcs1^em1Mcwi-/- FHH-Chr 1^BN-Sorcs1^em1Mcwi-/Sorcs1^em1Mcwi- ZFN mutant founders were backcrossed with FHH-Chr 1^BN/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is a 14-bp frameshift deletion mutation in exon 7. PhysGen Knockouts mutant Unknown Sorcs1^em1Mcwi 4139864 1 255767411 256279565 1 - by flanking markers 1 277404996 277912261 1 - by flanking markers 1 269965824 270473097 1 - by flanking markers 5688109 FHH-Chr 1^BN-Sorcs1^em1Mcwi+/+ FHH-Chr 1^BN-Sorcs1^em1Mcwi+/Sorcs1^em1Mcwi+ ZFN mutant founders were backcrossed with FHH-Chr 1^BN/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688111 SS-Tfdp2^em2Mcwi-/- SS-Tfdp2^em2Mcwi-/Tfdp2^em2Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688113 SS-Tfdp2^em2Mcwi+/+ SS-Tfdp2^em2Mcwi+/Tfdp2^em2Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688116 SS-Tgfb1^em1Mcwi+/+ SS-Tgfb1^em1Mcwi+/Tgfb1^em1Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688119 SS-Tgfb1^em3Mcwi+/- SS-Tgfb1^em3Mcwi+/Tgfb1^em3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2021-08-24) 5688121 SS-Ube2q2^em3Mcwi-/- SS-Ube2q2^em3Mcwi-/Ube2q2^em3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688123 SS-Ube2q2^em3Mcwi+/+ SS-Ube2q2^em3Mcwi+/Ube2q2^em3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 5688125 SS-Ulk4^em3Mcwi-/- SS-Ulk4^em3Mcwi-/Ulk4^em3Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2018-09-05) 5688396 ACI.BN-(D3Rat80-D3Rat3)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 3 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 3 32056563 162589029 1 - by flanking markers 3 41713824 175796738 1 - by flanking markers 3 36599933 169714239 1 - by flanking markers 5688400 ACI.BN-(D4Rat5-D4Got131)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 4 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 4 9638281 162284199 1 - by flanking markers 4 10720881 224994372 1 - by flanking markers 4 10728623 157981900 1 - by flanking markers 5688402 ACI.BN-(D6Rat148-D6Rat109)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 6 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 6 20826657 146162691 1 - by flanking markers 6 31958575 155686896 1 - by flanking markers 6 22070168 146778380 1 - by flanking markers 5688405 ACI.COP-(D5Rat12-D5Rat205)/Shul This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 70669803 70670361 1 - by flanking markers 5 74199071 74199222 1 - by flanking markers 5 70038765 70038916 1 - by flanking markers 5688407 ACI.COP-(D5Rat28-D5Rat205)/Shul This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 126963761 126963962 1 - by flanking markers 5 129313212 129313302 1 - by flanking markers 5 125455818 125455908 1 - by flanking markers 5688409 ACI.COP-(D5Rat28-D5Rat36)/Shul This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 5 126963761 145187034 1 - by flanking markers 5 129313212 147610238 1 - by flanking markers 5 125455818 143846372 1 - by flanking markers 6218997 SHR/NCrlAnra These were originally from Harvard University, Boston MA, then at UNESP, Botucatu, SP, Brazil, now maintained at Behavior Genetics Laboratory, SC, Brazil Behavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, Brazil inbred Unknown 6219002 LEW/HsdUnibAnra LEW rats originally from Harlan Sprague Dawley, IN then bred at UNICAMP (Campinas, SP Brazil) now maintained at Behavior Genetics Laboratory, SC, Brazil Behavior Genetics Laboratory, Departamento de Biologia Celular, Embriologia e Genetica, Universidade Federal de Santa Catarina, Florianopolis, SC, Brazil inbred Unknown 6478788 STOCK-Tp53^{tm1(EGFP-Pac)Qly}/Rrrc p53 knockout rat This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.7kb 5 prime and 1.6- kb 3 prime homology arms and a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting F344 blastocysts. Founder animals were mated with SD rats. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01) Tp53|Tp53^{tm1(EGFP-Pac)Qly} 3889|12792957 10 56399721 56411150 1 - by flanking markers 10 55932658 55944087 1 - by flanking markers 10 56186299 56198449 1 - by flanking markers 6478789 LEW-Tg(CAG-EGFP)YsRrrc Transgene prepared from cDNA fragment of EGFP derived from pEGFP vector (No. 6077-1, Clontech Laboratories, Inc., Palo Alto, CA) and pCXN2 expression vector containing cytomegalovirus enhancer, chicken b-actin enhancer-promoter and rabbit b-globin poly(A) signal. Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2018-07-16) 6478791 F344-Tg(UBC-EGFP)F455Rrrc This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. Animals that exhibited fluorescence of tails were mated. Offspring were bred with Lewis wild-type mates to map transgene location. Animals were backcrossed 10 generations onto F344. Rat Resource and Research Center transgenic Live Animals; Cryopreserved Embryo; Cryopreserved Sperm 6480190 NAft:HS Heterogeneous stock From Dr. Eva Redei, Center for Comparative Medicine, Northwestern University to Dr. Alberto Fernandez-Teruel, Barcelona Psychiatry and Forensic Medicine, Institute of Neurosciences, School of Medicine, Autonomous University of Barcelona, Barcelona, Spain outbred Unknown 6480205 MWF-Chr 6^SHR Chr 8^SHR/Rkb Chr 8 and chr 6 were introgressed from albuminuria-resistant SHR/FubRkb into the sensitive isogenic background of MWF/FubRkb Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown 6480210 SHR-Chr 8^MWF/Rkb SHR/FubRkb male was crossed with female MWF/FubRkb to get F1 animals which in turn were backcrossed with female SHR/FubRkb, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown 6480218 AR-Ednrb^sl/Hkv Aganglionosis rat Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR), provided to Dr. Takashi Agui by Dr. Ozaki, National Institute for Physiological Sciences, Okazaki, Japan Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan mutant Unknown Ednrb^sl 10755424 15 87893141 87898700 1 - by flanking markers 15 91500400 91531979 1 - by flanking markers 15 88004775 88036354 1 - by flanking markers 6480220 LE/Hkv.AR-Ednrb^sl Aganglionosis rat This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. AR-derived Ednrb^sl was introduced into Long-Evans by Dr. Ozaki (NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm), and this rat was provided to Dr. Agui at Hokkaido University and inbred line was established by sib mating. Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan, National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-11-15) Internal Medicine Ednrb^sl 10755424 15 87893141 87898700 1 - by flanking markers 15 91500400 91531979 1 - by flanking markers 15 88004775 88036354 1 - by flanking markers 6480223 F344.AR-Ednrb^sl/Hkv Aganglionosis rat This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. This congenic strain was established by backcrossing (over 10 generations) of AR rat to F344/NSlc. Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan, National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2016-10-28) Ednrb^sl 10755424 15 87893141 87898700 1 - by flanking markers 15 91500400 91531979 1 - by flanking markers 15 88004775 88036354 1 - by flanking markers 6480863 BBDR/RhwRrrc BBDR/Rhw from R. H. William Laboratory, University of Washington, Seattle, Washington to Rat Resource & Research Center Rat Resource & Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 6480866 BN-Chr 13^LH/MavRrrc Chr 13 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped Laboratoire de Physiologie, Lyon Cedex , France, Rat Resource & Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm 6480868 BN-Chr 2^LH/MavRrrc Chr 2 from LH/Mav was introgressed onto the genetic background of BN/NHsdMcwi and then genotyped Laboratoire de Physiologie, Lyon Cedex , France, Rat Resource & Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm 6480874 COP.DA-(D16Rat12-D16Rat90)/McoRrrc Male COP/OlaHsd were crossed with female DA/OlaHsd then the F1 males were backcrossed to COP females. Male progeny containing the fewest number of DA-alleles were backcrossed to female COP. These males were backcrossed to female COP. Transferred from Medical College of Toledo to Rat Resource & Research Center Rat Resource & Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm 16 350121 85734479 1 - by flanking markers 16 1084304 85597057 1 - by flanking markers 16 1090054 86162972 1 - by flanking markers 6482243 WI-Cit^fhJjlo/Rrrc flathead rat Flathead rat was discovered at University of Connecticut in an inbred colony of Wistar rats. Spontaneous single G deletion in exon 1 of citron kinase (Cit) confers a premature stop codon and lack of citron kinase protein. Department of Physiology and Neurobiology, University of Connecticut, Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-07-21) Cit^fhJjlo 13204831 12 41858134 42019601 1 - by flanking markers 12 48136329 48295119 1 - by flanking markers 12 46334669 46494152 1 - by flanking markers 6482244 SS-Tg(APOA1)116OpazRrrc SS/JrHsd embryos were microinjected with human APOA1 C3 promoter Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 6482245 SS-Tg(Atp1a1)24OpazRrrc SS/JrHsd embryos were microinjected with rat alpha1 Na,K-ATPase promoter (-1288 5 flanking regulatory region isolated from Sprague Dawley genomic library); transgene cDNA: Dahl R alpha1 Na,K-ATPase Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-05-24) 6482247 FDIO/Rrrc Cross between F344 (lean phenotype) and SDDIO (diet-induced obese phenotype) then inbred for 6 generations with maintenance of obese phenotype. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 6482252 F344-Tg(Pgk1-EGFP)/Rrrc Multiple random integration of EGFP gene under the control of the PGK promoter. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 6482254 Gunn-Ugt1a1^j/BluHsdRrrc Gunn rat This mutation was first observed in normal Wistar albino rats in a breeding colony at Cannaught Laboratories in 1934. Jaundice was evident at birth or shortly after and was persistant throughout life. Harlan , Rat Resource and Research Center mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-09-15) Ugt1a1^j 13432064 9 87091241 87098362 1 - by flanking markers 9 94982916 94990037 1 - by flanking markers 9 95295701 95302822 1 - by flanking markers 6482256 HS/Rrrc High Self-Administration Developed from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations. Rat Resource and Research Center inbred Cryorecovery (as of 2019-02-01) 6482259 LS/Rrrc Low Self-Administration Developed from selective breeding of outbred Wistar rats. Selectively bred over six generations for increased intravenous drug self-administration with subsequent inbreeding within this strain over six generations. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-01-13) 6482268 BRAT-Avp^di/BluHsdRrrc Brattleboro Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Brattleboro rats transferred to the RRRC in 2009. Rat Resource and Research Center mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) Avp^di 13627261 3 118205007 118206985 1 - by flanking markers 3 129615610 129627147 1 - by flanking markers 3 123117482 123119460 1 - by flanking markers 6482271 LEW.Cg-Foxn1^rnu/NRrrc The NIH nude rat was developed in 1979-1980 at the NIH through a series of matings involving the following inbred rat strains: BN/SsN, MR/N, BUF/N, WN/N, ACI/N, WKY/N, M520/N, and F344/N. Received from the National Institute of Health by NCI in 1983. The nude mutation was subsequently backcrossed 17 generations to the Lewis inbred strain. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm 6482282 LEW-Tg(EGFP)463-5Rrrc Lewis- GFP transgenic insertion of EGFP transgene with Ubiquitin C promoter Rat Resource and Research Center transgenic Cryopreserved Sperm 6482284 LEW-Tg(EGFP)456-9Rrrc Lewis- GFP transgenic insertion of EGFP transgene with Ubiquitin C promoter Rat Resource and Research Center transgenic Cryopreserved Sperm 6482286 LEW-Tg(EGFP)458-7Rrrc Lewis- GFP transgenic insertion of EGFP transgene with Ubiquitin C promoter Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 6482288 LEW-Tg(EGFP)463-1Rrrc Lewis- GFP transgenic insertion of EGFP transgene with Ubiquitin C promoter Rat Resource and Research Center transgenic Cryopreserved Sperm 6482290 LEW-Tg(EGFP)455Rrrc Lewis- GFP transgenic This transgenic strain contains the enhanced green fluorescent protein gene under the control of the human ubiquitin-C promoter with a the woodchuck hepatitis virus posttranscriptional regulatory element (WRE). This transgenic strain was made by injecting the lentivirus vector containing the GFP construct (vector name FUGW) into Lewis rat embryos. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm 6482292 LEW-Tg((ROSA26)Sor-lacZ)15Jmsk This strain expresses LacZ ubiquitously driven by the ROSA26 promoter established at Jichi Medical School. Rat Resource and Research Center transgenic Cryopreserved Embryo (as of 2017-08-08) 6482294 LH-Chr 13^BN/MavRrrc Chr 13 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Rat Resource and Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm 6482296 LH-Chr 17^BN/MavRrrc Chr 17 from BN/NHsdMcwi was introgressed onto the genetic background of LH/Mav and then genotyped Rat Resource and Research Center consomic Cryopreserved Embryo; Cryopreserved Sperm 6482298 MWF/ZtmRrrc Munich Wistar Fromter From outbred Wistar rats selected for large numbers of superficial glomeruli. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-01) 6482643 WIN/RhwRrrc Submitted to Rat Resource & Research Center Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 6482645 SD-Tg(Rho-S334X)3LavRrrc This transgenic strain carries a mouse rhodopsin gene that bears a termination codon at residue 334, which encodes a C-terminal truncated rhodopsin protein. Submitted to Rat Resource & Research Center Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-08-17) 6482654 ACI.BN-(D7Rat36-D7Rat11)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 7 1526177 118826810 1 - by flanking markers 7 2632014 121752141 1 - by flanking markers 7 2653138 121762010 1 - by flanking markers 6482674 HIS/NdkRrrc High-Saccharin-Consuming (HiS) Rat The Occidental HiS (high-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that voluntarily consumed high levels of saccharin.This male was mated to several Holtzman Sprague-Dawley females and offspring displaying high saccharin consumption were selected. Selective breeding was continued in which offspring with high saccharin consumption were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 6482676 LOS/NdkRrrc Low-Saccharin-Consuming (HiS) Rat The Occidental LoS (low-saccharin-consuming) rat strain was developed from a male Holtzman Sprague-Dawley rat that did not voluntarily consume saccharin. This male was mated to several Holtzman Sprague-Dawley females and offspring displaying low saccharin consumption were selected. Selective breeding was continued in which offspring with low saccharin consumption (see phenotyping protocol) were bred. To maintain the outbred status of this colony the donor backcrosses to Hsd:SD every 4-6 generations. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm 6482680 SD-Tg(MMTV-Erbb2)1UwmRrrc Hsd:SD background carrying a transgene which produces over-expression of the rat Erbb2 proto-oncogene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-12) Erbb2 2561 6483453 SS-Dguok^em2Mcwi This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110) Medical College of Wisconsin, Milwaukee WI mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Dguok^em2Mcwi 5508354 4 117697251 117725383 1 - by flanking markers 4 179770727 179798683 1 - by flanking markers 4 115180433 115208061 1 - by flanking markers 6483454 SS-Dguok^em1Mcwi This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105) Medical College of Wisconsin, Milwaukee WI mutant Cryopreserved Sperm (as of 2017-01-26) Dguok^em1Mcwi 5508345 4 117697251 117725383 1 - by flanking markers 4 179770727 179798683 1 - by flanking markers 4 115180433 115208061 1 - by flanking markers 6483455 SS-Dguok^em3Mcwi This allele was made by ZFN mutagenesis. The resulting mutation is a net 57-bp frameshift deletion in exon 1 (del 3-102, ins. GCTTAGCAAGGCGGGCACTTCCGCCgagggcacttccgcctgc) Medical College of Wisconsin, Milwaukee WI mutant Cryopreserved Sperm Dguok^em3Mcwi 5508325 4 117697251 117725383 1 - by flanking markers 4 179770727 179798683 1 - by flanking markers 4 115180433 115208061 1 - by flanking markers 6483846 HsdFcen:WI Wistar Descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan and now maintained at School of Science, Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, Argentina Buenos Aires University, Ciudad Universitaria, Buenos Aires, Capital Federal, Argentina outbred Unknown 6484519 SS-ROSA26^{em1(SB11)Mcwi} This strain was produced by ZFN-stimulated knockin in the rat Rosa26 locus. ZFNs targeting the sequence CCTTCCCCCTTCTTCcctcgtGATCTGCAACTGGAGTCT were injected into SS/JrHsdMcwi rat embryos along with a plasmid template incorporating the Engrailed-2 mouse splice acceptor, a loxP site, the SB11 Sleeping Beauty transposase cDNA, and SV40 polyadenylation signal to integrate the transgene by homologous recombination. The resulting animal was confirmed by sequencing both junctions to harbor the SB11 gene knocked into the rat locus and expresses SB11 transposase in every cell by immunohistochemistry. PhysGen Knockouts mutant Cryorecovery (as of 2017-08-08) Rosa26^{em1(SB11)Mcwi} 6484518 6484559 SS-Slc34a1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGTGCTCAGCTCTGCCTTccaactGGCCGGAGGTAGGGCCCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp deletion in exon 4. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Slc34a1^em1Mcwi 5687699 17 15262929 15277902 1 - by flanking markers 17 11856946 11872100 1 - by flanking markers 17 9747766 9762739 1 - by flanking markers 6484560 SS-Pdc^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pdc^em2Mcwi 5687695 13 64622473 64636031 1 - by flanking markers 13 72510251 72523421 1 - by flanking markers 13 67545430 67558600 1 - by flanking markers 6484561 SS-Comt^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGTTCCAGGTCACCATCctcaatGGGGCATCCCAGGATCTT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Comt^em1Mcwi 5687725 11 84561591 84581713 1 - by flanking markers 11 89809853 89829568 1 - by flanking markers 11 86715981 86735630 1 - by flanking markers 6484562 SS-Fgf5^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fgf5^em1Mcwi 5687720 14 12713971 12734634 1 - by flanking markers 14 12917742 12938879 1 - by flanking markers 14 12974921 12996046 1 - by flanking markers 6484563 SS-Cst3^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cst3^em3Mcwi 5687738 3 137650903 137654776 1 - by flanking markers 3 149628692 149632565 1 - by flanking markers 3 143219671 143223544 1 - by flanking markers 6484564 SS-Cd247^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Cd247^em3Mcwi 5687730 13 81515383 81594699 1 - by flanking markers 13 88876046 88951003 1 - by flanking markers 13 83996045 84071408 1 - by flanking markers 6484565 SS-Ldlr^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 12-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Ldlr^em3Mcwi 5144082 8 20824040 20846920 1 - by flanking markers 8 22804325 22827199 1 - by flanking markers 8 22750425 22773305 1 - by flanking markers 6484566 SS-Slc6a12^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTCCCTCTCCAGTatggacAGAAAGGTTACAGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion overlapping exon 2 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc6a12^em1Mcwi 5687736 4 157781178 157800038 1 - by flanking markers 4 221009224 221029242 1 - by flanking markers 4 153921199 153941333 1 - by flanking markers 6484567 FHH-Chr 1^BN-Sorcs3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCCCGCTCCATTGAcatcagtTCCCTGGTCGTCCAGGAT into FHH-Chr 1BN/Mcwi rat embryos. The resulting mutation is a 33-bp insertion in exon 7 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs3^em1Mcwi 5687731 1 254125935 254345330 1 - by flanking markers 1 275416357 276060204 1 - by flanking markers 1 267986305 268620331 1 - by flanking markers 6484568 SS-Cd247^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Extinct Cd247^em5Mcwi 5687713 13 81515383 81594699 1 - by flanking markers 13 88876046 88951003 1 - by flanking markers 13 83996045 84071408 1 - by flanking markers 6484569 SS-Adora2b^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 114-bp deletion in exon 1 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Adora2b^em1Mcwi 5687729 10 48421592 48437967 1 - by flanking markers 10 48358068 48374871 1 - by flanking markers 10 48569563 48586366 1 - by flanking markers 6484570 SS-Stc1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGCTGCCCAATCACttctccAACAGGTATCCTGAGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Stc1^em2Mcwi 5687722 15 49566885 49577539 1 - by flanking markers 15 54622230 54632884 1 - by flanking markers 15 50891137 50901791 1 - by flanking markers 6484571 SS-Myadml2^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Myadml2^em5Mcwi 5687726 10 110039330 110040967 1 - by flanking markers 10 109418559 109420196 1 - by flanking markers 10 109822170 109827328 1 - by flanking markers 6484572 SS-Fgf5^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence TGGATCCCACGAAGCcagtgtGTTAAGTAAGTTGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fgf5^em5Mcwi 5687727 14 12713971 12734634 1 - by flanking markers 14 12917742 12938879 1 - by flanking markers 14 12974921 12996046 1 - by flanking markers 6484573 SS-Clcn6^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCCCTGGTGACGACtgtggtGGTGTTTGTGGCCTCCATG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 13. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Clcn6^em2Mcwi 5687740 5 165079773 165110594 1 - by flanking markers 5 168469718 168502323 1 - by flanking markers 5 164811815 164844554 1 - by flanking markers 6484574 SS-Umod^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Extinct Umod^em1Mcwi 5687697 1 177729212 177742552 1 - by flanking markers 1 196127939 196141822 1 - by flanking markers 1 189186027 189199939 1 - by flanking markers 6484575 SS-Resp18^em3Mcwi This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp substitution in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Resp18^em3Mcwi 5687714 9 74551809 74558151 1 - by flanking markers 9 82240055 82246695 1 - by flanking markers 9 82470794 82477136 1 - by flanking markers 6484576 SS-Adipoq^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-13) Adipoq^em1Mcwi 5687709 11 79908291 79911065 1 - by flanking markers 11 84363940 84382663 1 - by flanking markers 11 81330845 81344488 1 - by flanking markers 6484577 SS-Gnb3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GGCTCCCTCTCTCCTGGCagtccTTGTGGGACATTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 111-bp deletion overlapping exon 7. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Gnb3^em1Mcwi 5687696 4 160957524 160963226 1 - by flanking markers 4 224370234 224376918 1 - by flanking markers 4 157352558 157359237 1 - by flanking markers 6484578 SS-Mylip^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Mylip^em1Mcwi 5508347 17 25308147 25329887 1 - by flanking markers 17 21703590 21725205 1 - by flanking markers 17 19682040 19703681 1 - by flanking markers 6484579 SS-Chr 5^BN-Cyp4a3^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5^BN/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2. PhysGen Knockouts mutant Extinct Cyp4a3^em3Mcwi 5687737 5 135876140 135893753 1 - by flanking markers 5 138258628 138274813 1 - by flanking markers 5 134468666 134484851 1 - by flanking markers 6484580 SS-Ldlr^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 123-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Extinct (as of 2017-01-26) Ldlr^em2Mcwi 5144094 8 20824040 20846920 1 - by flanking markers 8 22804325 22827199 1 - by flanking markers 8 22750425 22773305 1 - by flanking markers 6484581 SS-Resp18^em2Mcwi This strain was produced by injecting ZFNS targeting the sequence CTCAGCAGACTCCATCCCCagtatcCATGCCGGAAGGAGGGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Resp18^em2Mcwi 5687705 9 74551809 74558151 1 - by flanking markers 9 82240055 82246695 1 - by flanking markers 9 82470794 82477136 1 - by flanking markers 6484582 SS-Cd247^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Cd247^em1Mcwi 5687703 13 81515383 81594699 1 - by flanking markers 13 88876046 88951003 1 - by flanking markers 13 83996045 84071408 1 - by flanking markers 6484583 SS-Nr2f2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCTTCTTCCCTGACCTGCagatcACGGACCAGGTGGCC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nr2f2^em1Mcwi 5687721 1 125280974 125286929 1 - by flanking markers 1 132486697 132499845 1 - by flanking markers 1 131447671 131465749 1 - by flanking markers 6484584 SS-Adipoq^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-13) Adipoq^em2Mcwi 5687716 11 79908291 79911065 1 - by flanking markers 11 84363940 84382663 1 - by flanking markers 11 81330845 81344488 1 - by flanking markers 6484585 SS-Slc7a9^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a9^em2Mcwi 5687701 1 87976440 87999102 1 - by flanking markers 1 92836837 92865759 1 - by flanking markers 1 91709034 91738492 1 - by flanking markers 6484711 SS-Atp2b1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence TACCTTCTGGGTTCAgaagagGCCGTGGCTTGCTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 117-bp deletion in intron 8 and exon 9. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Atp2b1^em2Mcwi 6484707 7 36493661 36600280 1 - by flanking markers 7 41153926 41262537 1 - by flanking markers 7 41114606 41223138 1 - by flanking markers 6484712 SS-Lpin1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Lpin1^em1Mcwi 6484709 6 40253664 40297195 1 - by flanking markers 6 51532422 51638090 1 - by flanking markers 6 41796214 41905149 1 - by flanking markers 6484713 SS-Cubn^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CGGGAGTACCTTCAGATTcatgatGGAGACTCCTCAGCG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 14. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cubn^em1Mcwi 6484705 17 87545893 87772079 1 - by flanking markers 17 82205509 82425565 1 - by flanking markers 17 80584921 80807181 1 - by flanking markers 6484714 SS-Lss^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CCCATCCACTGGTTCtctgggGAAGAAGAGAAGGAAAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 12-bp deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Lss^em2Mcwi 6484706 20 12507575 12534612 1 - by flanking markers 20 15000298 15338473 1 - by flanking markers 20 12844522 12870474 1 - by flanking markers 6484715 SS-Adora2b^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 162-bp deletion in exon 1 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Adora2b^em2Mcwi 5687698 10 48421592 48437967 1 - by flanking markers 10 48358068 48374871 1 - by flanking markers 10 48569563 48586366 1 - by flanking markers 6484716 SS-Bcat1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGTCTGTACATCCGCCCCacattCATCGGGATTGAGGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is 15-bp deletion in exon 5 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Bcat1^em2Mcwi 6484708 4 182641517 182692917 1 - by flanking markers 4 243444839 243491574 1 - by flanking markers 4 179259305 179340021 1 - by flanking markers 6484717 SS-Cacna1h^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CCGACCCACAGTGTCtgggagATCGTGGGGCAGGCAGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 11. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cacna1h^em2Mcwi 6484703 10 14621372 14679051 1 - by flanking markers 10 14547456 14605627 1 - by flanking markers 10 14730932 14789201 1 - by flanking markers 6484718 SS-Ace^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 6. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-13) Ace^em2Mcwi 6484704 10 95361338 95381455 1 - by flanking markers 10 93922062 93965127 1 - by flanking markers 10 94170766 94213831 1 - by flanking markers 6484719 SS-Lepr^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence AGCATCGTACTGCCCacaatgGGACATGGTCACAAG into SS/JrHsdMcwi rat embryos. The resulting mutation was a 16-bp deletion in exon 11, predicted nonsense stop codon 30. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Lepr^em2Mcwi 6484701 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 6484720 SS-Lep^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTGTGCCTATCCacaaaGTCCAGGATGACACC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Lep^em5Mcwi 6484700 4 55943837 55945938 1 - by flanking markers 4 56085079 56099209 1 - by flanking markers 4 56337695 56351818 1 - by flanking markers 6484721 SS-Ace^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GAAACCCAACCTCGATGTCaccagtACAATGGTACAGAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 6. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-11-12) Ace^em1Mcwi 6484702 10 95361338 95381455 1 - by flanking markers 10 93922062 93965127 1 - by flanking markers 10 94170766 94213831 1 - by flanking markers 6766770 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi This congenic strain was developed by cyclic cross-intercross breeding using diabetic prone and diabetic resistant BB rats. (DP x DR)F1 x DR cross intercross breeding was used to generate F2 lymphopenic rats. These were then genotyped for both the flanking markers of the Gimap5 gene; maintained at Medical College of Wisconsin Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 4 75732943 75733127 1 - by flanking markers 4 141978848 141979031 1 - by flanking markers 4 77307388 79562753 1 - by flanking markers 6893382 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 1-bp insertion in exon 5. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Il1r1^em3Mcwi 6893378 9 39434910 39473552 1 - by flanking markers 9 46647422 46723241 1 - by flanking markers 9 46962291 47038139 1 - by flanking markers 6893383 SS-Fyn^em6Mcwi This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fyn^em6Mcwi 6893380 20 43501853 43695567 1 - by flanking markers 20 46160734 46353456 1 - by flanking markers 20 44436354 44630316 1 - by flanking markers 6893384 SS-Kcnj11^em9Mcwi This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnj11^em9Mcwi 6893381 1 96614960 96617993 1 - by flanking markers 1 103186859 103190535 1 - by flanking markers 1 102103093 102107134 1 - by flanking markers 6893385 SS-Kcnj11^em5Mcwi This strain was produced by injecting ZFNs targeting the sequence CTACAGAGCCCAGGTAccgtacTCGGGAGAGGAGGGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnj11^em5Mcwi 6893379 1 96614960 96617993 1 - by flanking markers 1 103186859 103190535 1 - by flanking markers 1 102103093 102107134 1 - by flanking markers 6893429 SS-Nos3^em8Mcwi This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 109-bp deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nos3^em8Mcwi 6893421 4 6158847 6179441 1 - by flanking markers 4 7333272 7353767 1 - by flanking markers 4 7321908 7342404 1 - by flanking markers 6893430 SS-Nat8^em4Mcwi This strain was produced by injecting ZFNs targeting the sequence CACATCCGCCAGTTCCAGgagaggGACTATGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nat8^em4Mcwi 6893413 4 120001277 120002055 1 - by flanking markers 4 182101688 182103119 1 - by flanking markers 4 117525963 117527443 1 - by flanking markers 6893431 SS-Nos3^em13Mcwi This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4 PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Nos3^em13Mcwi 6893422 4 6158847 6179441 1 - by flanking markers 4 7333272 7353767 1 - by flanking markers 4 7321908 7342404 1 - by flanking markers 6893432 SS-Hvcn1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Hvcn1^em1Mcwi 6893410 12 35536954 35556666 1 - by flanking markers 12 41702567 41731349 1 - by flanking markers 12 39822814 39851093 1 - by flanking markers 6893433 SS-Nos3^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Nos3^em2Mcwi 6893418 4 6158847 6179441 1 - by flanking markers 4 7333272 7353767 1 - by flanking markers 4 7321908 7342404 1 - by flanking markers 6893434 SS-Kcnj16^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Kcnj16^em1Mcwi 6893423 10 100514180 100515949 1 - by flanking markers 10 99027026 99087674 1 - by flanking markers 10 99330894 99391551 1 - by flanking markers 6893435 SS-Tfdp2^em6Mcwi This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in exon 6. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Tfdp2^em6Mcwi 6893417 8 101256112 101392512 1 - by flanking markers 8 103489105 103629520 1 - by flanking markers 8 104040795 104181228 1 - by flanking markers 6893436 SS-Kcnmb1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a net 4-bp deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnmb1^em1Mcwi 6893415 10 18904902 18912604 1 - by flanking markers 10 18790595 18800957 1 - by flanking markers 10 18910586 18922856 1 - by flanking markers 6893437 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5. PhysGen Knockouts mutant Extinct Il1r1^em1Mcwi 6893425 9 39434910 39473552 1 - by flanking markers 9 46647422 46723241 1 - by flanking markers 9 46962291 47038139 1 - by flanking markers 6893438 SS-Fgf1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence TTCCAGTTCAGCTGCAGCtcagtGCGGAAAGCGCGGGCGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Fgf1^em2Mcwi 6893412 18 31785480 31806452 1 - by flanking markers 18 31951411 32037426 1 - by flanking markers 18 32273830 32359831 1 - by flanking markers 6893439 SS-Hvcn1^em2Mcwi-/- This strain was produced by injecting ZFNs targeting the sequence CACACCCAGGCCATCCCTGgacttCAGGAGCCGGCTAAGGAA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Hvcn1^em2Mcwi 6893419 12 35536954 35556666 1 - by flanking markers 12 41702567 41731349 1 - by flanking markers 12 39822814 39851093 1 - by flanking markers 6893440 SS-Fyn^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4. PhysGen Knockouts mutant Extinct Fyn^em1Mcwi 6893411 20 43501853 43695567 1 - by flanking markers 20 46160734 46353456 1 - by flanking markers 20 44436354 44630316 1 - by flanking markers 6893441 SS-Grm7^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCCGCCATGTTAACTTCaatggTAAGACTCCAATGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 3. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Grm7^em2Mcwi 6893416 4 146952340 147270225 1 - by flanking markers 4 205768625 206680107 1 - by flanking markers 4 142452616 143368460 1 - by flanking markers 6893442 SS-Pparg^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence TGCCATTCTGGCCCAccaactTCGGAATCAGCTCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a a 133-bp deletion of (RGSC 5.0/rn5): chr4:210,640,676-210,640,808, including part of intron 1 and exon 2 of isoform NM_013124.3 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pparg^em1Mcwi 6893424 4 151492220 151617331 1 - by flanking markers 4 210562928 210688585 1 - by flanking markers 4 147274055 147399383 1 - by flanking markers 6893443 BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5. PhysGen Knockouts mutant Extinct Il1r1^em2Mcwi 6893414 9 39434910 39473552 1 - by flanking markers 9 46647422 46723241 1 - by flanking markers 9 46962291 47038139 1 - by flanking markers 6893444 SS-Kcnmb1^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence AGCTGCATCATAAACACCttcatcATTGGGGCAGCCTTGGCA into SS/JrHsdMcwi rat embryos. The resulting allele is a 21-bp deletion in exon 2 and intron 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Kcnmb1^em3Mcwi 6893420 10 18904902 18912604 1 - by flanking markers 10 18790595 18800957 1 - by flanking markers 10 18910586 18922856 1 - by flanking markers 6893530 BBDR.LA-(D5Rat98-D5Rat233)/Rhw Koletsky rat leptin receptor mutant (lepr) from the LA/N-cp was introgressed into the BBDR/Rhw rats by marker-assisted breeding. This was initiated in 2001 by Dr. Hansen and completed in 2007 at the University of Washington, Seattle. R. H. William Laboratory, University of Washington, Seattle, Washington congenic Unknown 5 100017060 124932061 1 - by flanking markers 5 103451053 127341295 1 - by flanking markers 5 99421434 123480464 1 - by flanking markers 6893535 BBDR.LA-(D5Rat98-D5Rat233), BBDP-(D4Mit6-D4Mit7)/Rhw Heterozygous BBDR.LA-(D5Rat98-D5Rat233)/Rhw (DR.^lepr) were crossed with homozygous BBDR.BBDP-(-(D4Mit6-D4Mit7)/Rhw (DR.^Gimap5), to geenrate teh double congenic rats that had mutations for Gimap5 and lepr genes. R. H. William Laboratory, University of Washington, Seattle, Washington congenic Unknown 6893551 DA.PVG.1AV1-(D1Rat32-D1Rat51)/Kini DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 112148733 159782631 1 - by flanking markers 1 173583273 202649821 1 - by flanking markers 1 167394665 195598217 1 - by flanking markers 6893554 DA.PVG.1AV1-(D1Rat193-D1Rat68)/Kini DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 1 183163129 193070197 1 - by flanking markers 1 201022827 212591221 1 - by flanking markers 1 193968438 205603226 1 - by flanking markers 6893599 SS-Pdc^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CACCACCATCGTGGTtaacaTTTACGAGGATGGTGTCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a net 47-bp deletion in exon 5. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Pdc^em3Mcwi 5687712 13 64622473 64636031 1 - by flanking markers 13 72510251 72523421 1 - by flanking markers 13 67545430 67558600 1 - by flanking markers 6893600 SS-Abcb1b^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-07-24) Abcb1b^em2Mcwi 6893598 4 21829489 21912239 1 - by flanking markers 4 22161597 22244735 1 - by flanking markers 4 22225123 22307577 1 - by flanking markers 6902893 BB.SHR-(Acsm3-Igf2)/K Congenics extablished as speed-congenics by cross of BB/OK and SHR/Mol rats and repeated backcrossing onto BB/OK rats Dept. of Laboratory Animal Science, University of Greifswald, Karlsburg, Germany congenic Unknown Igf2|Acsm3 2870|62086 1 178054386 202915231 1 - by flanking markers 1 196449042 222733868 1 - by flanking markers 1 189514504 215839081 1 - by flanking markers 6903879 SS/NEisSlc 1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan inbred Unknown 6903881 SR/NEisSlc 1962: Dr. L. K. Dahl found the mutant rat from SD at NIH; 1989: Moved to Eisai (Eisai Co., Ltd.); 1991: Moved to BMR Institute for breeding; 1994: Started selling by SLC, Shizuoka, Japan inbred Unknown 6903902 WF.COP-(D2Uwm14-D2Uwm13)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 10539188 11957973 1 - by flanking markers 2 10116941 11387756 1 - by flanking markers 2 10246312 11522696 1 - by flanking markers 6903904 WF.COP-(D2Uwm17-D2Rat16)/Uwm A segment of chromosome 2 was transferred from COP into the WF background. University of Wisconsin, Madison, Wisconsin, USA congenic Unknown 2 32051319 43376636 1 - by flanking markers 2 50381686 62691053 1 - by flanking markers 2 31224612 43643900 1 - by flanking markers 6903912 SS.SHR-(D9Mco72-D9Rat89)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 72258219 1 - by flanking markers 9 52352690 80172715 1 - by flanking markers 9 52686874 80400631 1 - by flanking markers 6903914 SS.SHR-(D9Mco72-D9Rat55)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 69875226 1 - by flanking markers 9 52352690 77741892 1 - by flanking markers 9 52686874 77966876 1 - by flanking markers 6903917 SS.SHR-(D9Mco72-D9Mco109)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 44842324 1 - by flanking markers 9 52352690 52352896 1 - by flanking markers 9 52686874 72470724 1 - by flanking markers 6903920 SS.SHR-(D9Mco72-D9Uia4)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 59247627 1 - by flanking markers 9 52352690 67265755 1 - by flanking markers 9 52686874 67451944 1 - by flanking markers 6903922 SS.SHR-(D9Mco72-D9Mco106)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 44842324 1 - by flanking markers 9 52352690 52352896 1 - by flanking markers 9 52686874 58156770 1 - by flanking markers 6903925 SS.SHR-(D9Mco72-D9Mco105)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Mco72-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 44842118 44842324 1 - by flanking markers 9 52352690 52352896 1 - by flanking markers 9 52686874 57216771 1 - by flanking markers 6903928 SS.SHR-(D9Rat7-D9Got111)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 89249893 1 - by flanking markers 9 83453664 96967940 1 - by flanking markers 9 97276144 97276310 1 - by flanking markers 6903932 SS.SHR-(D9Rat7-D9Rat52)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 81205197 1 - by flanking markers 9 83453664 87395775 1 - by flanking markers 6903934 SS.SHR-(D9Rat7-D9Mco91)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 78634594 1 - by flanking markers 9 83453664 84866878 1 - by flanking markers 9 85112340 85112539 1 - by flanking markers 6903936 SS.SHR-(D9Rat7-D9Rat84)/Mco This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Mco93)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio congenic Unknown 9 77172934 83316504 1 - by flanking markers 9 83453664 91313982 1 - by flanking markers 9 91579562 91579769 1 - by flanking markers 6907047 WF.WKY-(D5Uwm63-D5Uwm60)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Wox7-D5Uwm37). University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 57848236 76159022 1 - by flanking markers 5 61271852 79426001 1 - by flanking markers 5 56733010 75274687 1 - by flanking markers 6907054 WF.WKY-(D5Uwm67-D5Uwm98)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79919505 79919776 1 - by flanking markers 5 82897463 82897734 1 - by flanking markers 5 78777540 82587133 1 - by flanking markers 6907057 WF.WKY-(D5Uwm76-D5Uwm61)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 84434303 84434576 1 - by flanking markers 5 87362775 87363048 1 - by flanking markers 5 83268986 83269259 1 - by flanking markers 6907059 WF.WKY-(D5Uwm76-D5Uwm98)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82586913 82587133 1 - by flanking markers 6907061 WF.WKY-(D5Uwm67-D5Uwm78)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79919505 79919776 1 - by flanking markers 5 82897463 82897734 1 - by flanking markers 5 78777540 79954846 1 - by flanking markers 6907063 WF.WKY-(D5Uwm76-D5Got18)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82406661 82406827 1 - by flanking markers 5 85556660 85556825 1 - by flanking markers 5 81457871 81458036 1 - by flanking markers 6907076 WF.WKY-(D5Uwm78-D5Uwm98)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82406661 82406827 1 - by flanking markers 5 85556660 85556825 1 - by flanking markers 5 79954586 81458036 1 - by flanking markers 6907078 WF.WKY-(D5Uwm95-D5Uwm98)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 82406661 82406827 1 - by flanking markers 5 85556660 85556825 1 - by flanking markers 5 80975875 81458036 1 - by flanking markers 6907080 WF.WKY-(D5Uwm67-D5Uwm81)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79919505 79919776 1 - by flanking markers 5 82897463 82897734 1 - by flanking markers 5 78777540 80126657 1 - by flanking markers 6907084 WF.WKY-(D5Uwm76-D5Uwm92)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80451098 80451339 1 - by flanking markers 6907087 WF.WKY-(D5Uwm78-D5Uwm84)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79954586 80203685 1 - by flanking markers 6907090 WF.WKY-(D5Uwm78-D5Uwm93)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79954586 80518802 1 - by flanking markers 6907092 WF.WKY-(D5Uwm88-D5Uwm92)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80401019 80451339 1 - by flanking markers 6907094 WF.WKY-(D5Uwm87-D5Uwm92)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80372955 80451339 1 - by flanking markers 6907096 WF.WKY-(D5Uwm85-D5Uwm92)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80229223 80451339 1 - by flanking markers 6907098 WF.WKY-(D5Uwm82-D5Uwm92)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80154593 80451339 1 - by flanking markers 6907100 WF.WKY-(D5Uwm82-D5Uwm91)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 80154593 80431178 1 - by flanking markers 6907104 WF.WKY-(D5Uwm77-D5Uwm91)/Uwm A sub congenic strain derived from the progenitor strain WF.WKY-(D5Uwm68-D5Mit4)/Uwm. University of Wisconsin School of Medicine, Madison, Wisconsin congenic Unknown 5 79935684 80431178 1 - by flanking markers 6907436 SS.BN-(D13Hmgc41-D13Hmgc23)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 13^BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45282442 47299604 1 - by flanking markers 13 54236862 56238470 1 - by flanking markers 13 49168131 51182122 1 - by flanking markers 6907438 SS.BN-(D13Rat77-D13Rat105)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 13^BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45592985 63175600 1 - by flanking markers 13 54552997 71047437 1 - by flanking markers 13 49478067 66075827 1 - by flanking markers 6907445 SS.BN-(D13Rat124-D13Rat101)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 13^BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46721037 49428577 1 - by flanking markers 13 55662705 58314767 1 - by flanking markers 13 50609228 53264877 1 - by flanking markers 7204133 LEW-Rag1^em1Ztm This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. Zentrales Tierlaboratorium, Medizinische Hochschule Hannover, Germany mutant Unknown Rag1^em1Ztm 7204132 3 86780782 86791878 1 - by flanking markers 3 97866048 97877145 1 - by flanking markers 3 91206394 91217491 1 - by flanking markers 7204136 SD-Rag1^em1Ang This strain was produced by injecting ZFNs into Sprague-Dawley rat embryos. The resulting mutation is a 5-bp frameshift deletion in the Rag1 gene that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. Institut National de la Sante et de la Recherche Medicale (INSERM) mutant Unknown Rag1^em1Ang 7204135 3 86780782 86791878 1 - by flanking markers 3 97866048 97877145 1 - by flanking markers 3 91206394 91217491 1 - by flanking markers 7207880 LEW.WKY-(D13Arb15-D13Rat58)/Tja Segment of interest from chr 13 of WKY/NCrl was introgressed into LEW/SsNHsd Imperial College, London, UK congenic Unknown 13 71116479 96441728 1 - by flanking markers 13 78673431 103987907 1 - by flanking markers 13 73748382 98985851 1 - by flanking markers 7240510 DA.PVG.1AV1-(D4Rat113-D4Kiru96)/Kiru congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 157006984 157007337 1 - by flanking markers 4 220242234 220242357 1 - by flanking markers 4 153152949 155869653 1 - by flanking markers 7240512 DA.PVG.1AV1-(D4Rat113-D4Kiru80)/Kiru congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 157006984 157007337 1 - by flanking markers 4 220242234 220242357 1 - by flanking markers 4 153152949 156629648 1 - by flanking markers 7240513 DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru congenic strain derived by marker-assisted transfer of the desired region from PVG.1AV1/Kini onto the genetic background of DA/ZtmKini Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 155730927 157145363 1 - by flanking markers 7240514 DA.PVG.1AV1-(D4Kiru12-D4Kiru55)/Kiru Congenic substrain derived by marker-assisted transfer of the desired region from DA.PVG.1AV1-(D4Kiru90-D4Kiru111)/Kiru onto the genetic background of DA/ZtmKini Department of Medicine, Rheumatology Unit, Karolinska Institutet, Karolinska University, Stockholm, Sweden congenic Unknown 4 155929794 156347543 1 - by flanking markers 7240521 DA.PVG.1AV1-(D4Kini3-D4Rat177)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden congenic Unknown 4 114073976 114074165 1 - by flanking markers 4 175324865 175325053 1 - by flanking markers 4 110635261 110635449 1 - by flanking markers 7240522 DA.PVG.1AV1-(D4Kini3-D4Mgh14)/Kini DA/ZtmKini females were mated with PVG.1AV1/Kini males; breeding pair from N5 generation were crossed for 2 generation to get the desired congenic strain Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Viral encephalitis (HSE) 4 36592628 36592773 1 - by flanking markers 4 37534124 37534268 1 - by flanking markers 4 28161938 37685319 1 - by flanking markers 7241047 LE-Lrrk1^em1SageLrrk2^em1Sage This strain was produced by crossing LE-Lrrk1^em1Sage with LE-Lrrk2^em1Sage Horizon Discovery mutant Cryopreserved Embryo (as of 2017-06-06) Lrrk1^em1SageLrrk2^em1Sage 7241043 7 130105902 130267747 1 - by flanking markers 7 132531591 132694226 1 - by flanking markers 7 132857311 133018549 1 - by flanking markers 7241048 LE-Park7^em1Sage This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 Sigma Advanced Genetic Engineering Labs mutant Unknown Park7^em1Sage 7241042 5 168050149 168061616 1 - by flanking markers 5 171559202 171582476 1 - by flanking markers 5 167982438 168004724 1 - by flanking markers 7241049 LE-Pink1^em1Sage-/- ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). Horizon Discovery mutant Live Animals (as of 2017-05-08) Pink1^em1Sage 7241046 5 157091181 157103293 1 - by flanking markers 5 160425715 160437827 1 - by flanking markers 5 156677146 156689258 1 - by flanking markers 7241050 LE-Lrrk2^em1Sage This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 30. Horizon Discovery mutant Live Animals (as of 2017-06-06) Lrrk2^em1Sage 7241045 7 130105902 130267747 1 - by flanking markers 7 132531591 132694226 1 - by flanking markers 7 132857311 133018549 1 - by flanking markers 7241051 LE-Lrrk1^em1Sage This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. Horizon Discovery mutant Unknown Lrrk1^em1Sage 7241044 1 120695657 120836324 1 - by flanking markers 1 128248473 128372456 1 - by flanking markers 1 127166866 127301053 1 - by flanking markers 7241052 LE-Prkn^em1Sage-/- ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT). Horizon Discovery mutant Unknown Prkn^em1Sage 7241041 1 43151265 44374470 1 - by flanking markers 1 49684308 50875397 1 - by flanking markers 1 48880015 50069998 1 - by flanking markers 7241053 LE-Lrrk1^em1Sage-/-Lrrk2^em1Sage-/- ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous Horizon Discovery mutant Unknown Lrrk1^em1SageLrrk2^em1Sage 7241043 7 130105902 130267747 1 - by flanking markers 7 132531591 132694226 1 - by flanking markers 7 132857311 133018549 1 - by flanking markers 7241054 LE-Pink1^em1Sage This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs mutant Unknown Pink1^em1Sage 7241046 5 157091181 157103293 1 - by flanking markers 5 160425715 160437827 1 - by flanking markers 5 156677146 156689258 1 - by flanking markers 7241055 LE-Park7^em1Sage-/- ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA). Horizon Discovery mutant Live Animals (as of 2017-05-08) Park7^em1Sage 7241042 5 168050149 168061616 1 - by flanking markers 5 171559202 171582476 1 - by flanking markers 5 167982438 168004724 1 - by flanking markers 7241056 LE-Lrrk2^em1Sage-/- ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offsprings maintained as homozygous Sigma Advanced Genetic Engineering Labs mutant Live Animals (as of 2018-08-24) Lrrk2^em1Sage 7241045 7 130105902 130267747 1 - by flanking markers 7 132531591 132694226 1 - by flanking markers 7 132857311 133018549 1 - by flanking markers 7241057 LE-Lrrk1^em1Sage-/- ZFN mutant founders carrying a 19-bp frameshift deletion in exon 4 were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. Horizon Discovery mutant Unknown Lrrk1^em1Sage 7241044 1 120695657 120836324 1 - by flanking markers 1 128248473 128372456 1 - by flanking markers 1 127166866 127301053 1 - by flanking markers 7241058 LE-Prkn^em1Sage This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs mutant Unknown Prkn^em1Sage 7241041 1 43151265 44374470 1 - by flanking markers 1 49684308 50875397 1 - by flanking markers 1 48880015 50069998 1 - by flanking markers 7241239 DA.BN-(D9Wox18-D9Rat20)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 18347599 47129300 1 - by flanking markers 9 24554204 54685631 1 - by flanking markers 9 25692373 54978814 1 - by flanking markers 7241240 DA.BN-(D9Mit6-D9Rat29)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 1526763 22066432 1 - by flanking markers 9 28304251 28304379 1 - by flanking markers 9 29466970 29467098 1 - by flanking markers 7241241 DA.BN-(D9Mit6-D9Got15)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 1526763 6948180 1 - by flanking markers 9 12615141 12615255 1 - by flanking markers 9 13683965 13684079 1 - by flanking markers 7241242 DA.BN-(D9Got8-D9Rat139)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 2174611 3811711 1 - by flanking markers 9 2597055 37252772 1 - by flanking markers 9 2657610 3308009 1 - by flanking markers 7241243 DA.BN-(D9Wox24-D9Rat20)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 9 47129152 47129300 1 - by flanking markers 9 9858502 54685631 1 - by flanking markers 9 10869391 54978814 1 - by flanking markers 7241244 DA.BN-(D9Wox24-D9Wox18)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 18347599 18347796 1 - by flanking markers 9 9858502 24554401 1 - by flanking markers 9 10869391 25692570 1 - by flanking markers 7241245 DA.BN-(D9Wox24-D9Rat139)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 2174611 2174738 1 - by flanking markers 9 9858502 37252772 1 - by flanking markers 9 3307883 10869489 1 - by flanking markers 7241246 DA.BN-(D9Wox24-D9Rat44)/Kini DA/ZtmKini females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 2948882 2949051 1 - by flanking markers 9 2813697 9858600 1 - by flanking markers 9 2880977 10869489 1 - by flanking markers 7241247 LEW.BN-(D9Got8-D9Got22)/Kini LEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 3811425 12324010 1 - by flanking markers 9 2597055 17959093 1 - by flanking markers 9 2657610 19076070 1 - by flanking markers 7241248 LEW.BN-(D9Wox24-D9Got22)/Kini LEW/Rj females were mated with BN/Rj males, speed congenic strategy was used to generate these congenics; when the donor genome outside of the congenic segment was removed, two heterozygous animals were intercrossed to produce homozygous rats Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden congenic Unknown 9 12323882 12324010 1 - by flanking markers 9 9858502 17959093 1 - by flanking markers 9 10869391 19076070 1 - by flanking markers 7241265 SHR-Chr Y^WKY/Akr WKY/NHsd males were crosssed with SHR/NHsd females to get F1 animals, the hybrid animals were backcrossed with female SHR/NHsd to transfer the Y chromosome Universityof Akron breeding colonies, The University of Akron, Akron, Ohio consomic Unknown 7241267 WKY-Chr Y^SHR/Akr SHR/NHsd males were crosssed with WKY/NHsd females to get F1 animals, the hybrid animals were backcrossed with female WKY/NHsd to transfer the Y chromosome University of Akron breeding colonies, The University of Akron, Akron, Ohio consomic Unknown 7241271 SHR.BN-(D10Mit4-D10Wox11)/Cub Segment of chromosome 10 from BN.Lx/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 10 36649906 53793117 1 - by flanking markers 10 36354729 53388667 1 - by flanking markers 10 36584373 53637634 1 - by flanking markers 7241594 (SDxF344)F1-Rbm20^m1Mlgw This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. University of Wisconsin, Madison mutant Cryopreserved Sperm (as of 2017-01-25) Rbm20^m1Mlgw 7241593 1 259905545 260144190 1 - by flanking markers 1 281783646 282003053 1 - by flanking markers 1 274391932 274589816 1 - by flanking markers 7241595 (SDxF344)F1xBN-Rbm20^m1Mlgw+/+ Heterozygous offspring were intercrossed and maintained as wild type University of Wisconsin, Madison mutant Cryopreserved Sperm Rbm20^m1Mlgw 7241593 1 259905545 260144190 1 - by flanking markers 1 281783646 282003053 1 - by flanking markers 1 274391932 274589816 1 - by flanking markers 7241596 (SDxF344)F1-Rbm20^m1Mlgw+/+ Heterozygous offsprings were intercrossed and maintained as wild type University of Wisconsin, Madison mutant Cryopreserved Sperm Rbm20^m1Mlgw 7241593 1 259905545 260144190 1 - by flanking markers 1 281783646 282003053 1 - by flanking markers 1 274391932 274589816 1 - by flanking markers 7241597 (SDxF344)F1xBN-Rbm20^m1Mlgw This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. University of Wisconsin, Madison mutant Cryopreserved Sperm (as of 2017-01-25) Rbm20^m1Mlgw 7241593 1 259905545 260144190 1 - by flanking markers 1 281783646 282003053 1 - by flanking markers 1 274391932 274589816 1 - by flanking markers 7241794 SHR/Bbb This SHR colony is maintained at Max-Delbruck Center for Molecular Medicine, Germany Max-Delbruck Center for Molecular Medicine, Germany inbred Unknown 7241811 BBDP.WF-(D8Rat73-D8Sunn1467)(D13Rat124-D13Mgh5)/Sunn a double congenic strain which has more than 38.74 Mb of chr 8 and more than 16.78 Mb of chr 13 of Wistar Furth introgressed into the gentic background of BBDP/WorSunn Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada congenic Unknown 7243955 DA.F344-(D4Got44-D4Arb21)/Arb Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 63884916 104416123 1 - by flanking markers 4 63125453 163844250 1 - by flanking markers 4 63411811 99067102 1 - by flanking markers 7243960 DA.F344-(D4Got44-D4Rat128)/Arb Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 63884916 79190364 1 - by flanking markers 4 63125453 145335458 1 - by flanking markers 4 63411811 80666496 1 - by flanking markers 7243963 DA.F344-(D4Uia2-D4Wox21)/Arb Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 68131191 78039646 1 - by flanking markers 4 133170446 144249459 1 - by flanking markers 4 68379412 79575667 1 - by flanking markers 7243965 DA.F344-(D4Arb21-D4Arb4)/Arb Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 104415843 154937227 1 - by flanking markers 4 163843971 216606455 1 - by flanking markers 4 99066823 150682594 1 - by flanking markers 7243966 DA.F344-(D4Arb5-D4Arb4)/Arb Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 4 120436701 154937227 1 - by flanking markers 4 182615641 216606455 1 - by flanking markers 4 118044851 150682594 1 - by flanking markers 7244374 FXLE/Stm Recombinant inbred strain derived from Le/Stm (from Ben May, Laboratory for Cancer Research, University of Chicago, Chicago IL) and F344/DuCrlj (from Charles River Japan) and then maintained by brother-sister mating. Saitama Cancer Center Research Institute, 818 Komuro Saitama, Japan advanced_intercross_line Unknown 7244380 DA.F344(Cia3c)/Arb Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 7244381 DA.F344(Cia3e)/Arb Congenic substrain derived from backcrossing DA.F344-(D4Got44-D4Arb4)/Arb (DA.F344(Cia3) with DA/BklArbN; after 10 backcrosses offsprings were intercrossed to ensure homozygosity The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland congenic Unknown 7245481 SD-Tg(hsMt-LacZ)Reh presses LacZ under the transcriptional control of the mouse metallothionein regulatory sequences. Transgene expression in germ cells is constitutive; expression of the transgene can be induced in liver by zinc or cadmium. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05) 7245482 SD-Tg(ROSA26-EGFP)RehRrrc Strain carries a 1.8kb transgene consisting of the mouse ROSA26 regulatory sequences driving EGFP. FISH was used to localize the transgene insertion to Chromosome 11q11-q12, proximal to Grik1 and near Ncam2. The transgene is expressed exclusively in male and female germ cells throughtout development. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-02-05) 7245488 SD-Tg(Chat-tTA) Rats express a mouse tetracycline-controlled transactivator (tTA) driven by the mouse choline acetyltransferase (Chat) promotor. When mated to a second transgenic strain (RRRC:00633) that carries a target gene (TDP43) under the regulation of a tetracycline response element (TRE), the expression of TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) 7245494 SD-Tg(TRE-TARDBP-M337V) Strain carries a transgene expressing human TDP43 with the M337V mutation under control of a tTA-dependent promoter (TRE). When mated to a second transgenic strain (RRRC:632) that carries a tetracycline-controlled transactivator driven by the mouse choline acetyltransferase (Chat) promoter, the expression of mutant TDP43 in Chat-expressing motor neurons in the double transgenic rats can be induced by withdrawal of doxycycline. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) TARDBP 1322081 7245521 SD-Tg(Th-SNCA^*)3Ins the transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines Rat Resource and Research Center transgenic Unknown 7245523 SD-Tg(Th-SNCA^*)4Ins the transgene overexpressing human mutated alpha-synuclein (A53T and A30P) under the control of rat tyrosine hydroxylase (Th)promoter was microinjected into SD ovocytes to generate 3 transgenic rat lines Rat Resource and Research Center transgenic Unknown 7245527 WKHA/Edh derived from a cross between SHR/N and WKY/N starting in 1980; followed by selected brother/sister inbreedings from F2 generation forward, selecting WKHA for highest activity and lowest blood pressure Rat Resource and Research Center inbred Unknown 7245556 WKHT/Edh WKHT rats are derived from a cross between SHR and WKY. Brother/sister inbreeding of the hybrids and successive generations was performed, selecting for the hypertension, but not the behavioral hyperactivity, of the SHR. Rat Resource and Research Center inbred Unknown 7246924 HanTacFcfiq:WH Wistar Hannover Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating. Universidade de Sao Paulo outbred Unknown 7246927 NTacFcfiq:SD Sprague Dawley Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating. Universidade de Sao Paulo outbred Unknown 7246928 NTac:NIH-Foxn1^rnu nude The NIH nude Spontaneous mutant model was developed by NIH in 1979-1980 by intercrossing eight strains of rats. Taconic received stock from NIH Animal Genetic Resource in 1981. The rats were derived by hysterectomy in 1987 and again in 1998. Animals are randomly bred at Taconic without selection for coat color or pigmentation. Taconic outbred Unknown 7246929 NTacFcfiq:NIH-Foxn1^rnu nude Received from Taconic in 2001; bred according to the Poiley rotation (1960) with permanent monogamous mating between homozygous male x heterozygous female. Universidade de Sao Paulo outbred Unknown 7247278 SD-Tg(Camk2a-tTA)Xgx Camk2a-tTA transgenic rats expressing tTA under regulatory control of the forebrain promotor Camk2a. Transgene expression can be blocked by administration of doxycycline to drinking water. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) 7247279 SD-Tg(TRE-FUS-R521C)Xgx Overexpression of R521C mutant form of human FUS (Fused in Sarcoma) transgene is under regulatory control of tetracycline-responsive promoter element. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) FUS 1318882 7247280 SD-Tg(TRE-LacZ)Xgx LacZ gene was assembled downstream of the TRE (tetracycline-responsive promoter elements) promoter, allowing inducible gene expression. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) 7247286 F344-Tg(APP)21Besey F344/NHsd embryos were microinjected with a DNA construct containing human beta amyloid precursor protein (APP), Swedish (Swe) double mutation (K670N-M671L) and Indiana (Ind) single autosomal dominant mutation (V642F). The transgene is driven by an ubiquitin-C promoter. Homozygous transgenic rats exhibit approximately 2.9-fold more expression of APP mRNA than wild-type rats. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) APP 736021 7247289 SD-Tg(TETRA-EGFP)Besey SD embryos were microinjected with a DNA construct containing the GFP gene downstream of a miniCMV promoter under the control of tetracycline response element (TRE). The pLV-Tet-GFP was generated by co-transfection of pLV-Tet-GFP, pÎ8.9 and pVSV-G into a 293FT packaging cell line Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-18) 7247290 SD-Tg(Ubc-P2ry2)Besey SD embryos were microinjected with a lentiviral construct containing the rat P2ry2 gene (G protein-coupled purinergic receptor P2Y2) under control of an ubiquitin-C promoter. Results in over-expression of P2ry2 mRNA. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-08-22) P2ry2 62088 7247594 WKY.SHR-(D1Rat90-D1Mit18)/Iwai Fragment of the chromosome 1 derived from SHR and repeated backcross to WKY Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 224426266 267111153 1 - by flanking markers 1 246118980 289137268 1 - by flanking markers 1 238830408 281795785 1 - by flanking markers 7248453 SS.BN-(D12Hmgc3-AU047911)/Mcwi Subcongenic strain generated by backcrossing SS-Chr 12^BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi to SS-Chr 12^BN/Mcwi, intercrossing the F₁ generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12^BN/Mcwi and bred to homozygosity. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 15420627 15420833 1 - by flanking markers 12 17102817 19021770 1 - by flanking markers 12 15085585 17031347 1 - by flanking markers 7248454 SS.BN-(D12Hmgc7-D12Hmgc6)/Mcwi Subcongenic strain generated by backcrossing SS-Chr 12^BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi to SS-Chr 12^BN/Mcwi, intercrossing the F₁ generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12^BN/Mcwi and bred to homozygosity. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 24299715 24300160 1 - by flanking markers 12 22283062 22283507 1 - by flanking markers 7248456 SS.BN-(D12Hmgc3-D12Got29)/Mcwi Subcongenic strain generated by backcrossing SS-Chr 12^BN.SS-(D12Hmgc3-D12Hmgc6)/Mcwi to SS-Chr 12^BN/Mcwi, intercrossing the F₁ generation, and genotyping for recombinations; recombinant strain was backcrossed to SS-Chr 12^BN/Mcwi and bred to homozygosity. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 12 14395317 14395596 1 - by flanking markers 12 17102817 18009770 1 - by flanking markers 12 15085585 16012213 1 - by flanking markers 7248725 ACI.BN-(D7Rat164-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7248727 ACI.BN-(D7Rat164-D7Uwm30)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7248729 ACI.BN-(D7Rat206-D7Uwm30)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 75357125 75357349 1 - by flanking markers 7 78786126 78786349 1 - by flanking markers 7 78758303 78758526 1 - by flanking markers 7248731 ACI.BN-(D7Rat164-D7Uwm31)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7248733 ACI.BN-(D7Rat164-D7Uwm33)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 69506936 69507070 1 - by flanking markers 7 72918736 72918869 1 - by flanking markers 7 72752037 72752170 1 - by flanking markers 7248736 ACI.BN-(D7Uwm32-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7248738 ACI.BN-(D7Uwm36-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7248740 ACI.BN-(D7Uwm38-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7248742 ACI.BN-(D7Uwm33-D7Mit27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 7 98955068 98955278 1 - by flanking markers 7 103159379 103159589 1 - by flanking markers 7 102588240 102588450 1 - by flanking markers 7248744 ACI.BN-(D7Uwm33-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7248746 ACI.BN-(D7Uwm41-D7Mit16)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 7248748 ACI.BN-(D7Uwm28-D7Mit16)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 120745845 120746007 1 - by flanking markers 7 123587556 123587717 1 - by flanking markers 7 123602837 123602998 1 - by flanking markers 7257663 WI-Tlr4^em1Geh This strain was produced by TALEN mediated 13 bp deletion in Exon 1 in the rat Tlr4 gene; background strain is Crl:WI University of Pittsburgh, Rat Resource and Research Center mutant Unknown alcohol action, immune system function, septic shock Tlr4^em1Geh 7257661 5 83564100 83577735 1 - by flanking markers 5 86690670 86704302 1 - by flanking markers 5 82587424 82601056 1 - by flanking markers 7257722 WKY.SHR-(D1Mgh14-D1Rat77)/Iwai Fragment of the chromosome 1 derived from SHR/NCrlj and repeated backcross to WKY/NCrlCrlj Shiga University of Medical Science, Otsu, Japan congenic Unknown 1 238037373 263699089 1 - by flanking markers 1 259703519 285604895 1 - by flanking markers 1 252479838 278228889 1 - by flanking markers 7349321 LEXF2D/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. Saitama Cancer Center Research Institute, Saitama, Japan recombinant_inbred Unknown 7349322 LEXF8B/Stm This strain is derived from systematic breeding of the F2 generation between LE/Stm and F344/Stm. Saitama Cancer Center Research Institute, Saitama, Japan recombinant_inbred Unknown 7349357 DA.PVG.1AV1-(D4Got128-D4Got136) Congenic substrain derived from marker assisted selection for PVG.1AV1 chromsome 4 alleles on the DA recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 159334251 160528447 1 - by flanking markers 4 222712454 223964695 1 - by flanking markers 4 155691688 156945571 1 - by flanking markers 7364879 SS-Apoe^em9Mcwi This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Apoe^em9Mcwi 7364878 1 79003634 79006387 1 - by flanking markers 1 81878372 81882298 1 - by flanking markers 1 80612894 80616820 1 - by flanking markers 7364880 SS-Cst3^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Cst3^em1Mcwi 5687708 3 137650903 137654776 1 - by flanking markers 3 149628692 149632565 1 - by flanking markers 3 143219671 143223544 1 - by flanking markers 7364881 SS-Slc7a9^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Slc7a9^em1Mcwi 5687700 1 87976440 87999102 1 - by flanking markers 1 92836837 92865759 1 - by flanking markers 1 91709034 91738492 1 - by flanking markers 7364882 SS-Sorcs2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Sorcs2^em1Mcwi 5508343 14 79968072 80344330 1 - by flanking markers 14 79176694 79547823 1 - by flanking markers 14 79538911 79912333 1 - by flanking markers 7364902 SS-Chr 2^BN/1McwiAek Compared to the current SS-Chr 2^BN/Mcwi colony at the Medical College of Wisconsin (where this strain originated) it is a more complete consomic strain (a smaller piece of distal Chromosome 2 is of the SS genotype compared to the SS-Chr 2^BN/Mcwi strain). Rat Resource and Research Center consomic Cryopreserved Embryo (as of 2019-02-19) Studies of ischemia reperfusion injury or hypertension 7364919 SS.BN-(rs64114288-rs107464428)/Aek This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2^BN/Mcwi from the top to ~227 Mb transferred to the SS/JrHsdMcwi strain background. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) cardiac ischemia 2 4393495 226787712 1 - by flanking markers 2 4122074 253120782 1 - by flanking markers 2 4124871 233798506 1 - by flanking markers 7364923 SS.BN-(rs106982173-rs65057186)/Aek This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2^BN/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) cardiac ischemia 2 95437081 219011790 1 - by flanking markers 2 115311536 243978789 1 - by flanking markers 2 95571004 225944289 1 - by flanking markers 7364927 SS.BN-(rs13453786-rs66377062)/Aek This congenic strain contains a fragment of chromosome 2 of the SS-Chr 2^BN/Mcwi from ~95 to 219 Mb transferred to the SS/JrHsdMcwi strain background. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) cardiac ischemia 2 224440703 248978273 1 - by flanking markers 2 250808785 274502259 1 - by flanking markers 2 231460803 255813030 1 - by flanking markers 7364932 ACI.BN-(D7Rat42-D7Uwm33)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 88132195 95760450 1 - by flanking markers 6 20168871 116858395 1 - by flanking markers 6 10173862 108696915 1 - by flanking markers 7364934 ACI.BN-(rs199006987-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 98063531 98063531 1 - by flanking markers 7 101990558 101990558 1 - by flanking markers 7 101422284 101422284 1 - by flanking markers 7364936 ACI.BN-(D7Arb15-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 96648929 96649150 1 - by flanking markers 7 100740218 100740438 1 - by flanking markers 7 100160221 100160441 1 - by flanking markers 7364938 (LE x RCS-p⁺/LavRrrc)F1 RCS-p⁺/LavRrrc males were mated to LE females. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) Retinal Research Mertk 69283 7364940 F344-Tp53^{tm1(EGFP-Pac)Qly}/Rrrc Backcrossed STOCK-Tp53^{tm1(EGFP-Pac)Qly}Rrrc with F344 using speed congenic approach to move mutation onto F344 genetic background. Rat Resource and Research Center mutant Unknown tumorigenesis model 7364954 DA.ACI-(D2Mit12-D2Got121)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 7 times then brother-sister mating to maintain in the homozygous state North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 174730375 193841840 1 - by flanking markers 2 201404917 220662282 1 - by flanking markers 2 181990297 201193787 1 - by flanking markers 7364956 DA.ACI-(D2Wox20-D2Mit14)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 10 times then brother-sister mating to maintain in the homozygous state North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 181213221 197256313 1 - by flanking markers 2 207864396 224018437 1 - by flanking markers 2 188448030 204585731 1 - by flanking markers 7364959 DA.ACI-(D2Uwm24-D2Rat54)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 8 times then brother-sister mating to maintain in the homozygous state North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 2 198168347 210012267 1 - by flanking markers 2 224860752 234970326 1 - by flanking markers 2 205430606 216878775 1 - by flanking markers 7364970 DA.ACI-(D12Mit2-D12Got49)/Nsi Congenic strain created by backcrossing DA/BklArbNsi and ACI/SegHsd 12 times then brother-sister mating to maintain in the homozygous state North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-18) arthritis/autoimmunity studies 12 20932559 24257553 1 - by flanking markers 12 24662983 28081151 1 - by flanking markers 12 22650702 26079250 1 - by flanking markers 7364974 DA.F344-(D10Rat195-D10Rat92)/Nsi Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 10 63690620 78170722 1 - by flanking markers 10 66394066 77132664 1 - by flanking markers 10 65234285 77269936 1 - by flanking markers 7364976 DA.F344-(D10Rat195-D10Arb27)/Nsi Congenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 10 63690620 69160517 1 - by flanking markers 10 66394066 67971488 1 - by flanking markers 10 65234285 68305173 1 - by flanking markers 7364978 DA.F344-(D10Arb27-D10Rat92)/Nsi Congenic strain created by backcrossing F344 into DA/BklArbNsi 8 times then brother-sister mating to maintain in the homozygous state North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 10 69160380 78170722 1 - by flanking markers 10 67971352 77132664 1 - by flanking markers 10 68305037 77269936 1 - by flanking markers 7364981 DA.F344-(D7Rat22-D7Rat15)/Nsi Congenic strain created by backcrossing F344/NHsd into DA/BklArbNsi 11 times then brother-sister mating to maintain in the homozygous state The National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-19) arthritis/autoimmunity studies 7 76615341 107428439 1 - by flanking markers 7 110975825 110975995 1 - by flanking markers 7 111043360 111043530 1 - by flanking markers 7364991 ACI/EurMcwi ACI (August × Copenhagen Irish) substrain of ACI derived from ACI/Eur Medical College of Wisconsin, Rat Resource & Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm Renal disease 7365040 SS.SR-(rs65785750-rs13452155)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2021-05-07) 5 106408365 138369243 1 - by flanking markers 5 109436629 140527096 1 - by flanking markers 5 105452223 136738047 1 - by flanking markers 7365043 SS.SR-(rs65785750-rs106808193)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 5 106408365 141744732 1 - by flanking markers 5 109436629 143913027 1 - by flanking markers 5 105452223 140120264 1 - by flanking markers 7394698 ZUC.BN-(D1Rat42-D1Rat90)/Ste homozygous lean wild-type ZUC-Lepr^+Ste were crossed with BN/Crl to get F₁; these were backcrossed to lean ZUC males; congenics were selected by genotyping with markers University of California Davis, Davis, CA congenic Unknown 1 135418152 267111153 1 - by flanking markers 1 142342107 289137268 1 - by flanking markers 1 141381406 281795785 1 - by flanking markers 7394818 P.NP-(D4Mgh16-D4Rat173)/Iusm P.NP-(D4Rat119-D4Rat55)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown 4 61646674 92716873 1 - by flanking markers 4 61427427 158932336 1 - by flanking markers 4 61708103 94143659 1 - by flanking markers 7394821 P.NP-(Snca-D4Rat35)/Iusm P.NP-(D4Rat119-D4Rat55)/Iusm and P rats were backcrossed to get F1 animals which were further backcrossed to P rats for 10 generations, this was followed by intercross to generate the congenic strains, these animals were selected by marker-assisted selection Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana congenic Unknown Snca 3729 4 89613731 91336908 1 - by flanking markers 4 155592411 157297332 1 - by flanking markers 4 90782412 92490285 1 - by flanking markers 7401201 SS.SR-(D17Rat24-rs106534785)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 17 57724628 71942842 1 - by flanking markers 17 50489557 65074022 1 - by flanking markers 17 52424553 63306062 1 - by flanking markers 7401203 SS.SR-(rs105019230-D17Rat44)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. Rat Resource and Research Center Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts. congenic Cryopreserved Sperm (as of 2021-05-07) 17 63080042 81612488 1 - by flanking markers 17 55371177 75653670 1 - by flanking markers 17 57343133 73981731 1 - by flanking markers 7401261 LOU/NimrOlaHsd Louvain LOU/C was selected for high immunocytoma incidence; to National Institute of Medical Research, Mill Hill; in 1985 from Nimr to Harlan Envigo inbred Cryorecovery 7411634 WDB/Nips Crlj:WI females were bred to DA/Slc males to generate F₁ pups which were bred by brother-sister mating; only black (non-agouti) pups were picked for breeding. (The genotype of the pups was checked by backcrossing to BN (for BB or Bb) and Hooded strains (for HH or Hh) genotype.) When the aaBBCCHH genotype of F2 was confirmed then the strain was maintained by brother-sister mating. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN inbred Unknown 7411676 SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc Congenic strain created by speed congenic strategy where the desired region from Chromosome 3 of WKY/Gcrc was introgressed into the SHRSP/Gcrc background. University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 3 6373335 149496698 1 - by flanking markers 3 11361699 160347840 1 - by flanking markers 3 6000748 155263151 1 - by flanking markers 7411679 SHRSP.WKY-(D2Rat13-D2Rat157)(D3Mgh16-D3Rat114)/Gcrc F₁ rats generated by crossing SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc and SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc were backcrossed to SHRSP.WKY-(D2Rat13-D2Rat157)/Gcrc; heterozygous animals for chr 3 fragment were crossed with homozygous animals for chr 2; animals that were homozygous for both fragments were intercrossed to get the desired bicongenic strain University of Glasgow, Western Infirmary, Glasgow, UK congenic Unknown 7411703 SHRSP.SHR-(D1Rat93-D1Rat269)(D18Rat73-D18Rat11)/Izm constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 18;1 52290789;63990899 71692408;126292805 1 - by flanking markers;1 - by flanking markers 18;1 50804228;63244295 69942605;133485967 1 - by flanking markers;1 - by flanking markers 18;1 51609032;64252881 70803264;132448306 1 - by flanking markers;1 - by flanking markers 7411705 SHR.SHRSP-(D1Rat93-D1Rat269)(D18Rat73-D18Rat11)/Izm constructed by crossing and backcrossing the congenic strains for chr 1 and chr 18 segments Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 18;1 52290789;63990899 71692408;126292805 1 - by flanking markers;1 - by flanking markers 18;1 50804228;63244295 69942605;133485967 1 - by flanking markers;1 - by flanking markers 18;1 51609032;64252881 70803264;132448306 1 - by flanking markers;1 - by flanking markers 7411707 SHRSP.SHR-(D1Mgh5-D1Got87)/Izm male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 78134304 85828306 1 - by flanking markers 1 80946174 92291485 1 - by flanking markers 1 79689548 91156803 1 - by flanking markers 7411709 SHRSP.SHR-(D1Mit30-D1Rat269)/Izm male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 94473940 126292805 1 - by flanking markers 1 101048742 133485967 1 - by flanking markers 1 99983293 132448306 1 - by flanking markers 7421599 SS.LEW-(D1Chm64-D1Rat19)/Ayd A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 1 43872710 43872827 1 - by flanking markers 1 50173150 50173266 1 - by flanking markers 1 49578577 49578693 1 - by flanking markers 7421603 SS.LEW-(D1Rat320-D1Mgh32)/Ayd A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 1 119536684 247882384 1 - by flanking markers 1 126980427 269885827 1 - by flanking markers 1 125875758 262433692 1 - by flanking markers 7421606 SS.LEW-(D1Uia4-D1Rat320)/Ayd A segment of chromosome 1 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 1 64343599 119536913 1 - by flanking markers 1 63580258 126980655 1 - by flanking markers 1 64588516 125875986 1 - by flanking markers 7421610 SS.LEW-(D5Mit5-D5M4Mit14)/Ayd A segment of chromosome 5 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 5 109163281 109163425 1 - by flanking markers 5 112057862 112058005 1 - by flanking markers 5 108092659 108092802 1 - by flanking markers 7421612 SS.LEW-(D16Chm48-D16Chm60)/Ayd A segment of chromosome 16 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 16 2116303 3165043 1 - by flanking markers 16 2471921 3491557 1 - by flanking markers 16 3524957 3525217 1 - by flanking markers 7421617 SS.LEW-(D17Chm14-D17Rat65)/Ayd A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 17 80181988 93930006 1 - by flanking markers 17 74265283 88435496 1 - by flanking markers 17 72580584 86731080 1 - by flanking markers 7421619 SS.LEW-(D17Chm85-D17Chm71)/Ayd A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 7421621 SS.LEW-(D17Chm131-D17Chm93)/Ayd A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 7421623 SS.LEW-(D17Rat84-D17Chm17)/Ayd A segment of chromosome 17 was transferred from LEW/Crlc into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 17 29603712 29604237 1 - by flanking markers 17 23473207 23473342 1 - by flanking markers 17 21490950 21491085 1 - by flanking markers 7421634 SS.MNS-(D2Got93-D2Rat222)/Ayd A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 140672373 145318823 1 - by flanking markers 2 160649967 164927046 1 - by flanking markers 2 140958240 145514793 1 - by flanking markers 7421636 SS.MNS-(D2Chm90-D2Rat38)/Ayd A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 147424195 155102371 1 - by flanking markers 2 167706439 175354471 1 - by flanking markers 2 148295267 155965721 1 - by flanking markers 7421638 SS.MNS-(D2Chm381-D2Chm225)/Ayd A segment of chromosome 2 was transferred from MNS/N into the SS/Jr background, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 156267173 156267340 1 - by flanking markers 2 177626917 177627084 1 - by flanking markers 2 158268536 158268703 1 - by flanking markers 7421640 SS.MNS-(D2Rat155-D2Chm161)/Ayd Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 179581946 179582150 1 - by flanking markers 2 206293779 206293982 1 - by flanking markers 2 186889035 186889238 1 - by flanking markers 7421643 SS.MNS-(D2Chm254-D2Chm161)/Ayd Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 7421645 SS.MNS-(D2Rat155-D2Chm419)/Ayd Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 179581946 179582150 1 - by flanking markers 2 206293779 206293982 1 - by flanking markers 2 186889035 186889238 1 - by flanking markers 7421647 SS.MNS-(D2Chm161-D2Chm410)/Ayd Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 7421649 SS.MNS-(D2Chm153-D2Chm410)/Ayd Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 7421651 SS.MNS-(D2Chm442-D2Chm410)/Ayd Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 7421654 SS.MNS-(D2Chm366-D2Rat52)/Ayd Congenic substrain created by backcrossing congenic strain SS.MNS-(D2Chm25-D2Mit14)/Ayd strain into the parental Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 2 200866667 200866813 1 - by flanking markers 2 227502003 227502148 1 - by flanking markers 2 208081050 208081195 1 - by flanking markers 7771589 SS.SR-(D2Rat352-rs63922710)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 2 173606885 196312011 1 - by flanking markers 2 200318348 223091129 1 - by flanking markers 2 180909971 203646445 1 - by flanking markers 7771600 SS.SR-(rs106870553-rs63922710)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2019-02-05) 2 176635705 196312011 1 - by flanking markers 2 203270720 223091129 1 - by flanking markers 2 183864092 203646445 1 - by flanking markers 7771610 SHRSP-Chr 1^F344/Rkb SHRSP/Bbb male was crossed with female F344/Crl to get F1 animals which in turn were backcrossed with female SHRSP, this was repeated for 7 generations, tested by sequential marker-assisted backcrossing Department of Clinical Pharmacology and Toxicology, Charite-Universitatsmedizin Berlin, Berlin, Germany consomic Unknown 7777135 SS.LEW-(D5Mco39-D5Mco57)/1Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 7777138 SS.LEW-(D5Mco41-D5Mco47)/Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 5 116151523 122679716 1 - by flanking markers 7777140 SS.LEW-(D5Mco39-D5Mco57)(D5Mco41-D5Mco47)/Mco male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco57)/1Mco and SS.LEW-(D5Mco41-D5Mco47)/Mco were randomly selected and intercrossed to get F₁; the heterozygous animals for the desired region were intercrossed to get the bicongenics Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7777143 SS.LEW-(D5Mco39-D5Mco57)/2Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 7777180 SS.LEW-(D5Mco42-D5Mco47)/1Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 5 116151523 120258299 1 - by flanking markers 7794691 SS.LEW-(D5Mco39-D5Mco57)(D5Mco42-D5Mco47)/Mco male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco57)/2Mco and SS.LEW-(D5Mco42-D5Mco47)/1Mco were randomly selected and intercrossed to get F₁; the heterozygous animals for the desired region were intercrossed to get the bicongenics Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7794694 SS.LEW-(D5Mco39-D5Mco57)/3Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 7794696 SS.LEW-(D5Mco43-D5Mco47)/Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 5 116151523 116151740 1 - by flanking markers 7794698 SS.LEW-(D5Mco39-D5Mco57)(D5Mco43-D5Mco47)/Mco male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco57)/3Mco and SS.LEW-(D5Mco413-D5Mco47)/Mco were randomly selected and intercrossed to get F₁; the heterozygous animals for the desired region were intercrossed to get the bicongenics Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7794700 SS.LEW-(D5Mco39-D5Mco41)/Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 5 122679504 122679716 1 - by flanking markers 7794704 SS.LEW-(D5Mco42-D5Mco47)/2Mco SS.LEW-(D5Mco34-D5Rat108)/Jr was selectively backcrossed with the SS/Jr strain Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 5 0 0 1 - by flanking markers 5 116151523 120258299 1 - by flanking markers 7794706 SS.LEW-(D5Mco39-D5Mco41)(D5Mco42-D5Mco47)/Mco male and female pairs of the monocongenic SS.LEW-(D5Mco39-D5Mco41)/Mco and SS.LEW-(D5Mco42-D5Mco47)/2Mco were randomly selected and intercrossed to get F₁; the heterozygous animals for the desired region were intercrossed to get the bicongenics Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 7800659 F344.Cg-Du, Tyr^C/Kyo downunder rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-10) Development 7800661 F344.Cg-Du, Tyr^CKyo+/+ downunder rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Unknown 7800667 F344.Cg-Foxn1^rnuKyo-/+ Jic N13 to Kyo (1988) National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Immunology; Cancer Foxn1 3970 7800671 F344-Sv2a^m1Kyo Established by ENU mutagenesis. A missense mutation (L174Q) mutation in Sv2a: synaptic vesicle glycoprotein 2a, was identified. National BioResource Project for the Rat in Japan mutant Unknown Sv2a|Sv2a^m1Kyo 619715|12792962 2 190989187 191000859 1 - by flanking markers 2 217808165 217823872 1 - by flanking markers 2 198321100 198336889 1 - by flanking markers 7800673 KFRS2/Kyo^-/+ KFRS2^-/+ A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Ophthalmology; Dermatology Tyr|Tyr^siaKyo 1589755|13207345 1 143641257 143746315 1 - by flanking markers 1 157322968 157416594 1 - by flanking markers 1 151012598 151106802 1 - by flanking markers 7800676 KFRS3A/Kyo^+/+ A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for mink were selected for inbreeding. National BioResource Project for the Rat in Japan mutant Unknown 7800692 MKO/Tami Minko Rat MKO rat is derived from Wistar male rat which exhibited large-size and abnormal lipid metabolism. National BioResource Project for the Rat in Japan inbred Live Animals; Cryopreserved Embryo 7800694 NER.F344-(D1Rat132)(D5Rat100)/Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown 7800702 KHR/Kyo^-/- kaken hairless rat Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dermatology Oca2 2318412 1 115683593 115991040 1 - by flanking markers 1 114661970 114987433 1 - by flanking markers 7800705 KHR/Kyo^-/+ kaken hairless rat Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dermatology Oca2 2318412 1 115683593 115991040 1 - by flanking markers 1 114661970 114987433 1 - by flanking markers 8142383 SHRSP/BbbUtx Animals transferred from Harvard University/Brigham (Dr Klaus Lindpaintner) originating from SHRSP colony at University of Heidelberg University of Texas, Houston, TX inbred Unknown 8142385 SHR/Utx Animals transferred from Professor T. Suzuki, Kinki University School of Medicine, Kinki, Japan in 2002, descended from the original SHR sub-strains reported by Okamoto, 1974 University of Texas, Houston, TX inbred Unknown 8547938 CrljJcl:SD Sprague-Dawley from Charles River Laboratory Japan, to CLEA Japan, Inc. CLEA Japan, Inc outbred Live Animals (as of 2021-04-22) 8548794 F344-Tg(NC1-269B17)1Nkg BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 8548809 F344-Tg(NC1-269B17)2Nkg BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 8548812 F344-Tg(NC1-269B17)3Nkg BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 8548815 F344-Tg(NC1-269B17)4Nkg BAC clone NC1-269B17 which containing about 120 kb of ACI/NJcl rat-derived Casp3 (caspase 3) was injected into F344/Jcl embryos. The founder rat was backcrossed into F344/Jcl rat to establish the transgenic strain. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Casp3 2275 8548817 KDP.PVG-RT1^a/u/Nyo MHC haplotype (RT1.BaDa) of PVG.R23 was transferred onto the genetic background of KDP/Tky strain (RT1.BuDu). This allele has been maintained in heterozygous condition. Backcrossing has started since 2003 and afterwards maintained by sib mating National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 8549599 BN.LEW-(D10Rat32-D10Rat133)/Ciml Congenic strain created from parental BN/Rj and LEW/Rj strains. Institut National de la Sante et de la Recherche Medicale, Toulouse, France congenic Unknown 10 53786347 65668639 1 - by flanking markers 10 53381898 64823355 1 - by flanking markers 10 53630865 53631032 1 - by flanking markers 8549776 F344-Lep^m1Kyo F344 OB rat Established by ENU mutagenesis in F344/NSlc rats. This strain has Lep missense mutation (Q92X). National BioResource Project for the Rat in Japan mutant Live Animals (as of 2017-03-17) Diabetes Obesity Lep|Lep^m1Kyo 3000|12792963 4 55943837 55945938 1 - by flanking markers 4 56085079 56099209 1 - by flanking markers 4 56337695 56351818 1 - by flanking markers 8549778 PVG.KDP-Cblb/Nyo PVG.KDP-Cblb congenic Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo Diabetes Obesity Cblb 620535 8549779 DRU/Uubc The mutant rat showing microphthalmia was found in the colony of Donryu rats at Central Institute for Experimental Animals in 1974. A pair of F3 rats was transferred to The Third Department for Anatomy, School of Medicine, Chiba University in 1975 and maintained by sib mating. F50 rats were transferred to Faculty of Agriculture, Utsunomiya University by Dr. S Sugita in 1991 National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 8549782 SD.Gunn-Ugt1a1^j/Aon Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-09-15) Neurobiology; Metabolism Ugt1a1|Ugt1a1^j 3935|13432064 8549785 W.Gunn-Ugt1a1^j/Aon Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Unknown Neurobiology; Metabolism Ugt1a1|Ugt1a1^j 3935|13432064 8549798 WMS/SimNcp Munich, Germany from Wistar stock selectively bred for superficial glomeruli. To Simonsen Labs, CA via Veterans Administration Medical Center, San Francisco, California in 1979 at which time inbreeding was begun. Transferred at Nigata University from Simonsen Laboratory in 2005. at Niigata University Department of cellular physiology, Institute of Nephrology, Niigata University, Niigata, Japan, National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 8551711 SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D10Rat194-D10Chm243)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551714 SS.LEW-(D10Chm10-D10Rat11)(D10Chm246-D10Chm257)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D10Chm246-D10Chm257)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551716 SS.LEW-(D10Rat194-D10Chm243)(D16Chm48-D16Chm60)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D10Rat194-D10Chm243)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551718 SS.LEW-(D10Chm10-D10Rat11)(D16Chm48-D16Chm60)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D10Chm10-D10Rat11)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551721 SS.LEW-(D8Rat58-D8Chm12)(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D8Rat58-D8Chm12)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551723 SS.LEW-(D8Rat58-D8Chm12)(D10Rat194-D10Chm243)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D8Rat58-D8Chm12)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551725 SS.LEW-(D8Chm12-D8Rat15)(D10Rat194-D10Chm243)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D8Chm12-D8Rat15)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551727 SS.LEW-(D3Rat2-D3Chm79)(D10Rat194-D10Chm243)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551730 SS.LEW-(D3Rat2-D3Chm79)(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat2-D3Chm79)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551732 SS.LEW-(D17Chm131-D17Chm93)(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551734 SS.LEW-(D17Chm131-D17Chm93)(D17Rat84-D17Chm17)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd and SS.LEW-(D17Rat84-D17Chm17)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551737 SS.LEW-(D2Uia5-D2Mit6)(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D2Uia5-D2Mit6)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551739 SS.LEW-(D2Uia5-D2Mit6)(D10Rat194-D10Chm243)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D2Uia5-D2Mit6)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551742 SS.LEW-(D16Chm48-D16Chm60)(D18Rat101-D18Rat92)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D16Chm48-D16Chm60)/Ayd and SS.LEW-(D18Rat101-D18Rat92)/Ayd Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 8551748 SS.LEW-(D3Rat17-D3Mco80)(D10Rat194-D10Chm243)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D3Rat17-D3Mco80)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551750 SS.LEW-(D1Uia4-D1Rat320)(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.LEW-(D1Uia4-D1Rat320)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551752 SS.LEW-(D1Rat320-D1Mgh32)(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd A triple congenic strain derived from the progenitor strain SS.LEW-(D1Rat320-D1Mgh32)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551755 SS.LEW-(D1Chm64-D1Rat19)(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd A triple congenic strain derived from the progenitor strain SS.LEW-(D1Chm64-D1Rat19)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551757 SS.LEW-(D7Uia3-D7Mgh1)(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd A triple congenic strain derived from the progenitor strain SS.LEW-(D7Uia3-D7Mgh1)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551759 SS.MNS-(D2Chm90-D2Rat38),LEW-(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm90-D2Rat38)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551761 SS.MNS-(D2Chm90-D2Rat38),LEW-(D10Got112-Igfbp4)/Ayd A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm90-D2Rat38)/Ayd and SS.LEW-(D10Got112-Igfbp4)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551763 SS.MNS-(D2Rat155-D2Chm419),LEW-(D10Rat194-D10Chm243)/Ayd A double congenic strain derived from the progenitor strain SS.MNS-(D2Rat155-D2Chm419)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551766 SS.MNS-(D2Rat155-D2Chm419),LEW-(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.MNS-(D2Rat155-D2Chm419)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551772 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D10Rat194-D10Chm243),LEW-(D10Chm10-D10Rat11)/Ayd A triple congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D10Rat194-D10Chm243)(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551774 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D10Chm10-D10Rat11)/Ayd A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D10Chm10-D10Rat11)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551776 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D10Rat194-D10Chm243)/Ayd A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551778 SS.MNS-(D2Chm33-Tm2sf1),LEW-(D3Rat2-D3Chm79)/Ayd A double congenic strain derived from the progenitor strain SS.MNS-(D2Chm33-Tm2sf1)/Ayd and SS.LEW-(D3Rat2-D3Chm79)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8551782 SS.LEW-(D18Chm90-D18Chm4)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 13071222 27421017 1 - by flanking markers 18 12230011 27443258 1 - by flanking markers 18 12441876 27733166 1 - by flanking markers 8551785 SS.LEW-(D18Wox7-D18Rat67)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 12406948 23780206 1 - by flanking markers 18 15314151 23867696 1 - by flanking markers 18 15539551 24147513 1 - by flanking markers 8551787 SS.LEW-(D18Rat55-D18Mgh2)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 54856551 62313296 1 - by flanking markers 18 53346348 61092546 1 - by flanking markers 18 54108375 61901354 1 - by flanking markers 8551789 SS.LEW-(D18Chm59-D18Rat1)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 18 69138888 86857890 1 - by flanking markers 18 66790645 86108580 1 - by flanking markers 18 67627706 87074531 1 - by flanking markers 8551864 DA.LEW.1AV1-(D4Mgh17-D4Mgh21)/Kiru LEW.1AV1/Kini allele is introgressed into the DA/ZtmKini rats. Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 116611031 116611168 1 - by flanking markers 4 177782842 177926667 1 - by flanking markers 4 113100978 179563872 1 - by flanking markers 8551866 LEW.1AV1.DA-(D4Mgh17-D4Rat203)/Kiru DA/ZtmKini allele is introgressed into the LEW.1AV1/kini rats. Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 116611031 161435775 1 - by flanking markers 4 177782842 224843794 1 - by flanking markers 4 113100978 157826751 1 - by flanking markers 8551868 PVG.1AV1.DA-(D4Mgh17-D4Rat84)/Kiru DA/ZtmKini allele is introgressed into the PVG.1AV1/Kini rats. Department of Medicine, Karolinska Institutet, Stockholm, Sweden congenic Unknown 4 116611031 185398530 1 - by flanking markers 4 177782842 246313537 1 - by flanking markers 4 113100978 182171018 1 - by flanking markers 8551872 DA.PVG.1AV1-(D4Rat155-D4Rat113)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 157006984 157007337 1 - by flanking markers 4 47848402 220242357 1 - by flanking markers 4 48053950 153153072 1 - by flanking markers 8551874 DA.PVG.1AV1-(D4Rat63-D4Rat84)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 185398530 1 - by flanking markers 4 219683260 246313537 1 - by flanking markers 4 152598827 182171018 1 - by flanking markers 8551876 DA.PVG.1AV1-(D4Rat203-D4Got130)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 161435633 166051402 1 - by flanking markers 4 224843653 227653798 1 - by flanking markers 4 157826610 162454686 1 - by flanking markers 8551880 DA.PVG.1AV1-(D4Rat63-D4Rat203)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 156442644 161435775 1 - by flanking markers 4 219683260 224843794 1 - by flanking markers 4 152598827 157826751 1 - by flanking markers 8551882 DA.PVG.1AV1-(D4Rat203-D4Mit22)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 161435633 175947418 1 - by flanking markers 4 224843653 236764513 1 - by flanking markers 4 157826610 172512411 1 - by flanking markers 8551885 DA.PVG.1AV1-(D4Mit22-D4Rat84)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 175947270 185398530 1 - by flanking markers 4 236764366 246313537 1 - by flanking markers 4 172512264 182171018 1 - by flanking markers 8551887 DA.PVG.1AV1-(D4Got126-D4Rat203)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 159298584 161435775 1 - by flanking markers 4 222677930 224843794 1 - by flanking markers 4 155657051 157826751 1 - by flanking markers 8551889 DA.PVG.1AV1-(D4Rat62-D4Got136)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 157913800 160528447 1 - by flanking markers 4 221142142 223964695 1 - by flanking markers 4 154054175 156945571 1 - by flanking markers 8551892 DA.PVG.1AV1-(D4Rat113-D4Rat62)/Kiru Congenic substrain derived from marker assisted selection for PVG.1AV1/Kini chromosome 4 alleles on the DA/ZtmKini recipient strain. Center for Molecular Medicine, Karolinska Institute, Stockholm, Sweden congenic Unknown 4 157006984 157913968 1 - by flanking markers 4 220242234 221142309 1 - by flanking markers 4 153152949 154054342 1 - by flanking markers 8552235 SD-Tg(Pbsn-TAg)1Obs SV40 Large T Antigen along with Rat probasin promoter National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-17) Pbsn 708571 8552237 WI-Tg(Nanog-GFP-PuroR)22Kyo mouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performance National BioResource Project for the Rat in Japan transgenic Live Animals 8552239 F344.WI-Tg(Nanog-GFP-PuroR)Kyo WI-Tg(Nanog-GFP-puro-R)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic background National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 8552242 ETR/Eis Eisai Turning Rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Behavior 8552244 SD-Tg(Dsp-mCherry-DTR)Jfln This rat carries a transgene consisting of the Dsp promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. Red fluorescence can be detected from the skin of the animals but not the brain. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 8552247 SD-Tg(Neurod6-mCherry-DTR)Jfln This rat carries a transgene consisting of the NeuroD6 promoter followed by a STOP cassette flanked by FRT sites. The stop cassette consists of an mcherry gene encoding for a red fluorescent protein and a kanamycin resistant gene and three SV40polyA adenylation signals. The STOP cassette is followed by a gene encoding for the human diphtheria toxin receptor. This model is yet to be validated. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-17) 8552249 SD-Tg(Camk2a-FLPo)Jfln This transgene consists of approximately 6kb of the CamK2a promoter followed by a gene encoding FLP, optimised for mamalian exprssion (FLPo). This rat remains unvalidated. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-08-16) 8552252 ACI.BUF-Aftm1/2Mna This congenic strain was established as a strain with the genetic background of ACI onto which a segment from the BUF/Mna has been transferred. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo 8552255 LAP/Hshyo low alcohol preference rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 8552257 HAP/Hshyo high alcohol preference rat Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 8552259 F344-Ldlr^m1Kyo/Ta Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo 8552261 WIAR.MPR-Arsb^abd/Ncchd Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Osteology; Metabolism Arsb|Arsb^MPR 2158|12792967 2 24067560 24223821 1 - by flanking markers 2 42559079 42717753 1 - by flanking markers 2 23385154 23543028 1 - by flanking markers 8552267 SHRSP.WKY-(D1Rat116-D1Wox10)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 218466863 220639653 1 - by flanking markers 1 238863547 244066407 1 - by flanking markers 1 231729437 236763528 1 - by flanking markers 8552269 SHRSP.WKY-(D1Tkyo58-D1Rat90)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 267110921 267111153 1 - by flanking markers 1 289137107 289137268 1 - by flanking markers 1 281795624 281795785 1 - by flanking markers 8552271 SHRSP.WKY-(D1Rat27-D1Wox18)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 90282040 94626661 1 - by flanking markers 1 95301716 101198506 1 - by flanking markers 1 94201400 100133395 1 - by flanking markers 8552273 SHRSP.WKY-(D1Tkyo57-D1Wox18)/Tkyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 1 94626541 94626661 1 - by flanking markers 1 101198387 101198506 1 - by flanking markers 1 100133276 100133395 1 - by flanking markers 8552275 F344-Lgi1^m1Kyo Developed by gene driven ENU mutagenesis in F344/NSlc rats. Lgi1-mutant rats carrying a missense mutation (c.1154 T > G)(L385R). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-03-17) Lgi1|Lgi1^m1Kyo 628742|12792970 1 242593236 242634141 1 - by flanking markers 1 264436441 264477332 1 - by flanking markers 1 256955944 256996835 1 - by flanking markers 8552279 WI-Tg(Per1-luc)Ylab The original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 8552285 F344.WI-Tg(Per1-luc)Ylab The original work using this transgenic rat was published in Science (Yamazaki et al. 2000). This transgenic rat was generated in the Wistar outbred strain (Charles River, Japan). We maintained the L1 line. The transgenic rat was generated using a DNA construct in which the mouse Period1 promoter drives firefly luciferase National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 8552287 F344.WIC-Tg^rdwKts This is a F344 congenic carrying Tgrdw derived from WIC-Tgrdw/Kts. WIC-Tgrdw/Kts was established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting congenital dwarfism (rdw), is inherited as an autosomal recessive. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-04-27) Metabolism 8552289 A5M/Khos Developed by the DEPOSITOR National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Metabolism 8552293 SR/JrSeac Dahl Salt-Resistant Substrain of Dahl SR, from a Sprague-Dawley outbred colony, selected for resistance to salt-induced hypertension developed at Kyudo Co.,Ltd (http://www.kyudo.co.jp/) to Seac Yoshitomi, LTD Japan, now maintained at NBRP National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio- Hypertension 8552296 UPL/CasTakeu Substrain of UPL National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Ophthalmology 8552298 DA-Tyr^em1Kyo The strain having a Endonuclease-induced 29-bp deletion mutation in Tyr gene was established by TALENs combined with Exonuclease 1. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-03-17) Behavior; Dermatology Tyr|Tyr^em1Kyo 1589755|12792972 1 143641257 143746315 1 - by flanking markers 1 157322968 157416594 1 - by flanking markers 1 151012598 151106802 1 - by flanking markers 8552303 DA-Tyr^em2Kyo Developed by the DEPOSITOR National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Behavior; Dermatology 8552309 ODUS/Odu The mutant rat showing spontaneous gingivitis was found in the colony of WKY rats in 1972. The inbred strain was established in 1991. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 8552311 ODUR/Odu This inbred strain was established from WKY rats as a control for ODUS/Odu. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo 8552313 DA.PVG.1AV1-(D10Rat81-D10Rat238)/Kini DA/Kini females were bred to PVG.1AV1/Kini males and male offspring selected for PVG alleles within the fragment. To ensure that mitochondrial DNA was inherited from the DA/Kini strain, female rats were from the DA/Kini strain throughout the breeding program. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 10 49618846 62685691 1 - by flanking markers 10 49641148 61927099 1 - by flanking markers 10 49863561 62214000 1 - by flanking markers 8552315 W-Tg(Thy1-COP4/YFP*)4Jfhy The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Ophthalmology; Otorhinology 8552317 W-Tg(Thy1-COP4/YFP*)5Jfhy The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Ophthalmology; Otorhinology 8552319 W-Tg(Thy1-COP4/YFP*)6Jfhy The transgenic rats were established by injection of transgene consisting of ChR2 and Venus fused transgene driven by the Thy-1.2 promoter into Wistar rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Ophthalmology; Otorhinology 8552321 SHR-Tg(APOC3-CETP)1Tkyo The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC3 promoter into SHR/Izm rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Diabetes Obesity; Neurobiology 8552323 SHR-Tg(APOC3-CETP)2Tkyo The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Diabetes Obesity; Neurobiology 8552325 SHR-Tg(APOC3-CETP)3Tkyo The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC5 promoter into SHR/Izm rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Diabetes Obesity; Neurobiology 8552327 SHR-Tg(APOC3-CETP)4Tkyo The transgenic rats were established by injection of transgene consisting of cholesterylester tansfer protein gene driven by the APOC4 promoter into SHR/Izm rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Diabetes Obesity; Neurobiology 8552329 W-Tg(Nqo1)Kop The transgenic rats were established by injection of transgene consisting of NAD(P)H quinone oxidoreductase 1 gene derived from a DA/Slc rat strain into Wistar rat fertile eggs. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Oncology; Metabolism 8552331 F344-Il2rg^em7Kyo The strain having a Endonuclease-induced 7 bp deletion mutation in the 2nd exon of the rat Il2rg gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University. National BioResource Project for the Rat in Japan mutant Unknown Hematology; Immunology Il2rg^em7Kyo 13628732 8552337 DA.PVG.1AV1-(D10Got406-D10Rat93)/Kini Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Animals for congenic breeding were selected from the 10th generation of an advanced intercross line (AIL) originating from the EAE-susceptible DA and EAE-resistant PVG.1AV1 rat strains. Selected males containing a PVG.1AV1 fragment in the Eae18b region (from OT24.18 to D10Rat93 marker, at 68.36 Mb and 81.9 Mb, respectively) were backcrossed with DA females for 8 generations, and offspring was genotyped using microsatellite markers in each generation. In the 8th generation, heterozygous males and females were crossed to obtain the experimental population of homozygous congenic rats and littermate controls. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 10 68361384 81887390 1 - by flanking markers 10 67154600 80788180 1 - by flanking markers 10 67495867 80946110 1 - by flanking markers 8552341 DA.PVG.1AV1-(D10Got6-D10Rat184)/Kini Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by transfer of the defined Vra4 segment selected from male donors of G8 generation of a DAxPVG1.AV1 andvanced intercross line. Subsequential backcrossing for 9 generations. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 10 3219701 11568211 1 - by flanking markers 10 1728277 10319475 1 - by flanking markers 10 2847625 11561989 1 - by flanking markers 8552346 DA.PVG.1AV1-(D4Rat107-D4Got132)/Kini Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Congenic strain was established by selective transferring of PVG alleles in the interval between D4Rat137 and D4Kiru157 onto DA background in minimum of 13 backcross generations. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 4 156090003 162362144 1 - by flanking markers 4 219336960 225566369 1 - by flanking markers 4 152249616 158564471 1 - by flanking markers 8552348 DA.PVG.1AV1-(D13Rat105-D13Rat131)/Kini Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). The congenic line was established from DA and MHC-identical PVG.A rats using a speed-congenic approach with marker assisted selection. DA females were mated with male offspring selected from F2 (DAxPVG.A) with heterozygote alleles within chromosome 13 and Eae34 QTL interval and with the lowest PVG.A background contamination using 96 microsatellite markers equally spaced throughout the genome (at 20 centimorgan cM intervals). A breeding pair selected from the N7 generation were crossed for two generations to produce homozygous DA.PVG-Eae34 congenic rats. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 13 45592985 80755583 1 - by flanking markers 13 54552997 88144258 1 - by flanking markers 13 49478067 83263907 1 - by flanking markers 8552351 DA.PVG.1AV1-(D9Wox24-D9Rat44)/Kini Inbred Dark Agouti (DA) rats were originally obtained from Hannover, Germany and Piebald Virol Glaxo(PVG) rats from Harlan UK Limited (Blackthorn, UK). Briefly, in each backcross generation, rats for further breeding were selected on the basis of genotyping of 8 microsatellite markers in the congenic region, from marker D9Wox24 to D9Rat20. The genetic background of rats was also screened with 100 markers. After the complete removal of the donor genome outside the congenic fragment, two heterozygous rats were intercrossed to produce the homozygous strains DA.BN-Eae4(N7F1). Subsequently, interval-specific recombinants were bred from an F2 breeding. R25 recombinant was established in 2003. Center for Molecular Medicine, Neuroimmunology Unit, Karolinska Institutet, Stockholm, Sweden, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 9 2948882 2949051 1 - by flanking markers 9 2813697 9858600 1 - by flanking markers 9 2880977 10869489 1 - by flanking markers 8552364 WI-Tg(L2-Venus)Nips The construct contains CAG--lox P--Neo-pA--lox P--Venus--pA (4.3 kb) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN transgenic Unknown 8552366 WI-Tg(CAG-cre)Nips The construct contains CAG--NLS-Cre--pA (3.3 kb)which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN transgenic Unknown 8552368 WI-Tg(CAG-Venus)Nips The construct contains L2-Venus Ã¿ CAG-Cre (CAG--lox P--Venus--pA (3.1 kb)) which was injected into Crlj:WI embryos; now maintained as transgenic heterozygotes Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN transgenic Unknown 8552371 WDB-ROSA26^em1(RT2)Nips This strain was produced by knock-in in the rat Rosa26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Unknown 8552996 F344/Arc substrain of F344 bred at Animal Resources Centre Australia Animal Resources Centre, Australia inbred Unknown 8553001 ArcCrl:CD(SD) substrain derived from Crl:CD(SD); IGS refers to animals bred using the CRL International Genetic Standard system. Animal Resources Centre, Australia outbred Unknown 8553003 ArcCrl:WI Wistar rats From Charles River to Animal Resources Centre, Australia Animal Resources Centre, Australia outbred Unknown 8553005 BN/RijHsdArc To Animal Resources Centre, Australia from Harlan. Animal Resources Centre, Australia inbred Unknown 8553006 DA/Arc substrain of DA bred at Animal Resources Centre, Australia Animal Resources Centre, Australia inbred Unknown 8553008 LEW/CrlArc Lewis Developed by Dr. Lewis from Wistar stock in the early 1950s. To Animal Resources Centre, Australia from Charles River Animal Resources Centre, Australia inbred Unknown 8553010 PVG/Arc substrain of PVG maintained at Animal Resources Centre Animal Resources Centre, Australia inbred Unknown 8553013 SHR/NCrlArc To Animal Resources Centre from Charles River Animal Resources Centre, Australia inbred Unknown 8553015 WKY/NCrlArc To Animal Resources Centre from Charles River Animal Resources Centre, Australia inbred Unknown 8553187 FHH.BN(D14Rat98-D14Hmgc4)/Mcwi desired segments from BN were introgressed in FHH background Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 14 14535071 21435476 1 - by flanking markers 14 14613528 21463742 1 - by flanking markers 14 14673206 21555302 1 - by flanking markers 8655639 WAG/Nov Substrain of WAG, now bred at the Institute of Cytology and Genetics, Russian Academy of Sciences (Novosibirsk) Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown 8655660 WAG.OXYS-(D1Rat30-D1Rat219)/Nov desired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia congenic Unknown Cic|Arhgap33 1310706|2318374 1 100539980 188654926 1 - by flanking markers 1 107049754 209588735 1 - by flanking markers 1 106002252 202571904 1 - by flanking markers 8655663 WAG.OXYS-(D1Rat219-D1Rat81)/Nov desired region was introgressed from OXYS/Nov into the genetic background of WAG/Nov by first intercrossing and then backcrossing to WAG/Nov Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia congenic Unknown Snurf|Ifit1|Zp2|Gtf3c1|Col17a1 69269|620599|620605|621048|1311130 1 188654686 250119874 1 - by flanking markers 1 209588496 272245383 1 - by flanking markers 1 202571665 264802994 1 - by flanking markers 8655977 W-Lepr^+/+/Nin Wistar NIN lean The lean litter mates of WNIN-Ob (W-LeprfaNin, RGD:8655992). Both are derived from the inbred stock of Wistar rats (W/NIN) dating back to 1920 at National Institute of Nutrition (NIN), Hyderabad, India. National Institute of Nutrition (NIN), Hyderabad, India inbred Unknown 8655992 W-Lepr^faNin The spontaneously developed obese rat was derived from the colony of inbred W/Nin by selective breeding. Its lean litter mate ( W-Lepr+/+/Nin, RGD:8655977) was used as a control strain in obesity related study. National Institute of Nutrition (NIN), Hyderabad, India mutant Unknown 8657051 F344/Nin Substrain of F344 maintained at National Institute of Nutrition (NIN), Hyderabad, India. National Institute of Nutrition (NIN), Hyderabad, India inbred Unknown 8657079 SS.LEW-(D18Chm124-D18Chm126)/Ayd SS/Jr and LEW/Crlc were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre-CHUM, Montreal, Quebec, Canada congenic Unknown 8657135 SS.LEW-(D10Chm280-D10Chm216)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 76589831 76590030 1 - by flanking markers 10 74503802 74504001 1 - by flanking markers 10 75603400 75603599 1 - by flanking markers 8657348 SS.LEW-(D17Chm131-D17Chm93),MNS-(D2Rat155-D2Chm161),LEW-(D18Chm41-D18Rat92)/Ayd A triple congenic strain derived from the progenitor strain SS.LEW-(D17Chm31-D17Chm93)/Ayd, SS.MNS-(D2Rat155-D2Chm161)/Ayd and SS.LEW-(D18Chm41-D18Rat92)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8657351 SS.MNS-(D2Chm366-D2Rat52),LEW-(D18Rat61-D18Rat45),LEW-(D10Chm128-D10Chm121)/Ayd A triple congenic strain derived from the progenitor strain SS.MNS-(D2Chm366-D2Rat52)/Ayd, SS.LEW-(D18Rat61-D18Rat45)/Ayd and SS.LEW-(D10Chm128-D10Chm121)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8657361 SS.MNS-(D2Chm254-D2Chm161),LEW-(D10Chm246-D10Chm257),LEW-(D16Chm48-D16Chm60),LEW-(D18Rat55-D18Mgh2)/Ayd A congenic strain derived from the progenitor strain SS.MNS-(D2Chm254-D2Chm161)/Ayd, SS.LEW-(D10Chm246-D10Chm257)/Ayd and SS.LEW-(D16Chm48-D16Chm60)/Ayd and SS.LEW-(D18Rat55-D18Mgh2)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8657392 SS.LEW-(D10Rat155-D10Chm171)/Ayd A sub congenic strain derived from the progenitor strain SS.LEW-(D10Chm224-D10Chm6)/Ayd. Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 10 70229781 71032765 1 - by flanking markers 10 69020437 69797898 1 - by flanking markers 10 69385595 70167191 1 - by flanking markers 8657399 SS.MNS-(D2Chm214-D2Chm302)/Ayd Congenic substrain created by backcrossing congenic strain MNS/N strain with Dahl Salt-sensitive (SS/Jr) strain, the F₂ rats were genotyped with markers that resided in the region of interest, heterozygous rat was then backcrossed to SS/Jr rat to duplicate the fragment. Centre Hospitalier de Universite de Montreal (CRCHUM), Quebec, Canada congenic Unknown 8657402 SS.LEW-(D3Rat52-D3Chm57),MNS-(D2Chm214-D2Chm302),LEW-(D10Rat194-D10Chm243)/Ayd A triple congenic strain derived from the progenitor strain SS.LEW-(D3Rat52-D3Chm57)/Ayd, SS.MNS-(D2Chm214-D2Chm302)/Ayd and SS.LEW-(D10Rat194-D10Chm243)/Ayd Research Centre, Centre Hospitalier de l'Universite de Montreal (CHUM), Montreal, Quebec, Canada congenic Unknown 8661233 SS-TgTn(T2GFP)53Mcwi This strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 15 near 35.6 Mb (rn4) Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 8661234 SS-TgTn(T2ePet-eGFP)11Mcwi This strain was made by pronuclear microinjection of SS/JrHsdMcwi embryos with a Sleeping Beauty transposon vector harboring a serotonergic neuron-specific ePet1 promoter driving enhanced green fluorescent protein along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 7 near 123.8Mb (rn4) Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown 8661235 FHH-TgTn(T2/Rab38)1Mcwi This strain was made by pronuclear microinjection of a Sleeping Beauty transposon vector harboring a ubiquitous CAG promoter driving the Brown Norway allele cDNA for Rab38 along with mRNA encoding the SB100X transposase. The transposon inserted into rat chromosome 14 near 13.2 Mb (rn4) Human and Molecular Genetics Center, Medical College of Wisconsin, Milwaukee, Wisconsin transgenic Unknown Rab38 628752 8662449 LOU/MBbb LOU/M strain maintained at Max-Delbruck-Center for Molecular Medicine, Berlin, Germany Max-Delbruck-Center for Molecular Medicine, Berlin, Germany inbred Unknown 8662861 LOU.BN-(D5Rat59-D5Rat133)/Bbb the desired chromosomal segment from BN/Rj was introgressed into the genetic background of LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 49696253 1 - by flanking markers 5 1662934 53233338 1 - by flanking markers 5 1666587 48652920 1 - by flanking markers 8662874 LOU.BN-(D5Rat59-D5Rat127)/Bbb this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 27586431 1 - by flanking markers 5 1662934 31408200 1 - by flanking markers 5 1666587 26713119 1 - by flanking markers 8662878 LOU.BN-(D5Rat59-D5Rat125)/Bbb this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 17703194 1 - by flanking markers 5 1662934 22043910 1 - by flanking markers 5 1666587 17263178 1 - by flanking markers 8662925 LOU.BN-(D5Rat59-rs13448399)/Bbb this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 5230907 1 - by flanking markers 5 1662934 10489561 1 - by flanking markers 5 1666587 5649731 1 - by flanking markers 8662933 LOU.BN-(rs65016308-D5Rat133)/Bbb this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 10525723 49696253 1 - by flanking markers 5 15442246 53233338 1 - by flanking markers 5 10652699 48652920 1 - by flanking markers 8662955 LOU.BN-(rs13448399-D5Rat133)/Bbb this congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 5230907 49696253 1 - by flanking markers 5 10489561 53233338 1 - by flanking markers 5 5649731 48652920 1 - by flanking markers 8662958 LOU.BN-(D5Rat59-rs13448399)/Bbb-/+ this heterozygous congenic strain is produced by backcrossing LOU.BN-(D5Rat59-D5Rat133)/Bbb to LOU/MBbb Max-Delbruck-Center for Molecular Medicine, Berlin, Germany congenic Unknown 5 1368223 5230907 1 - by flanking markers 5 1662934 10489561 1 - by flanking markers 5 1666587 5649731 1 - by flanking markers 8663453 BN.ACI-(D14Uwm4-D14Rat39)/Shul This congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 14 77787938 77788272 1 - by flanking markers 14 77221247 77221492 1 - by flanking markers 14 34997325 77240029 1 - by flanking markers 8663455 BN.ACI-(D14Uwm1-D14Uwm5)/Shul This congenic strain contains a region of ACI/SegHsd chromosome 14 transferred to the BN/SsNHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown 14 34228109 36047474 1 - by flanking markers 8663458 ACI.BN-(D7Rat164-D7Rat142)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 69506936 76323874 1 - by flanking markers 7 72918736 79648829 1 - by flanking markers 7 72752037 79629245 1 - by flanking markers 8663462 ACI.BN-(D7Uwm32-D7Uwm43)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 0 0 1 - by flanking markers 8663464 ACI.BN-(D7Uwm33-D7Uwm43)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Live Animals (as of 2017-09-07) mammary cancer 7 0 0 1 - by flanking markers 8693598 LE-Tg(DIO-mCherry)2Ottc The transgene contains Cre recombinase reporter rat expressing mCherry driven by the EF1 alpha promoter. Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery 9586448 SHR/NCrlPrin Substrain of SHR originally from Charles River now maintained at University of California Dept. of Pharmacology, University of California, San Diego, La Jolla, California inbred Unknown 9586450 SHR/OlaIpcvPrin These are substrains of SHR from Czech Academy of Sciences now maintained at University of California Dept. of Pharmacology, University of California, San Diego, La Jolla, California inbred Unknown 9587464 SD-Tg(UBC-DsRedT3-emGFP)18Narl SD-Tg(UBC-DsRedT3-emGFP)18 This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter. National Laboratory Animal Center, Taiwan transgenic Live Animals UBC 1346853 9587466 SD-Tg(UBC-cre/ERT2)7Narl This strain was generated by microinjection of SD embyos with UBC-Cre/ERT2 transgene which is composed of Cre/ERT2 recombinase gene driven by human UBC promoter. National Laboratory Animal Center, Taiwan transgenic Cryopreserved Embryo (as of 2017-05-31) UBC 1346853 9587470 SD-Tg(UBC-DsRedT3-emGFP)26Narl This strain was generated by microinjection of SD embyos with UBC-DsRed-emGFP transgene which is composed of DsRed flanked by loxP and followed by emerald GFP(emGFP). The transgene is driven by human UBC promoter. National Laboratory Animal Center, Taiwan transgenic Cryopreserved Embryo UBC 1346853 9587473 SD-Tg(UBC-emGFP)18Narl This strain was produced by microinjection of UBC-cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)18Narl National Laboratory Animal Center, Taiwan transgenic Live Animals UBC 1346853 9587475 SD-Tg(UBC-DsRed-GFP)(Col1a(5A)-cre)Narl This strain was produced by microinjection of Col1a(5A)-Cre construct into embryos from SD-Tg(UBC-DsRedT3-emGFP)26Narl. As loxP-flanked DsRed is removed by Col1a(5A) promoter-driven Cre recombinase National Laboratory Animal Center, Taiwan transgenic Unknown 9587825 BN/SsNNarl Imported from NIH, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) 9587827 F344/NNarl Imported from NIH, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) 9587829 LEW/SsNNarl Imported from NIH in 1995, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) 9587831 SHR/NCrlNarl Imported from NIH in 2000, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) 9587833 WKY/NCrlNarl Imported from NIH in 2000, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan inbred Live Animals (as of 2018-03-28) 9587835 CrlNarl:LE Imported from Charles River in 1997, now maintained at National Laboratory Animal Center, Taiwan National Laboratory Animal Center, Taiwan outbred Live Animals (as of 2018-03-28) 9588294 CrljKwl:SD Sprague-Dawley from Charles River Laboratory Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1985; these were turned into SPF by caesarean section Kiwa Laboratory Animals Co.Ltd. Japan outbred Unknown 9588298 Kwl:LE Long Evans from Sasaki Institute, Japan, to Kiwa Laboratory Animals Co.Ltd. Japan in 1971; these were turned into SPF by caesarean section Kiwa Laboratory Animals Co.Ltd. Japan outbred Unknown 9588544 SHR-Ndufc2^em1Mcwi This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a 9-bp deletion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ndufc2^em1Mcwi 9588537 1 154635889 154642112 1 - by flanking markers 1 168576274 168582497 1 - by flanking markers 1 162369801 162376024 1 - by flanking markers 9588546 SHR-Ndufc2^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence GGCTTCCTGGGCTACTGCacgggcCTGATGGACAACATG into SHR/NCrl rat embryos. The resulting mutation is a net 107-bp deltion in exon 1. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-01-26) Ndufc2^em2Mcwi 9588541 1 154635889 154642112 1 - by flanking markers 1 168576274 168582497 1 - by flanking markers 1 162369801 162376024 1 - by flanking markers 9588552 SD-Nfe2l2^em1Mcwi This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1. PhysGen Knockouts mutant Live Animals (as of 2017-01-26) Nfe2l2^em1Mcwi 9588549 3 58366693 58394116 1 - by flanking markers 3 69041641 69069190 1 - by flanking markers 3 62497568 62525146 1 - by flanking markers 9588559 LE-Tg(DIO-iRFP)3Ottc The transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter. Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery 9588570 LE-Tg(cFos-eGFP)2Ottc The transgene contains reporter rat expressing eGFP in cFos expressing cells Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown 9588572 LE-Tg(Slc6a3-icre)1Ottc The transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown dopamine neurons in drug abuse or neurodegeneration 9588576 LE-Tg(Slc6a3-icre)5Ottc The transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neurons Optogenetics and Transgenic Technology Core transgenic Unknown 9588578 LE-Tg(Slc6a3-icre)6Ottc The transgene contains BAC transgenic using rat DAT promoter to express Cre recombinase in dopaminergic neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2017-05-31) neurodegeneration 9588581 LE-Tg(cFos-LacZ)1Ottc The transgene contains reporter rat expressing beta-galactosidase in cFos expressing cells Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown 9588583 LE-Tg(cFos-TetO-iCre)4Ottc The transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressor Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown 9588585 LE-Tg(cFos-TetO-iCre)6Ottc The transgene contains Cre recombinase expressed from cFos promoter and controllable by Tet activator/repressor Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown 9588587 LE-Tg(EF1a-TetR)1Ottc The transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectors Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown 9588589 LE-Tg(EF1a-TetR)2Ottc The transgene expresses TetR using "ubiquitous" promoter; to be used in combination with TetO containing rats or viral vectors Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown 9588591 LE-Tg(Gad1-iCre)2Ottc The transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neurons Optogenetics and Transgenic Technology Core transgenic Extinct (as of 2019-02-01) 9588593 LE-Tg(Gad1-icre)3Ottc The transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-02-28) 9588595 LE-Tg(Slc6a5-icre)1Ottc The transgene expresses BAC transgenic using rat GlyT2 promoter to express Cre recombinase in glycinergic neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Unknown 9589088 ACI.COP-(D3Rat130-D3Rat114)(D6Rat80-D6Rat146)/Shul This congenic strain contains regions of COP/CrCrl chromosome 3 and COP/CrCrl chromosome 6 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison, Rat Resource and Research Center congenic Cryorecovery (as of 2019-02-26) 9590284 SS-Tg(ApoC3-CETP)25Opaz SS/JrHsd embryos were microinjected with 1.57 kb human CETP cDNA construct into pSV-SPORT1 with human ApoC3 promoter Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, Massachusetts, Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-02-05) 9685623 SD-Pax6^Sey2/Mce This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.)Genomic DNA analysis from mutants revealed a single base(c) insertion, resulting in a abnormal stop codon at 33-bp downstream from the insertion site due to frameshift. Department of Ophthalmology, Okayama University Medical School, Okayama, Japan, National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-02-23) Pax6^Sey2 12790970 3 91127605 91149178 1 - by flanking markers 3 102320059 102348223 1 - by flanking markers 3 95700241 95728682 1 - by flanking markers 9685625 F344-Il2rg^em1Kyo The strain having a zinc finger nuclease-induced 660-bp deletion mutation in Il2rg gene shows severe combined immunodeficiency and grows normally under SPF condition. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-03-27) Immunology Il2rg^em1Kyo 12798560 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 9685748 F344-Il2rg^em2Kyo The severe combined immunodeficiency strain carries a zinc finger induced 1097-bp deletion mutation of Il2rg gene created in the F344/Stm embryos. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-03-27) Immunology Il2rg^em2Kyo 12798561 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 9685750 F344-Il2rg^em3Kyo This strain shows severe combined immunodeficiency caused by a 332 bp deletion in Il2rg gene and grow normally under SPF condition. National BioResource Project for the Rat in Japan mutant Unknown Immunology Il2rg^em3Kyo 13464340 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 9685752 TM-Il2rg^em4Kyo The severe combined immunodeficiency strain carries a zinc finger nuclease-induced 162-bp deletion mutation in rat Il2rg gene. Grows normally under SPF condition. National BioResource Project for the Rat in Japan mutant Unknown Immunology Il2rg^em4Kyo 13464339 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 9685754 TM-Il2rg^em5Kyo This strain shows severe combined immunodeficiency caused by a zinc finger nuclease induced 653-bp deletion in Il2rg gene of TM/Kyo embryo. The rats grow normally under SPF condition. National BioResource Project for the Rat in Japan mutant Unknown Immunology Il2rg^em5Kyo 12910099 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 9685755 W-Tg(tetO-Pou5f1,-Klf4,-Sox2,Ubc-rtTA,-EGFP)T1-3Hina Doxycycline induced mouse Oct3/4, Klf4, Sox2/ Ubc-promoter EGFP was introduced into embryonic fibroblast of Wistar rat (Slc:Wistar)by replication incompetent type lentivirus vector and iPS cells were induced. Chimeric rats (male) were generated from this iPS cells, and crossed with the wild-type Wistar rat (female). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Development 9685757 W-Il2rg^em1Hina This strain was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar) National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-03-27) Immunology Il2rg^em1Hina 12798562 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 9685759 LEW.WKY-(D13Arb15-D13Rat77)(D16Rat40-D16Rat88)/Tja Segment of interest from chr 13 and chr 16 of WKY/NCrl were introgressed into LEW/SsNHsd Imperial College, London, UK, National BioResource Project for the Rat in Japan, Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 16;13 819225;63175274 60432230;96441728 1 - by flanking markers;1 - by flanking markers 16;13 1534408;71047218 59992088;103987907 1 - by flanking markers;1 - by flanking markers 16;13 1550187;66075608 60316851;98985851 1 - by flanking markers;1 - by flanking markers 9685785 SS.LEW-(D1Mco36-D1Mco54)/Bj This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 129013896 1 - by flanking markers 1 130267716 136181734 1 - by flanking markers 1 129208943 135158838 1 - by flanking markers 9685787 SS.LEW-(D1Mco36-D1Rat200)/Bj This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 126939275 1 - by flanking markers 1 130267716 134204042 1 - by flanking markers 1 129208943 133164521 1 - by flanking markers 9685791 SS.LEW-(D1Mco36-D1Mco61)/Bj This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 122991895 124296272 1 - by flanking markers 1 130267716 131494744 1 - by flanking markers 1 129208943 130446906 1 - by flanking markers 9685793 SS.LEW-(D1Rat200-D1Mco136)/Bj This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 0 126939275 1 - by flanking markers 1 134116233 134204042 1 - by flanking markers 1 133076978 133164521 1 - by flanking markers 9685795 SS.LEW-(D1Mco55-D1Wox6)/Bj This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 127933558 131956825 1 - by flanking markers 1 135124726 138778112 1 - by flanking markers 1 134089429 137787460 1 - by flanking markers 9685797 SS.LEW-(D1Mco134-D1Wox6)/Bj This is a congenic substrain developed by crossing the progenitor strain SS.LEW-(D1Mco36-D1Mco101)/Mco to SS/Jr to get F2 which were again crossed with SS/Jr to duplicate the recombinant region Medical College of Ohio, Toledo, Ohio, USA congenic Unknown 1 0 131956825 1 - by flanking markers 1 138777913 138778112 1 - by flanking markers 1 137787261 137787460 1 - by flanking markers 9831158 Y59/Zgd Strain developed by Prof. Borislav Nakic, Prof. Silobrcic and Prof. Andrija Kastelan from outbred Wistar rats during 1960s, maintained at Department of Animal Physiology,Faculty of Science, University of Zagreb, Republic of Croatia University of Zagreb, Republic of Croatia inbred Live Animals (as of 2020-10-05) Immunology and transplantational research 9835401 ZDF-Lepr^m1Rll The Zucker rats from Charles River (ZDF-Lepr^fa/Crl) carry the Lepr^m1Rll allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 Laboratory of Human Behavior and Metabolism, Rockefeller University, New York mutant Unknown Lepr^m1Rll 9835400 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 9835403 WDF-Lepr^m1Rll The WDF colony at Vassar College (WDF/Vc) carry the Lepr^m1Rll allele that has substitution of a nucleotide at 880 (A-C) results in Gln-Pro at position 269 Laboratory of Human Behavior and Metabolism, Rockefeller University, New York mutant Unknown Lepr^m1Rll 9835400 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 9854707 SHR.WKY-(D4Rat143-D4Rat10)/Tja This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk MRC Clinical Centre, London, UK, Rat Resource and Research Center congenic Unknown Insulin Resistance 4 26280781 26280949 1 - by flanking markers 4 2432766 26659527 1 - by flanking markers 4 2380037 26753822 1 - by flanking markers 9854709 SHR.WKY-(D12Rat1-D12Mit3)/Tja This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk MRC Clinical Centre, London, UK, Rat Resource and Research Center congenic Unknown Insulin Resistance, Hypertension 12;1 555108;223364189 555654;223364281 1 - by flanking markers;1 - by flanking markers 1;12 245071632;6945260 245071725;7384617 1 - by flanking markers;1 - by flanking markers 9854711 SHR.WKY-(D16Rat88-D16Rat15)/Tja This congenic strain was generated by introgressing the desired fragment from WKY/NCruk onto the genetic background of SHR/NCruk MRC Clinical Centre, London, UK, Rat Resource and Research Center congenic Unknown Insulin Resistance 16 819225 80047126 1 - by flanking markers 16 1534408 79886465 1 - by flanking markers 16 1550187 80316424 1 - by flanking markers 9999141 IRL/NCr The IRL/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production program National Cancer Institute, Animal Production Program, Rat Resource and Research Center inbred Unknown Pulmonary hypertension 9999143 LOU/MNCr The NCI Animal Production Program received this rat strain from NIH in 1987 for production and distribution of the LOU/MNCr rat strain National Cancer Institute, Animal Production Program, Rat Resource and Research Center inbred Unknown 9999145 F344/NCr The F344/NCr rat strain was received into the NIH Genetic Resources program in 1987, now maintained at NCI Animal production program National Cancer Institute, Animal Production Program, Rat Resource and Research Center inbred Unknown Phenylketonuria 10002743 DA.E3-(D20Rat42-D20Rat49)/Rhd A fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 4582054 8286657 1 - by flanking markers 20 6265460 10844146 1 - by flanking markers 20 4186104 8654464 1 - by flanking markers 10002745 DA.E3-(D20Rat47-AA858870)/Rhd A fragment containing MHC region from E3/ZtmRhd was introduced in DA/ZtmRhd by marker-assisted breeding and verified as pure congenic line after six generations of backcross to DA/ZtmRhd. Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown 20 1616332 5924094 1 - by flanking markers 20 4059279 9491404 1 - by flanking markers 20 2018654 7289058 1 - by flanking markers 10002782 SHR-Sbf1^m1Ipcv Spontaneous mutation in the colony of SHR/OlaIpcv in Prague. Institute of Biology and Medical Genetics, Charles University, Prague mutant Unknown Sbf1^m1Ipcv 10002755 7 127583779 127611043 1 - by flanking markers 7 129946572 129973566 1 - by flanking markers 7 130261552 130288566 1 - by flanking markers 10002787 SD-Krt71^m1Yuyi Several rats curled arose spontaneously in a closed colony of SD rats maintained at Laboratory Animal Center of Zhengzhou University. a 3 bp deletion at position 420-422 of Krt71 which results in the deletion of aspartate was identified. Laboratory Animal Center of Zhengzhou University, Henan Province, China mutant Unknown Krt71^m1Yuyi 10002785 7 141143396 141166531 1 - by flanking markers 7 143345201 143371346 1 - by flanking markers 10002791 SD-Fah^em3Mcwi This strain was produced by injecting TALENs targeting the sequence CTCAGTGTTCCTACTCTgcccctcccagaggttcaATGCTTTGTGTTCAATGTCG into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 3. PhysGen Knockouts mutant Cryorecovery (as of 2017-07-18) Fah^em3Mcwi 10002790 1 140851975 140876187 1 - by flanking markers 1 147640316 147662920 1 - by flanking markers 1 146713663 146736339 1 - by flanking markers 10002794 SD-Il2rg^em2Mcwi This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2. PhysGen Knockouts mutant Live Animals (as of 2017-01-26) Il2rg^em2Mcwi 10002792 10043120 BBDP.ACI-(D2Mit8-D2Rat69)/Sunn 104 Mb region from ACI.BBDP-(RT1^u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm32 Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 148790600 247295816 1 - by flanking markers 2 169047256 272813962 1 - by flanking markers 2 149614466 254121739 1 - by flanking markers 10043122 BBDP.ACI-(D2Mit8-D2Arb16)(D2Rat354-D2Rat69)/Sunn 104 Mb region from ACI.BBDP-(RT1^u)(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which includes Iddm26, Iddm33 QTL regions and a small fragment of Iddm32 the region from D2Rat99 and D2Rat354 is from the background ACI strain Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2;2 199719703;148790600 247295816;198312656 1 - by flanking markers;1 - by flanking markers 2;2 226390296;169047256 272813962;225003755 1 - by flanking markers;1 - by flanking markers 2;2 206966406;149614466 254121739;205573168 1 - by flanking markers;1 - by flanking markers 10043124 BBDP.ACI-(D2Mit8-D2Arb16)/Sunn 104 Mb region from ACI.BBDP-(RT1^u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm32 Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 148790600 198312656 1 - by flanking markers 2 169047256 225003755 1 - by flanking markers 2 149614466 205573168 1 - by flanking markers 10043127 BBDP.ACI-(D2Mit8-D2Rat354)/Sunn 104 Mb region from ACI.BBDP-(RT1^u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm26 and a small fragment of Iddm32 Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 148790600 199719925 1 - by flanking markers 2 169047256 226390517 1 - by flanking markers 2 149614466 206966627 1 - by flanking markers 10043129 BBDP.ACI-(D2Arb16-D2Rat63)/Sunn 104 Mb region from ACI.BBDP-(RT1^u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm26 Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 198312439 231465091 1 - by flanking markers 2 225003539 257699856 1 - by flanking markers 2 205572952 239166203 1 - by flanking markers 10043132 BBDP.ACI-(D2Rat50-D2Rat63)/Sunn 104 Mb region from ACI.BBDP-(RT1^u),(Gimap5)/Sunn is introgressed into the BBDP/WorSunn background which carries the centromeric region of Iddm33 and telomeric region of Iddm26 Sunnybrook Research Institute, Toronto, Ontario, Canada congenic Unknown 2 200390326 231465091 1 - by flanking markers 2 227035223 257699856 1 - by flanking markers 2 207612323 239166203 1 - by flanking markers 10043368 NER.F344-(D3M2Mit327-D3Arb10)/Kyo The chromosome 3 region (D3M2Mit327-D3Arb10) was introgressed from F344/NSlc to NER/Kyo by backcrossing.（Sep 12, 2012） National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology 3 0 93413837 1 - by flanking markers 10043382 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)Lgi1^m1/Kyo Triple congenic rat made by mating F344.NER-(D1Mgh6-D1Rat132)(D5Mgh4-D5Rat36)/Kyo and F344-Lgi1m1Kyo. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology Lgi1 628742 5;1 145186817;87656636 145187034;224420760 1 - by flanking markers;1 - by flanking markers 5;1 147610023;92524380 147610238;246113473 1 - by flanking markers;1 - by flanking markers 5;1 143846157;91394009 143846372;238824901 1 - by flanking markers;1 - by flanking markers 10043385 F344.NER-(D1Mgh6-D1Rat73)(D5Mgh4-D5Rat36)Scn1a^m1/Kyo Triple congenic rat made by mating F344.NER-(D1Mgh6-D1Rat132)(D5Mgh4-D5Rat36)/Kyo and F344-LScn1am1Kyo. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Neurobiology Scn1a 69364 5;3;1 145186817;48238528;87656636 145187034;48364143;224420760 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 5;3;1 147610023;59016641;92524380 147610238;59135580;246113473 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 5;3;1 143846157;52388811;91394009 143846372;52533365;238824901 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 10043617 SPRD-Anks6^PKD/Fsn This strain rats was provided to University of Kansas from Central Institute for Laboratory Animal Breeding (Hanover, Germany), and then was introduced to Fujita Health University. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2018-04-20) Anks6^PKD 11534996 5 63633540 63674953 1 - by flanking markers 5 67163440 67204853 1 - by flanking markers 5 62642974 62684387 1 - by flanking markers 10043620 SHRSP.WKY-(D1Smu13)/Izm This congenic strain was made by introducing chromosome 1 region (D1Smu13) of WKY into SHRSP/Izm. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio Hypertension 1 173074640 173074855 1 - by flanking markers 1 166884926 166885141 1 - by flanking markers 10043791 SHRSP.SHR-(D1Mgh5-D1Rat213)/Izm male SHRSP.SHR-(D1Rat93-D1Rat269)/Izm were crossed with female SHRSP/Izm and the offsprings were intercrossed, animals were genotyped to get the desired recombinants which were then backcrossed to SHRSP/Izm Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan, National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 78134304 81548909 1 - by flanking markers 1 80946174 84537228 1 - by flanking markers 1 79689548 83282814 1 - by flanking markers 10043794 WKY.SHRSP-(D1Mgh5-D1Arb21)/Izm A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 1 78134304 187092492 1 - by flanking markers 1 80946174 206277202 1 - by flanking markers 1 79689548 199254774 1 - by flanking markers 10043808 WKY.SHRSP-(D1Mgh5-D1Arb21)(D4Mgh7-D4Rat68)/Izm A congenic strain made by introducing a segments of chromosome 1 from SHRSP/Izm into WKY/Izm. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 4;1 172169471;78134304 172169650;187092492 1 - by flanking markers;1 - by flanking markers 4;1 200825021;80946174 233267140;206277202 1 - by flanking markers;1 - by flanking markers 4;1 136351734;79689548 168998263;199254774 1 - by flanking markers;1 - by flanking markers 10043811 SHRSP.MES-Cyba^MES/Izm A congenic strain made by introducing a genetic locus of Cyba from Matsumoto Eosinophilic Shinshu (MES/Slc) rat into SHRSP/Izm rat. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Cardio-Hypertension 10043813 SHR/HktIzm SHR/Kyushu rat (Kyushu University) was delivered to Shimane University in 2000 and maintained as inbred. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 10043816 LEA-Tg(Pou5f1-YFP*)3Ncco Provided from Kyoto Bioresource center. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Oncology, Development 10043826 SHR/Kpo Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 10043828 SHR/2Kpo Spontaneously hypertensive rat (SHR) was segregated in Wistar-Kyoto rat in 1963. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 10044232 SHRSP/Kpo Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 10045545 CDS/Sasz Cohen diabetic-sensitive rat Original breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony. Hebrew University-Hadassah Medical School, Jerusalem, Israel inbred Unknown 10045548 CDR/Sasz Cohen diabetic-rssistant rat Original breeders are from a colony at Hadassah University Hospital, Jerusalem, Israel: Professor Cohen AM et al. initiated the Cohen diabetic (CD) rat model at the Hadassah University Hospital in the 1950s to examine the role of constitutional (genetic) and environmental (dietary) factors in the development of type 2 diabetes mellitus. Since 1996, the original colony underwent a secondary inbreeding by Dr. Sarah Zangen designated by Prof. Cohen as responsible for the Cohen diabetic (CD) rat colony. Hebrew University-Hadassah Medical School, Jerusalem, Israel inbred Unknown 10045576 SHRSP/2Kpo Okamoto et al. found some rats that have cerebrovascular lesion in SHR rats (especially in line A). This strain was established in 1974 and named stroke-prone SHR (SHRSP) rat. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo; Cryopreserved Sperm Cardio-Hypertension 10045578 MSHRSP/Kpo Okamoto et al. found that a few rats developed higher blood pressure (over 230 mmHg) at 10 weeks old. They selected SHRSP rats that show severe hypertension from young age and M-SHRSP (malignant or precocious SHRSP) rat was established in 1985. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo Cardio-Hypertension 10045580 LE-Tg((ROSA26)Sor-CAG-tdTomato)24Jfhy Background strain: Long Evans | Transgene: CAG-loxP-flanked Neo/STOP cassette-tdTomato was inserted into mouse ROSA26 BAC (RP23 244D9). National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-15) 10045582 ODURM/Odu This strain shows malocclusion. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm Dentistry 10045584 SD-Tg(CAG-HRAS*G12V)218Htsu The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V（HrasV12）was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Oncology 10045589 SD-Tg(CAG-HRAS*G12V)246Htsu The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-ras*G12V（HrasV12）was injected into embryos of SD rat (Jcl:SD). This strain was generated at CLEA Japan,Inc. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Oncology 10045590 LEA.F344-(D20Rat47-D20Mgh4)/Tj Long-Evans Agouti (LEA), type 2 diabetes model, dies from lymphocytic insulitis induced by radiation (4 Gy). This LEA.F344-(D20Rat47-D20Mgh4) strain is a congenic strain made by introducing a segment of chromosome 20 (D20Rat47-D20Mgh4) from F344 strain into LEA strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity 20 1616332 6880472 1 - by flanking markers 20 4059279 7910747 1 - by flanking markers 20 2018654 5875448 1 - by flanking markers 10045591 F344-Cacna1a^gryScn1a^m1Kyo/Okym GRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) was backcrossed to F344/NSlc, and then crossed to HISS rat (HISS rat has the N1417H mutation in the Scn1a gene) to generate Scn1a/Cacna1a double mutant rats. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2017-05-05) Neurobiology Cacna1a|Scn1a^m1Kyo|Cacna1a^gry 2244|12792283|12880382 19 25188170 25424495 1 - by flanking markers 19 36502533 36727039 1 - by flanking markers 19 25453236 25749550 1 - by flanking markers 10045593 W-Dmd^em1Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat. The resulting mutation is a 329-bp deletion around exon 3 and 2-bp substitution in exon16. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-12-08) Neurobiology Dmd^em1Kykn 10045592 X 71501362 71671414 1 - by flanking markers X 51475950 53700033 1 - by flanking markers X 51149358 53519271 1 - by flanking markers 10045597 F344-Nfe2l2^em1Kyo Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 7-bp deletion in Nfe2l2 (Nrf2) gene. National BioResource Project for the Rat in Japan mutant Unknown Neurobiology; Diabetes Obesity Nfe2l2^em1Kyo 10045594 3 58366693 58394116 1 - by flanking markers 3 69041641 69069190 1 - by flanking markers 3 62497568 62525146 1 - by flanking markers 10045600 F344-Nfe2l2^em2Kyo Zinc-finger nucleases (ZFNs) method targeting exon 5 of Nfe2l2 (Nrf2) (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nfe2l2 gene. National BioResource Project for the Rat in Japan mutant Unknown Neurobiology; Diabetes Obesity Nfe2l2^em2Kyo 10045598 3 58366693 58394116 1 - by flanking markers 3 69041641 69069190 1 - by flanking markers 3 62497568 62525146 1 - by flanking markers 10045602 W-Tg(CMV-Ddx54)19Tsuy This transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007. National BioResource Project for the Rat in Japan transgenic Unknown Neurobiology 10045606 W-Tg(CMV-Ddx54)37Tsuy This transgenic rat was established by microinjection of transgene consisting of Ddx54 gene (NM_001191548.1) driven by CMV promoter (pCMV-Tag2B) derived from cytomegalovirus into Wistar rat (SLC) pronuclear fertile eggs at UNITECH Co., Ltd. in 2007. National BioResource Project for the Rat in Japan transgenic Unknown Neurobiology 10046035 SS.SR-(D13Arb5-D13Arb8)/Mcwi A region of chromosome 13 containing the renin gene from the Dahl salt-resistant (Dahl R; SR/JrHsd) strain into the SS genetic background (SS/JrHsdMcwi) Department of Physiology, Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 38985717 47698301 1 - by flanking markers 13 47898759 56629737 1 - by flanking markers 13 42794724 51577031 1 - by flanking markers 10047085 SD-Fus^em1Ionsz CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat. The mutation changed the 521th amino acid Arg (R) into Cys (C). Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Fus^em1Ionsz 10047084 1 187250871 187264742 1 - by flanking markers 1 206435510 206449423 1 - by flanking markers 1 199412805 199426705 1 - by flanking markers 10047391 LE/OrlBarth Long-Evans/Cryptorchid Obtained from Centre Nationale de la Researche Scientifique, Orleans, France; then bred at A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware inbred Unknown 10047393 SDLEF7/Barth This hybrid strain was created by interbreeding Crl:SD and Crl:LE for F7 generation. A.I. duPont Hospital for Children Life Science Center, Wilmington, Delaware hybrid Unknown 10053598 WI-Foxn1^em1Nips Foxn1 mutation was induced by injecting pX330 espressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Unknown Foxn1^em1Nips 10053596 10 64243323 64256847 1 - by flanking markers 10 66004940 66030134 1 - by flanking markers 10 65621142 65634666 1 - by flanking markers 10053601 WI-Foxn1^em2Nips Foxn1 mutation was induced by injecting pX330 espressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105). Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Unknown Foxn1^em2Nips 10053599 10 64243323 64256847 1 - by flanking markers 10 66004940 66030134 1 - by flanking markers 10 65621142 65634666 1 - by flanking markers 10054231 HFJ/Hblac bred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China) Hebei Medical University, Shijiazhuang, Hebei, China inbred Unknown 10054233 MIJ/Hblac bred from Wistar rats that were from National Resource Center (NRLARC) for Rodent Laboratory Animal (Beijing, China) Hebei Medical University, Shijiazhuang, Hebei, China inbred Unknown 10054235 MIJN/Hblac this strain is derived from MIJ/Hblac, they do not carry the infertile gene Hebei Medical University, Shijiazhuang, Hebei, China coisogenic Unknown 10054239 DA-Abcd1^em2Mcwi CRISPR/Cas9 system was used to introduce a 2-bp insertion mutation in the exon1 of the Abcd1 gene of DA/OlaHsd rat embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Abcd1^em2Mcwi 10054237 X 159614569 159635963 1 - by flanking markers 1 152823436 152844829 1 - by flanking markers X 157073860 157095652 1 - by flanking markers 10054242 DA-Abcd1^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Abcd1 gene of DA/OlaHsd rat embryos. MCW Gene Editing Rat Resource Center mutant Extinct (as of 2016-10-24) Abcd1^em4Mcwi 10054240 X 159614569 159635963 1 - by flanking markers 1 152823436 152844829 1 - by flanking markers X 157073860 157095652 1 - by flanking markers 10054245 SS-Adora1^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Adora1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Adora1^em3Mcwi 10054243 13 47160292 47192804 1 - by flanking markers 13 56097883 56132155 1 - by flanking markers 13 51042111 51076913 1 - by flanking markers 10054276 SD-Vcp^em1Ionsz CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into His Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Vcp^em1Ionsz 10054274 10054279 SD-Gfap^{em1(2A-Chr2-EYFP)Ionsz} CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap. Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Gfap^em1Ionsz 10054277 10054284 SS-Adora1^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp deletion in the Adora1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Adora1^em4Mcwi 10054282 13 47160292 47192804 1 - by flanking markers 13 56097883 56132155 1 - by flanking markers 13 51042111 51076913 1 - by flanking markers 10054287 SS-Adora2a^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp deletion in the Adora2a gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Adora2a^em3Mcwi 10054285 20 13815719 13834131 1 - by flanking markers 20 16449385 16466147 1 - by flanking markers 20 14265251 14282873 1 - by flanking markers 10054292 SS-Arhgef11^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in the Arhgef11 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Arhgef11^em4Mcwi 10054289 2 179676236 179796785 1 - by flanking markers 2 206384799 206507431 1 - by flanking markers 2 186979850 187102523 1 - by flanking markers 10054296 SS-Arhgef11^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Arhgef11^em5Mcwi 10054293 2 179676236 179796785 1 - by flanking markers 2 206384799 206507431 1 - by flanking markers 2 186979850 187102523 1 - by flanking markers 10054299 SS.BN-(D13Rat25-rs106935835)-Btg2^em11Mcwi CRISPR/Cas9 system was used to introduce a 16-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-26) Btg2^em11Mcwi 10054297 13 47026986 47030745 1 - by flanking markers 13 55966299 55970058 1 - by flanking markers 13 50913185 50916944 1 - by flanking markers 10054304 SS.BN-(D13Rat25-rs106935835)-Btg2^em13Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Btg2^em13Mcwi 10054302 13 47026986 47030745 1 - by flanking markers 13 55966299 55970058 1 - by flanking markers 13 50913185 50916944 1 - by flanking markers 10054307 SS.BN-(D13Rat25-rs106935835)-Btg2^em7Mcwi The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Unknown (as of 2020-01-23) Btg2^em7Mcwi 10054305 13 47026986 47030745 1 - by flanking markers 13 55966299 55970058 1 - by flanking markers 13 50913185 50916944 1 - by flanking markers 10054310 SS-Casr^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Casr gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp (T) insertion in the Casr gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Casr^em1Mcwi 10054308 11 66084169 66153292 1 - by flanking markers 11 70278784 70352137 1 - by flanking markers 11 67188204 67262261 1 - by flanking markers 10054373 LEW-Chrna3^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos.The resulting mutation is a 1-bp (G) insertion in the Chrna3 gene. MCW Gene Editing Rat Resource Center mutant Unknown (as of 2018-10-22) Chrna3^em1Mcwi 10054371 8 58570223 58583594 1 - by flanking markers 8 58176165 58189008 1 - by flanking markers 8 59594007 59607122 1 - by flanking markers 10054376 LEW-Chrna3^em9Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrna3 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-11-26) Chrna3^em9Mcwi 10054374 8 58570223 58583594 1 - by flanking markers 8 58176165 58189008 1 - by flanking markers 8 59594007 59607122 1 - by flanking markers 10054379 LEW-Chrna4^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 5-bp deletion in the Chrna4 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-11-26) Chrna4^em4Mcwi 10054377 3 170171214 170185998 1 - by flanking markers 3 180243234 180258017 1 - by flanking markers 3 176533182 176547965 1 - by flanking markers 10054383 LEW-Chrna4^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/NCrl rat embryos. The resulting mutation is a 17-bp deletion in the Chrna4 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-11-26) Chrna4^em3Mcwi 10054380 3 170171214 170185998 1 - by flanking markers 3 180243234 180258017 1 - by flanking markers 3 176533182 176547965 1 - by flanking markers 10054386 LEW-Chrna5^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the Chrna5 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-11-26) Chrna5^em1Mcwi 10054384 8 58538002 58566388 1 - by flanking markers 8 58143974 58172330 1 - by flanking markers 8 59561817 59590172 1 - by flanking markers 10054389 LEW-Chrna5^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrna5 gene of LEW/NCrl rat embryos. The resulting mutation is a 20-bp deletion in the Chrna5 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-11-26) Chrna5^em2Mcwi 10054387 8 58538002 58566388 1 - by flanking markers 8 58143974 58172330 1 - by flanking markers 8 59561817 59590172 1 - by flanking markers 10054398 DA-Gla^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Gla^em2Mcwi 10054395 X 122044703 122056327 1 - by flanking markers X 105295029 105306686 1 - by flanking markers X 105405915 105417331 1 - by flanking markers 10054401 FHH-Chr 3^BN-Helz2^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3^BN/Mcwi rat embryos.The resulting mutation is a 11-bp deletion in the Helz2 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Helz2^em3Mcwi 10054399 3 170368815 170382086 1 - by flanking markers 3 180439958 180454321 1 - by flanking markers 3 176730024 176744382 1 - by flanking markers 10054405 FHH-Chr 3^BN-Helz2^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Helz2 gene of FHH-Chr 3^BN/Mcwi rat embryos.The resulting mutation is a 1-bp insertion in the Helz2 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Helz2^em4Mcwi 10054402 3 170368815 170382086 1 - by flanking markers 3 180439958 180454321 1 - by flanking markers 3 176730024 176744382 1 - by flanking markers 10054408 SS-Kcnj10^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Kcnj10 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Kcnj10^em1Mcwi 10054406 13 88341102 88370591 1 - by flanking markers 13 95245046 95274535 1 - by flanking markers 13 90722945 90753338 1 - by flanking markers 10054411 SS-Kcnj10^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp deletion in the Kcnj10 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Kcnj10^em3Mcwi 10054409 13 88341102 88370591 1 - by flanking markers 13 95245046 95274535 1 - by flanking markers 13 90722945 90753338 1 - by flanking markers 10054414 SS-Mmp9^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Mmp9^em4Mcwi 12743378 3 155985473 155993433 1 - by flanking markers 3 167578904 167605890 1 - by flanking markers 3 161413410 161421473 1 - by flanking markers 10054417 SS-Mmp9^em6Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Mmp9 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Mmp9 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Mmp9^em6Mcwi 10054415 3 155985473 155993433 1 - by flanking markers 3 167578904 167605890 1 - by flanking markers 3 161413410 161421473 1 - by flanking markers 10054420 LEW-Mrpl28^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Mprl28 gene of LEW/NCrl rat embryos. The resulting mutation is a 2-bp insertion in the Mrpl28 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Mrpl28^em1Mcwi 10054418 10 15394360 15397270 1 - by flanking markers 10 15309316 15312227 1 - by flanking markers 10 15495616 15498527 1 - by flanking markers 10054430 LEW-Pkd1^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 15-bp deletion in the Pkd1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Pkd1^em2Mcwi 10054428 10 13801445 13848212 1 - by flanking markers 10 13731035 13778993 1 - by flanking markers 10 13914057 13962008 1 - by flanking markers 10054433 LEW-Pkd1^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Pkd1^em3Mcwi 10054431 10 13801445 13848212 1 - by flanking markers 10 13731035 13778993 1 - by flanking markers 10 13914057 13962008 1 - by flanking markers 10054436 LEW-Pkd1^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/Crl rat embryos. The resulting mutation is a 16-bp deletion in the Pkd1 gene. MCW Gene Editing Rat Resource Center mutant Extinct (as of 2017-01-26) Pkd1^em1Mcwi 10054434 10 13801445 13848212 1 - by flanking markers 10 13731035 13778993 1 - by flanking markers 10 13914057 13962008 1 - by flanking markers 10054439 LEW-Pkd1^em6Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Pkd1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Pkd1^em6Mcwi 10054437 10 13801445 13848212 1 - by flanking markers 10 13731035 13778993 1 - by flanking markers 10 13914057 13962008 1 - by flanking markers 10054444 LEW-Rorc^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the Rorc gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Rorc^em3Mcwi 10054442 2 189345134 189369442 1 - by flanking markers 2 195612471 195636797 1 - by flanking markers 10054447 LEW-Rorc^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Rorc gene of LEW/NCrl rat embryos. The resulting mutation is a 59-bp deletion in the Rorc gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Rorc^em5Mcwi 10054445 2 189345134 189369442 1 - by flanking markers 2 195612471 195636797 1 - by flanking markers 10054450 SS-Sirt3^em25Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Sirt3^em25Mcwi 10054448 1 201021391 201043756 1 - by flanking markers 1 220539132 220561380 1 - by flanking markers 1 213613502 213636061 1 - by flanking markers 10054453 SS-Sirt3^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Sirt3^em4Mcwi 10054451 1 201021391 201043756 1 - by flanking markers 1 220539132 220561380 1 - by flanking markers 1 213613502 213636061 1 - by flanking markers 10054456 T2DN-Sirt3^em35Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-22) Sirt3^em35Mcwi 10054454 1 201021391 201043756 1 - by flanking markers 1 220539132 220561380 1 - by flanking markers 1 213613502 213636061 1 - by flanking markers 10054459 T2DN-Sirt3^em30Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 31-bp deletion in the Sirt3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Sirt3^em30Mcwi 10054457 1 201021391 201043756 1 - by flanking markers 1 220539132 220561380 1 - by flanking markers 1 213613502 213636061 1 - by flanking markers 10054462 SS-Stk39^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp del in exon 5 in the Stk39 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Stk39^em5Mcwi 10054460 3 50249626 50517085 1 - by flanking markers 3 60973443 61244306 1 - by flanking markers 3 54359449 54625702 1 - by flanking markers 10054465 SS-Stk39^em6Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Stk39 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Stk39 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Stk39^em6Mcwi 10054463 3 50249626 50517085 1 - by flanking markers 3 60973443 61244306 1 - by flanking markers 3 54359449 54625702 1 - by flanking markers 10054473 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi SS/JrHsdMcwi were crossed with SS-13^BN/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 0 46721269 1 - by flanking markers 13 55662705 55662936 1 - by flanking markers 13 50609228 50609459 1 - by flanking markers 10059570 WI-Kiss1^tm1Nips This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells with a targeting vector. Homologous recombination of the rKiss1 targeting construct (13.4kb) result in the deletion of 2.5 kb of the Kiss1 locus, consisting of 88 bp of the first coding exon, all of the 2.0-kb downstream intron, and 319 bp of the second coding exon, covering all of the coding region of this exon including the key active region of the processed peptide. Founder animals were backcrossed to Crlj:WI. National Institute for Physiological Sciences, Okazaki Aichi, JAPAN, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan mutant Unknown Kiss1^tm1Nips 40902862 13 46244786 46247288 1 - by flanking markers 13 55582365 55590432 1 - by flanking markers 13 50529506 50537603 1 - by flanking markers 10059573 SS-Adora2a^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Adora2a gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion and 5-bp insertion in the Adora2a gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Adora2a^em5Mcwi 10059571 20 13815719 13834131 1 - by flanking markers 20 16449385 16466147 1 - by flanking markers 20 14265251 14282873 1 - by flanking markers 10059576 WKY-Sik2^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2017-01-26) Sik2^em4Mcwi 10059574 8 54240307 54337976 1 - by flanking markers 8 53905730 54005295 1 - by flanking markers 8 55309005 55408608 1 - by flanking markers 10059635 W-Tg(GnRH-GFP)Mni generated by Dr. Masugi Nishihara's group Department of Veterinary Physiology, Veterinary Medical Science, The University of Tokyo, Tokyo Japan transgenic Unknown 10395226 Sim:LE Long Evans Received from Dr. Evans, University of California, Berkeley - Experimental Institute of Biology in 1949. Caesarean rederived in 1997. Selection is based on the black-hooded phenotype. Simonsen Laboratories outbred Unknown 10395228 Sim:WI Wistar Received from the Lobund Institute, University of Notre Dame in 1957. Caesarean rederived in 1997. Simonsen Laboratories outbred Unknown 10395233 Sim:SD Sprague-Dawley Derived Received Sprague-Dawley derived breeding stock from Charles River Laboratory in 1958 and crossed with Sprague-Dawley rats received from ARS/Sprague-Dawley in 1975. Caesarean rederived in 1997. Simonsen Laboratories outbred Unknown 10395235 F344/NSim FISCHER 344 Gnotobiotic pedigreed breeders received from the NIH repository colony in 2005. Most widely used inbred rat strain, particularly for toxicology and teratology. Simonsen Laboratories inbred Unknown 10395249 FHH.FHH.3^BN-(3p-D3Rat98)/Mcwi (FHH X FHH-3^BN/Mcwi) F₂ males were backcrossed with FHH-3^BN/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 3 30253942 30254280 1 - by flanking markers 3 38636977 38637167 1 - by flanking markers 3 33477354 33477544 1 - by flanking markers 10395251 FHH.FHH.3^BN-(D3Hmgc24-3q)/Mcwi (FHH X FHH-3^BN/Mcwi) F₂ males were backcrossed with FHH-3^BN/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 10395253 FHH.FHH.3^BN-(D3Hmgc24-3q)(3p-D3Rat98)/Mcwi (FHH X FHH-3^BN/Mcwi) F₂ males were backcrossed with FHH-3^BN/Mcwi females to produce offsprings, these were intercrossed to generate this congenic line Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 3 30253942 30254280 1 - by flanking markers 3 38636977 38637167 1 - by flanking markers 3 33477354 33477544 1 - by flanking markers 10395297 GK/FarMcwi Goto-Kakizaki Generated by selective brother x sister breeding of 18 non-diabetic Jcl:Wistar rats which were glucose intolerant on oral glucose tolerant tests. This colony is from F36 generation of the Japanese colony provided by Drs. Suzuki and Toyota of Tokoku University , Sendai Japan. Now bred and maintained at Medical College of Wisconsin Medical College of Wisconsin, Milwaukee, Wisconsin inbred Unknown 10401195 SD-Tg(CAG.LoxP.EGFP)Zi Random insertion of a Cre inducible expression cassette, controlled by the CAG promoter. LacZ is expressed constitutively, GFP only after Cre mediated recombination Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm; Cryorecovery 10401201 LE-Tg(Th-cre)3.1Deis Cre gene was introduced immediately before the ATG of the mouse tyrosine hydroxylase (Th) gene on BAC RP23-350E13 Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm (as of 2017-05-31) 10401204 LE-Tg(ChAT-cre)5.1Deis Cre gene was introduced immediately before the ATG of the mouse choline acetyltransferase (Chat) gene in BAC RP23-246B12. This strain is estimated to carry 6 copies of the transgene at the integration site. Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm (as of 2017-05-31) 10401208 F344-Tg(Prp-APP,Prp-PS1)19/Rrrc The strain was coinjected with two transgenes: one contains the human amyloid beta (A4) precursor protein (hAPP) gene with the Swedish mutation (K595N/M596L) driven by mouse prion promoter (Prp). The other contains the human presenilin 1 gene (PS1) with a deletion of exon 9, also driven by the mouse prion promoter (Prp). Based on segregation patterns, it is believed that the two transgenes have integrated at the same chromosomal site. Rat Resource and Research Center transgenic Live Animals; Cryopreserved Sperm (as of 2019-02-20) 10401212 SD-Tg(Thy1.2-NIPA1) Human NIPA1G106R mutation is made by site-directed mutagenesis and then inserted into Thy1.2-promotor cassette. Transgenic vector is injected into fertilized eggs to produce 2 independent lines (A, B) Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery 10401835 WKY.F344-(D17Got91-D17Rat51)/Tja A congenic strain made by introducing a 15 Mbp segment of chromosome 17 from F344/NHsd into WKY/Cruk, this region has the distal end of Cm15 QTL MRC Clinical Centre, London, UK congenic Unknown 17 82277434 96587905 1 - by flanking markers 17 76512697 91678127 1 - by flanking markers 17 74852634 90012722 1 - by flanking markers 10401837 WKY.F344-(D17Got91-D17Rat47)/Tja A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja MRC Clinical Centre, London, UK congenic Unknown 17 82277434 85072478 1 - by flanking markers 17 76512697 79573336 1 - by flanking markers 17 74852634 77922655 1 - by flanking markers 10401839 WKY.F344-(D17Rat47-D17Rat51)/Tja A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja MRC Clinical Centre, London, UK congenic Unknown 17 85072352 96587905 1 - by flanking markers 17 79573143 91678127 1 - by flanking markers 17 77922462 90012722 1 - by flanking markers 10401841 WKY.F344-(D17Rat131-D17Rat51)/Tja A congenic substrain derived from the progenitor strain WKY.F344-(D17Got91-D17Rat51)/Tja MRC Clinical Centre, London, UK congenic Unknown 17 93347783 96587905 1 - by flanking markers 17 87712049 91678127 1 - by flanking markers 17 85994775 90012722 1 - by flanking markers 10401843 WKY-Slc39a12^em77Tja This strain was produced by injecting ZFNs targeted sequence into WKY/Cruk rat embryos. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. MRC Clinical Centre, London, UK mutant Unknown Slc39a12^em77Tja 10401842 17 88525527 88605947 1 - by flanking markers 17 83202775 83288616 1 - by flanking markers 17 81455731 81541742 1 - by flanking markers 10401845 WKY-Slc39a12^em77Tja+/- WKY-Slc39a12^em77Tja+/WKY-Slc39a12^em77Tja- ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. MRC Clinical Centre, London, UK mutant Unknown Slc39a12^em77Tja 10401842 17 88525527 88605947 1 - by flanking markers 17 83202775 83288616 1 - by flanking markers 17 81455731 81541742 1 - by flanking markers 10401848 WKY-Slc39a12^em77Tja-/- WKY-Slc39a12^em77Tja-/WKY-Slc39a12^em77Tja- ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. MRC Clinical Centre, London, UK mutant Unknown Slc39a12^em77Tja 10401842 17 88525527 88605947 1 - by flanking markers 17 83202775 83288616 1 - by flanking markers 17 81455731 81541742 1 - by flanking markers 10401851 SD-Lep^em1Narl CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermates National Laboratory Animal Center, Taiwan mutant Unknown Lep 3000 4 55943837 55945938 1 - by flanking markers 4 56085079 56099209 1 - by flanking markers 4 56337695 56351818 1 - by flanking markers 10401918 BDIX/HanHsd BDIX/Han maintained at Envigo (Harlan) Envigo inbred Cryorecovery 10402160 HCR/1Mco High-capacity runners; generation 5 HCR/Mco bred till the fifth generation Medical College of Ohio, Toledo, Ohio, USA inbred Unknown 10402163 HCR/2Mco High-capacity runners; generation 26 HCR/Mco bred till the twenty-sixth generation Medical College of Ohio, Toledo, Ohio, USA inbred Unknown 10402165 LCR/1Mco Low-capacity runners; generation 5 LCR/Mco bred till the fifth generation Medical College of Ohio, Toledo, Ohio, USA inbred Unknown 10402167 LCR/2Mco Low-capacity runners; generation 26 LCR/Mco bred till the twenty-sixth generation Medical College of Ohio, Toledo, Ohio, USA inbred Unknown 10402390 BNW/Jer Brown Norway-wild This is a wild caught strain, characterized by Charles River Laboratories and has been bred brother x sister Agricultural Omega Solutions LLC, Milwaukee, Wisconsin inbred Unknown 10402393 HPE/Jer Hairless pink eye dilute This is a strain of unknown background, and has been bred brother x sister Agricultural Omega Solutions LLC, Milwaukee, Wisconsin inbred Unknown 10402395 HBLS/Jer Hairless black skin pigmented This is a result of a cross of the BNW and HPE, this spontaneous hairless black skin mutation was selected from the F2 offspring for the black hairless quality and subsequently bred brother x sister Agricultural Omega Solutions LLC, Milwaukee, Wisconsin inbred Unknown 10402819 DA-Tph2^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Live Animals (as of 2017-01-26) Tph2^em2Mcwi 10402817 7 54321033 54430706 1 - by flanking markers 7 58053268 58157949 1 - by flanking markers 7 58042279 58149220 1 - by flanking markers 10402822 DA-Tph2^em3Mcwi This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Cryorecovery (as of 2017-01-26) Tph2^em3Mcwi 10402820 7 54321033 54430706 1 - by flanking markers 7 58053268 58157949 1 - by flanking markers 7 58042279 58149220 1 - by flanking markers 10402834 LEW.SS-(D7Rat27-D7Mgh1)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 7 32004504 32004684 1 - by flanking markers 7 35931747 35931926 1 - by flanking markers 7 35867729 35867908 1 - by flanking markers 10402836 LEW.SS-(D8Chm12-D8Rat15)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 8 103548728 103548876 1 - by flanking markers 8 105836600 105836747 1 - by flanking markers 8 106394231 106394378 1 - by flanking markers 10402839 LEW.SS-(D10Mgh6-D10Mgh1)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 10 67677924 67678060 1 - by flanking markers 10 63366082 63366218 1 - by flanking markers 10 64648175 64648311 1 - by flanking markers 10402842 LEW.SS-(D17Rat15-D17Rat51)/Ayd LEW/Crlc and SS/Jr were backcrossed for 5 generations, then BC5 rat was mated with LEW/Crlc to produce the desired congenic strain Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 17 37727971 96587905 1 - by flanking markers 17 33949701 91678127 1 - by flanking markers 17 32055882 90012722 1 - by flanking markers 10402850 LEW.SS-(D7Rat27-D7Mgh1)(D17Rat15-D17Rat51)/Ayd double congenic strain was generated by combining the two separate congenic strains Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 17;7 37727971;32004504 96587905;32004684 1 - by flanking markers;1 - by flanking markers 17;7 33949701;35931747 91678127;35931926 1 - by flanking markers;1 - by flanking markers 17;7 32055882;35867729 90012722;35867908 1 - by flanking markers;1 - by flanking markers 10402852 LEW.SS-(D7Rat27-D7Mgh1)(D17Rat15-D17Rat51)(D10Mgh6-D10Mgh1)/Ayd multiple congenic strain was generated by combining the three separate congenic strains Research Centre, Centre Hospitalier de l'Universite de Monteal (CHUM), Quebec, Canada congenic Unknown 17;10;7 37727971;67677924;32004504 96587905;67678060;32004684 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 17;10;7 33949701;63366082;35931747 91678127;63366218;35931926 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 17;10;7 32055882;64648175;35867729 90012722;64648311;35867908 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 10412325 LE-Tg(Drd1-icre)3Ottc The transgene expresses BAC transgenic using rat dopamine receptor 1 promoter to express Cre recombinase in D1R neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) Drd1 2518 17 16655926 16658161 1 - by flanking markers 17 13211031 13215581 1 - by flanking markers 17 11099736 11104352 1 - by flanking markers 10412327 LE-Tg(Drd2-iCre)1Ottc The transgene expresses BAC transgenic using rat dopamine receptor 2 promoter to express Cre recombinase in D2R neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) Drd1 2518 17 16655926 16658161 1 - by flanking markers 17 13211031 13215581 1 - by flanking markers 17 11099736 11104352 1 - by flanking markers 10412329 LE-Tg(Pvalb-icre)2Ottc The transgene expresses BAC transgenic using rat parvalbumin promoter to express Cre recombinase in parvalbumin expressing neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) Pvalb 3457 10413850 SD-Abcc6^em1Qlju-/- This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. Thomas Jefferson University, Philadelphia mutant Unknown Abcc6^em1Qlju 10413843 1 96448588 96524655 1 - by flanking markers 1 103042723 103096453 1 - by flanking markers 1 101954786 102013252 1 - by flanking markers 10413852 SD-Abcc6^em2Qlju-/- This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. Thomas Jefferson University, Philadelphia mutant Unknown Abcc6^em2Qlju 10413846 1 96448588 96524655 1 - by flanking markers 1 103042723 103096453 1 - by flanking markers 1 101954786 102013252 1 - by flanking markers 10413854 SD-Abcc6^em3Qlju-/- This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 10-bp deletion (CAGGCCTGAG)from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. Thomas Jefferson University, Philadelphia mutant Unknown Abcc6^em3Qlju 10413847 1 96448588 96524655 1 - by flanking markers 1 103042723 103096453 1 - by flanking markers 1 101954786 102013252 1 - by flanking markers 10413856 SD-Abcc6^em4Qlju-/- This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. Thomas Jefferson University, Philadelphia mutant Unknown Abcc6^em4Qlju 10413848 1 96448588 96524655 1 - by flanking markers 1 103042723 103096453 1 - by flanking markers 1 101954786 102013252 1 - by flanking markers 10413858 SD-Abcc6^em5Qlju-/- This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. Thomas Jefferson University, Philadelphia mutant Unknown Abcc6^em5Qlju 10413849 1 96448588 96524655 1 - by flanking markers 1 103042723 103096453 1 - by flanking markers 1 101954786 102013252 1 - by flanking markers 10450489 SD-Bsn^em1Ionsz CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Bsn^em1Ionsz 10450488 8 113364208 113455766 1 - by flanking markers 8 116227802 116319071 1 - by flanking markers 8 116873721 116965396 1 - by flanking markers 10755350 F344.ZUC-(Lepr^fa),OLETF-(D14Rat23-D14Rat12)/Tj The F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-Lepr^fa with F344.OLETF-( D14Rat23-D14Rat12) and then selecting Lepr^fa -Niddm20 (fa/fa-Nidd2/of) homozygotes National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity Lepr 3001 14;5 1764386;122320075 41707592;122503449 1 - by flanking markers;1 - by flanking markers 14;5 2222207;124380327 61886417;124556585 1 - by flanking markers;1 - by flanking markers 14;5 2227825;120503475 61783215;120682281 1 - by flanking markers;1 - by flanking markers 10755352 LH/MavRrrcAek Lyon Hypertensive Lyon Hypertensive rats maintained at Department of Pharmacology, University of Iowa Department of Pharmacology, University of Iowa, Iowa inbred Unknown 10755354 LN/MavRrrcAek lyon normotensive Lyon normotensive rats maintained at Department of Pharmacology, University of Iowa Department of Pharmacology, University of Iowa, Iowa inbred Unknown 11040455 SHR.BN-(D16Rat88-D16Rat9)/Cub Segment of chromosome 16 from BN.Lx/Cub was transferred to SHR/Ola after 9 backcrosses an intercross was done to obtain the desired congenic Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic congenic Unknown 16 819225 22577050 1 - by flanking markers 16 1534408 22473610 1 - by flanking markers 16 1550187 22579213 1 - by flanking markers 11040519 SHR-Ndufc2^em1Mcwi-/+ SHR-Ndufc2^em1Mcwi-/Ndufc2^em1Mcwi+ ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown Ndufc2^em1Mcwi 9588537 1 154635889 154642112 1 - by flanking markers 1 168576274 168582497 1 - by flanking markers 1 162369801 162376024 1 - by flanking markers 11040521 SHR-Ndufc2^em2Mcwi-/+ SHR-Ndufc2^em2Mcwi-/Ndufc2^em2Mcwi+ ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 11040525 SHR-Ndufc2^em1Mcwi+/+ SHR-Ndufc2^em1Mcwi+/Ndufc2^em1Mcwi+ ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 11040527 SHR-Ndufc2^em2Mcwi+/+ SHR-Ndufc2^em2Mcwi+/Ndufc2^em2Mcwi+ ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Unknown 11040548 CrlCembe:WI Wistar rats CeMBE received breeding stock from Charles River (Crl:WI, strain code 003) in 2014, these are bred according to the Poiley rotation (1960) with permanent monogamous mating. Center for Biological Model Research (CeMBE), Pontifical Catholic University from Rio Grande do Sul (PUCRS), Brazil outbred Unknown 11040561 WI-Htr7^em1Geh CRISPR/Cas9 system was used to generate this mutant; this induced 89 base pair deletion in exon 1 of the Htr7 gene. Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery Htr7^em1Geh 14696714 1 240136279 240260620 1 - by flanking markers 1 261759122 261879914 1 - by flanking markers 1 254547964 254671811 1 - by flanking markers 11040563 SD-Tg(Adra1a)Vccr Cardiac specific overexpression of the alpha 1A adrenergic receptor, 40 fold overexpression of the receptor Rat Resource and Research Center transgenic Unknown 11040565 LEW-Tg(CAG-OFP)Pic random insertion of a transgene carrying orange fluorescent protein (OFP) driven by the CAG promoter Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery 11040568 W-Tg(RNB1-116K03-EGFP-mRFP)3Kyo The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 11040570 W-Tg(RNB1-116K03-EGFP-mRFP)20Kyo The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 11040572 W-Tg(RNB1-116K03-EGFP-mRFP)21Kyo The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 11040574 W-Tg(RNB1-116K03-EGFP-mRFP)22Kyo The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 11040577 W-Tg(RNB1-116K03-EGFP-mRFP)41Kyo The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 11040579 W-Tg(RNB1-116K03-EGFP-mRFP)104Kyo The transgene consists of the bacterial artificial chromosome (BAC) clone RNB1-116, which contains the attractin (Atrn) gene which is modified by in-frame insertion of the EGFP reporter gene upstream of the 29th exon and an in-frame insertion of the mRFP reporter gene between 24th exon and stop codon. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Atrn 69063 3 118539268 118701177 1 - by flanking markers 3 129934303 130067267 1 - by flanking markers 3 123434409 123567922 1 - by flanking markers 11040581 TRM.W-Tg(RNB1-186G14)51Kyo F344/Stm rat BAC clone RNB1-186G14 was microinjected into embryos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040675 TRM.W-Tg(RNB1-186G14)33Kyo F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040678 TRMR.W-Tg(RNB1-186G14)51Kyo F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040681 TRMR.W-Tg(RNB1-186G14)33Kyo F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM/Kyo rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236-60354841 of Rat Chr 10 and this region contains Spata22 gene expressed in testes. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm 11040683 SER.TRMR.W-Tg(RNB1-186G14)51Kyo The sperms from N2 generation rat (ID#252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) were microinjected into SER embyos. The offspring with transgese was backcrossed with SER rats. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040916 F344-Zeb2^em1Kyo Zinc-finger nucleases (ZFNs) method taregting exon 5 of Zeb2 gene (AGCCAAAGCTTGCCTCCA and GACTACTGACTCAAG) was used; This strain has a 5-bp deletion (cagag) and a 2-bp insertion (tc) in exon7 of Nrf2 gene, resulting in a deletion of Glutamine(Q)541. Background strain: F344/Stm National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology; Development Zeb2 1307272 11040918 WTC-furue/Kyo WTC-furue rat was found in a colony of WTC.ZI-Atrn congenic strain at national cancer research center in 2000. The tremor phenotype is controlled by an autosomal recessive mutation ("furue") National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Neurobiology 11040920 WTC.Cg-dmyTg(Mrs2-EGFP)39Kyo CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040922 WTC.Cg-dmyTg(Mrs2-EGFP)15Kyo CHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040934 WTC.Cg-dmyTg(Mrs2-EGFP)92Kyo CHORI230-9K13 recombinant BAC (Mrs2-EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040936 WTC.Cg-dmyTg(Mrs2-EGFP)131Kyo CHORI230-9K13 recombinant BAC (Mrs2/EGFP) was introduced into Crlj:Wistar embyos. BAC Tg rats were backcrossed with WTC.DMY-dmy. dmy gene: homozygous, transgene: hemizygous. 4 lines: #15, #39, #92, #131 National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040939 STOCK.dmyTg(CMV-Mrs2)Kyo A transgene containing the CMV promoter and MRS2 gene was microinjected into the pronuclei of fertilized oocytes collected from Wistar rats. Transgenic offspring founder rats were backcrossed with WTC.DMy-dmy rats to obtain dmy/dmy homozygous and also hemizygous for the transgede (dmy/dmy, tg/+). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Mrs2 708529 11040941 SD-Tg(Gfap-Tk1)Jog SD-Tg(Gfap-Tk1) The rats were originally generated by the University of Michigan Transgenic Animal Model Core, University of Michigan. They used a Crl:CD(SD) sub strain of Sprague-Dawley rats, obtained from Charles River Laboratory (Wilmington, MA, USA). The F1 rats have been bred in the UK with Hsd:Sprague Dawley (Harlan laboratories, UK), which are direct descendants of the original 1925 SD-company colony (Madison, Wisconsin, USA). The GFAP-TK rat was generated by pronuclear injection of a Gfap-Tk Bacterial Artificial Chromosome (BAC) construct, engineered using RedET-mediated homologous recombination methods. National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo Gfap|Tk1 2679|621014 11040946 F344-Prkdc^em1Kyo This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene, resulting a 46-deletion. Background strain: F344/Stm National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-06-08) Prkdc|Prkdc^em1Kyo 1308982|12910095 11 86951420 87169229 1 - by flanking markers 11 92347175 92565022 1 - by flanking markers 11 89293547 89510948 1 - by flanking markers 11040948 F344-Prkdc^em2KyoIl2rg^em6Kyo This strain was established by Zinc-finger nucleases (ZFNs) method taregting rat Prkdc gene (227-bp deletion) and Il2rg gene (332-bp deletion). Background strain: F344/Stm National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-06-08) Il2rg|Prkdc|Prkdc^em2Kyo|Il2rg^em6Kyo 621466|1308982|12910096|12910097 11;X 86951420;89342055 87169229;89345715 1 - by flanking markers;1 - by flanking markers 11;X 92347175;72017856 92565022;72021516 1 - by flanking markers;1 - by flanking markers X;11 71165378;89293547 71169078;89510948 1 - by flanking markers;1 - by flanking markers 11040950 TM-Prkdc^em4KyoIl2rg^em5Kyo This strain was established by Zinc-finger nucleases (ZFNs) method causing 20-bp deletion in the exon1 of Prkdc gene and a 653-bp deletion Il2rg gene. Background strain: TM/Kyo National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-07-12) Il2rg|Prkdc|Prkdc^em4Kyo|Il2rg^em5Kyo 621466|1308982|12910098|12910099 11;X 86951420;89342055 87169229;89345715 1 - by flanking markers;1 - by flanking markers 11;X 92347175;72017856 92565022;72021516 1 - by flanking markers;1 - by flanking markers X;11 71165378;89293547 71169078;89510948 1 - by flanking markers;1 - by flanking markers 11040952 WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm A congenic strain made by introducing a segments of chromosome 1 and 3 from SHRSP/Izm into WKY/Izm. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo; Cryopreserved Sperm 1;3 78134304;6373335 187092492;151449116 1 - by flanking markers;1 - by flanking markers 1;3 80946174;11361699 206277202;162886090 1 - by flanking markers;1 - by flanking markers 1;3 79689548;6000748 199254774;156656443 1 - by flanking markers;1 - by flanking markers 11040954 LEA-Tp53^{tm1(AmCyan1)Ncco} LEA rats were provided from Kyoto Bioresource Center in 2006. Then LEA rat ES cells having Oct4-Venus gene and Oct4-Venus Tg rat strain (LEA-Tg(Pou5f1-YFP*)3Ncco) were established. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo 11040957 F344-Tp53^m1Kyo This strain was established by ENU mutagenesis (gene-driven) using F344/NSlc and has a missense mutation（R271C). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm Tp53|Tp53^m1Kyo 3889|12792955 10 56399721 56411150 1 - by flanking markers 10 55932658 55944087 1 - by flanking markers 10 56186299 56198449 1 - by flanking markers 11040959 SER.TRMR.W-tm^TRMAtrn^ziTg(RNB1-186G14)/Kyo The sperms from N2 generation rat (NBRP Rat No:252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP Rat No:0677) were microinjected into SER embryos. The offspring with transgene was backcrossed with SER rats. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11040962 F344-Bscl2^m1Kyo T239A mutation was found by screening of 4608DNA sample from ENU mutagenesis library KURMA. This strain has a T239A (L80X) nonsense mutation in Bscl2 gene. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2019-01-09) Bscl2|Bscl2^m1Kyo 1308135|13838727 1 211509675 211518963 1 - by flanking markers 1 231972073 231983764 1 - by flanking markers 1 225035956 225046137 1 - by flanking markers 11040969 DWH/Iet Dwarfism derived from Wistar Hannover GALAS rats derived from Wistar Hannover GALAS rats National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo Metabolism Tg 3848 7 104035776 104220754 1 - by flanking markers 7 107399165 107602400 1 - by flanking markers 7 107467260 107652897 1 - by flanking markers 11040971 F344-Tyr^CKit^H/Kyo 1) point mutation in the exon 2 (896G>A, p.R229H) of Tyrosinase (Tyr) gene (albino phenotype) and 2) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to black. Background strain: F344/Stm National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-07-17) Kit|Tyr 620568|1589755 14;1 34906043;143641257 34984819;143746315 1 - by flanking markers;1 - by flanking markers 14;1 34901860;157322968 34979384;157416594 1 - by flanking markers;1 - by flanking markers 14;1 35072131;151012598 35149638;151106802 1 - by flanking markers;1 - by flanking markers 11040974 F344-Asip^ATyr^CKit^H/Kyo 1) point mutation in the exon 2 of Tyrosinase (Tyr) gene (albino phenotype), 2) 19-bp deletion in Asip gene (Agouti phenotype), and 3) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to Agouti. Background strain: F344/Stm National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm Asip|Kit|Tyr 2003|620568|1589755 3;14;1 145445175;34906043;143641257 145536831;34984819;143746315 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 14;3;1 34901860;156860395;157322968 34979384;156949277;157416594 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 3;14;1 150492010;35072131;151012598 150579870;35149638;151106802 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 11040977 WI-ROSA26^{em1(CAG-EGFP)Kyo} CAG-GFP vector was knock-in into the rat Rosa26 locus by CRISPR/Cas9 system. Background strain: Crlj:WI National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2017-08-08) 11040980 W-Dmd^em2Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-05-02) Dmd 2507 X 71501362 71671414 1 - by flanking markers X 51475950 53700033 1 - by flanking markers X 51149358 53519271 1 - by flanking markers 11040985 W-Dmd^em3Kykn By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: Deletion of exon3 to exon16 (a part of intron 3 remain). This straindied out in 2015. National BioResource Project for the Rat in Japan mutant Extinct (as of 2017-05-02) Dmd 2507 X 71501362 71671414 1 - by flanking markers X 51475950 53700033 1 - by flanking markers X 51149358 53519271 1 - by flanking markers 11040987 WIC-Tg(Nanog-YFP*)1Utr BAC (containing rat Nanog gene) vector was injected into Iar:Wistar-Imamichi rats. The construct is as follows: Venus-IRES-puromycin resistance gene. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-21) Nanog 1303178 11041106 LE-Tg(Pvalb-tTA)15Hio background strain #65306; Long-Evans rat #65288; Iar:Long-Evans #65289; Transgene #65306; (1) Parvalbumin (PV) promoter #65306; mouse derived (MGI:97821). PV is calcium-binding protein. (2) tetracycline transactivator (tTA) #65306; Fusion protein of tetracycline repressor (Escherichia coli-derived) and VP16 (Herpes simplex virus-derived). In the absence of Doxycycline (Dox), tTA binds to tetracycline-responsive element (TRE) and expression of TRE-controlled genes can be induced. Vector #65306; pBlueScript (Stratagene), pBACe3.6 (CHORI) National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm 11041108 CV/Iet The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm 11041128 TM.KDP-Cblb(D9Rat13-D9Rat4)(D12Rat5-D12Rat45)(D18Mit9-D18Rat44)/Nyo The Cblb mutation, one of the causative gene in type 1 diabetes of KDP/Tky and KDP alleles in other modifier genes were transferred onto the genetic background of TM:Kyo strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm Diabetes Obesity Cblb 620535 11041139 F344-Tg(Dct-lacZ)9Kyo The construct was made by connecting a 3,659 bp DNA fragment of rat Dct (dopachrome tautomerase) gene (5'-3237 to 422) with the upstream of lacZ gene. Dct gene was derived from F344/Stm. Background strain: F344/NSlc, plasmid: pLacZ-Basic (Clontech Laboratories) National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm Development Dct 1564975 11041143 PL/Iet A new mutant gene that causes preaxial polydactyl in the hindlimbs was found in the Jcl:Wistar -derived strain of rats with fused pulmonary lobes (FRL) at the Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology . Genetic analysis has revealed that the new mutation is not closely linked with the fpl gene. This strain was established by sib mating (over 20 generations). National BioResource Project for the Rat in Japan inbred Cryopreserved Sperm Development 11049145 SD-Crh^em1Ionsz CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh. Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Crh^em1Ionsz 11049142 2 104764023 104765887 1 - by flanking markers 2 124182919 124184783 1 - by flanking markers 2 104459999 104461863 1 - by flanking markers 11073612 SS-Chr 13^BN-Mir29b^em1Mcwi This strain was produced by injecting TALENs targeting the sequence TTTAAATAGTGATTGTCtagcaccatttgaaaTCAGTGTTCTTGGTGGA into SS-Chr 13BN/mcwi rat embryos. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequence PhysGen Knockouts mutant Live Animals (as of 2017-01-26) Mir29b1^em1Mcwi 11073608 4 58100053 58100133 1 - by flanking markers 4 58344310 58344390 1 - by flanking markers 11073719 SD-Drd1^em1Ionsz CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. Institute of Neuroscience, Chinese Academy of Sciences mutant Unknown Drd1^em1Ionsz 11073717 17 16655926 16658161 1 - by flanking markers 17 13211031 13215581 1 - by flanking markers 17 11099736 11104352 1 - by flanking markers 11081142 SD-Pgr^em1Soar Crispr/Cas9 targeting of Exon 3 of rat Pgr gene resulting in a deletion of Exon3 Rat Resource and Research Center mutant Unknown reproduction, neurobiology, and cancer Pgr 3317 8 5784717 5845901 1 - by flanking markers 8 7113895 7172761 1 - by flanking markers 8 7128656 7187796 1 - by flanking markers 11081149 SD-Esr2^em1Soar Zinc finger nuclease targeting of exon 4 of the rat estrogen receptor-2 gene resulting in the deletion of exon 4 Rat Resource and Research Center mutant Unknown reproduction Esr2^em1Soar 40902840 6 98691167 98775299 1 - by flanking markers 6 108576398 108626196 1 - by flanking markers 6 99163953 99214711 1 - by flanking markers 11081151 WI-Grm8^em1Geh CRISPR/Cas9 induced 29 base pair deletion in exon 1 Rat Resource and Research Center mutant Unknown neurologic medications, neurologic diseases, normal brain functions Grm8 619858 4 53976781 54902331 1 - by flanking markers 4 54226315 55151544 1 - by flanking markers 4 54474344 55409526 1 - by flanking markers 11081153 SD-Tg(DIO--iRFP)9Ottc The transgene contains Cre recombinase reporter rat expressing the red fluorescent protein gene (iRFP) driven by the EF1 alpha promoter. Optogenetics and Transgenic Technology Core, Rat Resource and Research Center transgenic Live Animals (as of 2019-02-26) 11081177 F344^tl toothless (tl) A spontaneous tooth less mutation was maintained in inbred Fisher colony maintained at the University of Massachusetts Medical School. The homozygous mutant is a 10-bp insertion near the beginning of the open reading of the Csf1 gene that yields a truncated, nonfunctional protein and an early stop codon. Rat Resource and Research Center mutant Unknown skeletal and osteoclast biology Csf1^tl 12910954 2 203292765 203307968 1 - by flanking markers 2 229989430 230017945 1 - by flanking markers 2 210522370 210550546 1 - by flanking markers 11084925 SD-Tg(CD59-HBA1)Bryd Transgene: human CD59 gene (cDNA) under control of alpha-globin regulatory elements (alpha-globin promoter and alpha hemoglobin locus control region). Upon administration of intermedilysin (ILY), cells expressing human CD59 will be selectively ablated Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-01-26) intravascular hemolysis and related sequelae of anemia, hemoglobinemia, and hemoglobinuria CD59 736600 11084928 WKY-Jund^em1Tja The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) leukemia, breast cancer Jund^em1Tja 11084926 16 19239694 19241529 1 - by flanking markers 16 20342096 20343775 1 - by flanking markers 16 20485028 20486707 1 - by flanking markers 11084931 SD-Tg(RIP7-RLuc-YFP)Vpoit Transgene: RIP7-RLuc-YFP. This transgene expresses a renilla luciferase-YFP fusion protein under control of the rat insulin 2 gene promoter (RIP7). Rat Resource and Research Center transgenic Unknown 11087549 LE-Tg(GFAP-TK)Hcam random insertion of human GFAP promoter driving herpes simples virus thymidine kinase Rat Resource and Research Center transgenic Unknown neurogenesis 11087551 SD-Il15^em1Soar Zinc finger nuclease mediated 7bp deletion within exon 2 of the Il15 gene, resulting in a frameshift and premature stop codon. Rat Resource and Research Center mutant Unknown Il15|Il15^em1Soar 2887|12910491 19 27487268 27498973 1 - by flanking markers 19 34532033 34598725 1 - by flanking markers 19 23542606 23624366 1 - by flanking markers 11087553 SD-Mmp12^em1Soar TALEN mediated 664 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2017-08-10) allergy and lung responses and blood coagulation Mmp12|Mmp12^em1Soar 620195|12910500 8 4249938 4259675 1 - by flanking markers 8 5610392 5620294 1 - by flanking markers 8 5594717 5616494 1 - by flanking markers 11354901 SS.SHR-(D9Mco110-D9Mco124)/Bj This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 89709209 1 - by flanking markers 9 94881322 97361568 1 - by flanking markers 9 95162214 97679852 1 - by flanking markers 11354903 SS.SHR-(D9Mco110-D9Mco121)/Bj This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 89541777 1 - by flanking markers 9 94881322 97223353 1 - by flanking markers 9 95162214 97532584 1 - by flanking markers 11354924 SS.SHR-(D9Mco113-D9Mco124)/Bj This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. University of Toledo College of Medicine and Life Sciences congenic Unknown 9 87225627 89709209 1 - by flanking markers 9 95118069 97361568 1 - by flanking markers 9 95430880 97679852 1 - by flanking markers 11354926 SS.SHR-(D9Mco110-D9Got111)/Bj This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 89249893 1 - by flanking markers 9 94881322 96967940 1 - by flanking markers 9 95162214 97276310 1 - by flanking markers 11354928 SS.SHR-(D9Mco110-D9Mco114)/Bj This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. University of Toledo College of Medicine and Life Sciences congenic Unknown 9 86987972 87252238 1 - by flanking markers 9 94881322 95143906 1 - by flanking markers 9 95162214 95162463 1 - by flanking markers 11354930 SS.SHR-(D9Mco115-D9Mco124)/Bj This is a congenic substrain developed by crossing SS.SHR-(D9Rat7-D9Rat84)/Mco to SS/Jr and the F1 were intercrossed to produce an F2 population,which was genotyped using microsatellite markers. The selected recombinant rats were crossed to SS/Jr again to duplicate the recombinant region. University of Toledo College of Medicine and Life Sciences congenic Unknown 9 89708990 89709209 1 - by flanking markers 9 95727999 97361568 1 - by flanking markers 9 96024146 97679852 1 - by flanking markers 11528524 LE-Tg(Slc17a6-icre)3Ottc The BAC-based transgene contains Cre recombinase is expressed from rat Slc17a6 promoter. Optogenetics and Transgenic Technology Core transgenic Extinct (as of 2019-02-01) 11528588 SHR.LEW-(D4Rat76-D4Mgh11) This congenic strain contains a LEW chromosome 4 segment containing a QTL affecting anxiety-related response transferred to the SHR background. Laboratorio de Genetica do Comportamento, Departamento de Biologia Celular, Embriologia e Genetica, Centro de Ciencias Biologicas, Universidade Federal de Santa Catarina, Florianopolis, Santa Catarina, Brazil congenic Unknown 4 84886545 171204531 1 - by flanking markers 4 150964994 230565226 1 - by flanking markers 4 86312589 168047091 1 - by flanking markers 11530008 CDS.CDR-(D4Rat9-D4Rat153)/Ygl This CDS congenic containing genomic elements from CDR was created by crossing the consomic strain CDS-Chr 4CDR/Ygl(RGD:4889499) with CDS. The congenic carries QTL affecting diabeties initation. Laboratory for Molecular Medicine and Israeli Rat Genome Center Barzilai University Med Ctr Campus 2 Hahistadrut St Ashkelon 78278, Israel congenic Unknown 4 23537363 23537525 1 - by flanking markers 4 23916923 23917084 1 - by flanking markers 4 23991721 23991882 1 - by flanking markers 11530011 CDS.SBN-(D13Rat85-D13Mit4)/Ygl This CDS congenic containing the genomic element from SBN/Ygl was created by crossing the SBN/Ygl with CDS. The congenic carries QTL affecting diabeties development. Laboratory for Molecular Medicine and Israeli Rat Genome Center Barzilai University Med Ctr Campus 2 Hahistadrut St Ashkelon 78278, Israel congenic Unknown 13 72141292 90551272 1 - by flanking markers 13 79488981 97381801 1 - by flanking markers 13 74568378 92916783 1 - by flanking markers 11530028 NP/Iusm-Npy^em6Sage These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Npy into NP/Iusm embryos. A 26-bp deletion, including 6 bp in intron 1 and 20 bp in exon 2 in rat Npy was created in the mutant founders. These mutant founders were backcrossed with NP/Iusm to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. Department of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USA mutant Unknown Npy^em6Sage 11530022 4 78038013 78045187 1 - by flanking markers 4 144233753 144240956 1 - by flanking markers 4 79557856 79565059 1 - by flanking markers 11531089 SD-F8^em1Sage+/-/Novo The heterozygous ZFN mutant rats were produced by backcrossing mutant founders (SD/Novo-F8^em1Sage) with Sprague Dawley. Genotyping of the offspring was carried out by PCR amplification of the deletion fragment which caused a premature translation stop. Novo Nordisk, Maaloev, Denmark mutant Unknown F8^em1Sage 11531096 18 121134 162008 1 - by flanking markers 18 413447 444491 1 - by flanking markers 18 367862 399242 1 - by flanking markers 11531091 SD-F8^em1Sage-/-/Novo The homozygous F8 mutant rats were produced by intercrossing the heterozygous ZFN mutants (SD-F8^em1Sage+/-/Novo) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of the deletion fragment which caused a premature translation stop. Novo Nordisk, Maaloev, Denmark mutant Unknown F8^em1Sage 11531096 18 121134 162008 1 - by flanking markers 18 413447 444491 1 - by flanking markers 18 367862 399242 1 - by flanking markers 11531094 SD-F8^em1Sage/Novo These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat F8 into Sprague Dawley embryos. A premature translation stop in rat F8 was created in the mutant founders carrying a 13-bp deletion in exon 16. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. Novo Nordisk, Maaloev, Denmark mutant Unknown F8^em1Sage 11531096 18 121134 162008 1 - by flanking markers 18 413447 444491 1 - by flanking markers 18 367862 399242 1 - by flanking markers 11531104 NP/Iusm-Npy^em6Sage+/- The heterozygous ZFN mutant rats were produced by backcrossing mutant founders (NP/Iusm-Npy^em6Sage) with NP/Iusm. Genotyping of the offspring was carried out by PCR amplification of a 26-bp deleted fragment. Department of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USA mutant Unknown Npy^em6Sage 11530022 4 78038013 78045187 1 - by flanking markers 4 144233753 144240956 1 - by flanking markers 4 79557856 79565059 1 - by flanking markers 11531106 NP/Iusm-Npy^em6Sage-/- The homozygous Npy mutant rats were produced by intercrossing the heterozygous ZFN mutants (NP/Iusm-Npy^em6Sage+/-) to produce homozygous and heterozygous offspring. Genotype of the homozygous offspring was confirmed by PCR amplification of a 26-bp deleted fragment. Department of Gastroenterology, Indiana University School of Medicine, Indianapolis, IN 46202, USA mutant Unknown Npy^em6Sage 11530022 4 78038013 78045187 1 - by flanking markers 4 144233753 144240956 1 - by flanking markers 4 79557856 79565059 1 - by flanking markers 11532753 F344.ZUC-(Lepr^fa),OLETF-(D5Rat166-D5Rat90)/Tj The F344.ZUC,OLETF double congenic was produced by crossing F344.ZUC-Lepr^fa with F344.OLETF-( D5Rat166-D5Rat90) and then selecting Lepr^fa -Niddm24 (fa/fa-Nidd6/of) homozygotes National BioResource Project for the Rat in Japan congenic Unknown Diabetes Obesity 11535000 PKD/Mhm PKD The colony of inbred PKD/Mhm rats was established in the laboratory in Mannheim after 18 additional generations of inbreeding of the Han:SPRD (cy/+).The mutation was a C to T transition that replaces an arginine by a tryptophan at amino acid 823 in the protein sequence. Medical Research Centre, Klinikum Mannheim, University of Heidelberg, Mannheim, Germany inbred Unknown (as of 2016-11-29) Anks6^PKD 11534996 11535031 SD-Tg(hCMV-Anks6^PKD)Mhm This transgenic strain was derived by pronuclear microinjection of fertilized Sprague Dawley oocytes with a 2.8-kb mutated Anks6^PKD cloned between a human cytomegalovirus promoter upstream and an intron as well as a polyadenylation signal of SV40 downstream. Medical Research Centre, Klinikum Mannheim, University of Heidelberg, Mannheim, Germany transgenic Unknown (as of 2016-11-29) Anks6^PKD 11534996 11535955 Crlj:CD(SD) A colony of outbred CD(SD) (RGD: 734476) maintained in the Charles River Laboratories Japan. Charles River Laboratories outbred Unknown 11553848 WKY-Trpv4^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 4 of the Trpv4 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Trpv4^em5Mcwi 11553847 12 43226933 43265889 1 - by flanking markers 12 49492064 49529956 1 - by flanking markers 12 47698915 47737902 1 - by flanking markers 11553850 WKY-Trpv4^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-22) Trpv4^em4Mcwi 11553851 12 43226933 43265889 1 - by flanking markers 12 49492064 49529956 1 - by flanking markers 12 47698915 47737902 1 - by flanking markers 11553852 SS-Vnn1^em2Mcwi CRISPR/Cas9 system and ssODN was used to introduce a N131S mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-10) Vnn1^em2Mcwi 11553853 1 22087290 22097592 1 - by flanking markers 1 24089365 24099667 1 - by flanking markers 1 22614832 22625134 1 - by flanking markers 11553855 SS-Vnn1^em1Mcwi CRISPR/Cas9 system was used to introduce a 7-bp deletion mutation in the Vnn1 gene of SS/HsdMcwiCrl rat embryos MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-10) Vnn1^em1Mcwi 11553856 1 22087290 22097592 1 - by flanking markers 1 24089365 24099667 1 - by flanking markers 1 22614832 22625134 1 - by flanking markers 11553858 SS-Rbm20^em5Mcwi ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 121-bp deletion in Exon 2 of the Rbm20 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Rbm20^em5Mcwi 11553857 1 259905545 260144190 1 - by flanking markers 1 281783646 282003053 1 - by flanking markers 1 274391932 274589816 1 - by flanking markers 11553860 DA-Scn5a^em2Mcwi ZFN system was used to introduce a mutation in the Scn5a gene of DA/MolTac rat embryos. The resulting mutation is a 110-bp deletion in Exon 4 of the Scn5a gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Scn5a^em2Mcwi 11553859 8 124446479 124545301 1 - by flanking markers 8 127375781 127471879 1 - by flanking markers 8 128169191 128266681 1 - by flanking markers 11553862 SS-Shc1^em1Mcwi ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion in Exon 2 of the Shc1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Shc1^em1Mcwi 11553854 2 181616581 181628144 1 - by flanking markers 2 208159786 208171348 1 - by flanking markers 2 188745503 188757066 1 - by flanking markers 11553873 LE-Fmr1^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp insertion in exon 8 of the Fmr1 gene. Generated with support from the Simons Foundation Autism Research Initiative (SFARI ); MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2016-10-18) Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) Fmr1^em2Mcwi 11553872 X 154756031 154793782 1 - by flanking markers 1 150408220 150445658 1 - by flanking markers X 154684924 154722369 1 - by flanking markers 11553875 LE-Fmr1^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp deletion in exon 8 of the Fmr1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2016-10-18) Fmr1^em4Mcwi 11553874 X 154756031 154793782 1 - by flanking markers 1 150408220 150445658 1 - by flanking markers X 154684924 154722369 1 - by flanking markers 11553877 SS-P2rx1^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 24-bp deletion in Exon 1 of the P2rx1 gene. MCW Gene Editing Rat Resource Center mutant Extinct (as of 2017-07-18) P2rx1^em1Mcwi 11553876 10 59889933 59904985 1 - by flanking markers 10 59305737 59320797 1 - by flanking markers 10 59566268 59581328 1 - by flanking markers 11553881 SS-Rbm20^em10Mcwi ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of the Rbm20 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Rbm20^em10Mcwi 11553880 1 259905545 260144190 1 - by flanking markers 1 281783646 282003053 1 - by flanking markers 1 274391932 274589816 1 - by flanking markers 11553883 SS-Rbm20^em8Mcwi ZFN system was used to introduce a mutation in the Rbm20 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 58-bp deletion in Exon 2 of the Rbm20 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Rbm20^em8Mcwi 11553882 1 259905545 260144190 1 - by flanking markers 1 281783646 282003053 1 - by flanking markers 1 274391932 274589816 1 - by flanking markers 11553886 SD-Tp53^em3Mcwi ZFN system was used to introduce a mutation in the Trp53 gene of Crl:SD rat embryos.The resulting mutation is a 84-bp deletion in Exon 3 of the Tp53 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Tp53^em3Mcwi 11553885 10 56399721 56411150 1 - by flanking markers 10 55932658 55944087 1 - by flanking markers 10 56186299 56198449 1 - by flanking markers 11553889 SS-Trpc3^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 25-bp deletion in Exon 2 of the Trpc3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm; Cryorecovery (as of 2018-10-10) Trpc3^em2Mcwi 11553887 2 123117180 123184016 1 - by flanking markers 2 142945309 143022844 1 - by flanking markers 2 123329954 123467574 1 - by flanking markers 11553892 SS-Trpc3^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpc3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the Trpc3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-10) Trpc3^em1Mcwi 11553891 2 123117180 123184016 1 - by flanking markers 2 142945309 143022844 1 - by flanking markers 2 123329954 123467574 1 - by flanking markers 11553894 SS-Tpcn2^em1Mcwi ZFN system was used to introduce a mutation in the Tpcn2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-26) Tpcn2^em1Mcwi 11553893 1 205702971 205732664 1 - by flanking markers 1 225286480 225316685 1 - by flanking markers 1 218419182 218448902 1 - by flanking markers 11553896 SHRSP-Spp1^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Spp1^em1Mcwi 11553895 14 6653086 6658937 1 - by flanking markers 14 6673686 6679965 1 - by flanking markers 11553899 WKY-Trpv2^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-26) Trpv2^em1Mcwi 11553898 10 48764894 48786150 1 - by flanking markers 10 48686500 48707996 1 - by flanking markers 10 48903540 48925036 1 - by flanking markers 11553902 SS-Trpc6^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-07-18) Trpc6^em3Mcwi 11553901 8 5472515 5577537 1 - by flanking markers 8 6799564 6904623 1 - by flanking markers 8 6811543 6917534 1 - by flanking markers 11553904 SS-Shc1^em3Mcwi ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in Exon 1 of the Shc1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Shc1^em3Mcwi 11553903 2 181616581 181628144 1 - by flanking markers 2 208159786 208171348 1 - by flanking markers 2 188745503 188757066 1 - by flanking markers 11553908 SS-Trpc6^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-26) Trpc6^em4Mcwi 11553907 8 5472515 5577537 1 - by flanking markers 8 6799564 6904623 1 - by flanking markers 8 6811543 6917534 1 - by flanking markers 11553912 SS-Trpc6^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp insertion in Exon 2 of the Trpc6 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-26) Trpc6^em1Mcwi 11553911 8 5472515 5577537 1 - by flanking markers 8 6799564 6904623 1 - by flanking markers 8 6811543 6917534 1 - by flanking markers 11553914 SS-Shc1^em4Mcwi ZFN system was used to introduce a mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in Exon 2 of theShc1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2017-01-26) Shc1^em4Mcwi 11553913 2 181616581 181628144 1 - by flanking markers 2 208159786 208171348 1 - by flanking markers 2 188745503 188757066 1 - by flanking markers 11553916 SS-Shc1^em5Mcwi ZFN system was used to introduce a T>G transversion mutation in the Shc1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a substitution to generate S36A in Exon 2 of theShc1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-25) Shc1^em5Mcwi 11553915 2 181616581 181628144 1 - by flanking markers 2 208159786 208171348 1 - by flanking markers 2 188745503 188757066 1 - by flanking markers 11554327 BDIX.BDIV-D10Mit3-D10Mgh16/Zte The BDIX.BDIV-D10Mit3-D10Mgh16/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Live Animals (as of 2016-10-26) 11554329 BDIX.BDIV-D10Got1-D10Rat45/Zte The BDIX.BDIV-D10Got1-D10Rat45/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Live Animals (as of 2016-10-26) 11556280 ACI.Cg-Du/Kyo Downunder (Du) mutation is introduced into ACI/Kyo strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-10) Development 11556282 WKY-Tg(UBC-sb10)3Wmukf This strtain has transgene that express SleepingBeauty transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown) National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-10) 11561897 Crl:WI-Lrap^em1Geh The CRISPR/Cas9 genome editing system was used to generate this knockout mutant rat strain. It created a 618-bp deletion in rat Lrap gene. The recipient zygotes were the Wistar rats from Charles River. University of Colorado mutant Unknown behavior, addiction Lrap^em1Geh 11561896 12 40910874 40918231 1 - by flanking markers 12 39016258 39017876 1 - by flanking markers 11561902 WKY-Tg(UBC-pb)5Wmukf This strtain has transgene that expresses piggyBac transposase under human Ubiquitin-C promoter. (insertion site of trans gene: unknown) National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-10) 11561905 WKY-Tg(Gabrb1^{Tn(pb-Bhr2)1Wmukf}) Transposed "Bhr2" was inserted into intron 4 of Gabrb1 gene by piggyBac (pb) transposon system. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-10) Gabrb1|Gabrb1^{Tn(pb-Bhr2)1Wmukf} 2649|11561925 14 38530259 39005615 1 - by flanking markers 14 38453142 38924073 1 - by flanking markers 14 38631192 39112598 1 - by flanking markers 11561909 WKY-Tg(Samt4^{Tn(pb-Bhr7)1Wmukf}) Transposed "Bhr7" was inserted into the first Met-coding exon region of rat Samt4 gene by piggyBac (pb) transposon system. National BioResource Project for the Rat in Japan transgenic Extinct (as of 2016-11-10) Samt4^{Tn(pb-Bhr7)1Wmukf} 11561928 11561966 LE.AR-Ednrb^sl/Hkv Aganglionosis rat This strain was derived from LE.AR-Ednrbsl/Okkm (NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm) provided by Dr. Dr.Ozaki to Dr. Agui at Hokkaido University. Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan, National BioResource Project for the Rat in Japan congenic Unknown (as of 2016-11-15) Internal Medicine 11561970 WKY-Tg(Zbtb20^{Tn(pb-Bhr7)1Wmukf}) Transposed "Bhr7" was inserted into the Intron 3 of Zbtb20 gene by piggyBac (pb) transposon system. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-15) Zbtb20^{Tn(pb-Bhr7)1Wmukf} 11561972 11561976 WKY-Tg(Plcb1^{Tn(pb-Bhr2)1Wmukf}) Transposed "Bhr2" was inserted into into Plcb1 gene by piggyBac (pb) transposon system. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-15) Plcb1^{Tn(pb-Bhr2)1Wmukf} 11561974 11561979 LE-Tg((ROSA26)Sor-CAG-tdTomato)9Jfhy Background strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien(UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato(Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9) National BioResource Project for the Rat in Japan transgenic Unknown (as of 2016-11-16) 11564343 LE-Tg((ROSA26)Sor-CAG-tdTomato)14Jfhy Background strain: Long-Evans (Institute for Animal Reproduction); pRSET-B tdTomato is provided by Dr. Roger Tsien (UCSD); Transgene: CAG promoter (CMV virus, chicken), tdTomato (Discosoma sp.); BAC clone: mouse ROSA26 BAC (RP23-244D9) National BioResource Project for the Rat in Japan transgenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2016-11-16) 11564346 F344-Aspa^em31Kyo The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-16) Aspa^em31Kyo 11564344 10 60178509 60199207 1 - by flanking markers 10 59578788 59627450 1 - by flanking markers 10 59839693 59888244 1 - by flanking markers 11564349 F344-Aspa^em34Kyo The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 16-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-16) Aspa^em34Kyo 11564348 10 60178509 60199207 1 - by flanking markers 10 59578788 59627450 1 - by flanking markers 10 59839693 59888244 1 - by flanking markers 11564350 SCR/Sscr Shumiya Cataract Rat Genetic Cataract rat SCR（Shumiya Cataract Rat）was segrigated from a SHR-fa strain colony that developed nuclear cataract at adult stage. This strain is a double mutant caused by recessive gene (ctr1) and dominant lethal gene (Ctr2l) and established by Dr. Shumiya at Tokyo Metropolitan Institute of Gerontology. In 2003, this strain was introduced to Kyoritsu College of Pharmacy (keio University Faculty of Pharmacy). ctr1 is lanosterol synthase (Lss) and Ctr2 is farnesyl diphosphate farnesyl transferase 1 (Fdft1). congenic Cryopreserved Embryo (as of 2016-11-16) Fdft1|Lss 61834|620955 11565091 F344-Ccdc85c^em1Kyo TALEN targeting the exon1 of rat Ccdc85c gene was designed and mRNA coding these TALEN was microinjected into F344/Stm embyo. Rats developed hydrocephalus and Subcortical heterotopia. Homozygous rats die within 1 month of hydrocephalus. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-18) Ccdc85c^em1Kyo 11565090 6 132572485 132641431 1 - by flanking markers 6 141284186 141353658 1 - by flanking markers 6 132113806 132183434 1 - by flanking markers 11565094 F344.LEC-(D4Nirs8-D4Nirs2)/Nrs This strain was established by crossing F344.LEC-xhs1/1Nrs (NBR-rat #0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is similar to F344.LEC-xhs1/1Nrs. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-18) 11565097 F344.LEC-(D4Rat54-D4Got87)/Nrs This strain was established by crossing F344.LEC-xhs1/1Nrs (NBRrat NO: 0293)(RGD:2304293) with F344/NSlc (RGD:1302627). The radiation sensitivity level of this strain is different from F344.LEC-xhs1/1Nrs. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2016-11-18) 11565100 NMC/Nrs This strain was found in a colony of F344.LEC-xhs1/1Nrs (NBRP Rat No: 0293). As to radiosensitivity gene, D4Nirs8-D4Rat45 region is LEC type. Affected females with dominant gene on Chr10 develop mammary gland cancer after pregnancy (histological type is undetermined). In many cases, this neoplastis lesion resolve spontaneously after delivery. No homozygous female is obtained at this time. Affected male rats don't show any phenotype. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2016-11-18) 11565116 LE-Tg(Chat-tdTomato)3Yyan Chat-tdToamto-polyA-FRT sequence was inserted into fertilized egg of Long Evans strain (Japan SLC). vector: BAC clone (RP23-246B12) from a C57BL/6J mouse genomic BAC library (BACPAC Resource Center, Oakland, CA, USA) National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2016-11-21) 11565122 SHR.Cg-Lepr^cp-Tg(APOB)110/Dmcr A BAC clone (CTD-2257F14) containing whole human APOB gene was maicroinjected into fertilized eggs of Wistar rats (Takeda Pharmaceutical Company). Then this Tg rats were backcrossed 9 times with SHR/NDmcr-cp rats (NBRP No.0446, SHR.Cg-Leprcp/NDmcr)(RGD: 2306033) National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2016-11-21) Lepr^cp 11570565 11565125 SHRSP.SHR-(D18Rat87-D18Got66)/Izm A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) 18 66217583 80805774 1 - by flanking markers 18 64552961 80162163 1 - by flanking markers 18 65366908 81115720 1 - by flanking markers 11565128 SHRSP.SHR-(D18Rat73-D18Rat52)/Izm A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) 18 52290789 61290878 1 - by flanking markers 18 50804228 59735418 1 - by flanking markers 18 51609032 60532087 1 - by flanking markers 11565130 SHRSP.SHR-(D1Rat23-D1Rat213)/Izm A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) Diabetes Obesity 1 78685103 81548909 1 - by flanking markers 1 81497710 84537228 1 - by flanking markers 1 80231217 83282814 1 - by flanking markers 11565132 SHRSP.SHR-(D1Rat95-D1Got87)/Izm A congenic strain made by introducing a segments of chromosome 1 from SHR/Izm into SHRSP/Izm National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2016-11-21) Diabetes Obesity 1 66832211 85828306 1 - by flanking markers 1 73096563 92291485 1 - by flanking markers 1 71706292 91156803 1 - by flanking markers 11565135 WKY.SHRSP-(D1Rat25-St8sia2)/Izm A congenic strain established by introducing segments of chromosome 1 from SHRSP/Izm into WKY/Izm. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Unknown (as of 2016-11-21) St8sia2 621843 1 72231246 129191810 1 - by flanking markers 1 67633807 136423629 1 - by flanking markers 1 66845268 135406699 1 - by flanking markers 11565826 F344-Ttn^em1Sage These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a 12-bp deletion and a 2-bp insertion (TA) at 228,608-228,619 (Rnor_5.0) to introduce a stop codon in exon 303, corresponding to exon 327 in the human sequence. Duke-National University of Singapore, Singapore mutant Unknown (as of 2016-11-28) Ttn^em1Sage 11565825 3 59404023 59665308 1 - by flanking markers 3 70138896 70408647 1 - by flanking markers 3 63565160 63837815 1 - by flanking markers 11565829 F344-Ttn^em2Sage These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Ttn into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of exons 2-6 (5,286-bp deletion, coordinates 2,323-7,608) to introduce a frameshift (Rnor_5.0). Duke-National University of Singapore, Singapore mutant Unknown (as of 2016-11-28) Ttn^em2Sage 11565827 3 59404023 59665308 1 - by flanking markers 3 70138896 70408647 1 - by flanking markers 3 63565160 63837815 1 - by flanking markers 11567272 SD-Mecp2^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Mecp2 into Sprague Dawley embryos. This mutant rat has a knockout of the methyl CpG binding protein 2 (Mecp2). Horizon Discovery mutant Live Animals (as of 2016-12-13) Autism, Rett syndrome, Cognition Mecp2^em1Sage 11568035 X 159980599 160035260 1 - by flanking markers 1 152390961 152461647 1 - by flanking markers X 156650389 156713813 1 - by flanking markers 11568040 SD-Fmr1^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. This mutant rat has a knockout of Fmr1. Horizon Discovery mutant Live Animals (as of 2017-05-09) Autism, Fragile X syndrome Fmr1^em1Sage 11568041 X 154756031 154793782 1 - by flanking markers 1 150408220 150445658 1 - by flanking markers X 154684924 154722369 1 - by flanking markers 11568058 SD-Nrxn1^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nrxn1 into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in exon1 resulting in knockout of Nrxn1. Horizon Discovery mutant Live Animals (as of 2018-03-22) Autism, Schizophrenia Nrxn1^em1 11568059 6 14050929 15354069 1 - by flanking markers 6 23843153 25145167 1 - by flanking markers 6 13886757 15191660 1 - by flanking markers 11568062 SD-Pten^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Pten into Sprague Dawley embryos. This mutant rat has a 7-bp deletion in exon7 resulting in knockout of Pten. Horizon Discovery mutant Live Animals (as of 2016-12-13) Autism, cancer Pten^em1Sage 11568063 1 236771027 236837261 1 - by flanking markers 1 258651829 258717009 1 - by flanking markers 1 251421814 251487634 1 - by flanking markers 11568067 SD-Grm5^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Grm5 into Sprague Dawley embryos. The resulting mutation was a knockout of Grm5 demonstrated by western blot. Horizon Discovery mutant Live Animals; Cryopreserved Embryo (as of 2016-12-13) Autism, Fragile X syndrome, Cognition, Schizophrenia, Anxiety, Pain Grm5^em1Sage 11568068 11568071 SD-Met^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a a-17 base pair deletion in exon 8 of Met. Horizon Discovery mutant Cryopreserved Embryo (as of 2016-12-07) Autism Spectrum Disorders, Synaptic Plasticity, Autoimmune disorders Met^em1Sage 11568072 4 43134183 43211355 1 - by flanking markers 4 45354290 45461638 1 - by flanking markers 4 44747467 44854628 1 - by flanking markers 11568646 SD-Cntnap2^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Met into Sprague Dawley embryos. The resulting mutation was a 5-bp deletion in exon 6 of Cntnap2. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. Horizon Discovery mutant Live Animals (as of 2017-05-05) Autism Spectrum Disorders, Synaptic Plasticity, Language disorders Cntnap2^em1Sage 11568647 4 74277978 75440178 1 - by flanking markers 4 140006078 141697964 1 - by flanking markers 4 74700539 77025463 1 - by flanking markers 11568700 SD-Nlgn3^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. Homozygous knockout rats exhibit complete loss of target protein as demonstrated by Western blot. Horizon Discovery mutant Live Animals; Cryopreserved Embryo (as of 2016-12-13) Autism, Asperger's syndrome, Synaptic plasticity Nlgn3^em1Sage 11568701 X 89376193 89398665 1 - by flanking markers X 72051846 72075119 1 - by flanking markers X 71199390 71227460 1 - by flanking markers 11568703 SD-Cacna1c^em1Sage The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Nlgn3 into Sprague Dawley embryos. This model contains 4-bp deletion at 460,649 to 460,652 bp in genomic sequence resulting in an early stop codon in exon 6. Horizon Discovery mutant Cryopreserved Embryo (as of 2016-12-13) Autism, Timothy syndrome, Long QT syndrome, Schizophrenia,Bipolar disorder Cacna1c^em1Sage 11568704 4 154895691 155517389 1 - by flanking markers 4 216562477 217184927 1 - by flanking markers 4 150635808 151270790 1 - by flanking markers 11667072 Sway/Rrrc This phenotype arose spontaneously during the third generation of selective breeding for decreased intravenous drug self-administration in Wistar rats (see RGD:6482259). After 10 weeks of age no drug administration is needed to see phenotype in which animals exhibits motor abnormalities with degenerative changes in cerebellar Purkinje cells. It appears to be transmitted in an autosomal recessive pattern. Animals have an abnormal swaying gait, which is readily identified as a slow (2 to 3 cycles per second) tremor. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 11667077 SD-Esr2^em2Soar Zinc finger nuclease targeting of exon 3 of the rat estrogen receptor-2 gene resulting in the deletion of exon 3. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) reproduction, neu7roscience, environmental healthg, cardiovascular 11667079 SD-Pgr^em2Soar zinc finger nucleases were used to generate a 136 bp deletion within the first exon of the progesterone receptor, resulting in a frameshift, premature stop codon, and a null. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) Reproduction, neuroscience, environmental health, cardiovascular 11667081 BDIV-Myo5a/StcRrrc Point mutation in Myo5a (Chromosome 8, end of exon 4)identified in In Berlin-Druckrey (BDIV) shaker rats Rat Resource and Research Center inbred Cryopreserved Sperm (as of 2017-01-26) Myo5a^m1Stc 42721971 11667084 W^Cat Wistar Cataract Rat ENU induced total juvenile cataract in inbred Wistar. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) 11667088 SD-Esr1^em1Soar zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-01-26) A range of experimentation examining the actions of estrogen in reproduction, cancer, cardiovascular, and neurobiology. Esr1^em1Soar 12910736 1 35523680 35759891 1 - by flanking markers 1 42534049 42935434 1 - by flanking markers 1 41192029 41594799 1 - by flanking markers 11667094 W-Tg(CFH)Crl micro-injected with a ~6 kb transgenic cassette, which contained a CMV enhancer, chicken beta-actin promoter, the full-length cDNA encoding human complement factor H, and a rabbit beta-globin poly(A) sequence that had been isolated and purified from plasmid pCAGGS-human fH. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-01-26) 11667096 WIST-Tulane Tulane rat Male Wistar rats with inbred congenital unilateral right hydronephrosis were bred from the colony described in 1979 by Friedman et al. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-26) 12437069 SS.BN-(D13Rat25-rs198199323)-Btg2^em21Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Btg2 gene of SS.BN-(D13Rat25-rs198199323)/Mcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-26) Btg2^em21Mcwi 12798564 13 47026986 47030745 1 - by flanking markers 13 55966299 55970058 1 - by flanking markers 13 50913185 50916944 1 - by flanking markers 12437071 SS.BN-(D13Rat25-rs198199323)-Btg2^em24Mcwi CRISPR/Cas9 system was used to introduce a 2-bp insertion in the exon 1 in the Btg2 gene of SS.BN-(D13Rat25-rs198199323)/Mcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-01-26) Btg2^em24Mcwi 12798565 13 47026986 47030745 1 - by flanking markers 13 55966299 55970058 1 - by flanking markers 13 50913185 50916944 1 - by flanking markers 12738212 SD-Tg(LRRK2*R1441C)268Rwm These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the R1441C mutation and fused to a YPet reporter tag. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2017-08-22) Parkinson's Disease LRRK2 1353141 12738218 SD-GEPR-9 Genetically Epilepsy-Prone Rats (GEPR-9) have severe levels of seizure predisposition. This colony was bred to exhibit clonic convulsions (severe seizures with an ARS of 9) following a single wild running phase in response to sound. Seizures model human generalized tonic/clonic seizures. Rat Resource and Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-01-30) seizure 12738365 SD-Rag2^em2Mcwi This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp frameshift deletion,Atgttgagat, in exon 2. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-02-01) Rag2^em2Mcwi 12738366 3 86764810 86773438 1 - by flanking markers 3 97851318 97859615 1 - by flanking markers 3 91191837 91200134 1 - by flanking markers 12738372 BDIX.BDIV-D6Mit1-D6Mgh2/Zte The BDIX.BDIV-D6Mit1-D6Mgh2/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown 12738388 BDIX.BDIV-D6Rat132-D6Mgh3/Zte The BDIX.BDIV-D6Rat132-D6Mgh3/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown 12738394 BDIX.BDIV-D6Mit8-D6Rat229/Zte The BDIX.BDIV-D6Mit8-D6Rat229/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown 12738452 ACI.F344-Apc^PircUwm This strain develops twice the number of colonic tumors as the F344-ApcPircUwm rats (RGD:1641862). Stop codon mutation at amino acid 1137 of the Apc gene. Nucleotide chr18:26,785,272 (Baylor 3.4/rn4) A to T transversion. University of Wisconsin-Madison, Madison, Wisconsin, Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-06) Apc^Pirc 1554322 18 26732147 26790383 1 - by flanking markers 18 26725560 26820837 1 - by flanking markers 18 27011710 27106323 1 - by flanking markers 12738455 DA.F344-(D10Got155-D10Nsi55) The Cia5a10 (D10Got155-D10Nsi55) interval was introgressed from F344 into DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a10) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. The Feinstein Institute for Medical Research. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-06) 10 105131088 105131258 1 - by flanking markers 10 104692565 104692735 1 - by flanking markers 10 103609431 103609601 1 - by flanking markers 12738457 DA.F344-(D10Got152-D10Mcw1) DA/BklArb rats through 8 backcrosses into DA/BklArb rats followed by 7 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia5a5)(D10Got152-D10Mcw1) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. The Feinstein Institute for Medical Research. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-06) 10 102307572 109926395 1 - by flanking markers 10 100889652 109306076 1 - by flanking markers 10 101211245 109712946 1 - by flanking markers 12738460 DA.F344-(D7Rat15-D7Mit2) The Cia4d (D7Rat15 -D7Mit2) interval was introgressed from F344 into DA/BklArb rats through 7 backcrosses into DA/BklArb rats followed by 3 additional backcrosses into DA/BklArbNsi rats. Heterozygous DA.F344(Cia4d) rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. The Feinstein Institute for Medical Research. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-06) 7 107428268 123191874 1 - by flanking markers 7 110975825 125794357 1 - by flanking markers 7 111043360 126080454 1 - by flanking markers 12738466 DA-Asip^m1 Developed by Beth Bauer, University of Missouri. Spontaneous mutation of agouti gene with resultant black coat color from Sprague Dawley (SD) X Dark Agouti (DA). Albino mutation and hooded mutation have been bred out of this line so that only the agouti mutation remains. Rat Resource and Research Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-06) This strain can be used to generate pigmented embryos for use with albino ES cell lines. Asip^m1 12738467 3 145445175 145536831 1 - by flanking markers 3 156860395 156949277 1 - by flanking markers 3 150492010 150579870 1 - by flanking markers 12743611 SS-Ren^em1Mcwi+/- SS-Ren^em1Mcwi+/Ren^em1Mcwi- ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2018-09-05) 12743623 BN.F344-Apc^Pirc The phenotype of the BN.F344-Apc^Pirc congenic shows high resistance to cancer. The heterozygous animals get spontaneous intestinal lesions (small intestinal and colonic)starting at 60 days of age in males. BN animals are highly resistant to tumor development and can live over 2 years. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-10) Apc^Pirc 1554322 18 26732147 26790383 1 - by flanking markers 18 26725560 26820837 1 - by flanking markers 18 27011710 27106323 1 - by flanking markers 12743627 cNLH-Cat congenital NLH Cataract Rat inbreeding since 2003, juvenile total cataract developed in cNLH line. cNLH = congenital non-learned helpless. congenital non-learned helpless and congenital learned helpless (cLH)lines were developed from outbred Dpargue-Dawley from Charles River. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-10) 12743630 BN-Spib spitzenborduere (spib) Retinae display marked rosett formation in the outer nuclear layer; in the funduscopy irregular, dark pigment flecks are observed, which cannot be identified in the histology. Linkage analysis indicating at least two genes interacting. Rat Resource and Research Center mutant Cryopreserved Sperm (as of 2017-02-10) 12743640 DA.E3-(RT1-DMa-Ggnbp1) The Tcs1 QTL in DA.E3-(RT1-DMa-Ggnbp1)(DA.1IR85) contains a ~0.5 Mb (min- max 0.43 - 0.63 Mb) insert from DA.1I (RGD:10002743, DA.E3-(D20Rat42-D20Rat49)/Rhd). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, inclduing the RT1-B and RT1-D genes. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-13) RT1-DMa|Ggnbp1 735053|1359729 20 4843458 5271653 1 - by flanking markers 20 7302036 7690734 1 - by flanking markers 20 3935512 5625320 1 - by flanking markers 12743645 DA.KHW-(RT1-Db1-RT1-DMb) The Tcs2 QTL in DA.KHW-(RT1-Db1-RT1-DMb)(DA.1HR10) contains a ~0.2 from DA.1H [DA.KHW-RT1h]. The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available at GenBank. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) RT1-DMb|RT1-Db1 735096|1593282 20 4671489 4836772 1 - by flanking markers 20 6167759 7295355 1 - by flanking markers 20 3945383 4097190 1 - by flanking markers 12743647 DA.E3-(Btnl2-RT1-DMb) The Tcs2 QTL in DA.E3-(Btnl2-RT1-DMb)(DA.1UR10) contains a ~0.2 Mb fromDA.E3-(D20Rat47-AA858870)/Rhd (RGD:10002745). The insert spans 12 genes in the MHC-II region, including RT1-B and RT1-D. All genes in the insert have been sequenced and sequences are available from GenBank. The genomic sequences of DA/OlaHsd and E3 have been completed and will be available soon (Backdahl et al. BMC Genomics 2014) Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) Btnl2|RT1-DMb 620731|735096 20 4613726 4836772 1 - by flanking markers 20 6221727 7295355 1 - by flanking markers 20 3945383 4156365 1 - by flanking markers 12743650 DA.AS2-(Tesb-RT1-DMb) DA.F-(Tesb-RT1-DMb) (DA.1FR61) contains a ~0.4 Mb (min- max 0.25 - 0.53 Mb) insert from DA.1F (RGD:2307301). The insert spans 12-19 genes in the MHC-II/MHC-III regions, including RT1-B and RT1-D. The 12 genes in the MHC-II region have been sequenced and sequences are available from GenBank. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) RT1-DMb|Tsbp1 735096|1597063 20 4532358 4836772 1 - by flanking markers 20 6258025 7295355 1 - by flanking markers 20 3945383 4235947 1 - by flanking markers 12743652 DA.KHW-(RT1-DMa-Mln) The Tcs1 QTL in DA.KHW-(RT1-DMa-Mln)(DA.1HR83) contains a ~~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1H [DA.KHW-RT1h]. The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) RT1-DMa|Mln 735053|1642907 20 4843458 5451752 1 - by flanking markers 20 7302036 8814591 1 - by flanking markers 20 3935512 6571791 1 - by flanking markers 12743655 DA.E3-(RT1-DMa-Mln) The Tcs1 QTL in DA.E3-(RT1-DMa-Mln)(DA.1UR83) contains a ~0.85 Mb (min - max: 0.61 - 1.08 Mb) insert from DA.1U (RGD:10002745). The inserted fragment spans the MHC-I region but excludes most of the MHC-II region, including the RT1-B and RT1-D genes. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-14) 12790593 DA.ACI-(Gtf2ird1-D12Rat8)/Nsi The strain contains the Cia25 R11 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(Chr12:27462118-Chr12:27611814) [also known as DA.ACI(Cia25) R11] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-16) arthritis/autoimmunity studies Gtf2ird1 620856 12 23319373 23934871 1 - by flanking markers 12 27273535 27805720 1 - by flanking markers 12 25264052 25799259 1 - by flanking markers 12790595 DA.ACI-(D12Mit2-Gtf2i)/Nsi The strain contains the Cia25 R12 recombinant interval introgressed from ACI into DA/Hsd rats through 13 backcrosses. Heterozygous DA.ACI-(D12Got43-Chr12:27368751)/Nsi [also known as DA.ACI(Cia25) R12] rats were brother-sister mated, and the recombinant strain was maintained in the homozygous state thereafter. North Shore-Long Island Jewish Research Institute,350 Community Drive - Manhasset, NY 11030, Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-16) arthritis/autoimmunity studies Gtf2i 727961 12 20932559 23545621 1 - by flanking markers 12 24662983 27497928 1 - by flanking markers 12 22650702 25487970 1 - by flanking markers 12790599 WKY-Asic3^em6Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Asic3 gene of WKY/Ncrlrat embryos. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-08-14) Asic3^em6Mcwi 12790597 4 6125614 6129660 1 - by flanking markers 4 7300219 7304265 1 - by flanking markers 4 7287868 7293295 1 - by flanking markers 12790602 SS-Axl^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 31-bp deletion in the exon 2 of the Axl gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-02-17) Axl^em1Mcwi 12790600 1 80964751 80994300 1 - by flanking markers 1 83812118 83840542 1 - by flanking markers 1 82550892 82580761 1 - by flanking markers 12790604 SS-Axl^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Axl gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 32-bp deletion in the exon 2 of the Axl gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-02-17) Axl^em2Mcwi 12790605 1 80964751 80994300 1 - by flanking markers 1 83812118 83840542 1 - by flanking markers 1 82550892 82580761 1 - by flanking markers 12790608 SS-Cd14^em1Mcwi The CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of the Cd14 gene of SS/JrHsdMcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-02-17) Cd14^em1Mcwi 12790606 18 29374593 29376190 1 - by flanking markers 18 29265328 29267236 1 - by flanking markers 18 29560341 29562290 1 - by flanking markers 12790610 SS-Cd14^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Cd14 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a net 7-bp deletion of the Cd14 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-02-17) Cd14^em2Mcwi 12790611 18 29374593 29376190 1 - by flanking markers 18 29265328 29267236 1 - by flanking markers 18 29560341 29562290 1 - by flanking markers 12790615 LEW-Chrna4^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryorecovery (as of 2017-02-17) Chrna4^em5Mcwi 12790616 3 170171214 170185998 1 - by flanking markers 3 180243234 180258017 1 - by flanking markers 3 176533182 176547965 1 - by flanking markers 12790621 SS-Cybb^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 42-bp deletion in the exon 3 of the Cybb gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-07-18) Cybb^em1Mcwi 12790620 X 25514572 25547181 1 - by flanking markers X 15359405 15391317 1 - by flanking markers X 14578330 14610049 1 - by flanking markers 12790623 SS-Cybb^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Cybb gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 35-bp deletion in the exon 3 of the Cybb gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryorecovery (as of 2017-07-18) Cybb^em3Mcwi 12790624 X 25514572 25547181 1 - by flanking markers X 15359405 15391317 1 - by flanking markers X 14578330 14610049 1 - by flanking markers 12790627 LEW-Igh-6^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the exon 2 of the Igh-6 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-02-17) Igh-6^em1Mcwi 12790625 6 143205627 143206076 1 - by flanking markers 12790629 LEW-Igh-6^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/Ncrl rat embryos. The resulting mutation is a 2-bp deletion in the exon 2 of the Igh-6 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-08-07) Igh-6^em4Mcwi 12790630 6 143205627 143206076 1 - by flanking markers 12790632 SS-Il2rg^em1Mcwi This strain was produced by injecting TALENs targeting the sequence of Il2rg gene into the SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in exon 2. PhysGen Knockouts mutant Live Animals (as of 2017-02-17) Il2rg^em1Mcwi 12790633 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 12790659 SD-Il2rg^em3Mcwi This strain was produced by injecting TALENs targeting the Il2rg gene into Crl:SD rat embryos. The resulting mutation is a 2-bp deletion in exon 2. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-02-20) Il2rg^em3Mcwi 12790660 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 12790662 WKY-Mb^em6Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-07-18) Mb^em6Mcwi 12790663 7 115087558 115094789 1 - by flanking markers 7 118094391 118101622 1 - by flanking markers 7 118101633 118108864 1 - by flanking markers 12790676 SS-P2rx1^em6Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-02-20) P2rx1^em6Mcwi 12790677 10 59889933 59904985 1 - by flanking markers 10 59305737 59320797 1 - by flanking markers 10 59566268 59581328 1 - by flanking markers 12790679 PCK-P2rx7^em8Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of PCK/CrljCrl-Pkhd1pck/Crl rat embryos. The resulting mutation is a 1-bp insertion in Exon 2 of the P2rx7 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-02-20) Pkhd1^pck|P2rx7^em8Mcwi 11535943|12790680 9;12 18833903;35074025 19338716;35117152 1 - by flanking markers;1 - by flanking markers 9;12 25025958;41242368 25593163;41808755 1 - by flanking markers;1 - by flanking markers 9;12 26164969;39353613 26736704;39396042 1 - by flanking markers;1 - by flanking markers 12790692 SS-Pon1^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-07-18) Pon1^em1Mcwi 12790693 4 29936314 29964821 1 - by flanking markers 4 30156712 30183204 1 - by flanking markers 4 30249749 30276297 1 - by flanking markers 12790695 SS-Pon1^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion of exon 5 in the Pon1 gene. MCW Gene Editing Rat Resource Center mutant Extinct (as of 2017-02-20) Pon1^em2Mcwi 12790696 4 29936314 29964821 1 - by flanking markers 4 30156712 30183204 1 - by flanking markers 4 30249749 30276297 1 - by flanking markers 12790698 SS-Pon1^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 5 in the Pon1 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-07-18) Pon1^em3Mcwi 12790699 4 29936314 29964821 1 - by flanking markers 4 30156712 30183204 1 - by flanking markers 4 30249749 30276297 1 - by flanking markers 12790702 SS-Pon3^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Pon3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 16-bp deletion of exon 4 in the Pon1 gene. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-07-18) Pon3^em1Mcwi 12790703 4 30000505 30027203 1 - by flanking markers 4 30218888 30245586 1 - by flanking markers 4 30311981 30338679 1 - by flanking markers 12790710 SD-Rag2^em3Mcwi This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp deletion in exon 2. PhysGen Knockouts mutant Cryorecovery (as of 2017-07-18) Rag2^em3Mcwi 12790711 3 86764810 86773438 1 - by flanking markers 3 97851318 97859615 1 - by flanking markers 3 91191837 91200134 1 - by flanking markers 12790713 SS-Rag2^em1Mcwi This strain was produced by targeting the Rag2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. PhysGen Knockouts mutant Live Animals; Cryopreserved Sperm (as of 2017-02-21) Rag2^em1Mcwi 12790714 3 86764810 86773438 1 - by flanking markers 3 97851318 97859615 1 - by flanking markers 3 91191837 91200134 1 - by flanking markers 12790717 SS-Rfwd2^em1Mcwi This strain was produced by targeting the Rfwd2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 6-bp insertion in exon 4. PhysGen Knockouts mutant Cryorecovery (as of 2017-07-18) Rfwd2^em1Mcwi 12790718 13 74552876 74590608 1 - by flanking markers 13 81853391 81986197 1 - by flanking markers 13 76942883 77076015 1 - by flanking markers 12790721 SS.BN-(D13Rat151-D13Rat197)-Serpinc1^em2Mcwi ZFN system was used to introduce a mutation in the Serpinc1 gene of SS.BN-(D13Rat151-D13Rat197)/Mcwi rat embryos. The resulting mutation is a 29-bp deletion in Exon 1 of the Serpinc1 gene. Medical College of Wisconsin, Milwaukee, Wisconsin mutant Live Animals (as of 2017-02-21) Serpinc1^em2Mcwi 12790722 13 76548456 76562724 1 - by flanking markers 13 83700761 83715029 1 - by flanking markers 13 78806107 78820375 1 - by flanking markers 12790944 WKY-Sik2^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-02-22) Sik2^em5Mcwi 12790945 8 54240307 54337976 1 - by flanking markers 8 53905730 54005295 1 - by flanking markers 8 55309005 55408608 1 - by flanking markers 12790947 SS-Sorcs2^em7Mcwi This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 33-bp frameshift deletion in exon 15. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-02-22) Sorcs2^em7Mcwi 12790948 14 79968072 80344330 1 - by flanking markers 14 79176694 79547823 1 - by flanking markers 14 79538911 79912333 1 - by flanking markers 12790950 SS-Sorcs2^em9Mcwi This strain was produced by injecting ZFNs targeting the sequence of Sorcs2 into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 15. PhysGen Knockouts mutant Cryopreserved Sperm (as of 2017-02-22) Sorcs2^em9Mcwi 12790952 14 79968072 80344330 1 - by flanking markers 14 79176694 79547823 1 - by flanking markers 14 79538911 79912333 1 - by flanking markers 12790954 WKY-Tert^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of WKY/NCrl rat embryos. The resulting mutation is a 17-bp deletion in Tert gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-02-22) Tert^em2Mcwi 12790955 1 30445180 30465942 1 - by flanking markers 1 33675744 33697542 1 - by flanking markers 1 32250876 32275330 1 - by flanking markers 12790957 SS.SR-(DXrat11-rs64754598)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome X region from DXRat11 to rs64754598 was introgressed on the genetic background of SS. Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-02-22) X 62691290 116944293 1 - by flanking markers X 44619917 99887329 1 - by flanking markers X 44320616 100046443 1 - by flanking markers 12790959 SS.SR-(D1Rat68-rs65309623)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from D1Rat68 to rs65309623 was introgressed on the genetic background of SS. Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-22) 1 193069836 205671704 1 - by flanking markers 1 212591076 225255286 1 - by flanking markers 1 205603081 218387917 1 - by flanking markers 12790962 SS.SR-(rs106908358-rs105920659)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 1 region from rs106908358 to rs105920659 was introgressed on the genetic background of SS. Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-22) 1 135112460 135775433 1 - by flanking markers 1 142050355 142050355 1 - by flanking markers 1 141088073 141088073 1 - by flanking markers 12790964 SS.SR-(rs66001705-D5Mgh16)/Opaz Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains. The SR chromosome 5 region from rs66001705 to D5Mgh16 was introgressed on the genetic background of SS. Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center congenic Cryopreserved Sperm (as of 2017-02-22) 5 156360938 168006088 1 - by flanking markers 5 159701342 171522762 1 - by flanking markers 5 155945375 167946134 1 - by flanking markers 12792211 SS.BN-(D13Hmgc1048-D13Hmgc664)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 0 0 1 - by flanking markers 13 79688409 79688633 1 - by flanking markers 12792212 SS.BN-(D13Hmgc1048-D13Hmgc1045)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 0 75435694 1 - by flanking markers 13 82670970 82671156 1 - by flanking markers 12792213 SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 0 0 1 - by flanking markers 12792214 SS.BN-(D13Hmgc1041-D13Hmgc664)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 74586260 74586404 1 - by flanking markers 13 81886999 81887143 1 - by flanking markers 13 79688409 79688633 1 - by flanking markers 12792216 SS.BN-(D13Hmgc885-D13Hmgc664)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 77913594 79688633 1 - by flanking markers 12792217 SS.BN-(D13Hmgc1041-D13Hmgc885)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Got45-D13Hmgc664)/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 74586260 74586404 1 - by flanking markers 13 81886999 81887143 1 - by flanking markers 13 77913594 77913762 1 - by flanking markers 12792226 SS.BN-(D13Got45-D13Hmgc664)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 69494326 1 - by flanking markers 13 76974692 76974960 1 - by flanking markers 13 72031440 79688633 1 - by flanking markers 12792939 SS.BN-(D13Got42-D13Rat61)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 68034927 1 - by flanking markers 13 73648968 75412480 1 - by flanking markers 13 68686589 70445080 1 - by flanking markers 12792944 SS.BN-(D13Got42-D13Got45)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 69494326 1 - by flanking markers 13 73648968 76974960 1 - by flanking markers 13 68686589 72031708 1 - by flanking markers 12792945 SS.BN-(D13Got42-D13Rat130)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 72283478 1 - by flanking markers 13 73648968 79590001 1 - by flanking markers 13 68686589 74672607 1 - by flanking markers 12792946 SS.BN-(D13Got42-D13Hmgc354)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 76116817 1 - by flanking markers 12792947 SS.BN-(D13Got42-D13Hmgc497)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 77151580 1 - by flanking markers 12792948 SS.BN-(D13Got42-D13Hmgc885)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 77913762 1 - by flanking markers 12792949 SS.BN-(D13Got42-D13Hmgc664)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 66200668 66200819 1 - by flanking markers 13 73648968 73649118 1 - by flanking markers 13 68686589 79688633 1 - by flanking markers 12792950 SS.BN-(D13Mit5-D13Rat32)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 78070512 78189379 1 - by flanking markers 13 85176659 85295746 1 - by flanking markers 13 80285619 80403666 1 - by flanking markers 12792951 SS.BN-(D13Hmgc5885-D13Rat32)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 78189125 78189379 1 - by flanking markers 13 85295639 85295746 1 - by flanking markers 13 77381168 80403666 1 - by flanking markers 12792952 SS.BN-(D13Hmgc354-D13Rat32)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 78189125 78189379 1 - by flanking markers 13 85295639 85295746 1 - by flanking markers 13 76116593 80403666 1 - by flanking markers 12792953 SS.BN-(D13Rat130-D13Rat32)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 72283275 78189379 1 - by flanking markers 13 79589799 85295746 1 - by flanking markers 13 74672405 80403666 1 - by flanking markers 12792954 SS.BN-(D13Got45-D13Rat32)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat151-D13Rat197)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 69494047 78189379 1 - by flanking markers 13 76974692 85295746 1 - by flanking markers 13 72031440 80403666 1 - by flanking markers 12798529 SS.BN-(D13Hmgc37-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 32396527;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 40757538;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 35643050;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 12798530 SS.BN-(D13Rat115-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 35719010;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 44763184;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 39639775;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 12798531 SS.BN-(D13Hmgc86-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 36367611;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 45412259;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 40295163;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 12798532 SS.BN-(D13Hmgc40-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 45828608;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 48645307;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 13;5 43545977;96601805 49720682;96603137 1 - by flanking markers;1 - by flanking markers 12798533 SS.BN-(D13Hmgc85-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 45828608;97701780 45828716;97703112 1 - by flanking markers;1 - by flanking markers 13;5 54791498;100631702 54791605;100633034 1 - by flanking markers;1 - by flanking markers 5;13 96601805;44588357 96603137;49720682 1 - by flanking markers;1 - by flanking markers 12798534 SS.BN-(D13Rat77-D13Got22)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13;5 45828608;97701780 63175600;97703112 1 - by flanking markers;1 - by flanking markers 13;5 54791498;100631702 71047437;100633034 1 - by flanking markers;1 - by flanking markers 13;5 49720575;96601805 66075827;96603137 1 - by flanking markers;1 - by flanking markers 12798535 SS.BN-(D13Rat111-D13Rat115)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 35719148 1 - by flanking markers 13 40421740 44763321 1 - by flanking markers 13 35301263 39639912 1 - by flanking markers 12798536 SS.BN-(D13Rat111-D13Hmgc86)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 36367935 1 - by flanking markers 13 40421740 45412583 1 - by flanking markers 13 35301263 40295487 1 - by flanking markers 12798537 SS.BN-(D13Rat111-D13Rat20)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 38329229 1 - by flanking markers 13 40421740 47267192 1 - by flanking markers 13 35301263 42155682 1 - by flanking markers 12798538 SS.BN-(D13Rat111-D13Hmgc85)/Mcwi SS/JrHsdMcwi were crossed with SS.BN-(D13Rat111-D13Got22)/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 32030139 32030259 1 - by flanking markers 13 40421740 40421859 1 - by flanking markers 13 35301263 44588509 1 - by flanking markers 12802362 SS.BN-(D13Rat25-RN34_13048990782)/Mcwi SS/JrHsdMcwi were crossed with SS-13^{BN(D13Rat123-D13Rat101)}/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46520126 48990782 1 - by flanking markers 13 55314020 55314194 1 - by flanking markers 13 50260357 50260531 1 - by flanking markers 12802363 SS.BN-(D13Rat25-rs106935835)/Mcwi SS/JrHsdMcwi were crossed with SS-13^{BN(D13Rat123-D13Rat101)}/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46520126 47031810 1 - by flanking markers 13 55314020 55971123 1 - by flanking markers 13 50260357 50918009 1 - by flanking markers 12802364 SS.BN-(D13Rat25-rs198199323)/Mcwi SS/JrHsdMcwi were crossed with SS-13^{BN(D13Rat123-D13Rat101)}/Mcwi (RGD:2293145), rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 46520126 47031810 1 - by flanking markers 13 55314020 55971123 1 - by flanking markers 13 50260357 50918009 1 - by flanking markers 12802365 SS.BN-(D13Hmgc64-D13Hmgc23)/Mcwi SS/JrHsdMcwi were crossed with SS-13^{BN(D13Rat123-D13Rat101)}/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45215472 47299604 1 - by flanking markers 13 54170894 56238470 1 - by flanking markers 13 49102205 51182122 1 - by flanking markers 12802366 SS.BN-(D13Hmgc64-4582)/Mcwi SS/JrHsdMcwi were crossed with SS-13^{BN(D13Rat123-D13Rat101)}/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45215472 46195314 1 - by flanking markers 13 54170894 54171089 1 - by flanking markers 13 49102205 49102400 1 - by flanking markers 12802367 SS.BN-(2340-RN34_13048990782)/Mcwi SS/JrHsdMcwi were crossed with SS-13^{BN(D13Rat123-D13Rat101)}/Mcwi, rats from F₁ were intercrossed and genotyped to get the congenic strain Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 47139940 48990782 1 - by flanking markers 12859278 Slc:ZUC-Lepr^fa Zucker fatty rats The spontaneous mutation "obese" (Fatty) was found in the 13M rat stock of Sherman and Merck, by Doctor Lois Zucker, Harriet Bird Memorial Laboratory, Stow, Massachusetts 01775, USA, in 1961.This strain was maintained at Japan SLC, Inc. (Hamamatsu, Japan.) Japan SLC, Inc. (Hamamatsu, Japan) outbred Unknown Lepr|Lepr^fa 3001|13432153 12859279 Ho:ZFDM-Lepr^fa Zucker Fatty Diabetes Mellitus rats In the Zucker fatty rat colony in Hoshino Laboratory Animals, Inc, they incidentally found fa/fa homozygous male rats having reproductive ability. The Selective breeding using the fa/fa male rats that exhibited relatively high blood glucose levels at 10 weeks of age, resulting in establishment of a diabetic strain. These fa/fa male rats developed diabetes as early as 10 weeks of age, reaching 100% incidence by 21 weeks of age, while none of the fa/+ male rats developed diabetes. Hoshino Laboratory Animals, Inc. (Ibaraki, Japan) outbred Unknown Lepr|Lepr^fa 3001|13432153 12859287 ZDF-Lepr^fa/Drt Zucker Diabetic Fatty Rat "Zucker" fatty rats of undefined outbred background, inbred with selection for non-insulin-dependent diabetes mellitus by mating diabetic homozygous fatty males to heterozygous sisters. Indiana University School of Medicine, Indianapolis. inbred Unknown Lepr 3001 12879386 W-Ghsr^em1Ottc The CRISPR/Cas9 genome editing system was used to generate this knock out rat strain with 846- bp deletion in the rat Ghsr gene. The rat strain had Ghsr exon1 deletion in the genome and did not express detectable Ghsr mRNA in brain regions. Optogenetics and Transgenic Technology Core, Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2018-12-04) Ghsr^em1Ottc 12880435 2 113269623 113272999 1 - by flanking markers 2 132784207 132789319 1 - by flanking markers 2 113065953 113071265 1 - by flanking markers 12879394 F344-Atm^m1Kyo Atm missense rats This strain is an Atm missense mutant (amino acid change of leucine (L) to proline (P) at position 2262 (L2262P))rat and was established by ENU mutagenesis using F344/NSlc strain. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-04-18) Immunology Atm^m1Kyo 12879395 8 56894746 56996565 1 - by flanking markers 8 56598503 56703115 1 - by flanking markers 8 58015938 58119973 1 - by flanking markers 12879400 F344-Atm^em1Kyo ZFN-Atm rats This rat strain was established by ZFN method targeting rat Atm gene (resulting in a 8-bp deletion of exon13). Background strain: F344/Stm. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2017-04-18) neurobiology Atm^em1Kyo 12879401 8 56894746 56996565 1 - by flanking markers 8 56598503 56703115 1 - by flanking markers 8 58015938 58119973 1 - by flanking markers 12879423 W-Tg(HCRT-cre-EGFP)B5Ahky orexin-Cre rat This transgenic rat strain was established by Dr. Yamanaka (Nagoya University) in 2012. Background strain: Wistar rat (CLEA Japan). plasmid backbone: pCR2.1. Transgene: human HCRT gene promoter, cre recombinase, EGFP gene, 2A gene. EGFP and cre recombinase are specifically expressed in orexin neurons. National BioResource Project for the Rat in Japan transgenic Unknown 12879424 LE-ROSA26^{em1(CAG-COP4*/EGFP)Kyo} This strain was established at Kyoto University. ChR90/EGFP fusion gene sequence under CAG promoter is knock-in at the Rosa26 locus. Background strain: Long-Evans strain (charles river). COP4*: Stigeoclonium helveticum-derived channelrhodopsin (Chronos, ChR90) National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2017-04-19) 12879426 ExHC.BN-(D14Got74-D14Rat132)/Kyu This congenic strain was established by introducing a segment of chromosome14 (D14Got74-D14Rat132 including Smek2 gene) from Brown Norway(BN)/seac strain into ExHC/Seac strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2017-04-19) 14 103289672 107101727 1 - by flanking markers 14 107489676 110102984 1 - by flanking markers 14 107428559 110402569 1 - by flanking markers 12879428 WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Rat36-D3Rat144)(D4Mgh7-D4Rat68)/Izm A double congenic strain bade by introducing segments of chromosome 1, 3, and 4 from SHRSP/Izm into WKY/Izm. This strain was established by mating between WKY.SHRSP-(D1Mgh5-D1Arb21)(D3Mgh16-D3Rat144)/Izm(NBRP Rat No:0713)and WKY.SHRSP-(D1Mgh5-D1Arb21) (D4Mgh7-D4Rat68)/IzmCNBRP Rat No:0714). This strain was established and is maintained in Shimane University. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2017-04-19) 1;3;4 78134304;78808731;172169471 187092492;151449116;172169650 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 3;1;4 89999731;80946174;200825021 162886090;206277202;233267140 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 3;1;4 83300114;79689548;136351734 156656443;199254774;168998263 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 12879431 Jcl:WI Wistar rats This strain is a rat strain originating from the Wistar Institute in Philadelphia (USA). The Wistar Institute was named as a memorial to the famous anatomist Professor Casper Wistar at the University of Pennsylvania. CLEA Japan, Inc. started the production and supply of this strain after it was introduced from Carworth (UK). CLEA Japan, Inc outbred Live Animals (as of 2021-04-22) behavioral pharmacology, toxicity, pharmacology, drug efficacy, and safety testing. 12879432 W-Ift140^em1Kyo This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 1 (em1) has 2-bp insertion (c.23_24insGG) in the exon 1 of Ift140 (intraflagellar transport 140) gene. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-04-19) Ift140^em1Kyo 12879433 10 14258556 14348468 1 - by flanking markers 10 14189328 14276940 1 - by flanking markers 10 14373668 14461509 1 - by flanking markers 12879434 W-Ift140^em2Kyo This strain was established by CRISPR/Cas9 system at Kyoto University and introduced to the Institute of Environmental Toxicology. Background strain: Jcl:Wistar. This line 2 (em2) has 2-bp deletion (c.23_24del) in the exon 1 of Ift140 (intraflagellar transport 140) gene. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2017-04-19) Ift140^em2Kyo 12879435 12879437 SHC/Ta spontaneously hypercholesterolemic rat This strain (Nephropathy model) was segrigated from SD strain (CLEA Japan,Inc.) by selective mating on the basis of total cholesterol level in blood. National BioResource Project for the Rat in Japan inbred Live Animals (as of 2017-04-19) Metabolism 12879438 F344-Tg(CAG-EGFP,Acr-EGFP)2Osb This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS（green body, green sperm）#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-19) 12879439 F344-Tg(CAG-EGFP,Acr-EGFP)6Osb This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2017-04-19) 12880021 SD-Apoe^em1Sage The mutant rat strain was produced by injecting zinc endonuclease targeting the exon 3 of rat Apoe into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in the gene and resulted in complete loss of Apoe protein in homozygotes. Horizon Discovery mutant Live Animals (as of 2017-05-01) Alzheimer's disease, Neurodegenerative diseases Apoe^em1Sage 12880022 1 79003634 79006387 1 - by flanking markers 1 81878372 81882298 1 - by flanking markers 1 80612894 80616820 1 - by flanking markers 12880026 SD-App^em1Sage This rat model carries a bi-allelic deletion of the amyloid precursor protein (APP) gene. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-01) Alzheimer's disease, Neurodegenerative diseases App^em1Sage 12880027 11 24457855 24693851 1 - by flanking markers 11 28048897 28265250 1 - by flanking markers 11 24425013 24641872 1 - by flanking markers 12880037 SD-Dmd^em1Ang This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation. mutant Unknown Dmd^em1Ang 12880032 X 71501362 71671414 1 - by flanking markers X 51475950 53700033 1 - by flanking markers X 51149358 53519271 1 - by flanking markers 12902614 SS.LEW-(D10M11Mit119-D10Rat27)/Ayd A segment of chromosome 10 was transferred from LEW into the SS background. Two congenic strains, designated S.L4 and S.L5, that were previously shown to have trapped 2 BP QTLs, were used to derive congenic substrains. The F2 rats were genotyped for markers that resided in a region of interest. Each rat was then backcrossed to an SS rat to duplicate the fragment. Centre Hospitalier de Universiti de Montrial, Quebec, Canada congenic Unknown 10 77091834 77092169 1 - by flanking markers 10 74127825 74127968 1 - by flanking markers 10 75983662 75983805 1 - by flanking markers 12902616 SD-Apoe^{tm1(APOE*)Sage} These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE gene Horizon Discovery mutant Live Animals (as of 2017-05-09) Alzheimer's disease, Neurodegenerative diseases APOE 736378 12902621 SD-Bdnf^em1Sage+/- This ZFN model contains a monoallelic deletion of the Bdnf gene, encoding for the nerve growth factor protein BDNF. Homozygous animals carrying the Bdnf deletion are postnatal lethal. Reductions of BDNF have been observed in patients with Alzheimer's disease (AD), and this model may be useful for understanding the role of BDNF in AD. Horizon Discovery mutant Live Animals (as of 2017-06-20) Schizophrenia and Alzheimer's Disease Bdnf^em1Sage 12902622 3 107371329 107421908 1 - by flanking markers 3 100768637 100819216 1 - by flanking markers 12902625 SD-Nr1i2^em1Sage This ZFN model contains a 20-bp deletion within the Nr1i2 gene. No induction of Cyp3a1 in the model. Horizon Discovery mutant Live Animals (as of 2017-05-09) Xenobiotic Sensors Nr1i2^em1Sage 12902626 11 64239918 64276702 1 - by flanking markers 11 67024185 67060494 1 - by flanking markers 11 65022100 65058546 1 - by flanking markers 12903250 SD-Ahr^em1Sage This ZFN model contains a 760-bp deletion in the rat Ahr gene. Horizon Discovery mutant Live Animals (as of 2017-05-10) Xenobiotic Sensors Ahr^em1Sage 12903271 6 54205104 54240268 1 - by flanking markers 6 64589066 64624078 1 - by flanking markers 6 54963990 55001806 1 - by flanking markers 12903251 LH-Chr 17^LN/Aek Chr 17 from LN was introgressed onto the genetic background of LH by crossing LH/MRrrcAek male to LN/MRrrcAek female rats. consomic Unknown 12903257 LH.LH-Chr 17^LN-(rs199194111-rs105876746)/Aek This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17^LN/Aek from rs199194111 through rs1056876746 transferred to the LH/MRrrcAek background. Rat Resource & Research Center congenic Unknown 17 83801670 90920974 1 - by flanking markers 17 78329613 85282628 1 - by flanking markers 17 76673662 83549032 1 - by flanking markers 12903267 SD-Nr1i3^em1Sage This model contains a ZFN-induced 10-bp deletion within rat Nr1i3 gene. Horizon Discovery mutant Live Animals (as of 2017-05-10) Xenobiotic Sensors Nr1i3^em1Sage 12903268 13 87104241 87108563 1 - by flanking markers 13 94211961 94218143 1 - by flanking markers 13 89585072 89591278 1 - by flanking markers 12903270 SD-Nr1i2^em1Sage Nr1i3^em1Sage This model contains two knockout genes, the 20-bp deletion within rat Nr1i2 and the ZFN-induced 10-bp deletion within rat Nr1i3 gene. Horizon Discovery mutant Live Animals (as of 2017-05-10) Xenobiotic Sensors Nr1i2^em1Sage|Nr1i3^em1Sage 12902626|12903268 13;11 87104241;64239918 87108563;64276702 1 - by flanking markers;1 - by flanking markers 13;11 94211961;67024185 94218143;67060494 1 - by flanking markers;1 - by flanking markers 13;11 89585072;65022100 89591278;65058546 1 - by flanking markers;1 - by flanking markers 12903272 SD-Nr1i2^em1Sage Nr1i3^em1Sage Ahr^em1Sage This model contains three knockout genes, the 20-bp deletion within rat Nr1i2, the ZFN-induced 10-bp deletion within rat Nr1i3 gene and the 760-bp deletion in the rat Ahr gene. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-10) Xenobiotic Sensors Nr1i2^em1Sage|Nr1i3^em1Sage|Ahr^em1Sage 12902626|12903268|12903271 13;11;6 87104241;64239918;54205104 87108563;64276702;54240268 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 11;13;6 67024185;94211961;64589066 67060494;94218143;64624078 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 11;13;6 65022100;89585072;54963990 65058546;89591278;55001806 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 12904057 SD-Abcb1a^{em1Sage -/-} SD-Abcb1a^em1-/Abcb1a^em1- This ZFN model contains biallelic 20 bp deletion within Abcba1 gene. Animals exhibit increased oral bioavailability of P-gp-specific substrates. The homozygous knockout rats display total loss of protein via Western blot. Horizon Discovery mutant Live Animals (as of 2017-05-16) Efflux Transporter Abcb1a^em1Sage 12904058 4 21709855 21796628 1 - by flanking markers 4 22276390 22448913 1 - by flanking markers 4 22339829 22517642 1 - by flanking markers 12904059 SD-(Abcb1a- Abcb1b)^em1Sage This model carries knockout of Abcb1a and Abcb1b. Horizon Discovery mutant Live Animals (as of 2017-05-16) Efflux Transporter 12904063 SD-Abcg2^em1Sage This ZFN model carries a 588-bp deletion within Abcg2 gene. Homozygous knockouts display total loss of protein via Western blot Horizon Discovery mutant Live Animals (as of 2017-05-16) Efflux Transporter Abcg2^em1Sage 12904064 4 87502584 87560017 1 - by flanking markers 4 153587206 153712481 1 - by flanking markers 4 88765441 88890268 1 - by flanking markers 12904679 WKY-Cyp2j4^em1Sage/Tja ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. mutant Unknown Cyp2j4^em1Sage 12904681 5 116702370 116729722 1 - by flanking markers 5 119130644 123455814 1 - by flanking markers 5 119546458 119564843 1 - by flanking markers 12904684 SD-Abcb1a^em1Sage Abcg2^em1Sage This model contains two knockout genes, the 20-bp deletion within rat Abcba1 and the 588-bp deletion within rat Abcg2 gene. Horizon Discovery mutant Live Animals (as of 2017-05-17) Efflux Transporter Abcb1a^em1Sage|Abcg2^em1Sage 12904058|12904064 4;4 21709855;87502584 21796628;87560017 1 - by flanking markers;1 - by flanking markers 4;4 22276390;153587206 22448913;153712481 1 - by flanking markers;1 - by flanking markers 4;4 22339829;88765441 22517642;88890268 1 - by flanking markers;1 - by flanking markers 12904685 SD-Abcc2^em1Sage This ZFN model contains a biallelic 726 bp deletion within the Abcc2 gene. Animals exhibit decreased transport of endogenous glutathione and hyperbilirubinemia. The homozygous knockout rats display total loss of protein via Western blot. Horizon Discovery mutant Live Animals (as of 2017-05-17) Efflux Transporter Abcc2^em1Sage 12904687 1 270999832 271057750 1 - by flanking markers 1 263554426 263612556 1 - by flanking markers 12904730 SD-Abcb11^em1Sage This ZFN induced knockout model contains biallelic 8-bp deletion within Abcb11 gene. The homozygous knockout rats display total loss of protein via Western blot. Horizon Discovery mutant Live Animals (as of 2017-05-19) Efflux Transporter Abcb11^em1Sage 12904731 3 62091490 62195528 1 - by flanking markers 3 55480024 55587946 1 - by flanking markers 12904733 SD-Slc22a1^em1Sage This ZFN induced knockout model contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-19) Uptake Transporters Slc22a1^em1Sage 12904734 1 42351239 42378295 1 - by flanking markers 1 51452604 51479610 1 - by flanking markers 1 48273639 48300645 1 - by flanking markers 12904891 SD-Slc22a2^em1Sage This ZFN model carries the knockout of the rat Slc22a2. Horizon Discovery mutant Live Animals (as of 2017-05-24) Uptake Transporters Slc22a2 61936 1 42395676 42442847 1 - by flanking markers 1 51394014 51435104 1 - by flanking markers 1 48318025 48360219 1 - by flanking markers 12904892 SD-Slc22a6^em1Sage This ZFN model carries the knockout of the rat Slc22a6. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) Uptake Transporters Slc22a6 69338 1 211294178 211302398 1 - by flanking markers 1 231761600 231772550 1 - by flanking markers 1 224824809 224833284 1 - by flanking markers 12904893 SD-Slc22a8^em1Sage This ZFN model carries the knockout of the rat Slc22a8. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) Uptake Transporters 12904897 SD-Tp53^em1Sage This ZFN model carries the monoallelic 11 base pair deletion in Tp53 gene. Animals exhibit broad tumor spectrum with high degree of tumor malignancy. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) carcinogenicity Tp53^em1Sage 12904898 10 56399721 56411150 1 - by flanking markers 10 55932658 55944087 1 - by flanking markers 10 56186299 56198449 1 - by flanking markers 12904900 SD-Rag1^em1Sage This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Homozygous animals display loss of Rag1 protein and loss of B and T cells by FACS analysis. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag1^em1Sage 12904901 3 86780782 86791878 1 - by flanking markers 3 97866048 97877145 1 - by flanking markers 3 91206394 91217491 1 - by flanking markers 12904902 F344-Rag1^em1Sage This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Rag1 knockout rats lack mature B and T lymphocytes. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag1^em1Sage 12904901 3 86780782 86791878 1 - by flanking markers 3 97866048 97877145 1 - by flanking markers 3 91206394 91217491 1 - by flanking markers 12904903 SD-Rag2^em1Sage This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene on chromosome 3. Homozygous Rag2 knockout rats display loss of RAG2 protein via Western blot. Homozygous Rag2 knockout rats show loss of B and T cells by FACS analysis. Horizon Discovery mutant Live Animals (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag2^em1Sage 12904904 3 86764810 86773438 1 - by flanking markers 3 97851318 97859615 1 - by flanking markers 3 91191837 91200134 1 - by flanking markers 12904905 F344-Rag2^em1Sage This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene.on chromosome 3 Rag2 knockout rats completely lack B and T cells. Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) immunology/Inflamation and Immunodeficient Rag2^em1Sage 12904904 3 86764810 86773438 1 - by flanking markers 3 97851318 97859615 1 - by flanking markers 3 91191837 91200134 1 - by flanking markers 12904907 SD-Prkdc^em1Sage This ZFN induced knockout rats have severe combined immunodeficiency (SCID) and lack of both B and T cells Horizon Discovery mutant Live Animals (as of 2017-05-24) immunology/Inflamation and Immunodeficient Prkdc 1308982 11 86951420 87169229 1 - by flanking markers 11 92347175 92565022 1 - by flanking markers 11 89293547 89510948 1 - by flanking markers 12904908 SD-Ldlr^em1Sage In this ZFN induced model, a total of 337 bp were deleted at the junction of intron 3 and exon 4 (on chromosome 8), and 4 bp ccgt were inserted rat Ldlr gene on chromosome 8. Homozygous knockout rats display loss of LDLR protein via Western blot. Homozygous knockout rats have increased body weight as compared to wild type. Homozygous knockout rats show significantly elevated serum cholesterol levels. Horizon Discovery mutant Live Animals (as of 2017-05-24) Ldlr^em1Sage 12904909 8 20824040 20846920 1 - by flanking markers 8 22804325 22827199 1 - by flanking markers 8 22750425 22773305 1 - by flanking markers 12904912 SD-Lep^em1Sage-/- This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels Horizon Discovery mutant Cryopreserved Embryo (as of 2017-05-24) Cardiovascular Lep^em1Sage 12904927 4 55943837 55945938 1 - by flanking markers 4 56085079 56099209 1 - by flanking markers 4 56337695 56351818 1 - by flanking markers 12905029 SD-Th^{tm1(IRES-cre)Sage} This ZFN knock in model expresses cre-recombinase under the control of the endogenous tyrosine hydroxylase promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of Th. The TH-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats 12905031 SD-Slc6a3^{tm1(IRES-cre)Sage} This model expresses cre-recombinase under the control of the endogenous dopamine transporter promoter enabling specific expression in dopaminergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of DAT. The DAT-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats 12905032 LE-Camk2a^{tm1(IRES-cre)Sage} This model expresses cre-recombinase under the control of the endogenous camkIIa promoter enabling specific expression in excititory neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of CamkIIa. The CamkIIa-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats 12905033 LE-Slc32a1^tm1(cre)Sage This model expresses cre-recombinase under the control of the endogenous solute carrier family 32 member 1 (Vgat) promoter enabling specific expression in Vgat positive GABAergic neurons. This model possesses a targeted insertion of (IRES)-cre immediately after the translational stop in the open reading frame of the Vgat gene. The Vgat-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats 12905034 LE-Vip^{tm1(T2A-cre)Sage} This model expresses cre-recombinase under the control of the endogenous vasoactive intestinal peptide (VIP) promoter enabling specific expression in VIP positive GABAergic interneurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the VIP gene. The VIP-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery mutant Unknown (as of 2017-05-31) Optogenetics Rats 12905035 LE-Tph2^{tm1(T2A-cre)Sage} This model expresses cre-recombinase under the control of the endogenous Tryptophan Hydroxylase 2 (Tph2) promoter enabling specific expression in Tph2 positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the Tph2 gene. The Tph2-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats 12905036 LE-Htr3a^{tm1(T2A-cre)Sage} This model expresses cre-recombinase under the control of the endogenous 5 prime-hydroxytryptamine receptor 3A (5Ht3a) promoter enabling specific expression in 5Ht3a positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the 5Ht3a gene. The 5Ht3a-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) Optogenetics Rats 12905037 LE-ROSA26^{em1(CAG-tdTomato)1Sage} This CRISPR knock in model possesses the fluorophore tdTomato, sitting behind a floxed stop codon in the Rosa26 locus under control of the CAG promoter. By introducing Cre-recombinase through viral transduction or crossing with one of our Cre-driver rats, tdTomato fluorescence will be observed anywhere Cre- is expressed. The tdTomato Reporter rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) 12905038 LE-ROSA26^{em1(CAG-tdTomato-NpHR)1Sage} This CRISPR knock in model possesses the Halorhodopsin fused to TdTomato, sitting behind a floxed stop codon in the Rosa26 locus under the control of the CAG promoter. By introducing Cre-recombinase by crossing with one of our Cre-driver rats, neuronal subtype-specific expression of halorhodopsin and TdTomato will be observed anywhere Cre- is expressed. The Halorhodopsin rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with Cre-driver lines. Horizon Discovery mutant Live Animals (as of 2017-05-31) 12907568 WI-Abcb1a^em2Sage This model contains biallelic 19- bp deletion in exon 7 of Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. mutant Unknown Abcb1a^em2Sage 12907569 4 21709855 21796628 1 - by flanking markers 4 22276390 22448913 1 - by flanking markers 4 22339829 22517642 1 - by flanking markers 12907570 WI-Abcb1a^em3Sage This model contains one 19- bp deletion and one 428-bp deletion within Abcba1 gene. The homozygous knockout rats display total loss of protein via Western blot. mutant Unknown Abcb1a^em3Sage 12907571 4 21709855 21796628 1 - by flanking markers 4 22276390 22448913 1 - by flanking markers 4 22339829 22517642 1 - by flanking markers 12910101 SD-Ldlr^em1 This model possesses a 19-bp deletion in the seventh exon of the ldlr gene by ZFN method. mutant Unknown Ldlr^em1 12910102 8 20824040 20846920 1 - by flanking markers 8 22804325 22827199 1 - by flanking markers 8 22750425 22773305 1 - by flanking markers 12910127 SD-Tg(Th-Ghsros) This transgenic strain carries a synthetic 108-nucleotide DNA fragment spanning the 5 prime extracellular region of GHS-R was cloned in the antisense orientation driven by tyrosine hydroxylase (Th) promoter. transgenic Unknown Ghsr 621397 12910483 Slc:SD Sprague-Dawley Derived Japan SLC, Inc. outbred Unknown 12910493 LEW.1WR1-Ifnar1^em1 The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion in exon 4 of Ifnar1 gene. Department of Medicine, University of Massachusetts Medical School, Worcester, MA mutant Unknown Ifnar1^em1 12910495 11 31454789 31478449 1 - by flanking markers 11 35248575 35272235 1 - by flanking markers 11 31640407 31666839 1 - by flanking markers 12910494 LEW.1WR1-Ifnar1^em2 The CRISPR/Cas9 genome editing system was used to generate this mutant rat strain. The resulting strains carrying a 81-bp deletion and 4-bp insertion in exon 4 of Ifnar1 gene. Department of Medicine, University of Massachusetts Medical School, Worcester, MA mutant Unknown Ifnar1^em2 12910496 11 31454789 31478449 1 - by flanking markers 11 35248575 35272235 1 - by flanking markers 11 31640407 31666839 1 - by flanking markers 12910505 SD-Mmp12^em2Soar TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon mutant Unknown Mmp12^em2Soar 12910506 8 4249938 4259675 1 - by flanking markers 8 5610392 5620294 1 - by flanking markers 8 5594717 5616494 1 - by flanking markers 12910514 SD-Lepr^em1 This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 57-bp deletion. East China Normal University, Shanghai, China mutant Unknown Lepr^em1 12910515 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 12910517 SD-Lepr^em2 This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 1-bp deletion. East China Normal University, Shanghai, China mutant Unknown Lepr^em2 12910518 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 12910519 SD-Lepr^em3 This strain was produced by injecting TALEN targeting the sequence of rat Lepr into SD embryos. The resulting mutation is a 18-bp insertion. East China Normal University, Shanghai, China mutant Unknown Lepr^em3 12910546 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 12910762 BN-Kit^Ws A spontaneous mutant male with a large white spot and coat color dilution was identified in the BN/fMai colony in Yagi Memorial Park (kani-gun, Japan). mutant Unknown Kit^Ws 12910763 14 34906043 34984819 1 - by flanking markers 14 34901860 34979384 1 - by flanking markers 14 35072131 35149638 1 - by flanking markers 12910940 SD-Cdkn1b^we The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype. mutant Unknown Cdkn1b^we 12910941 4 171841705 171846506 1 - by flanking markers 4 232962218 232967323 1 - by flanking markers 4 168689043 168694159 1 - by flanking markers 13204704 W-Myo7a^tnd/Hubr Wistar tornado rat Male Wistar founder rats were mutagenized using ENU and mated with untreated female to establish F1 population. Selected F1 progeny were mated to produce F2 and then to breed induced mutation to homozygosity. Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. mutant Unknown Myo7a^tnd/Hubr 13204705 1 155292620 155362698 1 - by flanking markers 1 169206150 169276706 1 - by flanking markers 1 163001313 163071545 1 - by flanking markers 13204756 SS.BN-(D13Hmgc1048-D13Hmgc1050)-Pappa2^em4Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-07-18) Pappa2^em4Mcwi 13204758 13 74286881 74379736 1 - by flanking markers 13 81303663 81574402 1 - by flanking markers 13 76389150 76660248 1 - by flanking markers 13204788 SS.BN-(D13Hmgc1048-D13Hmgc1050)-Pappa2^em5Mcwi CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-07-19) Pappa2^em5Mcwi 13204789 13 74286881 74379736 1 - by flanking markers 13 81303663 81574402 1 - by flanking markers 13 76389150 76660248 1 - by flanking markers 13207339 LH.LH-Chr 17^LN-(Fancc^{rgdv551196202-C}-rs106387478)/Aek This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17^LN/Aek from Fancc^{rgdv551196202-C} through rs106387478 transferred to the LH/MRrrcAek background. Rat Resource & Research Center congenic Unknown 17 7228496 53535067 1 - by flanking markers 17 939418 55648100 1 - by flanking markers 17 946321 47839901 1 - by flanking markers 13207341 LH.LH-Chr 17^LN-(Fancc^{rgdv551196202-C}-rs107291522)/Aek This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17^LN/Aek from Fancc^{rgdv551196202-C} through rs107291522 transferred to the LH/MRrrcAek background. Rat Resource & Research Center congenic Unknown 17 7228496 29903973 1 - by flanking markers 17 939418 26499100 1 - by flanking markers 17 946321 24556663 1 - by flanking markers 13207416 LH.LH-Chr 17^LN-(rgdv421102132^T-rgdv413679765^T)/Aek This congenic strain contains a fragment of chromosome 17 from the LH-Chr 17^LN/Aek from Fancc^{rgdv551196202-C} through rs106387478 transferred to the LH/MRrrcAek background. Rat Resource & Research Center congenic Unknown 17 30894361 74169166 1 - by flanking markers 13207488 LEW-Chrnb4^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/NCrl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryorecovery (as of 2017-08-02) Chrnb4^em5Mcwi 13207489 8 58586961 58605545 1 - by flanking markers 8 58192375 58210959 1 - by flanking markers 8 59610489 59629073 1 - by flanking markers 13207491 SD-Tg(Col3a1-loxP-eGFP-loxP-TurboRFP)Mcwi Bacterial artificial chromosome (BAC) Transgenic rats containing a Cre-inducible reporter switch from eGFP to TurboRFP under the control of the promoter of Col3a1 (BAC: CH230-401H12 ) MCW Gene Editing Rat Resource Center transgenic Cryopreserved Sperm (as of 2018-02-12) 13207492 SD-Cd55^em6Mcwi CRISPR/Cas9 system was used to introduce a 4-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-02) Cd55^em6Mcwi 13207493 13 43322246 43348334 1 - by flanking markers 13 52177543 52206137 1 - by flanking markers 13 47125156 47153557 1 - by flanking markers 13207494 SD-Cd55^em4Mcwi CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-02) Cd55^em4Mcwi 13207495 13 43322246 43348334 1 - by flanking markers 13 52177543 52206137 1 - by flanking markers 13 47125156 47153557 1 - by flanking markers 13207497 SS-Kcnj13^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-02) Kcnj13^em1Mcwi 13207498 9 86206927 86216659 1 - by flanking markers 9 94208941 94224828 1 - by flanking markers 9 94486719 94495333 1 - by flanking markers 13207501 SS-Nlrp10^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp deletion of exon 2 in the Nlrp10 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-03) Nlrp10^em2Mcwi 13207502 1 166411647 166419204 1 - by flanking markers 1 180511615 180519172 1 - by flanking markers 1 173521412 173528969 1 - by flanking markers 13207503 SS-Nlrp10^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 2 in the Nlrp10 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-03) Nlrp10^em3Mcwi 13207504 1 166411647 166419204 1 - by flanking markers 1 180511615 180519172 1 - by flanking markers 1 173521412 173528969 1 - by flanking markers 13207507 SS-Nlrp12^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp12 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion of exon 3 in the Nlrp12 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-11-12) Nlrp12^em1Mcwi 13207508 1 64242875 64271212 1 - by flanking markers 1 63493575 63521356 1 - by flanking markers 1 64506750 64543908 1 - by flanking markers 13207509 SS-P2rx1^em7Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm; Cryorecovery (as of 2018-10-10) P2rx1^em7Mcwi 13207510 10 59889933 59904985 1 - by flanking markers 10 59305737 59320797 1 - by flanking markers 10 59566268 59581328 1 - by flanking markers 13207511 SS.BN-(D13Rat151-D13Rat197)-Tg(Slc12a1-Ncf2-2A-Luc)26Mcwi A transgenic rat created by Sleeping Beauty transposon system with proximal tubule-specific overexpression of Ncf2 and Luciferase via a self cleaving 2A peptide, under control of the Slc12a1 (also known as Nkcc2) promoter produced in the line 26 strain. MCW Gene Editing Rat Resource Center transgenic Cryorecovery (as of 2017-08-03) Ncf2 1309424 13207513 SS-Tg(Slc12a1-Ncf2-2A-Luc)-Ncf2^em1Mcwi This is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2017-08-03) Ncf2^em1Mcwi 5144089 13 67806516 67834105 1 - by flanking markers 13 75197561 75229600 1 - by flanking markers 13 70226441 70259019 1 - by flanking markers 13207514 SD-ROSA26^{em1(Epac-SH187)Mcwi} CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-03) 13207516 SD-Rag2^em3McwiIl2rg^em2Mcwi This strain was produced by crossing of SD-Rag2em3Mcwi and SD-Il2rgem2Mcwi. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-03) Il2rg^em2Mcwi|Rag2^em3Mcwi 10002792|12790711 3;X 86764810;89342055 86773438;89345715 1 - by flanking markers;1 - by flanking markers 3;X 97851318;72017856 97859615;72021516 1 - by flanking markers;1 - by flanking markers 3;X 91191837;71165378 91200134;71169078 1 - by flanking markers;1 - by flanking markers 13207518 SHR-Hspa1^em1Mcwi CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos. MCW Gene Editing Rat Resource Center mutant Cryorecovery (as of 2018-05-01) Hspa1b|Hspa1a|Hspa1l 2840|1593284|1595925 20;20 3945716;3955274 3959552;3957748 1 - by flanking markers;1 - by flanking markers 20;20;20 6956234;7032557;4802576 6962151;7038454;7033025 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 20;20;20 4879998;4877638;4875834 4965191;4880112;4881751 1 - by flanking markers;1 - by flanking markers;1 - by flanking markers 13207525 SS-Spp1^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 3 of the Spp1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-04) spp1^em3Mcwi 13207528 14 6653086 6658937 1 - by flanking markers 14 6673686 6679965 1 - by flanking markers 13207529 SS-Spp1^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-04) Spp1^em4Mcwi 13207530 14 6653086 6658937 1 - by flanking markers 14 6673686 6679965 1 - by flanking markers 13207537 SD-Tg(Cdh5-cre)2Mcwi Transgenic rat overexpressing Cre under the control of the Cdh5 (VECadherin) promoter. MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2017-08-04) 13207551 SS-Tg(Nphs2-cre/ERT2)4Mcwi Transgenic rat overexpressing tamoxifen inducible Cre/ERT2 under the control of the Nphs2 (Podocin) promoter MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2017-08-04) 13207560 SS-Tg(Aqp2-cre/ERT2)4Mcwi Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Aquaporin 2 promoter MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2017-08-04) 13207563 SS-Tg(Mylpf-cre/ERT2)22Mcwi Transgenic overexpressing tamoxifen inducible CreERT2 under the control of the Mylpf (also known ad Mlc2) promoter MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2017-08-04) 13207595 WKY-Tph1^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-07) Tph1^em1Mcwi 13208230 1 97186071 97207551 1 - by flanking markers 1 103746878 103774100 1 - by flanking markers 1 102669868 102699442 1 - by flanking markers 13208223 LE-(ROSA26) ^{em1(LTR-nLuc)Ottc} The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. Rat Resource and Research Center mutant Unknown 13208224 LE-(ROSA)26 ^{em1(CAG-Cas9)Ottc} The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of Cas9 under the control of CAG promoter inserted to the rat ROSA26 locus. Rat Resource and Research Center mutant Unknown 13208231 WKY-Tph1^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-08) Tph1^em3Mcwi 13208232 1 97186071 97207551 1 - by flanking markers 1 103746878 103774100 1 - by flanking markers 1 102669868 102699442 1 - by flanking markers 13208517 SD-Nfe2l2^em1Mcwi+/+ SD-Nfe2l2^em1Mcwi+/Nfe2l2^em1Mcwi+ This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals (as of 2017-08-09) 13208518 SD-Nfe2l2^em1Mcwi-/- SD-Nfe2l2^em1Mcwi-/Nfe2l2^em1Mcwi- This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals (as of 2017-08-09) Nfe2l2^em1Mcwi 9588549 3 58366693 58394116 1 - by flanking markers 3 69041641 69069190 1 - by flanking markers 3 62497568 62525146 1 - by flanking markers 13208519 SD-Nfe2l2^em1Mcwi+/- SD-Nfe2l2^em1Mcwi+/Nfe2l2^em1Mcwi- This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders. PhysGen Knockouts mutant Live Animals (as of 2017-08-09) 13208537 HsdFfyb:WI Descendants of rats from the Wistar Institute, Philadelphia, Pennsylvania then to Harlan (Indianapolis).Since 1995 maintained at Bioterio Central- Facultad de Farmacia y BioquÃ¿Â¿mica de la Universidad de Buenos Aires. Contact: Junin 956 8 piso Ciudad AutÃ¿Â¿noma de Buenos Aires, Argentina Tel/Fax: +54 11 5287 4811 Mail: bioterio@ffyb.uba.ar Bioterio Central- Facultad de Farmacia y BioquÃ¿Â¿mica de la Universidad de Buenos Aires. Contact: Junin 956 8 piso Ciudad AutÃ¿Â¿noma de Buenos Aires, Argentina Tel/Fax: +54 11 5287 4811 Mail: bioterio@ffyb.uba.ar outbred Live Animals (as of 2017-08-11) 13208540 CrlFvetFfyb:SD Descendants of rats from the Charles River Laboratories (USA),then to Fvet at Buenos Aires University and since 2014 maintained at Bioterio Central of Facultad de Farmacia y Bioqu¿mica de la Universidad de Buenos Aires. Junin 956 Ciudad Aut¿noma de Buenos Aires, Argentina Bioterio Central of Facultad de Farmacia y Bioqu¿mica de la Universidad de Buenos Aires. Junin 956 Ciudad Aut¿noma de Buenos Aires, Argentina mutant Live Animals (as of 2017-08-11) 13208571 SS-Tg(Cyp11b2-cre/ERT2)2Mcwi Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Cyp11b2 promoter MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2019-04-26) 13208576 SS-Tg(Slc5a2-cre/ERT2)2Mcwi Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Slc12a1 (Sglt2) promoter MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2017-08-14) 13208583 SS-Tg(Ubc-Wisp2)2Mcwi Transgenic overexpressing Wisp2 under the control of the Ubiqutin C promoter MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2017-08-14) 13208584 SS-Tg(Ubc-Wisp2)3Mcwi Transgenic overexpressing Wisp2 under the control of the Ubiqutin C promoter MCW Gene Editing Rat Resource Center transgenic Live Animals (as of 2017-08-14) 13208842 SS-Ptgs2^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-21) Ptgs2^em1Mcwi 13208843 13 64427288 64432978 1 - by flanking markers 13 72315959 72324483 1 - by flanking markers 13 67351230 67356920 1 - by flanking markers 13208844 SS-Ptgs2^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion of exon 4 in the Ptgs2 gene. MCW Gene Editing Rat Resource Center mutant Live Animals (as of 2017-08-21) Ptgs2^em2Mcwi 13208845 13 64427288 64432978 1 - by flanking markers 13 72315959 72324483 1 - by flanking markers 13 67351230 67356920 1 - by flanking markers 13210578 SD-Lep^em1 This CRISPR/Cas9 model possesses a 3 bp(ATC) deletion resulting in the deletion of isoleucine at position 14. The Lep mutant rats exhibited similar mutant phenotypes to Lep and Lepr null rats. mutant Unknown Lep^em1 13210580 4 55943837 55945938 1 - by flanking markers 4 56085079 56099209 1 - by flanking markers 4 56337695 56351818 1 - by flanking markers 13210773 ACI.BN-(Fer1l6^{rgdv775925951-C}-D7Uwm27)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Cryopreserved Sperm (as of 2017-09-07) mammary cancer 7 98507649 98507649 1 - by flanking markers 13210774 ACI.BN-(Fer1l6^{rgdv775925951-C}-D7Uwm28)/Shul This congenic strain contains a region of BN/SsNHsd chromosome 7 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison congenic Unknown mammary cancer 7 98507649 98507649 1 - by flanking markers 13432148 SS.ZUC-Lepr^fa-/-/Slc SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain. congenic Unknown Diabetes Obesity Lepr^fa 13432153 13432150 SS.ZUC-Lepr^fa-/+/Slc SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain. congenic Unknown Diabetes Obesity Lepr|Lepr^fa 3001|13432153 13432151 SS.ZUC-Lepr^fa+/+/Slc SS.ZUC-Leprfa/Slc rats were generated as the result of an initial mating of a male Zucker rat (Japan SLC) heterozygous for the fa allele of Lepr with a female DahlS/JrSeac rat (Seac, Japan), followed by multiple rounds of backcrossing of the resulting progeny to the SS strain. congenic Unknown Diabetes Obesity Lepr 3001 13432199 SHRSP.WKY-(D3Wox20-D3Rat114)/Gcrc Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown 13432200 SHRSP.WKY-(D3Mgh16-D3Rat80)/Gcrc Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown 13432201 SHRSP.WKY-(D3Mgh16-D3Wox3)/Gcrc Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown 13432202 SHRSP.WKY-(D3Mgh16-rs65433898)/Gcrc Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown 13432203 SHRSP.WKY-(D3Mgh16-rs197649383)/Gcrc Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown 13432204 SHRSP.WKY-(D3Mgh16-D3Mit10)/Gcrc Congenic sub-strains were generated by backcrossing male SHRSP.WKY-(D3Mgh16-D3Rat114)/Gcrc rats to SHRSP females. Progeny generated from this backcross were heterozygous throughout the original congenic interval. Brother X sister mating was carried out to generate sub-strains containing smaller congenic intervals. Institute of Cardiovascular & Medical Sciences, BHF Glasgow Cardiovascular Research Centre, University of Glasgow, Glasgow, UK congenic Unknown 13437612 SS-Adamts16^em1Bj This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614. mutant Unknown Adamts16^em1Bj 13437613 17 2559771 2690663 1 - by flanking markers 1 36468949 36599799 1 - by flanking markers 1 35067268 35200530 1 - by flanking markers 13441556 LE-Tg(Cx3cr1-cre/ERT2)1Ottc This strain was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. Cre-ERT2 controllable with Tamoxifen. Optogenetics and Transgenic Technology Core, transgenic Unknown 13441557 LE-Tg(Cx3cr1-cre/ERT2)3Ottc This strain was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. Rat Resource and Research Center transgenic Unknown 13446407 SD-Tg(Camk2a-cre/ERT2)/ZiRrrc The hemizygous rats have random insertion of calcium/calmodulin-dependent protein kinase II alpha (Camk2a)- cre/ERT2 (tamoxifen inducible Cre recombinase) transgene in the genome. This transgenic exhibits expression of cre/ERT2 fusion protein in neural populations where the mouse Camk2a promoter region found in the transgene is active. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2017-11-07) 13450922 SD-GEPR-3 Genetically Epilepsy-Prone Rats (GEPR-3) have moderate levels of seizure predisposition. This colony,initially referred to as an AGS (audiogenic response score) colony, was bred to exhibit clonic convulsions (moderate seizures with an ARS of 3) following a single wild running phase in response to sound. Siezures model human generalized tonic/clonic seizures. Rat Resource and Research Center inbred Unknown seizure 13451132 BN-Crb1^m1 This Brown Norway from Janvier rat strain spontaneously develops progressive focal retinal layer disorganization, loss of photoreceptors, cystic cavitation, and RMG abnormalities associated with early retinal vascular telangiectasia and late stage subretinal neovascularization. This phenotype bears reminiscent of human Macular telangiectasia 2. A deletion insertion mutation in exon 6 of the rat crb1 was identified to be responsible for this retinal phenotype. mutant Unknown Crb1^m1 13451133 13 52558317 52725099 1 - by flanking markers 13 61292273 61480872 1 - by flanking markers 13 56270519 56462893 1 - by flanking markers 13451538 FHH-Chr 1^BN-Dusp5^em1Mcwi This strain was produced by injecting ZFNs targeting the following sequence CAGGGCAGCCGC-CACtggcaGAAGCTGCGGGAGGA in exon 1 of the rat Dusp5 gene into FHH-Chr 1^BN/Mcwi embryos. The resulting mutation is a 14 bp deletion and a 3 bp insertion between nucleotides 449 and 464 in Dusp5 mRNA that creates a frame shift mutation which is predicted to introduce a premature stop codon at amino acid 121. mutant Unknown Dusp5^em1Mcwi 13451539 1 259754234 259767645 1 - by flanking markers 1 281658075 281671486 1 - by flanking markers 1 274245184 274258595 1 - by flanking markers 13452382 SD-Tg(Htt^*) This rat model was developed by injection of SD embryos with construct containing rat huntingtin cDNA fragment with 51 CAG repeats (from HD patient) under control of the native rat huntingtin promoter. transgenic Unknown HTT 68472 13452406 SHR/NHsdAkr Spontaneously Hypertensive Rat SHR strain obtained from Harlan Sprague-Dawley (Indianapolis, IN) and maintained at the University of Akron breeding colonies, Akron, Ohio University of Akron breeding colonies, Akron, Ohio inbred Unknown 13452407 WKY/NHsdAkr These animals were bought from Harlan Indianapolis, Indiana U.S.A. and maintained at the University of Akron breeding colonies, Akron, Ohio. University of Akron breeding colonies, Akron, Ohio. inbred Unknown 13462044 LE-Tg(Thy1-GCaMP6f)9Rrrc Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. Janelia Research Campus and Princeton University, Rat Resource & Research Center transgenic Unknown 13462045 LE-Tg(Thy1-GCaMP6f)7Rrrc Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. Janelia Research Campus and Princeton University, Rat Resource & Research Center transgenic Live Animals (as of 2021-02-12) 13464263 F344-Il2rg^em1Iexas This strain was established by CRISPR/Cas9 targeting rat Il2rg gene using electroporation. background strain: F344/Jcl. This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion of Il2rg gene. This strain grows normally under SPF condition. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2018-01-02) Immunology Il2rg^em1Iexas 13464264 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 13464268 GH/Htru University of Otago Medical School from rats of Wistar origin imported from England in 1930. Selection for high blood pressure started by Smirk in 1955. A number of sublines have been developed. Closely related to strain AS (Heslop and Phelan 1973). Characteristics Develops hypertension, cardiac hypertrophy and vascular disease (Phelan 1968, Simpson and Phelan 1984, Simpson et al, 1994). National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2018-01-02) 13464270 Seac:LIS Lister Rat, Sea:Lister Hooded In 1990, this strain was introduced from Harlan Olac (UK) to Seiwa Institute of Experimental Animals. Then this strain was introduced to KYUDO Company in 2004. National BioResource Project for the Rat in Japan outbred Cryopreserved Embryo (as of 2018-01-02) 13464272 CrljJclKud:SD In 2004, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016. National BioResource Project for the Rat in Japan outbred Cryopreserved Embryo (as of 2018-01-02) 13464273 JclKud:WI Wistar rats In 1977, this strain was introduced from CLEA Japan,Inc to KYUDO company. This strain was maintained and supplied as the SPF animal until April 2016. National BioResource Project for the Rat in Japan outbred Cryopreserved Embryo (as of 2018-01-02) 13464320 STOCK Aspa^em34Kyo Hcn1^A354V/Kyo This double mutant strain was established by crossing WTC/Kyo (NBRP Rat No. 0020) and F344-Aspa^em34Kyo (NBRP Rat No. 0806). WTC/Kyo has a missense mutation (Hcn1A354V) in Hcn1 (Hyperpolarization-activated cyclic nucleotide-gated channel 1) gene and F344-Aspa^em34Kyo has a 16-bp deletion in the exon4 of Aspa (Aspartoacylase) gene (c.622_637del). National BioResource Project for the Rat in Japan inbred Unknown Aspa^em34Kyo|Hcn1^A354V 11564348|13464319 13464326 LE.W-Tg(Slc32a1-YFP*)1Yyan/Vip The original strain, W-Tg(Slc32a1-YFP*)1Yyan (NBRP No.0554 rat), was established at National Institute for Physiological Sciences in 2004, thereafter introduced to Gunma University in 2006 （Uematsu et al. Cerebral Cortex (2008). This original strain rats were was crossed with Long-Evans rat (Iar:Long-Evans) for 10 generations to establish the congenic strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Embryo (as of 2018-01-03) 13464327 WKY.Cg-clest/Iet When the depositor (The Institute of Environmental Toxicology ) conducted mating experiment using male Crl:CD(SD) rats, the offsprings of backcrossed-generation showed multiple malformations such as ectrodactylism, cleft palate or lip in 2013. These phenotype might be inherited in an autosomal recessive pattern. Therefore the congenic strain was established using WKY strain as the recipient strain. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2018-01-03) 13464329 FPL/Iet Fused pulmonary lobes, FPL This spontaneous mutant strain wa found in a colony of Jcl:Wistar strain at the Institute of Environmental Toxicology in 1978: 3 rats out of 13 rats showed fused right pulmonary lobes with reduction deformity of middle pulmonary lobes. These rats also had the syndactylism or paten tof the eyelid. It was difficult to maintain this strain in homozygous condition, mating system has been changed to sib mating between heterozygous rats. National BioResource Project for the Rat in Japan inbred Cryopreserved Embryo (as of 2018-01-03) Frem2^fpl 13464330 13503336 W;Cg-Acr^tm1Osb Acr KO, Acr {tm1 Osb} After homologous recombination using ES cells derived from hybrid (mix) breed of Slc:Wistar (female) and F344/NSlc (male), Acr KO strain was established by GLT at Osaka University. The genomic region including exon 1 to exon 3 is replaced by Neo resistance gene. After mating with Slc:Wistar, this strain is maintained by sib mating or with Slc:Wistar rats. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2018-01-12) 13506176 SS-Nox4^em2Ncf2^em1Mcwi Breeding together of SS-Nox4em2Mcwi (RGDID: 4139883) and SS-Ncf2em1Mcwi (RGDID: 5144104), both models were generated by ZFN mutagenesis. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm; Cryorecovery (as of 2018-11-12) Nox4^em2Mcwi|Ncf2^em1Mcwi 4139868|5144089 1;13 143415816;67806516 143603554;67834105 1 - by flanking markers;1 - by flanking markers 1;13 157106652;75197561 157285107;75229600 1 - by flanking markers;1 - by flanking markers 1;13 150796359;70226441 150976186;70259019 1 - by flanking markers;1 - by flanking markers 13506737 GK The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s, GK rats were initiated with breeding pairs in several places and also commercially available from Japanese breeders Charles River Japan, Yokohama, Oriental Yeast, Tokyo, Clea Japan Inc., Osaka (GK/Clea), Japan SLC, Shizuoka (GK/SLC), Takeda Lab Ltd., Osaka (GK/Taked), and from Taconic, USA (GK/Mol/Tac). inbred Unknown 13506738 GK/Par The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generation.In 1988, GK/Par substrain was established in Paris, France by initiating breeding pairs F35 from Japanese colonies . inbred Unknown 13506739 GK/Jcl The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.This strain was introduced from Tohoku University, and CLEA Japan Inc started its production and supply as GK/Jcl. CLEA Japan, Inc inbred Unknown 13506831 SS-P2rx7^em10Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 11-bp putative frame-shift deletion in exon 2 MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-02-21) P2rx7^em10Mcwi 13792805 12 35074025 35117152 1 - by flanking markers 12 41242368 41808755 1 - by flanking markers 12 39353613 39396042 1 - by flanking markers 13506832 SS-P2rx7^em13Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2rx7 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is an 10-bp putative frame-shift deletion in exon 2 MCW Gene Editing Rat Resource Center mutant Live Animals; Cryopreserved Sperm (as of 2018-10-10) P2rx7^em13Mcwi 13792806 12 35074025 35117152 1 - by flanking markers 12 41242368 41808755 1 - by flanking markers 12 39353613 39396042 1 - by flanking markers 13506918 F344/N Fischer Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Institutes of Health in 1951 (Hansen et al 1982). Subsequent sublines from NIH. NIH Autoimmune Rat Model Repository and Development Center inbred Unknown 13506919 F344/Nctr Fischer Curtiss and Dunning 1920 at Columbia University Institute for Cancer Research, To National Center for Toxicological Research, FDA. National Center for Toxicological Research, FDA. inbred Unknown 13508588 WI Wistar rat The Wistar rat is an outbred albino rat. This breed was developed at the Wistar Institute in 1906 for use in biological and medical research, and is notably the first rat developed to serve as a model organism. outbred Unknown 13513909 SD-Tg(Ren2)27^-/- This is a littermate wild type control strain for SD-Tg(Ren2)27 (RGD:629501), which was generated by the mouse Ren2 renin gene along with its 5' and 3' flanking sequences being microinjected into fertilized eggs from a Hannover Sprague-Dawley (SD) background. Center for Genome Research, University of Edinburgh, UK transgenic Unknown 13524863 LEC/Crlj Long Evans Cinnamon The LEC/Crlj is available at Japan Charles River Inc. (Yokohama, Japan) since 1991 from the Center for Experimental Plants and Animals, Hokkaido University. Japan Charles River Inc. (Yokohama, Japan) inbred Unknown 13524998 UPL In 1989, a femal sprague-Dawley rat with spontaneous cataracts was observed in the Upjohn Pharmaceuticals Limited Tsukuba Research Laboratory colony. The cataract was demonstrated to be hereditary and it was determined that there are two cataract types with different onset ages. inbred Unknown 13525002 Gunn rats This mutation was observed for the first time in the breeding stock of the rat colony of the Connaught Laboratories in 1934. It is of Wistar origin. segregating_inbred Unknown 13592602 SD-Tg(LRRK2*G2019S)418Rwm These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag. Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2018-05-14) Parkinson's Disease LRRK2 1353141 13592603 SD-Tg(LRRK2)302Rwn These rats were created using BAC constructs consisting of the entire 144kb human wild type LRRK2 locus fused to a YPet reporter tag. Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2018-05-14) LRRK2 1353141 13592604 SD-Tg(LRRK2*G2019S)416Rwm These rats were created using BAC constructs consisting of the entire 144kb human LRRK2 locus containing the G2019S mutation and fused to a YPet reporter tag. Rat Resource and Research Center transgenic Cryopreserved Sperm; Cryorecovery (as of 2018-05-14) Parkinson's Disease 13592605 F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561Bryd F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)561 The transgene consists of a SpeI fragment from plasmid pCAG-loxPSTOPloxP-ZsGreen (Addgene plasmid #51269, donated by Pawel Pelczar). Hemizygous animals contain approximately 4 copies of the transgene integrated at a site on Chromosome 2. Rat Resource and Research Center transgenic Live Animals (as of 2019-03-18) 13602097 LE.Cg-(ROSA26) ^{em1(CAG-Cas9*D10A)Ottc} The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of CRISPR associated protein 9 (Cas9) catalytic mutant protein D10A under the control of CAG promoter inserted to the rat ROSA26 locus. Rat Resource and Research Center mutant Unknown 13628730 SD-Il2rg^em1Ang TALEN targeting the 2nd exon of rat Il2rg gene was designed and mRNA coding these TALEN was microinjected into Crl:SD embyo.This strain carrying an 80 bp deletion generated a premature stop codon in the 3rd exon. No Il2rg protein was detected by western blot. Centre de Recherche en Transplantation et Immunologie UMR1064, INSERM, University de Nantes, Nantes, France. mutant Unknown Il2rg^em1Ang 13628731 X 89342055 89345715 1 - by flanking markers X 72017856 72021516 1 - by flanking markers X 71165378 71169078 1 - by flanking markers 13673907 NMcwiWfsm:HS Heterogeneous stock 25 breeding pairs were obtained from Dr. Eva Redei, Northwestern University (Chicago) at 55 breeding generations; these animals exhibit 30% genome-wide heterozygosity which is maintained by using a rotational breeding strategy. These HS rats were derived from NMcwi:HS at the Medical College of Wisconsin and maintained at Wake Forest Baptist Medical Center starting in 2017. Department of Internal Medicine, Molecular Medicine Wake Forest Baptist Medical Center outbred Unknown 13702080 SD-Ahr^em1Soar Crispr/Cas9 targeted deletion of DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The established Ahr null strain lacks responsiveness to Ahr ligands. Rat Resource and Research Center mutant Cryopreserved Sperm; Cryorecovery (as of 2019-01-21) Toxicology, reproduction, cancer Ahr^em1Soar 13702081 6 54205104 54240268 1 - by flanking markers 6 64589066 64624078 1 - by flanking markers 6 54963990 55001806 1 - by flanking markers 13702084 BBDP.BBDR-Gimap5/Sunn To generated Gimap5 congenic BBDP/WorSunn rats, the laboratory introgressed the wild-type Gimap5 locus derived from BBDR (BBDR/Wor) rats (Biomedical Research Models) into BBDP/WorSunn rats. Briefly, BBDP/WorSunn and BBDR/Wor rats were crossed, and the resulting F1 animals were backcrossed to BBDP/WorSunn rats. This step was followed by 10 more, marker- assisted backcrosses of Gimap5 heterozygous progeny to BBDP/WorSunn rats. After the eleventh backcross, nonlymphopenic rats were intercrossed, and their progeny homozygous for wild-type Gimap5 were selected for establishing the congenic non-lymphopenic BBDP/WorSunn line (also called BBDP/WorSunn.BBDR-Iddm2). Philippe Poussier,Sunnybrook Research Institute/University of Toronto congenic Unknown Gimap5 628871 13702085 BBDP.BBDR-Gimap5, WF-(D13Rat124-D13Mgh5)/Sunn The Gimap5 congenic BBDP/WorSunn rats (BBDP.BBDR-Gimap5/Sunn) were corssed with the BBDP/WorSunn.WF-CD45 inbred line (BBDP.WF-(D13Rat124-D13Mgh5)/Sunn) to develop an inbred BBDP/WorSunn strain that would be congenic for both wild type Gimap5, hence non T lymphopenic (and consequently diabetes resistant), and for the WF-derived CD45.2 (RT7) allele (the original BBDP/WorSunn strain carries the CD45.1 allele). Department of Medicine and Immunology, University of Toronto, Toronto, Ontario, Canada, Rat Resource & Research Center congenic Cryopreserved Sperm; Cryorecovery (as of 2019-03-18) Ptprc|Gimap5 3451|628871 13703119 SD-Lamp2^em1 This strain was produced by injecting TALEN targeting exon 2 of rat Lamp2 into SD embryos. The resulting mutation is a 2-bp deletion and results in knockout of Lamp2 protein in Lamp2 y/- male. State Key Laboratory of Cancer Biology, National Clinical Research Centre for Digestive Diseases and Xijing Hospital of Digestive Diseases, Fourth Military Medical University, Xi'an, China mutant Unknown Lamp2^em1 13703121 X 6908285 6951772 1 - by flanking markers X 124809053 124852509 1 - by flanking markers X 124722628 124766079 1 - by flanking markers 13781890 SD-Rnaset2^em1Sage Two pairs of CRISPR guide RNAs were designed to cleave together to delete all 9 exons of RNaseT2. The CRISPR guide RNA and Cas9 mRNA mixtures were microinjected into the pronuclei of fertilized embryos of Sprague-Dawley rats and transferred to pseudopregnant female rats. WT, heterozygous and homozygous (KO) rats were born in the expected Mendelian ratio, and homozygous RNaseT2 KO rats were viable and fertile. mutant Unknown Rnaset2^em1Sage 13781891 1 47227491 47244660 1 - by flanking markers 1 54425133 54442302 1 - by flanking markers 1 53174879 53192048 1 - by flanking markers 13782128 SD-Pde4b^em1Sage These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 1 of rat Pde4b into Sprague Dawley embryos. The 16-bp frameshift deletion (AGCGGCGTCGCTTCAC) in exon 1 in rat was created in the mutant founders. These mutant founders were backcrossed with Sprague Dawley to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. Horizon Discovery mutant Cryopreserved Embryo (as of 2018-08-22) Pde4b^em1Sage 13782129 5 123158156 123533877 1 - by flanking markers 5 125623815 126001128 1 - by flanking markers 5 121759236 122136814 1 - by flanking markers 13782146 SD-Bace1^em1Sage-/- SD-Bace1^em1Sage-/Bace1^em1Sage- Bace1 (-/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) mutant Unknown Bace1^em1Sage 13782148 8 48817824 48839681 1 - by flanking markers 8 48766005 48788272 1 - by flanking markers 8 50140092 50162388 1 - by flanking markers 13782163 SD-Snca^{tm1(SNCA*)Sage} This model contains a knockin of the A53T-mutated SNCA gene deeming the rat SNCA gene non-functional. The knockin contains humanized amino acids for the region spanning amino acids 53-122. The resulting model expresses a humanized A53T alpha-synuclein protein without endogenous rat alpha-synuclein. Horizon Discovery mutant Live Animals (as of 2018-08-24) 13782164 SD-Snca^em1Sage This model contains a deletion of the endogenous rat SNCA gene, encoding the alpha-synuclein protein. This model was generated using the CRISPR/Cas9 genome targeting strategy. Horizon Discovery mutant Live Animals (as of 2018-08-24) 13782280 SS-Kcnj1^em1Kasu+/+ Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein. This strain is the wild type littermate from heterozygous cross. Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,Inc mutant Unknown 13782351 SS-Kcnj1^em1Kasu+/- Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is TCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single -cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,Inc mutant Unknown Kcnj1^em1Kasu 13782352 8 32158243 32162370 1 - by flanking markers 8 33453597 33454750 1 - by flanking markers 8 33490280 33519127 1 - by flanking markers 13782353 SS-Kcnj1^em1Kasu-/- Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA). The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single-cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein in homozygotes. Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,Inc mutant Unknown Kcnj1^em1Kasu 13782352 8 32158243 32162370 1 - by flanking markers 8 33453597 33454750 1 - by flanking markers 8 33490280 33519127 1 - by flanking markers 13782371 SD-Cacna1f ^csnb congenital stationary night blindness rat A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. mutant Unknown Cacna1f ^csnb 13782372 X 26908850 26937165 1 - by flanking markers X 16504174 16532670 1 - by flanking markers X 15712709 15741135 1 - by flanking markers 13792570 WI-Oprl1^m1Hubr+/- The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon. Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Oprl1^m1Hubr 13792571 3 170869862 170873417 1 - by flanking markers 3 180932344 180943574 1 - by flanking markers 3 177223779 177231663 1 - by flanking markers 13792572 WI-Oprl1^m1Hubr-/- NOPr knockout rat The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon.NOPr is completely absent in homozygous mutants. Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Oprl1^m1Hubr 13792571 3 170869862 170873417 1 - by flanking markers 3 180932344 180943574 1 - by flanking markers 3 177223779 177231663 1 - by flanking markers 13792573 SD-Lep^em1Sage+/- This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels Horizon Discovery mutant Cryopreserved Embryo (as of 2018-09-13) Cardiovascular Lep^em1Sage 12904927 4 55943837 55945938 1 - by flanking markers 4 56085079 56099209 1 - by flanking markers 4 56337695 56351818 1 - by flanking markers 13792575 SD-Lep^em1Sage+/+ These wild type rats are littermates of homozygous knockout rats from heterozygote matings. The Lepr knockout model possesses a 151 bp deletion spanning the exon 1/intron 1 junction of the Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels mutant Unknown (as of 2018-09-13) Cardiovascular 13792606 SD-Cd59^em1Ask-/- SD-Cd59^em1-/Cd59^em1- The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. Cardiovascular Research Institute,University of California San Francisco, CA 94143-0521 USA mutant Unknown Cd59^em1Ask 13792720 3 89243600 89245129 1 - by flanking markers 3 100650411 100668036 1 - by flanking markers 3 94010481 94028660 1 - by flanking markers 13792607 SD-Cd59^em1Ask+/+ The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion in exon 3. No protein expression was detected in the blood smear of homozygous mutants. Breeding of CD59 +/- rats was done to generate wildtype (CD59+/+)and homozygous mutant (CD59-/-) rats. Cardiovascular Research Institute,University of California San Francisco, CA 94143-0521 USA mutant Unknown 13792682 SD-Abcc6^em2Qlju+/- This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. Thomas Jefferson University, Philadelphia mutant Unknown Abcc6^em2Qlju 10413846 1 96448588 96524655 1 - by flanking markers 1 103042723 103096453 1 - by flanking markers 1 101954786 102013252 1 - by flanking markers 13792683 SD-Abcc6^em2Qlju+/+ This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. This wild type mutant is the wild type offspring from the cross of heterozygous mutants. Thomas Jefferson University, Philadelphia mutant Unknown 13792701 SD-Trpv1^em1Sage-/- These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created. Homozygous knockout rats exhibit complete loss of Trpv1 protein. Horizon Discovery mutant Cryopreserved Embryo (as of 2018-09-21) Trpv1^em1Sage 13792702 10 60109656 60134939 1 - by flanking markers 10 59538296 59563441 1 - by flanking markers 10 59799123 59824208 1 - by flanking markers 13792705 SD-Trpv1^em1Sage+/+ These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created ( SD-Trpv1em1Sage-/-). This wild type mutant is the wild type offspring from the cross of heterozygous mutants. mutant Unknown 13792727 HanRj:WI Zentralinstitut fur Versuchstierzucht (Hannover) 1982 (from Allington Farm - UK 1964). This strain was selected by DONALDSON in 1906 at the Wistar Institute (USA), from a batch belonging to Chicago University (RUSSEL-LINDSAY, 1979). Janvier Labs outbred Unknown 13792794 SD-Fh^em1+/- A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. No homozygous -/- mutant was revealed in litters. mutant Unknown Fh^em1 13792797 13 91329837 91355722 1 - by flanking markers 13 98116496 98142636 1 - by flanking markers 13 93651486 93677371 1 - by flanking markers 13792795 SD-Fh^em1+/+ A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. Breeding of Fh +/- rats was done to generate wildtype (Fh+/+)and Fh (+/-). No homozygous mutant were observed. mutant Unknown 13792801 SS-Nlrp3^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 14-bp deletion of exon 1 in the Nlrp3 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-09-28) Nlrp3^em2Mcwi 13792799 10 45850224 45874533 1 - by flanking markers 10 45648191 45674617 1 - by flanking markers 10 45884324 45918290 1 - by flanking markers 13792803 SS-P2rx7^em12Mcwi This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp insertion in Exon 2 of the P2rx7 gene. mutant Unknown P2rx7^em12Mcwi 13792802 12 35074025 35117152 1 - by flanking markers 12 41242368 41808755 1 - by flanking markers 12 39353613 39396042 1 - by flanking markers 13792808 SS-Ptk2b^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2. mutant Unknown Ptk2b^em1Mcwi 13792810 15 45589222 45717866 1 - by flanking markers 15 48646476 48766708 1 - by flanking markers 15 42827306 42947796 1 - by flanking markers 13792811 SS-Ptk2b^em3Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a7-bp deletion in exon 2. mutant Unknown Ptk2b^em3Mcwi 13792812 13792813 SHRSP-Spp1^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-01) Spp1^em2Mcwi 13792814 14 6653086 6658937 1 - by flanking markers 14 6673686 6679965 1 - by flanking markers 13792821 SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1Mcwi SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)1 The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette. MCW Gene Editing Rat Resource Center transgenic Unknown 13792822 SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2Mcwi SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)2 The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line B. MCW Gene Editing Rat Resource Center transgenic Unknown 13792823 SD-Tg(CAG-loxP-stop-loxP-Drp1-GFP)3Mcwi The Sleeping Beauty transposon system was used to introduce a Drp1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette.This is line C. MCW Gene Editing Rat Resource Center transgenic Unknown 13792825 SD-Tg(CAG-loxP-stop-loxP-Mfn1-GFP)1Mcwi The Sleeping Beauty transposon system was used to introduce a Mfn1-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette. This is line A. MCW Gene Editing Rat Resource Center transgenic Unknown 13792827 WKY-Tg(Ubc-cre/ERT2)4Mcwi The Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line D.Cre activity is detected even without tamoxifen induction. MCW Gene Editing Rat Resource Center transgenic Cryopreserved Sperm (as of 2018-10-02) 13792828 WKY-Tg(Ubc-cre/ERT2)5Mcwi The Sleeping Beauty transposon system was used to introduce a cre-ERT2 fusion, driven by the UbC promoter. This is line E.Cre activity is detected even without tamoxifen induction. MCW Gene Editing Rat Resource Center transgenic Cryopreserved Sperm (as of 2018-10-02) 13793372 SS-Tlr4^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2. MCW Gene Editing Rat Resource Center mutant Unknown Tlr4^em1Mcwi 13793373 13793374 DA-Tph1^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of DA/MolTac rat embryos. The resulting mutation is a 1-bp deletion in exon 4. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-03) Tph1^em4Mcwi 13793375 1 97186071 97207551 1 - by flanking markers 1 103746878 103774100 1 - by flanking markers 1 102669868 102699442 1 - by flanking markers 13793376 SS-Avpr2^em4Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. MCW Gene Editing Rat Resource Center mutant Cryopreserved Embryo (as of 2018-10-03) Avpr2^em4Mcwi 13793377 X 159821860 159823488 1 - by flanking markers 1 152637074 152640726 1 - by flanking markers X 156889006 156892707 1 - by flanking markers 13793378 SS-Avpr2^em5Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-03) Avpr2^em5Mcwi 13793379 X 159821860 159823488 1 - by flanking markers 1 152637074 152640726 1 - by flanking markers X 156889006 156892707 1 - by flanking markers 13799346 SS-Cgnl1^em1Mcwi CRISPR/Cas9 system was used to introduce a 80-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryos MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-10) Cgnl1^em1Mcwi 13799347 8 76088865 76241145 1 - by flanking markers 8 74800532 74950938 1 - by flanking markers 8 78126670 78278490 1 - by flanking markers 13799348 SS-Cgnl1^em2Mcwi CRISPR/Cas9 system was used to introduce a 88-bp deletion on exon 2 of Cgnl1 gene in SS/JrHsdMcwi embryos MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-10) Cgnl1^em2Mcwi 13799349 8 76088865 76241145 1 - by flanking markers 8 74800532 74950938 1 - by flanking markers 8 78126670 78278490 1 - by flanking markers 13799350 T2DN-F2r^em1Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of F2r gene in the T2DN/Mcwi embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-10) F2r^em1Mcwi 13799351 2 25985800 25989072 1 - by flanking markers 2 45254489 45257761 1 - by flanking markers 2 26118760 26135340 1 - by flanking markers 13800555 F344/IcoCrl From mating #344 of rats purchased from a local breeder (Fischer). The colony was originated by M. R. Curtis, Columbia University in 1920. To the Germ-Free Animal Laboratory at CNRS, Gif-sur-Yvette, France from the Lobund Institute, University of Notre-Dame, South Bend, Indiana, U.S.A. Subsequently introduced to Charles River France in 1970 as an axenic colony. Charles River inbred Unknown 13800556 F344-Hsd11b2^em1Jmul-/- F344-Hsd11b2^em1Jmul-/Hsd11b2^em1Jmul- The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. mutant Unknown Hsd11b2^em1Jmul 13800560 19 35336342 35341585 1 - by flanking markers 19 48341841 48347084 1 - by flanking markers 19 37476083 37481326 1 - by flanking markers 13800557 F344-Hsd11b2^em1Jmul+/+ F344-Hsd11b2^em1Jmul+/Hsd11b2^em1Jmul+ This is the wild-type litter mates of the Hsd11b2 F344 mutants created by ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. mutant Unknown 13800746 SS-F8^em1Mcwi CRISPR/Cas9 system was used to delete the entire F8 gene in the SS/JrHsdMcwi embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-17) F8^em1Mcwi 13800747 18 121134 162008 1 - by flanking markers 18 413447 444491 1 - by flanking markers 18 367862 399242 1 - by flanking markers 13800749 Lew-Glp1r^em1Mcwi CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. MCW Gene Editing Rat Resource Center mutant Unknown Glp1r^em1Mcwi 13800750 20 9225881 9264184 1 - by flanking markers 20 11768479 11808416 1 - by flanking markers 20 9586075 9626228 1 - by flanking markers 13800810 SS-Kcnq1^em5Mcwi CRISPR/Cas9 system and the single-stranded oligodeoxynucleotide (ssODN ) were combined to introduce the R231H mutation in the Kcnq1 gene of SS/JrHsdMcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-10-18) Kcnq1^em5Mcwi 13800813 1 203383401 203803687 1 - by flanking markers 1 223154713 223490458 1 - by flanking markers 1 216293087 216630339 1 - by flanking markers 13800825 FHH-Muc1^em1Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 2 of rat Muc1 gene in the FHH/EurMcwi embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2018-10-18) Muc1^em1Mcwi 13800827 2 181399482 181403640 1 - by flanking markers 2 207957206 207962396 1 - by flanking markers 2 188543137 188547874 1 - by flanking markers 13800838 FHH-Mybphl^em1Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. MCW Gene Editing Rat Resource Center mutant Unknown Mybphl^em1Mcwi 13800841 2 203934530 203948031 1 - by flanking markers 2 230628901 230643002 1 - by flanking markers 2 211158902 211173036 1 - by flanking markers 13800845 FHH-Mybphl^em2Mcwi CRISPR/Cas9 system was used to introduce a 1-bp insertion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. MCW Gene Editing Rat Resource Center mutant Unknown Mybphl^em2Mcwi 13800846 2 203934530 203948031 1 - by flanking markers 2 230628901 230643002 1 - by flanking markers 2 211158902 211173036 1 - by flanking markers 13800848 SS-Nlrp3^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Nlrp3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp deletion of exon 1 in the Nlrp3 gene. MCW Gene Editing Rat Resource Center mutant Unknown Nlrp3^em1Mcwi 13800850 10 45850224 45874533 1 - by flanking markers 10 45648191 45674617 1 - by flanking markers 10 45884324 45918290 1 - by flanking markers 13800869 SS-P2ry2^em6Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 132-bp deletion in exon 3 in the P2ry2 gene. MCW Gene Editing Rat Resource Center mutant Unknown P2ry2^em6Mcwi 13800870 1 158440018 158454213 1 - by flanking markers 1 172227726 172241921 1 - by flanking markers 1 166031228 166045423 1 - by flanking markers 13800871 SS-P2ry2^em7Mcwi CRISPR/Cas9 system was used to introduce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 115-bp deletion in exon 3 in the P2ry2 gene. MCW Gene Editing Rat Resource Center mutant Unknown P2ry2^em7Mcwi 13800873 1 158440018 158454213 1 - by flanking markers 1 172227726 172241921 1 - by flanking markers 1 166031228 166045423 1 - by flanking markers 13800875 SS-Prl^tm1(PRL)Mcwi CRISPR/Cas9 and plasmid donor containing floxed human prolactin cDNA were used to insert the human cDNA into the start coden of rat prolactin gene MCW Gene Editing Rat Resource Center mutant Unknown PRL 736187 13800877 LH-Chr 17^LN-C17h6orf52^em2Mcwi CRISPR/Cas9 system was used to introduce a net 10-bp insertion in exon 2 of rat C17h6orf52. mutant Cryopreserved Sperm (as of 2018-10-18) C17h6orf52^em2Mcwi 13800878 17 29733271 29746771 1 - by flanking markers 17 23581681 23595498 1 - by flanking markers 17 21600326 21615888 1 - by flanking markers 13825143 WKY-Gja5^em1Mcwi CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. MCW Gene Editing Rat Resource Center mutant Unknown Gja5^em1Mcwi 13825144 2 191824118 191843867 1 - by flanking markers 2 218648368 218669354 1 - by flanking markers 2 199162745 199184942 1 - by flanking markers 13825147 SS-Per1^em3Mcwi CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Unknown Per1^em3Mcwi 13825148 13825196 SS-Sh2b3^tm1Mcwi CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exons mutant Cryopreserved Sperm (as of 2018-11-21) Sh2b3^tm1Mcwi 14394610 13825199 WI-Mc4r^m1Hubr The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Mc4r^m1Hubr 13825200 18 63390922 63392809 1 - by flanking markers 18 61799166 61801053 1 - by flanking markers 18 62612838 62614725 1 - by flanking markers 13838845 SD-Ahr^em2Sage ZFN constructs were designed to target exon 2 which contains the DNA binding bHLH motif of the AHR gene.This ZFN model contains a 29-bp deletion in the rat Ahr gene. mutant Unknown Ahr^em2Sage 126790510 6 54205104 54240268 1 - by flanking markers 6 64589066 64624078 1 - by flanking markers 6 54963990 55001806 1 - by flanking markers 14390067 WI-Slc6a4^m1Hubr-/- The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The homozygoous mutant rats were generated by incrossed between heterozygous Slc6a4 knock out rats. Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Slc6a4^m1Hubr 14390068 10 67134790 67155891 1 - by flanking markers 10 62851326 62872481 1 - by flanking markers 10 63153656 63188377 1 - by flanking markers 14390069 WI-Slc6a4^m1Hubr+/- The Slc6a4 knockout rat was generated by target-selected ENU-induced mutagenesis. An ENU-induced premature stop codon in exon 3 of the Slc6a4 gene in a female rat (Wistar from Crl) was identified.The heterozygoous mutant rats were used to generate homozygous Slc6a4 knock out rats. Hubrecht Laboratory, Utrecht, The Netherlands mutant Unknown Slc6a4^m1Hubr 14390068 10 67134790 67155891 1 - by flanking markers 10 62851326 62872481 1 - by flanking markers 10 63153656 63188377 1 - by flanking markers 14390082 SD-Tg(Fos-LacZ)Bhope The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Rats were rederived from frozen embryos in 2002 and bred onto SD background for >35 generations at NIDA IRP (Bruce Hope lab) Rat Resource and Research Center transgenic Unknown 14390083 WI-Tg(Fos-LacZ)Bhope The lacZ gene was inserted between NcoI and SalI sites in exon 4 of the murine Fos gene . The linearized DNA was then microinjected into fertilized rat oocytes and line 1-8 was chosen for continuation. Initial SD rats were then bred onto Wistar background for >10 generations at NIDA IRP (Bruce Hope lab) transgenic Unknown 14392784 ACI.SD-Esr1^em1Soar This strain was produced by backcrossing the ZFN induced 482 deletion allele (Esr1em1Soar) in HsdHot:SD to the ACI/SegHsd background for 12 generations. ACI strain is particularly sensitive to Estrogen-induced tumorigenesis. Rat Resource and Research Center mutant Unknown (as of 2019-02-28) Esr1^em1Soar 12910736 1 35523680 35759891 1 - by flanking markers 1 42534049 42935434 1 - by flanking markers 1 41192029 41594799 1 - by flanking markers 14392813 SD-Cftr^em1Sage+/- Cftr ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. This Cftr heterozygous rats exhibited similar bioelectric and other characteristics to wild-type. Horizon Discovery mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2019-03-04) Cftr^em1Sage 14392814 4 43874852 44041870 1 - by flanking markers 4 42281040 42448571 1 - by flanking markers 4 42693263 42860679 1 - by flanking markers 14392815 SD-Cftr^em1Sage-/- CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats are produced by crossing the Cftr heterozygous rats. Horizon Discovery mutant Unknown (as of 2019-03-04) Cftr^em1Sage 14392814 4 43874852 44041870 1 - by flanking markers 4 42281040 42448571 1 - by flanking markers 4 42693263 42860679 1 - by flanking markers 14392817 SD-Cftr^em1Sage+/+ CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats and wild-type rats are produced by crossing the Cftr heterozygous rats. mutant Unknown 14394485 SD-Bace1^em1Sage The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) mutant Unknown Bace1^em1Sage 13782148 8 48817824 48839681 1 - by flanking markers 8 48766005 48788272 1 - by flanking markers 8 50140092 50162388 1 - by flanking markers 14394486 SD-Bace1^em1Sage+/- SD-Bace1^em1Sage+/Bace1^em1Sage- The Bace1 (+/-) rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) mutant Unknown Bace1^em1Sage 13782148 8 48817824 48839681 1 - by flanking markers 8 48766005 48788272 1 - by flanking markers 8 50140092 50162388 1 - by flanking markers 14394487 SD-Bace1^em1Sage+/+ SD-Bace1^em1Sage+/Bace1^em1Sage+ The Bace1 (+/+) rats were generated by crossing SD-Bace1em1Sage. The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) mutant Unknown 14394488 Lew-Glp1r^em2Mcwi CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. MCW Gene Editing Rat Resource Center mutant Unknown Glp1r^em2Mcwi 14394489 20 9225881 9264184 1 - by flanking markers 20 11768479 11808416 1 - by flanking markers 20 9586075 9626228 1 - by flanking markers 14394491 Lew-Glp1r^em3Mcwi CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. MCW Gene Editing Rat Resource Center mutant Unknown Glp1r^em3Mcwi 14394492 20 9225881 9264184 1 - by flanking markers 20 11768479 11808416 1 - by flanking markers 20 9586075 9626228 1 - by flanking markers 14394494 SS-Kcnj2^em2Mcwi CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2019-03-22) Kcnj2^em2Mcwi 14394495 10 100574985 100576268 1 - by flanking markers 10 99125234 99134077 1 - by flanking markers 10 99429337 99442520 1 - by flanking markers 14394496 SS-Kcnj2^em4Mcwi CRISPR/Cas9 system was used to introduce a 2-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. MCW Gene Editing Rat Resource Center mutant Unknown Kcnj2^em4Mcwi 14394497 10 100574985 100576268 1 - by flanking markers 10 99125234 99134077 1 - by flanking markers 10 99429337 99442520 1 - by flanking markers 14394501 SHR-Klrb1a^em1Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2019-03-25) Klrb1a^em1Mcwi 14394503 4 165637478 165654188 1 - by flanking markers 4 227150602 227167004 1 - by flanking markers 4 161950270 161966582 1 - by flanking markers 14394504 SHR-Klrb1a^em2Mcwi CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. MCW Gene Editing Rat Resource Center mutant Unknown (as of 2019-03-25) Klrb1a^em2Mcwi 14394505 4 165637478 165654188 1 - by flanking markers 4 227150602 227167004 1 - by flanking markers 4 161950270 161966582 1 - by flanking markers 14394506 SS-P2ry2^em5Mcwi CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2019-03-25) P2ry2^em5Mcwi 14394507 14394508 BBDR.BBDP-(D4Mit6-D4Mit7)-Tlr4^em5Mcwi CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2019-03-25) Tlr4^em5Mcwi 14394509 5 83564100 83577735 1 - by flanking markers 5 86690670 86704302 1 - by flanking markers 5 82587424 82601056 1 - by flanking markers 14394515 LE-Grin2b^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Grin2b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 3. Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center mutant Unknown Autism, Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) Grin2b^em1Mcwi 14394517 4 172721895 173183187 1 - by flanking markers 4 233806406 234260360 1 - by flanking markers 4 169541620 170000216 1 - by flanking markers 14394518 LE-Arid1b^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4. Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center mutant Unknown Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) Arid1b^em1Mcwi 14394519 1 40012872 40324266 1 - by flanking markers 1 47197399 47550032 1 - by flanking markers 1 45923119 46232301 1 - by flanking markers 14394520 SS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1Mcwi SS-Tg(CAG-loxP-stop-loxP-Rpl10a-GFP)1 The Sleeping Beauty transposon system was used to introduce a Rpl10a-GFP fusion driven by a ubiquitous promoter, interupted by a floxed stop cassette MCW Gene Editing Rat Resource Center transgenic Unknown 14394616 DA-Tph2^em3Mcwi+/+ This wild type strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Unknown Tph2^em3Mcwi 10402820 7 54321033 54430706 1 - by flanking markers 7 58053268 58157949 1 - by flanking markers 7 58042279 58149220 1 - by flanking markers 14394617 DA-Tph2^em3Mcwi+/- The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Unknown Tph2^em3Mcwi 10402820 7 54321033 54430706 1 - by flanking markers 7 58053268 58157949 1 - by flanking markers 7 58042279 58149220 1 - by flanking markers 14394618 DA-Tph2^em3Mcwi-/- This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Unknown Tph2^em3Mcwi 10402820 7 54321033 54430706 1 - by flanking markers 7 58053268 58157949 1 - by flanking markers 7 58042279 58149220 1 - by flanking markers 14394619 DA-Tph2^em2Mcwi+/+ This wild type strain was produced by crossing Tph2em2Mcwi heterozygous rats and confirmed by sequencing. The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Unknown 14394620 DA-Tph2^em2Mcwi+/- The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. PhysGen Knockouts mutant Unknown Tph2^em2Mcwi 10402817 7 54321033 54430706 1 - by flanking markers 7 58053268 58157949 1 - by flanking markers 7 58042279 58149220 1 - by flanking markers 14394621 DA-Tph2^em2Mcwi-/- The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. PhysGen Knockouts mutant Unknown Tph2^em2Mcwi 10402817 7 54321033 54430706 1 - by flanking markers 7 58053268 58157949 1 - by flanking markers 7 58042279 58149220 1 - by flanking markers 14398460 SS-Cd40^em1Uthal-/- Zinc Finger Nuclease (ZFN) was utilized to knockout rat CD40 function in the embryos of SS/JrHsd rats. The target sequence (CAGCACCGACACTGCgaactcAGTGCGTGGGGCTGCCGGG) introduced an 11 bp-deletion (CTGCGAACTCA) in the third exon of the Cd40 gene, resulted in a trucated protein. Rat Resource and Research Center mutant Unknown Cd40^em1Uthal 14398461 3 156092602 156107427 1 - by flanking markers 3 167704285 167719416 1 - by flanking markers 3 161519789 161534943 1 - by flanking markers 14398463 SS-Prr5^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2019-04-19) Prr5^em1Mcwi 40818256 7 122693577 122714377 1 - by flanking markers 7 125317939 125338782 1 - by flanking markers 7 125569791 125609340 1 - by flanking markers 14398465 SS-Prr5^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in the exon 1 of the gene. MCW Gene Editing Rat Resource Center mutant Cryopreserved Sperm (as of 2019-04-19) Prr5^em2Mcwi 40818255 7 122693577 122714377 1 - by flanking markers 7 125317939 125338782 1 - by flanking markers 7 125569791 125609340 1 - by flanking markers 14398479 SS-Xdh^em1Mcwi CRISPR/Cas9 system was used to introduce a 7-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. MCW Gene Editing Rat Resource Center mutant Unknown Xdh^em1Mcwi 14398480 6 21417685 21590015 1 - by flanking markers 6 34996983 35059195 1 - by flanking markers 6 25149570 25211273 1 - by flanking markers 14398481 SS-Xdh^em2Mcwi CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. MCW Gene Editing Rat Resource Center mutant Unknown Xdh^em2Mcwi 14398482 6 21417685 21590015 1 - by flanking markers 6 34996983 35059195 1 - by flanking markers 6 25149570 25211273 1 - by flanking markers 14398499 LE-Drd1^{em1(iCre)Berke} The CRISPR system was used to created target insertion of iCre recombinase to the Drd1 (Drd1a) locus of the embryos of BluHsd:LE. Rat Resource and Research Center mutant Live Animals (as of 2021-02-12) Drd1^{em1(iCre)Berke} 14398500 17 16655926 16658161 1 - by flanking markers 17 13211031 13215581 1 - by flanking markers 17 11099736 11104352 1 - by flanking markers 14398734 LE-Adora2a^{em1(iCre)Berke} The CRISPR system was used to created target insertion of iCre recombinase immediately after Adora2a gene, with P2A linker, of the embryos of BluHsd:LE. Rat Resource and Research Center mutant Live Animals (as of 2021-02-12) Adora2a^{em1(iCre)Berke} 14398735 14398825 SD-Fah^em15Dlli-/- This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates. East China Normal University, Shanghai, China. mutant Unknown Fah^em15Dlli-/- 14398826 1 140851975 140876187 1 - by flanking markers 1 147640316 147662920 1 - by flanking markers 1 146713663 146736339 1 - by flanking markers 14398828 SD-Fah^em10Dlli-/- This strain was produced by injecting Sprague Dawley embryo with CRISP/Case9 system targeting the exon 2 of rat Fah gene. The resulting mutation is a 10-bp deletion in exon 2 caused premature stop in the Fah protein. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates East China Normal University, Shanghai, China. mutant Unknown Fah^em10Dlli-/- 14398829 1 140851975 140876187 1 - by flanking markers 1 147640316 147662920 1 - by flanking markers 1 146713663 146736339 1 - by flanking markers 14402419 LE-Chrna5^em18Pas The Zinc Finger Nuclease system was used to create184-bp deletion at the beginning of exon 5 thus created the premature stop coden. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous. Strains were produced at Institut Pasteur (France), Departement de Neuroscience, Benoit Forget. The lines will be maintained at Charles River Laboratory France (CRLF). mutant Unknown Chrna5^em18Pas 14402420 8 58538002 58566388 1 - by flanking markers 8 58143974 58172330 1 - by flanking markers 8 59561817 59590172 1 - by flanking markers 14402421 LE-Chrna5^{em20(D398N)Pas} The Zinc Finger Nuclease system was used to knock-in SNP rs16969968 in exon 5 (D398N) thus created a missense mutation. The embryos were from breeding of Long Evans from Janvier Labs (RjOrl:LE) and reimplanted to foster mother Dark Agouti (Janvier). Heterozygous rats are currently bred to generate heterozygous and homozygous. Strains were produced at Institut Pasteur (France), Departement de Neuroscience, Benoit Forget. The lines will be maintained at Charles River Laboratory France (CRLF). mutant Unknown Chrna5^{em20(D398N)Pas} 14402422 8 58538002 58566388 1 - by flanking markers 8 58143974 58172330 1 - by flanking markers 8 59561817 59590172 1 - by flanking markers 14694847 LE-Pvalb^{em1(flpo)Berke}/Rrrc A double-stranded DNA plasmid donor was synthesized to introduce self-cleaving peptide 2A (P2A),followed by Flpo recombinase,and the V5 peptide tag (GKPIPNPLLGLDST) before the termination codon in exon 5 of rat Parvalbumin. The CRISPR/Cas9 system was used to knock in the plasmid into the targeted gene in the Crl:LE embryo. (ref:bioRxiv preprint first posted online Aug. 7, 2018; doi: http://dx.doi.org/10.1101/386474. ) Rat Resource and Research Center mutant Unknown Pvalb^{em1(flpo)Berke} 14694849 7 116115034 116127508 1 - by flanking markers 7 119420581 119435235 1 - by flanking markers 7 119428657 119443674 1 - by flanking markers 14694998 SD-Sdhb^em1Ast This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 4 bp-deletion in Sdhb. Rat Resource and Research Center mutant Unknown 14694999 SD-Sdhb^em2Ast This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 6 bp-deletion in Sdhb. Rat Resource and Research Center mutant Unknown 14695000 SD-Sdhb^em3Ast This mutant strain was generated by injecting TALEN targeting rat Sdhb into NTac:SD embryo. The resulting mutant is a 15 bp-deletion in Sdhb. Rat Resource and Research Center mutant Unknown 14695002 SD-L1cam^em1Jgn The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 1bp-insertion (206_207insT) in exon 4. No protein expression was detected in the brain. Rat Resource and Research Center mutant Unknown L1cam^em1Jgn 38599015 X 159784792 159801553 1 - by flanking markers 1 152649353 152676124 1 - by flanking markers X 156901244 156928064 1 - by flanking markers 14695003 SD-L1cam^em2Jgn The CRISPR/Cas9 genome editing system was used to generate L1cam mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 4 of the rat L1cam created a 300 bp-deletion(c.205_505del) in exon 4. No protein expression was detected in the brain. Rat Resource and Research Center mutant Unknown L1cam^em2Jgn 14696788 X 159784792 159801553 1 - by flanking markers 1 152649353 152676124 1 - by flanking markers X 156901244 156928064 1 - by flanking markers 14695004 BBDR.F344-(D4Mgh24-D4Rhw6),BBDP-(D4Rhw6-D4Rhw10)/Rhw 3 Mb of F344 DNA introgressed on Chr.4 between D4Mgh24 (73.75 Mb) and D4Rhw6 (76.83 Mb), and BB diabetes prone (DP) DNA introgressed from D4Rhw6 to D4Rhw10 (the most distal marker the end of the chromosome) Rat Resource and Research Center congenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-06-27) 14695026 W-Tg(Crh-cre)Msg Cre recombinase has been inserted into the genome under the control of the Crh promoter. Generated on Wistar and backcrossed to Wistar every generation. Rat Resource and Research Center transgenic Live Animals (as of 2021-02-12) 14695028 SD.DA-Kcnh2^{tm(EGFP-Pac)1Qly} This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.3kb 5' and 2.1kb 3' homology arm. The Kcnh2 gene 7th and 8th exons are replaced with a CAG-EGFP-IRES-Pac cassette. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain. Rat Resource and Research Center mutant Unknown 14695029 SD.DA-Kcnh2^{tm(FRT-CAG-EGFP-IRES-Pac-FRT)1Qly} This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 7.5kb 5' and 1.6kb 3' homology arm. A FRT-CAG-EGFP-IRES-Pac-FRT cassette is inserted into the intron between 8th and 9th exons of Kcnh2 gene. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain Rat Resource and Research Center mutant Unknown 14695030 SD.DA-Pex1^{Tm(G843D-FRT-CAG-Pac-FRT)1Qly} This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 5.8kb 5' and 1.7kb 3' homology arms. A G843D point mutation is introduced into the Pex1 gene. The 12th and 13th exons are flanked with two loxP sites. A FRT-CAG-Pac-FRT cassette is inserted into the intron between Pex1 13th and 14th exon. This strain mimics the Peroxisomal Disorders. Heterozygote does not show any abnormalities. Rat Resource and Research Center mutant Unknown 14695031 SD.DA-Il2rg^{Tm(G843D-FRT-CAG-Pac-FRT)1Qly} This strain was made by electroporation of DAc8 embryonic stem cells with a targeting vector containing 6.0kb 5' and 1.8kb 3' homology arms and a FRT-CAG-Pac-FRT cassette. The FRT-CAG-Pac-FRT cassette is inserted into the intron between Il2rg 4th and 5th exon. No genomic sequence is deleted. Chimeras were formed by microinjecting into F344 blastocysts. Founder animals were mated with SD rats to produce this strain. Rat Resource and Research Center mutant Unknown 14695032 SD-Tg(CAG-loxP-mCherry-loxP-EGFP)1Qly A CAG-loxP-mCherry-loxP-EGFP cassette was injected into SD zygote to generate this line. The integration site is not determined. This transgenic line could be mated to other rat lines that express Cre/CreER for lineage tracing. Rat Resource and Research Center transgenic Unknown 14695033 SD-Tg(CAG-Flpe)Qly A CAG-Flpe cassette was injected into SD zygote to generate this line. The integration site is not determined.This transgenic line could be used to mate with other rat models that contains FRT sites to remove the cassette that is flanked by those FRT sites. Rat Resource and Research Center transgenic Unknown 14695034 ZUC-Lepr^fa.BN-(D1Rat183-D1Rat90)/Ste Congenic for distal half of Chromosome 1 from D1Rat183 to D1Rat90 from Brown Norway (BN) on the UC Davis ZUC Lepr faSte/+ strain background. The genetic backgound of the ZUC strain carries a defective leptin receptor on Chromosome 4. Rat Resource and Research Center congenic Unknown 14695052 ACI-Tg(ROSA26-ALPP)Rrrc F344-Tg(ROSA26-ALPP)EpsRrrc (RGD:1566458) received in 1999 from Dr. Eric Sandgren, Univ. Wisconsin-Madison. Since 1999 bred on ACI background. Rat Resource and Research Center transgenic Cryopreserved Sperm (as of 2019-07-01) ALPP 1314395 14695053 ZDF-Cnr1^em1/Rrrc ZDF-Cnr1^em1 11bp deletion from genomic DNAfor the cannabinoid-1 receptor (Cnr1)using Zinc-Fingers Nucleases. Animals are resistant to the development of type-2 diabetes. Rat Resource and Research Center mutant Unknown 14695054 F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551Bryd F344-Tg(CAG-loxP-STOP-loxP-ZsGreen)551 Rat Resource and Research Center transgenic Live Animals (as of 2019-07-01) 14695055 MHS/Roman Milan Hypertensive Strain Inbred hypertension model linked to a mutation in Add1 gene that has been validated as one of the genes linked to hypertension in numerous human genetic studies. Inbred strain originally developed by Dr. Bianchi in Milan in 1979. Rat Resource and Research Center inbred Unknown 14695058 SD-Add3^em1Roman frame shift deletion in an exon 12 of Add3 gene causing a stop codon and loss of function. SD outbred background. Rat Resource and Research Center mutant Unknown 14695059 BBDP/WorSunn.WAG-rnu/Sunn To develop BBDP rats congenic for the rnu mutation (nude BBDP), researchers introgressed the rnu mutation from inbred rnu/rnu WAG rats (obtained from Biomedical Research Models) using marker assisted genotyping. Rat Resource and Research Center congenic Unknown 14695060 WKY-Tg(Ef1a-GFP)Tja Transgenic strain using Sleeping Beauty transposon germline transgenesis, ubiquitously expressing green fluorescent protein (GFP) under the rat elongation factor 1 alpha (Ef1a) promoter. Two integration sites located on chromosome 8:28170658 and chromosome 1:276465837, both located in intronic gene areas, Jam3 (RGD:1303248) intron 1 and Vti1a (RGD:621490) intron 6, respectively. The Jam3 intron 1 is 51bp long, and the transgene resides at 37kb from exon 1 and 13kb from exon 2. In Vti1a intron 6, 102 bp long, the transgene is located at 81.4 kb from exon 5 and 21 kb from exon 6. Rat Resource and Research Center transgenic Unknown 14695061 W/Lob Male L-W develop spontaneous tumors in the anterior and ventral prostate and the seminal vesicle @ an average of 20 months. Tumors can be induced with N-methylnitrosourea and testosterone propinate in an average of 10 months. A cell line of a prostate adenocarcinoma was also created from the strain (PAIII) and can be administer SC in L-W rats with palpable tumor in 7-14 days and metastasis to the lymph nodes and lungs in 28-30 days. Rat Resource and Research Center mutant Unknown 14695063 BN.LEW-(D10Rat258 and D10Rat51)/Ssn Severe osteopetrosis with numerous non-functioning osteoclasts. Locus on chromosome 10. Homozygotes not fertile, need to test breed to ID heterozygotes. Homozygotes have no teeth, require ground food. One of only 4 osteopetrotic mutations in rat. Genetic lesion is not yet known but mutation is inherited in an autosomal recessive manner. The candidate gene region has been localized to Chr 10 between D10Rat258 and D10Rat51. original background strain is LEW/Ssn. Rat Resource and Research Center congenic Unknown 10 11212678 13365903 1 - by flanking markers 10 10039921 13302032 1 - by flanking markers 10 11278340 13486971 1 - by flanking markers 14695083 W/Lnne Audiogenic Wistar rat Wistar rats maintained at the animal facility of the Ribeirao Preto School of Medicine at the University of Sao Paulo, Brazil, were tested for audiogenic seizures, using as criteria an SI and the L1 (ref. RGD:14695082). The WAR colony foundation stock was produced by mating animals displaying at least procursive behaviors in three consecutive tests, one every 4 days (two males and four females). Each couple produced two or three lit-ters, from which selected individuals displaying the highest SI and shortest L1 were mated, at adult age,with their fathers and mothers. From the second generation on, brother and sister matings were done, in a ratio of one male to two females, selected accordingto the criteria above. Rat Resource and Research Center inbred Unknown 14695085 SD-Trim63^em1(hiLuc)/Rrrc The use of zinc finger nuclease technology (ZFN) to knockin a luciferase reporter directly downstream of MuRF1 (Trim63) coding sequences in rats,leaving endogenous MuRF1 gene expression intact and bicistro-nically linking it to the inserted reporter through a hepatitis CIRES (HCV-IRES). The resulting knockin rat line, MuRF1-hiLUCs, has reporter characteristics that are fully reflective ofendogenous MuRF1 gene expression, can be used as a universalbiomarker of skeletal muscle atrophyin vivo, and has abioluminescent readout compatible with whole animal imagingmodalities. Rat Resource and Research Center mutant Unknown Trim63^em1(hiLuc) 14696789 5 153059573 153073907 1 - by flanking markers 5 156292566 156306092 1 - by flanking markers 5 152533362 152547138 1 - by flanking markers 14695086 Zuc/VcJw Zucker fatty The original background strain derived from Sherman and Merck stock M rats (13 M strain). Obese animals produced by crossing homozygous obese males to heterozygous lean females. Rat Resource and Research Center inbred Unknown 14695088 WMS/SimfBR Munich Wistar Received from Munich, Germany via the V.A. San Francisco as line bred stock. Caesarean rederived when pedigreed brother x sister matings began. Selected for surface glomeruli and prominent elongated nephrons at the 6th, 12th and 18th .This strain also possess elongated nephrons. Unlike other Wistar strains with surface glomeruli, these animals do not become proteinuric as they age, which allows for the study of long term, chronic models. Age related proteinuria and spontaneous renal disease could interfere with experimentally-induced conditions. Rat Resource and Research Center inbred Cryopreserved Embryo (as of 2019-07-03) 14695547 LEW-Tg(HLA-B*2705,B2M)33-3Trg This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 55 copies of HLA-B*2705 and 29 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center . Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08) B2M|HLA-B 735892|1352836 14695548 LEW-Tg(HLA-B*2705,B2M)21-4HTrg This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 150 copies of HLA-B*2705 and 90 copies of human beta-2-microglobulin gene. The transgenic strain was transferred from Dr. Joel Taurog, University of Texas Southwestern Medical School in Dallas to the Rat Resource and Research Center . Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2019-07-08) B2M|HLA-B 735892|1352836 14696715 SD-Htr7^em1Msu CRISPR/Cas9 system was used to generate this mutant; this induced an 11 bp deletion in exon 1 and a 4 bp deletion in exon 2 of the Htr7 gene. Transgenic and Genome Editing Facility, and Institute for Quantitative Health Science and Engineering, Michigan State University, East Lansing, Michigan mutant Unknown Htr7^em1Msu 14696716 1 240136279 240260620 1 - by flanking markers 1 261759122 261879914 1 - by flanking markers 1 254547964 254671811 1 - by flanking markers 14696719 F344-Trpc4^{Tn(sb-T2/Bart3)2.192Mcwi+/+} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the wild type mutant. PhysGen, Transposagen, Rat Resource and Research Center mutant Unknown 14696720 F344-Trpc4^{Tn(sb-T2/Bart3)2.192Mcwi-/-} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the homozygous mutant. PhysGen, Transposagen, Rat Resource and Research Center mutant Unknown 14696721 F344-Trpc4^{Tn(sb-T2/Bart3)2.192Mcwi-/+} These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Trpc4 gene. The heterozygotes were intercrossed to produce the heterozygous mutant. PhysGen, Transposagen, Rat Resource and Research Center mutant Unknown 14696722 SD-Cyp3a23/3a1^em1Myliu,Cyp3a2^em1Myliu This rat strain is a double knock out for Cyp3a23/3a1 and Cyp3a2 created by using CRISPR/Cas9 targeting exons of Cyp3a23/3a1 and Cyp3a2. This strain carries a 22-bp deletion of Cyp3a23/3a1 and a 10-bp deletion of Cyp3a2 on Sprague Dawley background. East China Normal University and Shanghai Changzheng Hospital Joint Research Center for Orthopedic Oncology, Shanghai Key Laboratory of Regulatory Biology Institute of Biomedical Sciences and School of Life Sciences. Shanghai, China mutant Unknown Cyp3a23-3a1^em1Myliu|Cyp3a2^em1Myliu 14696724|14696725 12;12 9567120;9517016 9595974;9541000 1 - by flanking markers;1 - by flanking markers 12;12 13145742;13719927 13174596;13740743 1 - by flanking markers;1 - by flanking markers 12;12 11053888;11641500 11082742;11677818 1 - by flanking markers;1 - by flanking markers 14700890 SD-Tg(Cx3cr1-cre/ERT2)3Ottc This strain was generated by microinjection of Sprague-Dawley embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. Rat Resource & Research Center transgenic Live Animals (as of 2021-02-12) 14975242 ACI.FHH-(rs105487995-rs105373896)/Mcwi This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. Medical College of Wisconsin congenic Unknown 14975243 ACI.FHH-(rs105487995-rs106411696)/Mcwi This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. Medical College of Wisconsin congenic Unknown 14975244 ACI.FHH-(rgdv393055223-rs107095981)/Mcwi This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] ((also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. Medical College of Wisconsin congenic Unknown 14975245 ACI.FHH-(rgdv393055223-rs198922144)/Mcwi This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. Medical College of Wisconsin congenic Unknown 14975246 ACI.FHH-(rgdv393055223-rs198076037)/Mcwi This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. Medical College of Wisconsin congenic Unknown 14975247 ACI.FHH-(rs105373896-rgdv253272372)/Mcwi This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. Medical College of Wisconsin congenic Unknown 14975248 ACI.FHH-(rs198076037-rs105278863)/Mcwi This congenic line was produced by backcrossing ACI.FHH-[D1Rat74-D1Rat90] (also named Rf-1A, RGD:5143940) congenic rats to ACI rats to initiate the generation of Rf-1 congenic sublines. Offspring that had inherited a desirable recombination within the Rf-1 region were selected. These selected offspring were backcrossed and intercrossed to produce homozygous congenic sublines used for phenotyping. Medical College of Wisconsin congenic Unknown 14975305 F344-Bmpr2^em1Sage+/- These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 527 bp across intron and exon1 boundary. The strains of both sexes were confirmed Bmpr2 haplodeficiency. VA Palo Alto Health Care System, Stanford University School of Medicine mutant Unknown Bmpr2^em1Sage 14981587 9 58327587 58436057 1 - by flanking markers 9 66371542 66486121 1 - by flanking markers 9 66568074 66683019 1 - by flanking markers 14981588 F344-Bmpr2^em2Sage+/- These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Bmpr2 into F344 embryos. The zinc-finger nuclease mediated genome editing system created a deletion of 16 bp in exon1. The strains of both sexes were confirmed Bmpr2 haplodeficiency. VA Palo Alto Health Care System, Stanford University School of Medicine mutant Unknown Bmpr2^em2Sage 14981589 9 58327587 58436057 1 - by flanking markers 9 66371542 66486121 1 - by flanking markers 9 66568074 66683019 1 - by flanking markers 14981597 SD-Tg(SOD1*G93A)26DwcTac SD rats were microinjected with a linear 12 kb EcoRI-BamH1 fragment containing the coding sequence and promoter region of human SOD1 gene with G93A mutation. Originally created by John Kulik at Wyeth. Transgenic Model of SOD1 mediated Amyotrophic Lateral Sclerosis (ALS, Lou Gehrig's Disease). Came to Taconic in April 2002 for David Howland at Wyeth for distribution as an Emerging Model. Joint collaboration between Wyeth and The ALS Association. TACONIC transgenic Unknown SOD1 730855 14985210 LE-Cyfip1^em1Sage+/- The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8. mutant Unknown Cyfip1^em1Sage 14985211 1 107245993 107334337 1 - by flanking markers 1 115265128 115353515 1 - by flanking markers 1 114258773 114347138 1 - by flanking markers 14995941 Wpk Wistar polycystic kidney rat The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). This mutation was not present in the parental Wistar strain. mutant Unknown Tmem67^wpk 14995943 5 26324625 26377531 1 - by flanking markers 5 30371964 30424943 1 - by flanking markers 5 25666138 25721056 1 - by flanking markers 15017093 Wpk ^+/- Wpk heterozygous rat The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). mutant Unknown Tmem67^wpk 14995943 5 26324625 26377531 1 - by flanking markers 5 30371964 30424943 1 - by flanking markers 5 25666138 25721056 1 - by flanking markers 15017094 Wpk ^-/- Wpk homozygous rat The wpk mutation was first recognized in 1994 in a colony of outbred Wistar rats at Utrecht University (Utrecht, The Netherlands). In 1996, a breeding pair of test-proven heterozygotes were transferred to the University of Rotterdam (Rotterdam, The Netherlands), and a new subcolony was initiated. This colony has been maintained by brother-sister matings for more than five generations. Individuals heterozygous for the mutant allele were identified in each generation by test-crossing phenotypically normal offspring from known heterozygotes. A single C to T substitution in exon 12 was identified as the mutated allele in the Wpk rat. This mutation converts a proline to a leucine in the protein products(P394L). mutant Unknown Tmem67^wpk 14995943 5 26324625 26377531 1 - by flanking markers 5 30371964 30424943 1 - by flanking markers 5 25666138 25721056 1 - by flanking markers 15036806 WKAH/Tj Wistar-King A, WKA WKAH/Tj inbred rats were bred in the Institute for Animal Experimentation, the University of Tokushima School of Medicine, under specific pathogen free conditions. inbred Unknown (as of 2019-11-18) 15045605 SD-Tg(Prnp-LacZ/EGFP)12084 This transgenic strain line 12084 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter. transgenic Unknown 15045606 SD-Tg(Prnp-LacZ/EGFP)12085 This transgenic strain line Tg12085 carries the dual-reporter LacZ/EGFP (enhanced green fluorescent protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgenes were driven by rat Prnp promoter. transgenic Unknown 15045607 SD-Tg(Prnp-Prnp)2919 This transgenic strain line Tg2919 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter. transgenic Unknown 15045608 SD-Tg(Prnp-Prnp)2922 This transgenic strain line Tg2922 carries the open reading frame of rat Prnp (prion protein) cloned into the rat Prnp vector (raPrnp) and the expression of transgene were driven by rat Prnp promoter. transgenic Unknown 15090817 WI-Ahr^em1Hyama+/- Heterozygous rats carrying a defective exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI. mutant Unknown Ahr^em1Hyama 15090818 15090819 WI-Ahr^em1Hyama-/- The homozygous rats carrying 2 defective Ahr genes. The deletion of part of exon 2 in rat Ahr gene was created by injecting TALEN mRNA containing 5'-TTCTAAACGACACAGAGACCGGCTGAACACAGAGTTAGACCGCCTGGCTA-3' to embryos of JclKud:WI. mutant Unknown Ahr^em1Hyama 15090818 18182944 SS-Vwf^em2Mcwi-/- CRISPR/Cas9 mediated gene editing was used to delete a 130,954bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos MCW Gene Editing Rat Resource Center, through Versiti Blood Research Institute mutant Live Animals (as of 2020-01-14) Bleeding Disorders Vwf^em2Mcwi 18182945 4 161723415 161854766 1 - by flanking markers 4 225098521 225229257 1 - by flanking markers 4 158085059 158219525 1 - by flanking markers 18182946 SS-Vwf^em3Mcwi-/- CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos MCW Gene Editing Rat Resource Center, through Versiti Blood Research Institute mutant Cryopreserved Sperm (as of 2020-01-14) Bleeding Disorders Vwf^em3Mcwi 18182947 4 161723415 161854766 1 - by flanking markers 4 225098521 225229257 1 - by flanking markers 4 158085059 158219525 1 - by flanking markers 18337282 Iar: LE Long-Evans Rats This strain was established by Dr. Long and Dr. Evans in 1915. This traces its roots to Monash University to Tohoku University in 1984; to Institute for Animal Reproduction through acquisition in 1996. Institute for Animal Reproduction outbred Unknown Ophthalmology, Behavior 19165133 F344;SD-C3^em1Linf This mutant strain was created by CRISPR/Cas9 genome editing system. The mutant carried insertion of a premature termination codon in exon 2 and was predicted to result in loss of protein expression due to non-sense mediated decay of mRNA. The heterozygous knock out rats (F344/Sprague Dawley mixed background) were bred to each other, and the pups were genotyped to identify the WT and C3 homozygous knock out littermates. The animal facility of Lerner Research Institute, Cleveland Clinic mutant Unknown C3^em1Linf 19165134 9 8728465 8754412 1 - by flanking markers 9 9721137 9747084 1 - by flanking markers 19259464 SHR-Camk2n1^em1Tja-/- SHR-Camk2n1^em1Tja-/Camk2n1^em1Tja- SHR-Camk2n1-/- knockout rats were generated on an SHR/NCrl background by microinjecting zinc-finger nuclease (ZFN) mRNA (Sigma), targeted to exon 1 of Camk2n1, into one-cell stage SHR/NCrl embryos that were implanted into pseudopregnant rats. Heterozygous progeny, from a founder harboring a 38bp deletion in Camk2n1, were intercrossed to generate homozygous knockout rats. mutant Unknown Camk2n1^em1Tja 19259465 5 157235534 157237314 1 - by flanking markers 5 160625616 160627396 1 - by flanking markers 5 156876706 156878486 1 - by flanking markers 21079475 SD-Lepr^em4Lizh The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR. Chinese Academy of Medical Sciences & Comparative Medical Center, Peking Union Medical College, China mutant Unknown 21083604 SD-ROSA26 ^{em1(LTR-nLuc)Ottc} The CRISPR/Case9 knock-in rats have cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. Optogenetics and Transgenic Technology Core mutant Unknown 21409748 DA/Mmab Dark Agouti Dark Agouti rats which were bred and housed at the Military Medical Academy in Belgrade, Serbia Military Medical Academy, Serbia inbred Unknown 21409752 DA/Ibiss Dark Agouti Dark agouti rats were bred and housed at Institute for biological research Sinisa Stankovic, Belgrade, Serbia inbred Unknown 25314294 MWF/Ztm Munich Wistar Fromter Fromter selected from outbred Munich-Wistar rats for large numbers of superficial glomeruli. inbred Unknown 25330087 LE-Cntnap2^em1Mcwi The rat strain was produced by injecting CRISPR/Cas9 targeting rat Cntnap2 into Crl:LE embryos. The result is a 1-bp deletion in exon 6 of the gene. Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center mutant Unknown Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Bipolar disorder (from SFARI GENE) Cntnap2^em1Mcwi 25330101 25330088 LE-Chd8^em1Mcwi The rat strain was produced by injecting the CRISPR/Cas9 system targeting rat Chd8 gene of Crl:LE embryos. The result is a 5-bp deletion in exon 3 of rat Chd8 gene. Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center mutant Unknown Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia (from SFARI GENE) Chd8^em1Mcwi 25330100 15 27642767 27704443 1 - by flanking markers 15 32423198 32482762 1 - by flanking markers 15 28612932 28672574 1 - by flanking markers 25330089 LE-Nrxn1^em1Mcwi The rat strain was produced by injecting CRISPR/Cas9 targeting rat Nrxn1 into Crl:LE embryos. The result is a 4-bp deletion in exon 1. Generated with support from the Simons Foundation Autism Research Initiative (SFARI ); MCW Gene Editing Rat Resource Center mutant Unknown Autism, ADHD, Developmental delay, Intellectual disability, Epilepsy, Schizophrenia, Bipolar disorder (from SFARI GENE) 25330091 SS-Rictor^em4Mcwi CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene. MCW Gene Editing Rat Resource Center mutant Unknown Rictor^em4Mcwi 40818254 2 55982784 56071528 1 - by flanking markers 2 75754848 75846705 1 - by flanking markers 2 56013898 56105818 1 - by flanking markers 25330093 SD-Mir146b^em1Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a 7-bp deletion in Mir146b. MCW Gene Editing Rat Resource Center mutant Unknown 25330342 SS-Rr1^em3Mcwi CRISPR/Cas9 was used to introduce a large deletion in the regulatory region near rat Npr3 gene. The deletion location is at the genomic region chr2:82815769-82845639 (Rn5) MCW Gene Editing Rat Resource Center mutant Unknown 25394526 LE-Dyrk1a^em3Mcwi The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center mutant Unknown Developmental delay, Intellectual disability, Epilepsy (from SFARI GENE) 25394528 SD-Ephx2^em2Mcwi CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. MCW Gene Editing Rat Resource Center mutant Unknown Ephx2^em2Mcwi 25394529 15 45497660 45556101 1 - by flanking markers 15 48799823 48836848 1 - by flanking markers 15 42757241 42794211 1 - by flanking markers 25394530 LE-Scn2a^em1Mcwi The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The mutant allele was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The resulting mutation is net 4-bp deletion in exon 5 comprising a 10-bp deletion (shown in lower case: CTACGGGATccctggaattGGTTGGATTTCACAGTCATT ) and a 6-bp insertion (TTCACT). MCW Gene Editing Rat Resource Center mutant Unknown Scn2a^em1Mcwi 25394531 3 47588413 47722800 1 - by flanking markers 3 58322640 58456658 1 - by flanking markers 3 51687910 51822008 1 - by flanking markers 25394532 LE-Scn2a^em2Mcwi The rat strain was produced by injecting CRISPR/Cas9 targeting rat Scn2a into Crl:LE embryos. The result is a 4-bp deletion in exon 5 of the gene. MCW Gene Editing Rat Resource Center mutant Unknown Scn2a^em2Mcwi 25394533 3 47588413 47722800 1 - by flanking markers 3 58322640 58456658 1 - by flanking markers 3 51687910 51822008 1 - by flanking markers 25824850 NHla:SD The colony history began with a colony of rats established by Robert Dawley around 1925. SD rats are often referred to as "Sprague-Dawley" Mr. Dawley used both his name and the maiden name, "Sprague", of his wife to create the name of the stock. The colony then went to Sprague Dawley, Inc. in 1945. NIH began a closed colony with animals obtained from Sprague Dawley, Inc. Hilltop Lab Animals, Inc. received animals from NIH in 1984. Through cesarean rederivation, the animals were fostered onto gnotobiotic rats in isolation. Descendants of these animals then became the colonies currently available. All colony histories contain some possibility of inaccuracy. This information is provided to the best of Hilltop's knowledge. Hilltop Lab Animals, Inc. (http://www.hilltoplabs.com/public/sd.html) Hilltop Lab Animals, Inc. outbred Unknown 27095885 SS.BN-(D13Hmgc41-D13Rat101)-Ren^em2Mcwi This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS.BN(D13Hmgc41-D13Rat101)/Mcwi rat embryos. The resulting mutation is a net 4-bp frameshift deletion in exon 5. MCW Gene Editing Rat Resource Center mutant Unknown Ren^em2Mcwi 27095886 30309956 SS.BN-(D13Hmgc41-D13Rat101)/Mcwi These were generated by crossing SS/JrHsdMcwi with SS-Chr 13^BN/Mcwi, rats from F1 were intercrossed and genotyped to get the congenic strain. Medical College of Wisconsin, Milwaukee, Wisconsin congenic Unknown 13 45282442 49428577 1 - by flanking markers 13 54236862 58314767 1 - by flanking markers 13 49168131 53264877 1 - by flanking markers 32716420 BDIX.BDIV-D6Rat132-D6Rat229/Zte The BDIX.BDIV-D6Rat132-D6Rat229/Zte congenic strain was produced by crossing BDIX (tumor-susceptible) and BDIV (tumor resistant) and then selecting for strains carrying homozygous segments of the BDIV chromosome on a BDIX background. Institute of Cell Biology (Cancer Research) of Duisburg-Essen University Medical School, Essen, Germany congenic Unknown 6 52753065 99750142 1 - by flanking markers 6 63175341 63175567 1 - by flanking markers 6 53553892 53554118 1 - by flanking markers 35668858 LEW-Tg(HLA-B*2705m1,B2M)133-1Trg^Tg/0 This strain was made by pronuclear injection into Lewis embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene (human HLA-B27 gene with Serine replacing Cys67) and the human beta-2-microglobulin gene. The strain carries 12 copies of HLA-B*2705 and 4 copies of the human beta-2-microglobulin gene. transgenic Unknown 35668859 W-Gnrh1^{tm1(IRES-cre)Aeh} This model was generated using zinc finger nuclease (ZFN) method. Cre recombinase was expressed under the control of the endogenous Gnrh1 gene by inserting an internal ribosomal entry site (IRES)-Cre cassette 30bp downstream from the translational stop site of the Gnrh1 open reading frame. This was achieved by pronuclear co-injection of zinc finger nucleases (ATCCACAACATCCGAGTGtgacattGACGCTGAGATCCATGAC; cleavage site in lower case) along with a donor plasmid containing two 800bp homologous arms (HA) flanking IRES-Cre into a one-cell stage rat embryo. (1.) Allan Herbison at Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK.; (2.) Vincent Prevot in INSERM, Lille, France. mutant Live Animals (as of 2020-07-09) Neuroendocrinology, Neurobiology, Development 35668861 LEW-Tg(HLA-B*2705,B2M)21-3Trg^Tg/0 This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 20 copies of HLA-B*2705 and 15 copies of the human beta-2-microglobulin gene. transgenic Unknown 35668863 LEW-Tg(HLA-B*2705,B2M)21-3Trg^Tg/Tg This strain was made by pronuclear injection into LEW/Crl embryos. The embryos were co-injected with DNA fragments containing the HLA-B*2705 human gene and the human beta-2-microglobulin gene. The strain carries 40 copies of HLA-B*2705 and 30 copies of human beta-2-microglobulin gene. Founder 21-3 was selected and carrier animals from this founder were mated and bred to homozygosity. transgenic Unknown 36174030 SD-Hamp^{em1Jfcol +/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol +/- (RGD: 36174030) is heterozygous carrying a 169-bp deletion between exons 2 & 3 of rat Hamp gene. Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-28) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em1Jfcol 38455987 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 36174220 SD-Hamp^{em1Jfcol -/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em1Jfcol -/- (RGD:36174220) is homozygous carrying the 169-bp deletion between exons 2 & 3 of both rat Hamp alleles. Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em1Jfcol 38455987 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 36174221 SD-Hamp^{em2Jfcol +/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol +/- (RGD:36174221) is heterozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of the rat Hamp gene. Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em2Jfcol 38455989 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 36174222 SD-Hamp^{em2Jfcol -/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol -/- (RGD:36174222) is homozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of both rat Hamp alleles. Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em2Jfcol 38455989 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 36174223 SD-Hamp^{em3Jfcol +/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol +/- (RGD:36174223) is heterozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of the rat Hamp gene. Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em3Jfcol 38455990 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 36174224 SD-Hamp^{em3Jfcol -/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em3Jfcol -/- (RGD:36174224) is homozygous carrying a 20-bp deletion and a 3-bp insertion in exon 2 of both rat Hamp alleles. Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em3Jfcol 38455990 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 36174225 SD-Hamp^{em4Jfcol +/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol +/- (RGD:36174225) is heterozygous carrying a 15-bp deletion in exon 2 of the rat Hamp gene Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em4Jfcol 38455991 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 36174226 SD-Hamp^{em4Jfcol -/-} Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol -/- (RGD:36174226) is homozygous carrying a 15-bp deletion in exon 2 of both rat Hamp alleles Rat Resource & Research Center (RRRC) mutant Cryopreserved Sperm (as of 2020-07-29) This rat models hereditary hemochromatosis (Type 2B) in humans. Iron overload research. Hamp^em4Jfcol 38455991 1 85978120 85980059 1 - by flanking markers 1 90523506 90525473 1 - by flanking markers 1 89368021 89369960 1 - by flanking markers 38456008 LOU/C Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of immunocytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). Institut National de la Sante' et de la Recherche Medicale, Bichat-Claude Bernard, Paris, France inbred Unknown 38500209 NISAG NISAG were stress-sensitive hypertensive rats that exhibited normal systolic pressure during the first weeks after birth. The development of hypertension in these rats is accompanied by increased sensitivity of the hypothalamic-pituitary-adrenocortical and sympathoadrenal systems to stress. Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, Russia inbred Unknown 38501059 SD-Cp^em1Ang+/+ The wild type rats were littermates of cross of heterozygotes Cp mutant rats. The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. mutant Unknown 38501060 SD-Cp^em1Ang+/- The heterozygous Cp mutant rats were created by CRISPR/Cas9. They contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop coden in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. mutant Unknown Cp^em1Ang 38501062 2 105086278 105135367 1 - by flanking markers 2 124467383 124524140 1 - by flanking markers 2 104744249 104803034 1 - by flanking markers 38501061 SD-Cp^em1Ang-/- The homozygous Cp mutant rats are littermates of cross of heterozygotes Cp mutant rats . The mutations created by CRISPR/Cas9 contained a 54- bp deletion and a 2-bp insertion in exon1 of Cp, resulted a premature stop codon in exon 2. The sgRNAcr377 (TacGene, Paris, France) used targeted the exon 1 of Cp and had the following sequence: 59-GGAAT-TACTGAAGCAGTTT-39. mutant Unknown Cp^em1Ang 38501062 2 105086278 105135367 1 - by flanking markers 2 124467383 124524140 1 - by flanking markers 2 104744249 104803034 1 - by flanking markers 38501086 SD-Bmpr2^em1Ang+/- BMPR2-deficient rats were generated by using zinc-finger nucleases (Sigma, St. Louis, MO). The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates. mutant Unknown Bmpr2^em1Ang 38501087 9 58327587 58436057 1 - by flanking markers 9 66371542 66486121 1 - by flanking markers 9 66568074 66683019 1 - by flanking markers 38508891 F344-Tg(Cx3cr1-cre/ERT2)3Ottc The transgene of LE-Tg(Cx3cr1-cre)3Ottc (RGD: 13441557) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of transgene. The donor LE transgenic was generated by microinjection of LE embyos with a BAC DNA containing the Cx3cr1-cre/ERT2 transgene which is composed of cre/ERT2 recombinase gene driven by the rat genomic Cx3cr1promoter. transgenic Unknown 38508893 F344.LE-ROSA26 ^{em1(LTR-nLuc)Ottc} The mutated ROSA26 locus of LE-(ROSA)26 em1(LTR-nLuc)Ottc (RGD:13208223) was crossed onto Fischer344 background by backcrossing the hybrid to Fischer344 and select for the presence of mutated locus. The LE donor is CRISPR/Case9 knock-in strain that has cre recombinase-dependent expression of nanoluciferase under the control of HIV LTR promoter inserted to the rat ROSA26 locus. mutant Unknown 38543943 SD-Rag2^em1Hera The Rag2 gene in rat spermatogonia stem cells (SSC, SD-WT2) was targeted by TALENs and resulted in a 27-bp in-frame deletion. The genome modified SSC was transplanted to Busulfan-treated, Dazl-deficient male Sprague Dawley rats and mated with wild type female Sprague Dawley rats 70 to 81 later. The allele was then bred to homozygosity to generate the Sprague-Dawley Rag2 (SDR)-knockout rat. mutant Unknown 38548914 SD-Rag1^em1Rag2^em1/Mlit The Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2. The animal facility at Tongji University (Shanghai, China). mutant Unknown 38548915 SD-Il2rg^em1-/y/Mlit The Il2rg knock-out rats were obtained by injecting Il2rg-targeting sgRNA into 1-cell embryos. The resulted mutation is 1-bp insertion (A) at 71169012 position. No protein was detected in the spleen of this Il2rg knock out. The animal facility at Tongji University (Shanghai, China). mutant Unknown 38548916 SD-Rag1^em1Rag2^em1Il2rg^em1-/y/Mlit The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915). The animal facility at Tongji University (Shanghai, China). mutant Unknown 38548927 HsdCpb:WU Wistar Wu Rat The Wistar rat is selected at the Wistar Institute, Philadelphia, USA, prior to 1910. In 1932, from Wistar Institute to Glaxo Laboratory, UK. In 1933, from Glaxo to the Dutch Institution for Nutrition, Amsterdam. In 1941, the Unilever Company, Vlaardingen, the Netherlands, obtained a breeding stock from Dutch Institution for Nutrition. Thereafter, the Unilever stock was referred as the Wistar Unilever or WU rat. In 1958, transferred from Unilever to TNO Central Institute for the Breeding of Laboratory Animals. To Harlan Laboratories through acquisition in 1986. Harlan became Envigo in 2015. ENVIGO outbred Unknown 38549341 RP/AEurRijHsd Muhlbock, Amsterdam, 1947, from Wistar stock. To University of Leiden in 1958. To Erasmus University, Rotterdam in 1968. To Rijswick in 1982 (Greenhouse et al 1991). To Harlan (?). inbred Unknown 38549343 WKY/NIcoCrlf A substrain of WKY from Charles River France and bred at Institut Francois Magendie, Bordeaux Cedax, France. Charles River, France inbred Unknown 38549351 HXB10/IpcvMcwi Embryo-rederived from breeder stock provided by Pravenec and Kren from the Prague colonies, and maintain by Medical College of Wisconsin. Medical College of Wisconsin, Milwaukee, Wisconsin recombinant_inbred Unknown 38549352 SHR/OlaIpcvMcwi These are re-derived rats of SHR substrain (SHR/OlaIpcv, RGD:9586450) from Czech Academy of Sciences now maintained at Medical College of Wisconsin. Medical College of Wisconsin, Milwaukee, Wisconsin inbred Unknown 38549353 SD-Defb23^em1Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb23 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 171-bp deletion in exon2. School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb23^em1Mlit 38599011 3 142780126 142784338 1 - by flanking markers 3 154275191 154279834 1 - by flanking markers 3 147928201 147932413 1 - by flanking markers 38549354 SD-Defb26^em1Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb26 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutations is a 246-bp deletion in exon2. School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb26^em1Mlit 38599012 3 142834066 142837469 1 - by flanking markers 3 154391632 154395035 1 - by flanking markers 3 147982213 147985616 1 - by flanking markers 38549355 SD-Defb42^em1Mlit CRISPR/Cas9 system was used to generate this mutant; sgRNA targeting exon2 of Defb42 was injected into the cytoplasm of fertilized embryos of Slc:SD. The resulting mutation is a 85 -bp deletion in exon2. School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb42^em1Mlit 38599013 15 42247668 42254485 1 - by flanking markers 15 49925455 49932279 1 - by flanking markers 15 46159511 46166335 1 - by flanking markers 38549356 SD-Defb23^em2MlitDefb26^em2Mlit CRISPR/Cas9 system was used to generate this double-gene knockout. The Slc:SD zygotes were injected with sgRNAs that containing 4 sgRNAs (5 ng/ml each) targeting 2 adjacent sites (target sites 1 and 2) of each of the 2 genes. The resulting mutations are 317 bp (Defb23) and 380 bp (Defb26) fragments which were deleted in the Defb23/Defb26 double-mutant strain. School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb23^em2MlitDefb26^em2Mlit 38599014 38549357 SD-Defb23^em2MlitDefb26^em2MlitDefb42^em1Mlit CRISPR/Cas9 system was used to generate the Defb23, Defb26 double-gene knockout (RGD:38549356) and Defb42 (RGD:38549355). The triple-KO rats were generated by crossing the heterozygous Defb23/26 mutation rats with the heterozygous Defb42 mutation rats. School of Life Science and Technology, Tong Ji University, Shanghai, China. mutant Unknown Defb42^em1Mlit|Defb23^em2MlitDefb26^em2Mlit 38599013|38599014 15 42247668 42254485 1 - by flanking markers 15 49925455 49932279 1 - by flanking markers 15 46159511 46166335 1 - by flanking markers 38549372 SD-Eif2ak4^em1 The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4. mutant Unknown Eif2ak4^em1 38599016 3 104870871 104875529 1 - by flanking markers 3 116705333 116791037 1 - by flanking markers 3 110159624 110245382 1 - by flanking markers 38596327 WI-Tbc1d4^em1Gdcz The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) . Unit for Laboratory Animal Medicine, University of Michigan. mutant Unknown Tbc1d4^em1 38596330 15 85359159 85561229 1 - by flanking markers 15 89695614 89871879 1 - by flanking markers 15 85927978 86105829 1 - by flanking markers 38596339 SD-Rarres2^em1Msu Rat zygotes, produced by mating superovulated Sprague-Dawley females with males of the same strain [Crl:CD(SD), were microinjected with CRISPR/Cas9 reagents targeting arres2 exon2. The resulting allele lacked the splice site and the first 13 aa of exon 2. Department of Pharmacology and Toxicology, Michigan State University, East Lansing, Michigan, USA. mutant Unknown Rarres2^em1Msu 38596341 4 76659507 76662465 1 - by flanking markers 4 142869493 142872619 1 - by flanking markers 4 78205809 78208956 1 - by flanking markers 38599146 BN-Aire^em1Ang-/- The homozygous Aire mutant rats are littermates of cross of heterozygotes Aire mutant rats . The mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carries a 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. mutant Unknown Aire^em1Ang 38599148 20 10980031 10996102 1 - by flanking markers 20 13535776 13550486 1 - by flanking markers 20 11365630 11380636 1 - by flanking markers 38599147 SD.BN-Aire^em1Ang-/- The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. mutant Unknown Aire^em1Ang 38599148 20 10980031 10996102 1 - by flanking markers 20 13535776 13550486 1 - by flanking markers 20 11365630 11380636 1 - by flanking markers 38599152 WI-Lpin1^m1Hubr The mutant rats were created using N-ethyl-N-nitrosourea (ENU) mutagenesis. A point mutation in the 5'-end splice site of intron 18 resulting in mis-splicing, a reading frameshift, and a premature stop codon was identified. As this mutation does not induce nonsense-mediated decay, it allows the production of a truncated Lipin 1 protein lacking phosphatidate phosphatase 1 activity. From the Hubrecht Institute-KNAW and University Medical Center Utrecht, 3584 CT Utrecht, The Netherlands, mutant Unknown Lpin1^m1Hubr 38599153 6 40253664 40297195 1 - by flanking markers 6 51532422 51638090 1 - by flanking markers 6 41796214 41905149 1 - by flanking markers 38599155 BN-Themis^m1Adej This autosomal recessive mutation occurred spontaneously in a Brown-Norway rat colony and was identified as causing marked T cell lymphopenia. The mutation was identified as a frameshift mutation caused by a four-nucleotide insertion in the Themis gene, leading to its disruption. UMR Inserm, U1043, Toulouse, France, UMR CNRS, U5282, Toulouse, France, Universit de Toulouse, UPS, Centre de Physiopathologie de Toulouse Purpan (CPTP), Toulouse, France mutant Unknown Themis^m1Adej 38599156 1 17032677 17226924 1 - by flanking markers 1 18308043 18532366 1 - by flanking markers 1 17152973 17378225 1 - by flanking markers 38599157 F344-Depdc5^em1Kyo+/- TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. National Bio Resource Project Rat in Japan mutant Unknown Depdc5^em1Kyo 38599194 14 83484354 83614818 1 - by flanking markers 14 83775510 83906381 1 - by flanking markers 14 83089000 83219576 1 - by flanking markers 38599158 F344-Depdc5^em2Kyo+/- TALEN mRNAs targeting exon 2 of rat Depdc5 were microinjected into fertilized eggs of Fisher 344 (F344) rats to yield two founder mutant rats named Depdc5em1kyo (c.40_44delins17/p.Gly15*) and Depdc5em2kyo (c.39_55delinsT/p.Lys13fs*8). The genome edited fragment was identified by PCR. A 267 bp band was detected for wildtype, a 279 bp band for Depdc5em1kyo mutant and a 251 bp band for Depdc5em2kyo mutant. Depdc5 mutant homozygous pups were never observed at birth. Deletion of both alleles resulted in in utero lethality started around E14.5. National BioResource Project for the Rat in Japan mutant Unknown Depdc5^em2Kyo 38599195 14 83484354 83614818 1 - by flanking markers 14 83775510 83906381 1 - by flanking markers 14 83089000 83219576 1 - by flanking markers 38599187 SHRSP.SHR-(D1Mgh5-D1Got87)(D18Rat73-D18Rat11)/Izm A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-14) Hypertension and cerebral apoplexy 1;18 78134304;52290789 85828306;71692408 1 - by flanking markers;1 - by flanking markers 1;18 80946174;50804228 92291485;69942605 1 - by flanking markers;1 - by flanking markers 1;18 79689548;51609032 91156803;70803264 1 - by flanking markers;1 - by flanking markers 38599188 SHRSP.SHR-(D1Rat23-D1Rat213)(D18Rat73-D18Rat11)/Izm A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. Developed by Dr. Tohru Nabika from Shimane University. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-14) Hypertension and cerebral apoplexy 1;18 78685103;52290789 81548909;71692408 1 - by flanking markers;1 - by flanking markers 1;18 81497710;50804228 84537228;69942605 1 - by flanking markers;1 - by flanking markers 1;18 80231217;51609032 83282814;70803264 1 - by flanking markers;1 - by flanking markers 38599189 F344-Rag2^em1Iexas This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2020-09-14) immunology/Inflamation and Immunodeficient Rag2^em1Iexas 38599191 3 86764810 86773438 1 - by flanking markers 3 97851318 97859615 1 - by flanking markers 3 91191837 91200134 1 - by flanking markers 38599190 F344-Il2rg^em1IexasRag2^em1Iexas This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2020-09-14) severe combined immunodeficiency Rag2^em1Iexas|Il2rg^em1Iexas 38599191|38599192 3;X 86764810;89342055 86773438;89345715 1 - by flanking markers;1 - by flanking markers 3;X 97851318;72017856 97859615;72021516 1 - by flanking markers;1 - by flanking markers 3;X 91191837;71165378 91200134;71169078 1 - by flanking markers;1 - by flanking markers 38599197 W.F344-Lep^m1Kyo This cocngenic strain was made by backcrossing F344-Lepm1Kyo(RGD: 8549776, F344/NSlc rats having an induced mutation in the Lep gene by ENU mutagenesis) to W/Kyo (RGD:1302672). National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2020-09-14) Obesity Lep^m1Kyo 12792963 4 55943837 55945938 1 - by flanking markers 4 56085079 56099209 1 - by flanking markers 4 56337695 56351818 1 - by flanking markers 38599201 SHRSP.SHR-(D18Rat73-D18Rat8)/Izm A congenic strain made by introducing a segments of chromosome 18 from SHR/Izm into SHRSP/Izm. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-15) Hypertension and cerebral apoplexy 18 52290789 72450442 1 - by flanking markers 18 50804228 70825941 1 - by flanking markers 18 51609032 71692768 1 - by flanking markers 38599202 SHRSP.SHR-(D1Rat23-D1Rat213)(D18Rat73-D18Rat52)/Izm A double congenic strain made by introducing a segments of chromosome 1 and 18 from SHR/Izm into SHRSP/Izm. National BioResource Project for the Rat in Japan, Department of Functional Pathology, Shimane University Faculty of Medicine, Izumo, Japan. congenic Cryopreserved Sperm (as of 2020-09-15) Hypertension and cerebral apoplexy 1;18 78685103;52290789 81548909;61290878 1 - by flanking markers;1 - by flanking markers 1;18 81497710;50804228 84537228;59735418 1 - by flanking markers;1 - by flanking markers 1;18 80231217;51609032 83282814;60532087 1 - by flanking markers;1 - by flanking markers 38599203 LE-Tg(Gt(ROSA26)Sor-CAG-COP4*C167A/YFP*)2Jfhy The transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 3, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-15) 38599204 LE-Tg(Gt(ROSA26)Sor-CAG-COP4*C167A/YFP*)1Jfhy The transgenic LE line 2(Back ground strain: Iar:Long-Evans (RGD:18337282) (Kumagai-shigeyasu Co.,Ltd)) carrying Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), and Channel rhodopsin fast receiver (ChRFR)(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 1, In this strain, COP4*C167A, modified photosensitivity cation channel, is expressed ubiquitously in the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy number. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-15) 38599206 SHR-Prdx2^em2Izm This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 6-bp deletion (5'-CTCCGG-3', c.6_12del6) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-15) 38599208 SHR-Prdx2^em1Izm This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion (5'-CTCCGGC-3', c.6_13del7) in the exon2 of Prdx2 gene. Target sequence is 5?-CCTCCGGCAACGCGCACATCGGA-3?(PAM sequence:CCT). National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-15) 38599241 SD;DA-Tg(Thy1-APP*)1Dspb Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are different among Lines (12>1>14>6). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia 38599242 SD;DA-Tg(Thy1-APP*)6Dspb Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia 38599243 SD;DA-Tg(Thy1-APP*)12Dspb Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia 38599244 SD;DA-Tg(Thy1-APP*)14Dspb Mutant human amyloid beta (APP*) combined Thy1 promoter which is specifically expressed in neurons, was induced to ES cells from DA strain rats, and chimera rats obtained from the ES cells. The F1 rats were backcrossed with Crl:CD (SD) strain rats and F3 rats was deposited to NBRP. The expression levels of mutant human APP mRNA are difficult among Lines (12>1>14>6). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) dementia 38599245 LE-Tg(Tac1-cre)6-7Koba Background strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs. This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)6-7Koba are lower than in LE-Tg(Tac1-cre)4-1Koba (RGD:38599247) National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) 38599247 LE-Tg(Tac1-cre)4-1Koba Background strain: Long-Evans rat (Iar:Long-Evans, RGD:18337282). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs.This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. The expression levels of Cre recombinase in LE-Tg(Tac1-cre)4-1Koba are higher than in LE-Tg(Tac1-cre)6-7Koba (RGD:38599245). National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-16) 38676250 F344-Hcn1^em3Kyo TALEN (Left:ttcagＡＡＴＧＡＴＴＣＡＴＧＧＧ, Right:ＡＣＧＣＡＣＴＣＴＴＣＡＡＡＧＣＴＡ）targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 13-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) 38676251 F344-Hcn1^em2Kyo TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 24-bp deletion in the exon4 of Hcn1 gene. It is predicted that 8 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) 38676253 F344-Hcn1^em1Kyo TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) Hcn1^em1Kyo 150429632 2 49525949 49939066 1 - by flanking markers 2 68473431 68874494 1 - by flanking markers 2 50099576 50499799 1 - by flanking markers 38676254 F344-Pparg^m1Kyo By using ENU mutagenesis followed by MuT-POWER screening of the KURMA (Kyoto University Rat Mutant Archive) samples, the depositors generated a heterozygous PPARg mutant (Ppargmkyo/+) rat with a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg. The PpargG488T homozygous rats are embryonic lethal. Heterozygous Ppargmkyo/+ rats showed reduced fat mass with adipocyte hypertrophy and insulin resistance, which were highly predictable from known actions of Pparg agonists and phenotypes of patients with the PPARG mutation. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) Pparg^m1Kyo 127285617 4 151492220 151617331 1 - by flanking markers 4 210562928 210688585 1 - by flanking markers 4 147274055 147399383 1 - by flanking markers 38676255 F344-Hcn1^em4Kyo TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-16) 38676310 RjHan:SD The outbred strain [Sprague-Dawley] was created by R. W. Dawley in 1925, from a hooded male hybrid of unknown origin and an albino female (probably Wistar), and was crossed with the female's progeny for 7 generations. Janvier Labs received from Zentralinstitut fur Versuchstierzucht (Hannover) in1982. Janvier Labs, France outbred Live Animals (as of 2020-09-17) 38676445 W-Tg(Slc32a1-cre)1_4Fusa This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-17) 38676446 W-Tg(Slc32a1-cre)2_5Fusa This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-17) 38676447 W-Tg(Slc32a1-cre)5_9Fusa This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT (Slc32a1: mouse, Kanamycin registance gene (E. coli), Cre (P1 phage), polyA signal (SV40 virus. Mouse BAC clone: RP23-392-P11). Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-17) 38676448 W-Trpa1^em1Kcrd This Trpa1-deleted Wistar (background: Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. National BioResource Project for the Rat in Japan mutant Cryopreserved Embryo (as of 2020-09-17) Trpa1^em1Kcrd 38676449 5 3531163 3584401 1 - by flanking markers 5 3764339 3818781 1 - by flanking markers 5 3783247 3836485 1 - by flanking markers 38676450 F344-Phf24^em2Kyo In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2021-07-01) 38676451 W-Phf24^em11Iexas This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 11 and has a 128-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-17) 38676452 W-Phf24^em24Iexas This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-17) 38676453 F344; W-Phf24^{em6(EGFP)Iexas} This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-17) 38676459 HHR/Hat Hirosaki hairless rat Hirosaki hairless rat (HHR) is a mutant strain spontaneously derived from Sprague-Dawley rats, and its inheritance is autosomal recessive. . These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster. HHR attain sexualmaturity at approximately 10 weeks of age and give birth to young but are not able to nurse them. Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine mutant Unknown 38676461 HiSER/Hat Hirosaki small-eye rat HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine mutant Unknown 38676463 HHSE/Hat HHSE/Hat was derived from Hirosaki hairless rat (HHR) and Hirosaki small-eye rat (HiSER), which are Sprague-Dawley rat (SDR)mutant lines. HHR was established in 1984 as a spontaneous mutant of SDR that has been inbred in Department of Biochemistry and Genome Biology Hirosaki University Graduate School of Medicine. Whole body shows hypotrichosis, abnormal differentiation of thymus, and regressed mammary gland in females. These mutations are autosomal recessive and are suggested to be due to deletion of the keratin gene cluster and the lectin-like receptor gene Ly49s3. HiSER was established in 2013 as a spontaneous mutant of Sprague-Dawley rat maintained in our course in the same way as HHR/Hat. This mutant strain has retinal detachment and the disease is progressively exacerbated. The muation is autosomal recessive and is suggested to be due to deletion of the crystallin gene Cryba1. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. The mutations in HHR and HiSER are on different chromosomes and do not affect each other. National BioResource Project for the Rat in Japan ;Depart of Biochemistry and Genome Biology, Hirosaki Univer-sity School of Medicine mutant Cryopreserved Embryo; Cryopreserved Sperm (as of 2020-09-18) Cryba1^Hiser 38676462 10 63758929 63765451 1 - by flanking markers 10 66458061 66480390 1 - by flanking markers 10 65160777 65167504 1 - by flanking markers 38676464 WIC-Cspg4^em1Kyst By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-18) 38676495 BN-Lx/CubMcwi Brown Norway with polydactyly-luxate These are re-derived rats of BN-Lx/Cub now maintained at Medical College of Wisconsin. The parent strain was derived by introgressing mutant Lx gene of the polydactylous (PD/Cub) rat onto the BN background. RGD HRDP, contact HRDP mutant Unknown (as of 2021-07-21) The Hybrid Rat Diversity Panel 39128162 WIC-Cspg4^em2Kyst By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) 39128163 WIC-Cspg4^em3Kyst By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 2 bp insertion on Exon1. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) 39128166 WIC-Sparc^em1Kykn By CRISPR/Cas9 system, mutation was introduced in Sparc gene of Wistar-Imamichi rat. 7 bp deletion around Exon7. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) 39128167 W-Tg(Grp-YFP*)14Hskmt This strain was generated by microinjecting YFP* (Venus): yellow fluorescent protein variant, which is inserted at downstream of Grp-promoter (4 kb) to Wistar rat zygotes. The number of inserted gene is approximately 100 copy. National BioResource Project for the Rat in Japan transgenic Live Animals; Cryopreserved Sperm (as of 2020-09-23) 39128170 SHRSP-Stim1^em1Izm "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence. The sequence of the guide RNA target site is as follows, Stim1: 5'-GCAGGGTAGCTGAAACACAC-3' The sequence of the ssODN for homologous recombination is as follows, 5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2020-09-23) 39128171 LE-Tg(Pvalb-cre)2-28Koba This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs. National BioResource Project for the Rat in Japan mutant Live Animals; Cryopreserved Sperm (as of 2020-09-23) 39128172 W-Tg(Slc32a1-cre)3_5Fusa This strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) in 2014 and maintained at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT（Slc32a1: mouse, Kanamycin resistance gene（E. coli）, Cre（P1 phage), polyA signal（SV40 virus). Mouse BAC clone: RP23-392-P11 National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2020-09-23) 39128239 GK/CskCrlj The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. To Chugai Pharmaceutical Co. To Charles River Japan in 1995. Charles River Laboratories Japan inbred Unknown 39128242 SD-Vwf^em1Mcwi-/- CRISPR/Cas9 mediated gene editing resulted a 130,938-bp deletion between 32-bp in front of the 5' end of Exon 1 and 122bp after the stop codon. MCW Gene Editing Rat Resource Center, through Versiti Blood Research Institute mutant Cryopreserved Sperm (as of 2020-10-09) Vwf^em1Mcwi 39457948 4 161723415 161854766 1 - by flanking markers 4 225098521 225229257 1 - by flanking markers 4 158085059 158219525 1 - by flanking markers 39456105 F344/StmMcwi F344/StmMcwi was redelivered from F344/Stm which was derived from F344/DuCrlj. inbred Live Animals (as of 2020-10-02) 39456107 LE/StmMcwi The LE/StmMcwi was rederived from LE/Stm and maintained at Medical College of Wisconsin. The LE/Stm rats were introduced into Saitama Cancer Center Research Institute in 1969 from a closed colony of Long Evans rats maintained in the Ben May Laboratory for Cancer Research, University of Chicago. A mutant with red-eyed dilution was found in 1970 in the Long-Evans colony, and the mutation was fixed by selective mating. Thereafter, they were maintained by sister-brother mating more than F50. inbred Live Animals (as of 2020-10-02) 39456108 SD-Trpv4^em1Sage TRPV4 gene?specific zinc finger constructs directed against exon 13, containing the coding sequence for part of TM5, the pore region, and TM6, were injected in zygotes from Sprague-Dawley rats. An animal with an 899 bp deletion in the TRPV4 gene was selected as a founder for further breeding. This deletion completely removes exon 13, plus parts of intron 12-13 and intron 13-14 . mutant Unknown Trpv4^em1Sage 39456109 12 43226933 43265889 1 - by flanking markers 12 49492064 49529956 1 - by flanking markers 12 47698915 47737902 1 - by flanking markers 39457682 LCR-mt^HCR/Tol Mitochodrial genome of LCR/ was selectively replaced by HCR to create this conplastic strain; these have the mitochondrial genome of HCRl on LCR nuclear genetic background University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614 conplastic Unknown 39457683 HCR-mt^LCR/Tol Mitochodrial genome of HCR/ was selectively replaced by LCR to create this conplastic strain; these have the mitochondrial genome of LCRl on HCR nuclear genetic background University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614 conplastic Unknown 39457699 LCR/Tol Low-capacity runners Artificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. University of Toledo College of Medicine and Life Sciences, Toledo, Ohio. inbred Unknown 39457701 HCR/Tol High-capacity runners Artificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for high capacity based on distance run to exhaustion on a motorized treadmill. University of Toledo College of Medicine and Life Sciences, Toledo, Ohio. inbred Unknown 39457945 WI- Lpar1^m1Hubr The Lpar1 mutant rat line was generated by target-selected ENU-driven mutagenesis of male MSH6 knockout rats, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Lpar1 that resulted in the change of a methionine into an arginine (p.M318R) in the 8th helix and that was predicted to be deleterious for protein function. Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Lpar1^m1Hubr 126848739 5 76449470 76571458 1 - by flanking markers 5 79707131 79825313 1 - by flanking markers 5 75557038 75678067 1 - by flanking markers 39457947 SD-Bckdk^m1Dbsa The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk. Spring Valley Laboratories, Inc (Woodbine,MD) mutant Unknown 39457950 SD- Ngly1^em1Ta-/- The homozygous Ngly1 mutant rats are littermates of cross of heterozygotesNgly1 mutant rats . The mutations created by CRISPR/Cas9 contained 2.6 kb deletions in exon 11 and exon 12 and a 3' flanking region of the Ngly1. Two single-guideRNA (sgRNA) sequences targeting sites upstream (5'-sgRNA;5'-cagaggaattgtgatagtacagg-3')anddownstream(3'-sgRNA; 5'-ccagttattcataccatggtaaa-3') of the exon 11, exon 12 and a 3'flanking region of the ratNgly1genome, respectively. By the time of deposition, this strain was crossed twice to Crl:CD (SD). "Homozygous rats are obtained by crossing between heterozygous rats. Maintain the strain by crossing between heterozygous rats or by backcrossing to Crl:CD (SD) rats. Homozygous rats, both females and males, have no record of pregnancy and reproduction. They are more likely to be infertile." National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-22) Ngly1^em1Ta 149735565 15 10704196 10750564 1 - by flanking markers 15 14450836 14501356 1 - by flanking markers 15 10405453 10455973 1 - by flanking markers 40818253 LE-Dyrk1a^em1Mcwi The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 14-bp deletion in exon 3 Generated with support from the Simons Foundation Autism Research Initiative (SFARI); MCW Gene Editing Rat Resource Center mutant Unknown 40818401 M520/NRrrcMcwi To N 1951 from Heston at F51. Developed by Curtis at Columbia University Institute for Cancer Research, 1920; to Heston, 1949 at F49. It was then sent to Rat Resource and Research Center (RRRC). Medical College of Wisconsin received live animals from cryo-resuscitated pairs at RRRC in 2009. inbred Unknown 40924649 Beta IIM Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' were separated in 1958 and raised at the School of Medicine at Rosario. In 1976, some degree of overweight was found in the original 'b' group and in 1980, the obesity group was identified as Beta line. School of Medicine at Rosario, Argentina inbred Unknown 40924650 Alpha IIM Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' and 'alpha' were separated in 1958 and 1972 respectively and raised at the School of Medicine at Rosario. This line alpha (Alpha IIM) ), obtained from the F1 'a' X 'd', was used as control for the obese Beta line (RGD:40924649). School of Medicine at Rosario, Argentina inbred Unknown 40924656 BN.ZUC-Lepr^fa Established as congenics by introducing fa from 13M/Vc to BN/Crl mutant Unknown (as of 2021-01-19) Lepr^fa 13432153 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 40924661 LA-cp/NRll This corpulent rat used by Rudolph L Leibel's laboratory was developed at the National Institutes of Health (NIH). It was a congenic strain initially derived by mating a male Koletsky rat that was heterozygous for the corpulent gene (cp/ +) to a female Lister Albany/NIH (LAIN) rat. This congenic carrying the recessive Leprcp (RGD:11570565) identified in in the obese spontaneously hypertensive Koletsky rat. mutant Unknown Lepr^cp 11570565 5 122320075 122503449 1 - by flanking markers 5 124380327 124556585 1 - by flanking markers 5 120503475 120682281 1 - by flanking markers 41404646 SD-Lrp5^em1Vari CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. mutant Unknown Lrp5^em1Vari 41404647 1 206102750 206206350 1 - by flanking markers 1 225689353 225793075 1 - by flanking markers 1 218816833 218920147 1 - by flanking markers 41404648 SD-Lrp5^em2Vari CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. mutant Unknown Lrp5^em2Vari 41404650 1 206102750 206206350 1 - by flanking markers 1 225689353 225793075 1 - by flanking markers 1 218816833 218920147 1 - by flanking markers 41404651 SD-Lrp5^em3Vari CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. mutant Unknown Lrp5^em3Vari 41404652 1 206102750 206206350 1 - by flanking markers 1 225689353 225793075 1 - by flanking markers 1 218816833 218920147 1 - by flanking markers 41404660 GK/Jpe The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations.Until the end of 1980s, Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal inbred Unknown 41404661 W/Jpe Inbred Wistar rats maintained at Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal Center for Neurosciences and Cell Biology of Coimbra, University of Coimbra, Coimbra, Portugal inbred Unknown 41404705 SD-Shank3^em1Bux The mutant rats were generated using zinc-finger nuclease (ZFN) technology to target exon 6 of the ankyrin repeat domain of rat Shank3. The resulting mutant has a 68-base pair deletion in exon 6 leading to a premature stop codon. mutant Unknown Shank3^em1Bux 41404706 7 127817026 127877875 1 - by flanking markers 7 130159246 130220171 1 - by flanking markers 7 130474278 130534679 1 - by flanking markers 41404723 DA.W-Ncf1^W/Rhd The Wistar Ncf1 (Ncf1W) allele was backcrossed to the DA background for 10 generations Section for Medical Inflammation Research, Lund University, Lund, Sweden. congenic Unknown Ncf1^W 41404724 41408337 DA.F344-Dpp4^DPPIV/SvH Generation of the congenic strain was started with an initial cross between F344/Crl(Wiga)SvH-Dpp4m females, homozygous for the loss-of-function mutation in the Dpp4 gene on RNO3 and a DA/Ztm wild type male rat. The DP4 deficient congenic DA strain is maintained via brother=sister mating Hannover Medical School, Hannover, Germany mutant Unknown Dpp4^DPPIV 12792942 3 44279255 44360283 1 - by flanking markers 3 54957146 55038628 1 - by flanking markers 3 48291055 48372672 1 - by flanking markers 41408339 WI.SD-Pclo^{Tn(sb-B-Geo)Fkh} The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame. University of Texas Southwestern Medical Center, Dallas TX mutant Unknown Pclo^{Tn(sb-B-Geo)Fkh} 41408340 4 15911051 16269090 1 - by flanking markers 4 16428814 17031648 1 - by flanking markers 4 16454904 17058921 1 - by flanking markers 41410881 WI-Grm2^em1 This mutant rat strain was produced by Transposagen Biopharmaceutical and available in mGluR2+/- breeding pairs. The genome modification created a premature stop codon insertion that causes a nonsense mutation at amino acid C407, deleting the transmembrane and intracellular domains of the receptor and rendering the gene nonfunctional. Transposagen Biopharmaceutical mutant Unknown Grm2^em1D4Mit6-D4Mit24)/RhwMcwi The lymphopenia locus from diabetic proned BBDP rat was transferred onto the genome of diabetic-resistant BB rat by marker-assisted selection in nine cycles of cross-intercross breeding. This congenic strain from Ake Lernmark, Laboratory, University of Washington, Seattle, Washington to Medical College of Wisconsin. Medical College of Wisconsin, Milwaukee, WI, USA congenic Unknown 4 75732943 78039637 1 - by flanking markers 4 141978848 144249450 1 - by flanking markers 4 77307388 79575658 1 - by flanking markers 41412186 BBDP/Wor Diabetic prone BB rats. The Biobreeding rats (BB) spontaneously developed autoimmune diabetes mellitus were found in a closed colony of outbred WI (Wistar) rats at the Bio-Breeding Laboratories, Ottawa, Ontario in 1974. In 1977, Butler et al. began inbreeding BB rats at the University of Massachusetts Medical Center (laboratory code Wor) with 300 breeders purchased from the Bio-Breeding Laboratories. In 1978, during inbreding, pathogen-free rodent barrier system was introduced and and 2 strains were produced: disease prone (DP) and disease resistant (DR) by selected progenies were diabetic (DP) or remained diabtes free (DR). inbred Unknown 41457452 WI-Prdm14^em10Nips Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24) Prdm14^em10Nips 41457453 5 10550222 10570255 1 - by flanking markers 5 5710076 5730560 1 - by flanking markers 42721973 LEW/SsNArc This strain is now maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The LEW rats were received from National Institutes of Health , Bethesda MD, USA. inbred Unknown 42721974 LEW-Nek8^lpk/Arc The Lewis Polycystic Kidney (LPK) rat is a spontaneous mutant identified in the LEW colony (LEW/SsNArc) maintained at Animal Resources Centre in Canning Vale, WA 6970 AUSTRALIA. The causal gene is identified as a non-synonymous mutation R650C in the NIMA (never in mitosis gene a)- related kinase 8 ( Nek8) gene. mutant Unknown Nek8^lpkArc 42721975 10 64458886 64470044 1 - by flanking markers 10 66196993 66230588 1 - by flanking markers 10 65404489 65439059 1 - by flanking markers 42721977 SD-Pde6b^em1Baek Cpf1 mRNA (50 ng per uL) and CRISPR RNA (100 ng per uL) were co-microinjected into the cytoplasm of pronuclear stage embryos; surviving embryos were transplanted into the oviducts of pseudo-pregnant surrogate mothers to generate live animals. A Pde6b-mutant rat line with an 11-bp deletion in exon 1 was established. Western blot analysis confirmed deficiency of Pde6b protein in the homozygous mutant retina, indicating successful generation of Pde6b-deficient rats with Cpf1-mediated gene targeting. Asan Institute for Life Sciences, University of Ulsan College of Medicine, Asan Medical Center, Seoul, Republic of Korea mutant Unknown Pde6b^em1Baek 42721979 14 1871037 1914170 1 - by flanking markers 14 2327104 2370811 1 - by flanking markers 14 2328690 2371913 1 - by flanking markers 42722004 F344-Tg(HIV)1Hsd Noninfectious clone containing gag-pol-deleted HIV-1 provirus under the viral LTR promoter was microinjected into fertilized one-cell Sprague�Dawley � Fisher 344/NHsd F1. Female founder with opaque cataracts was mating with wil-type Fischer 344/NHsd. Tg rats from line 1 contained 20�25 copies. transgenic Unknown 45073130 SD-Fmr1^em1Mzhe The CRISPR/Cas9 system was used to introduce deletions/mutations in exon 4 of the rat Fmr1 gene of outbred Sprague- Dawley embryos. The resulting mutation is a deletion of five amino acids and a G-A mutation in the Fmr1 gene. This genetic modification results in a frame-shift starting from the second Agenet-like 2 domain in the Fmr1 protein. The laboratory animal center of Peking University. mutant Unknown Fmr1^em1Mzhe 124715480 X 154756031 154793782 1 - by flanking markers 1 150408220 150445658 1 - by flanking markers X 154684924 154722369 1 - by flanking markers 45073133 SD-Pon1^em1Lizh CRISPR/Cas9 system was used to introduce a 342-bp deletion in exon 4 of rat PON1 gene in Sprague- Dawley embryos. The destruction of Pon1 gene caused the absence of the the expression of Pon1 mRNA, protein in liver, spleen and thymus in the Pon1 homozygous knock-out rat. Institute of Laboratory Animal Science of Peking Union Medical College mutant Unknown Pon1^em1Lizh 124715481 4 29936314 29964821 1 - by flanking markers 4 30156712 30183204 1 - by flanking markers 4 30249749 30276297 1 - by flanking markers 53621137 SD-Tg(Wnt1-cre/ERT2)AppscRrrc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT2 Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 56677892 SD-Tg(GFAP-cre/ERT2)AppscRrrc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 58366897 SD-Tg(Tie2-cre/ERT2)AppscRrrc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2 Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 124713544 W-Cyp27b1^em1Thka This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes. mutant Unknown Cyp27b1^em1Thka 124713545 7 70512763 70517707 1 - by flanking markers 7 70333150 70340006 1 - by flanking markers 124713546 W-Vdr^em1Thka This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in changing arginine codon to Leu at p.270 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr (R270L) rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2 diet partially reversed their rickets symptoms. Homozygotes Vdr(R270L mutants were maintained bymating of heterozygotes. mutant Unknown Vdr^em1Thka 124713547 7 136567614 136617280 1 - by flanking markers 7 139536241 139585928 1 - by flanking markers 7 139344452 139394138 1 - by flanking markers 124713548 W-Vdr^em2Thka This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes. mutant Unknown Vdr^em2Thka 124713550 7 136567614 136617280 1 - by flanking markers 7 139536241 139585928 1 - by flanking markers 7 139344452 139394138 1 - by flanking markers 125093746 SD-Disc1^em1Rst CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation. University of Wisconsin-Madison School of Medicine and Public Health, mutant Unknown Disc1^em1Rst 125093747 19 55265116 55449375 1 - by flanking markers 19 68529791 68769050 1 - by flanking markers 19 57818838 58069992 1 - by flanking markers 125097486 SD-Nr3c1^em1Kuan The CRISPR/Cas9 genome editing system was used to created a conditional knockout of floxed Nr3c1 gene in outbred SD embryos. The LoxP sequences were inserted in the 5prime and 3prime sides of exon 3. For CaMKIIa cell-specific knockdown, 0.1 ul of AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40 (CaMKIIa Cre) [Penn Vector Core] was injected bilaterally and allowed a minimal of 3 weeks to incubate. Department Pharmacology and Systems Physiology, University of Cincinnati, Cincinnati, United States mutant Unknown Nr3c1^em1Kuan 125097487 18 32371496 32459145 1 - by flanking markers 18 31408742 32348480 1 - by flanking markers 18 31728373 32704022 1 - by flanking markers 125097491 WI.WDB-Prdm14^{tm1(H2BVenus)Nips} Targeting vector was designed to replace 1st and 4th exons encoding DNA-binding domain of Prdm14 locus with H2BVenus. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation . Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats. These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Prdm14 knocked-in rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Prdm14^{tm1(H2BVenus)Nips} 126781696 5 10550222 10570255 1 - by flanking markers 5 5710076 5730560 1 - by flanking markers 125097492 WI-Sall1^em1Nips Sall1 mutation was induced by injecting a mix of two pX330 expressing Cas9 and sgRNA targeting the sequence into Crlj:WI rat embryos. The resulting mutation is a 4456-bp deletion in exon 2 to 3. Homozygous Sall1 knocked-out rats had the anephric phenotype at E21.5, and died at postnatal Day-1. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki, Aichi 444-8787, JAPAN. mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Sall1^em1Nips 126781694 19 19277337 19293298 1 - by flanking markers 19 34377838 34395131 1 - by flanking markers 19 23387737 23405025 1 - by flanking markers 125097494 WI.WDB-Sall1^{tm4(tdTomato)Nips} Targeting vector was designed to replace 2nd and 3rd exons encoding DNA-binding domain of Sall1 locus with tdTomato. The vector was introduced into WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem cells by electroporation.Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Crlj:WI rats to produce heterozygous founder rats..These rat strains are being maintained by crossing the founder rats with Crlj:WI rats. Homozygous Sall1 knocked-in rats had the anephric phenotype at E21.5, and died at postnatal Day-1. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi 444-8787, JAPAN mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Sall1^{tm4(tdTomato)Nips} 126781695 19 19277337 19293298 1 - by flanking markers 19 34377838 34395131 1 - by flanking markers 19 23387737 23405025 1 - by flanking markers 125097496 Iar:WIC Iar:Wistar-Imamichi Institute for Animal Reproduction in Japan outbred Unknown Metabolism; Development 125097497 WIC;WI;WDB-Kiss1^tm8Nips This strain was made by electroporation of WDB/Nips-ES1/Nips (RGD ID:10054010) embryonic stem (ES) cells with a targeting vector. A targeting vector was designed to insert two loxP sites encompassing exons 2 and 3 of the Kiss1 gene coding for 52-amino acid rat kisspeptin-1 (Kiss1) and a neomycin-resistance gene into the Kiss1 locus in rat ES cells via homologous recombination. Targeted ES cells were injected into Crlj:WI blastocysts to produce chimeric rats. The chimeric rats were crossed with Iar:Wistar-Imamichi rats to produce heterozygous founder rats. This rat strain is being maintained by crossing the founder rat with Iar:Wistar-Imamichi rats. Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Japan, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN mutant Live Animals; Cryopreserved Embryo (as of 2021-04-01) Kiss1^tm8Nips 126781693 13 46244786 46247288 1 - by flanking markers 13 55582365 55590432 1 - by flanking markers 13 50529506 50537603 1 - by flanking markers 126777684 WI-Mkx^em1Asah The CRISPR/Cas9 genome editing system targeting exon 2 of rat Mkx gene was injected to the Wistar embryo to generate this knock out rat strain with 14- bp deletion causing frameshift mutation in the gene. mutant Unknown Mkx^em1Asah 126777685 17 63631540 63710138 1 - by flanking markers 17 62321329 62332471 1 - by flanking markers 17 60537615 60553284 1 - by flanking markers 126777687 WKY-Dnd1^ter/Ztm A spontaneous mutation (ter) leading to the formation of congenital ovarian and testicular tumors was detected in the WKY/Ztm rat strain. Sequence analysis detected a point mutation in exon 4 of the rat Dnd1, which introduces a premature stop codon assumed to cause a truncation of the Dnd1 protein. This recessive ter mutation has a complete penetrance of teratocarcinogenesis and infertility of both sexes in homozygous genotype. Institute for Laboratory Animal Science, Hannover Medical School (MHH), Germany mutant Unknown Dnd1^ter 150340622 18 29464691 29467315 1 - by flanking markers 18 29312395 29315019 1 - by flanking markers 18 29608588 29611212 1 - by flanking markers 126779578 LOU/MWsl A substrain of LOU/M maintained in the laboratory of Dr. H. Bazin at Universite de Louvain. Experimental Immunology Unite Faculty of Medicine Clos Chapelle aux Champs 30.56 Bruxelles 1200 BELGIUM inbred Unknown 126779586 SD-Csf1r^tm(EGFP)+/-/Tset Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients University of Edinburgh, United Kingdom mutant Unknown Csf1r^tm(EGFP)Tset 126781692 18 57080324 57107295 1 - by flanking markers 18 55662670 55689297 1 - by flanking markers 18 56414493 56458300 1 - by flanking markers 126779587 DA-Csf1r^tm(EGFP)+/-/Hume Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. Department of Microbiology, University of Queensland, Brisbane, Queensland 4072 Australia mutant Unknown Csf1r^tm(EGFP)Tset 126781692 18 57080324 57107295 1 - by flanking markers 18 55662670 55689297 1 - by flanking markers 18 56414493 56458300 1 - by flanking markers 126779591 SD-Csf1r^tm(EGFP)-/-/Tset Targeting vector was designed to disrupt the first exon encoding of Csf1r gene with a drug selection cassette by homologous recombination in Rat ESC clone DAK31-C2. Sprague-Dawley females were used as embryo donors and pseudo-pregnant recipients. The homozygotes were obtained by crossing of heterozygotes. University of Edinburgh, United Kingdom mutant Unknown Csf1r^tm(EGFP)Tset 126781692 18 57080324 57107295 1 - by flanking markers 18 55662670 55689297 1 - by flanking markers 18 56414493 56458300 1 - by flanking markers 126779592 DA-Csf1r^tm(EGFP)-/-/Hume Heterozygotes "SD-Csf1rtm(EGFP)+/-/Tset" were back-crossed for at least 7 generations to the inbred dark agouti (DA) background from the Animal Resource Centre, Western Australia. The homozygotes were obtained by crossing of heterozygotes Department of Microbiology, University of Queensland, Brisbane, Queensland 4072 Australia mutant Unknown Csf1r^tm(EGFP)Tset 126781692 18 57080324 57107295 1 - by flanking markers 18 55662670 55689297 1 - by flanking markers 18 56414493 56458300 1 - by flanking markers 126781838 SD-Tg(PDGFB-cre/ERT2)AppscRrrc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19) 126781839 SD-Tg(Olfr16-cre/ERT2)AppscRrrc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19) 126781841 SD-Tg(Mnx1-cre/ERT2)AppscRrrc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2 Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) 126781842 SD-Tg(Drd1-cre/ERT2)AppscRrrc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neurons Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) 126781843 SD-Tg(Gad1-cre/ERT2)AppscRrrc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes. Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) 126781844 SD-Tg(SMHC-cre/ERT2)AppscRrrc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 126781845 SD-Tg(CAG-GFP-LacZ)AppscRrrc A transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 line Rat Resource and Research Center transgenic Unknown 126790464 SD-Ube3a^em1Jue The CRISPR/Cas9 genome editing system was injected into fertilized Sprague-Dawley rat embryos and inserted into a surrogate. Two genomic RNAs (gRNAs) were designed to target the 5ʹ-end of the Ube3a gene (upstream of the Ube3a coding sequence) and two gRNAs target sequences downstream of Ube3a. gRNA pairs were used on each end of the deletion to maximize the probability of a complete deletion of the 90-kb region encompassing the Ube3a gene. The 90 kb deletion in Ube3a was confirmed by genome sequencing. Only pups with maternal inheritance of the deletion carried traits for model of Angleman Syndrome. mutant Unknown Ube3a^em1Jue 126790465 1 110729142 110816491 1 - by flanking markers 1 117745283 117834011 1 - by flanking markers 1 116586901 116678161 1 - by flanking markers 126790469 F344.Cg-Foxn1^rnu-/-/Jcl This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1^rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats. CLEA Japan, Inc congenic Live Animals (as of 2021-04-22) Immuno deficiency 126790472 F344.Cg-Foxn1^rnu-/+/Jcl This congenic strain was established as a strain with the genetic background of F344/N onto which a segment from the nude rat containing the Foxn1^rnu was transferred. Originally, hairless mutant (rnu) was observed in a colony of outbred hooded rats maintained at the Rowett Research Institute in Scotland. Backcrossing started at Central Institute for Experimental Animals in 1979 and thereafter the subline was transported to CLEA Japan, Inc for production and supply of these rats. CLEA Japan, Inc congenic Live Animals (as of 2021-04-22) Immuno deficiency 126790496 SD-Shank2^em13Sage The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA mutant Unknown Shank2^em13Sage 126790499 1 204399856 204855474 1 - by flanking markers 1 222118530 224450737 1 - by flanking markers 1 217149156 217593950 1 - by flanking markers 126790511 Jcl:WIST CLEA Japan, Inc., Taconic Farms Inc. (USA), and Taconic Europe (Denmark) created the Global Alliance for Laboratory Animal Standardization (GALASTM) agreement in collaboration with the Central Institute for Experimental Animals to promote the international standardization of outbred stocks usable for safety testing in the field of toxicity and pharmacology. Based on these activities,Wistar Hannover GALAS rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.). At and after the end of 1998, RCC Ltd. gave more than 50 pairs of pedigreed BrlHan:WIST rats to each GALAS member to use as seed rats for the Wistar Hannover GALAS strain. CLEA Japan, Inc outbred Live Animals (as of 2021-04-23) 126790547 SD-Rin1^em1-/-Hcz This strain was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene. Department of Histology and Embryology, Basic Medical College, China Medical University, Shenyang 110122, China mutant Unknown Rin1^em1Hcz 126790548 1 207671502 207676150 1 - by flanking markers 1 227359504 227364152 1 - by flanking markers 1 220335036 220342319 1 - by flanking markers 126848737 WI- Msh6^m1Hubr The Msh6 knockout mutant rat line was generated by target-selected ENU-driven mutagenesis on Crl:WI rats. The founder rat carried an ENU-induced premature stop codon in exon 4 of the Msh6 gene was bred to obtain homozygous animals. Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Msh6^m1Hubr 126848738 6 11525292 11542592 1 - by flanking markers 6 21616672 21634338 1 - by flanking markers 6 11644565 11662389 1 - by flanking markers 126848740 SDT.Cg-Lepr^fa/JttJcl SDT fatty Lepr^fa allele from ZDF was introgressed into SDT rats using the speed congenic method. The newly establised congenic strain of a SDT rat for Leprfa was maintained by intercross between fa-heterozygous littermates in Japan CLEA Inc. CLEA Japan, Inc congenic Live Animals (as of 2021-05-06) 126848751 RCS-Mertk^rdyp/LavJcl This strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for a deletion in the Mertk gene. CLEA Japan, Inc congenic Live Animals (as of 2021-04-28) Mertk^rdy 40902839 126848763 ODS-Gulo^od+/+/ShiJcl Osteogenic disorder Shionagi rat, wild type This is the wild type control for ODS-Gulood/od/ShiJcl (RGD:4140404) . Dr. Susumu Makino and his colleagues found several animals that had gait abnormalities among Wistar rats maintained at Shionogi Co. They named these animals osteogenic disorder (OD) rats because they exhibited prominent bone and joint abnormalities and systemic bleeding. Subsequent studies revealed that these symptoms were derived from an ascorbic acid (vitamin C) deficiency arising from defective gulonolactone oxidase (GLO) activity. This characteristic was confirmed to be the result of a mutation involving the autosomal single recessive gene od. Scurvy due to L-gulonolactone oxidase deficincy; phenotype normalizes if supplied with ascorbic acid 300mg/kg/d. od/od rats are more susceptible to dental caries as compared with +/+ rats, in only amoun parous females. CLEA Japan, Inc inbred Live Animals (as of 2021-04-29) 126848776 RCS-Mertk^rdy+p/LavJcl This strain maintained at Japan JCLEA is homozygous at the pink eye (p) locus and homozygous for wild type Mertk gene. CLEA Japan, Inc congenic Live Animals (as of 2021-04-30) 126848777 SD-Tg(HRAS)128NccJcl Hras128 is a transgenic rat, introduced human proto-type c-Ha-ras gene to Jcl:SD rat fertilized egg by Dr. Hiroyuki Tsuda, Natl. Cancer Center, in 1998. The strain has been kept by CLEA Japan from its creation and supplied to the related research organization after concluded an agreement with Natl. Cancer Center and Japan Science and Technology Agency (JST). This strain is carrying three copies of the human c-Ha-ras proto-oncogene, including its own promoter region. CLEA Japan, Inc transgenic Live Animals (as of 2021-04-30) 126848778 SD-Tg(CAG-KRAS*G12V)301Jcl The transgene consisting of CAG promoter/loxP/neomycin resistant gene casette/lox/Ha-Kras*G12V (KrasV12) was injected into embryos of SD rat (RGD:8547938). This strain was generated at CLEA Japan,Inc. This strain is introduced 3 copies of hemagglutinin (HA) epitope tag connected HA-K-rasv12 gene expression cassette by using Cre/loxP system for controlling term/location expression of human mutated form K-rasv12 gene (changing glycine to valine at the 12 amino acid sequence) that normally floxed rat does not express K-rasv12 gene. CLEA Japan, Inc transgenic Live Animals (as of 2021-04-30) Oncology 126848793 SS-Gper1^em1Bj-/- CRISPR/Cas 9 was utilized to delete rat Gper1 gene in the one-cell embryos of SS/Jr rats. The homozygous founders had complete deletion of Gper1 was confirmed by DNA sequenching. University of Toledo College of Medicine and life Sciences OH mutant Unknown 126848794 SHR-Zbtb16^em1Ipcv+/- TALEN was used to target Zbtb16 (Plzf )in the SHR and one founder with a deletion of G at position 93 of the coding sequence (c.93delG) was identified. That deletion resulted in a frameshift downstream glycine 31 (p.Gly31fs). The frameshift mutation caused the incorporation of 20 aberrant amino acids downstream of the deleted G, followed by a stop codon. The founder was bred with SHR to generate more heterozygous animals. The homozygous animals die perinatally because of multiple developmental abnormalities. Institute of Biology and Medical Genetics, Charles University, Prague mutant Unknown Zbtb16^em1Ipcv 150340624 8 51931530 52094813 1 - by flanking markers 8 51573252 51740759 1 - by flanking markers 8 52980226 53146765 1 - by flanking markers 126848804 F344-Trpc4^Tn(sb)1Bni The Sleeping Beauty transposon system was used to insert the sleeping beauty transposon into the first intron of the rat Trpc4 gene. Trpc4 knock-out (510 bp) and wild-type allele (905 bp) were confirmed using PCR and gel electrophoresis Laboratorium voor Fysiologie, Campus Gasthuisberg, KU Leuven, B-3000 Leuven Belgium mutant Unknown Trpc4^Tn(sb)Tngen 126848808 2 143350286 143485716 1 - by flanking markers 2 163115873 163282223 1 - by flanking markers 2 143433102 143605757 1 - by flanking markers 126908010 SD-Kcnk3^em1Ang-/- The homozygous Kcnk3 mutant rats are littermates of cross of heterozygotesKcnk3 mutant rats . The mutation created by CRISPR/Cas9 contained a 94- bp deletion in exon1 of resulted a premature stop codon. mutant Unknown Kcnk3^em1Ang 126908015 6 25745923 25782144 1 - by flanking markers 6 36969843 37005778 1 - by flanking markers 6 27154274 27190209 1 - by flanking markers 126908013 SD-Kcnk3^em1Ang-/+ The heterozygous Kcnk3 mutant rats were created by CRISPR/Cas9. The mutated allele contained a 94- bp deletion in exon1 of resulted a premature stop codon. mutant Unknown Kcnk3^em1Ang 126908015 6 25745923 25782144 1 - by flanking markers 6 36969843 37005778 1 - by flanking markers 6 27154274 27190209 1 - by flanking markers 126925134 SD-Il36rn^{tm1(Myh6-cre)Mhzh} This line was produced by mating rats carrying Il36rnf/f allele and Myh6-cre-allele. The expression of Il36rn was knockout in cardiomyocytes. Nanjing University Model Animal Center. mutant Unknown Il36rn^{tm1(Myh6-cre)Mhzh} 126925161 3 2530402 2536999 1 - by flanking markers 3 1378833 1385430 1 - by flanking markers 3 1385256 1392275 1 - by flanking markers 126925135 SD-Il1rl2^{tm1(Myh6-cre)Mhzh} This line was produced by mating rats carrying IIl1rl2f/f allele and Myh6-cre-allele. The expression of Il1rl2 was knockout in cardiomyocytes. Nanjing University Model Animal Center. mutant Unknown Il1rl2^{tm1(Myh6-cre)Mhzh} 126925159 9 39492187 39537792 1 - by flanking markers 9 46733619 46778352 1 - by flanking markers 9 47044870 47093679 1 - by flanking markers 126925136 SD-Mstn^em1Cqin ZFN constructs were designed to target the genomic region of rat Mstn exon 1. ZFN mutant founders were backcrossed to Spargue Dawley rats to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. mutant Unknown 126925137 SD-Ogdh^em1Yuyi The TALEN systems targeting Ogdh were injected to Sprague Dawley one cell embryos and an 8-bp deletion was identified in one founder animal. No homozygous rats were obtained from mating of heterozygotes that suggests embryonic lethal for the homozygotic mutant. Laboratory Animal Center of Zhengzhou university mutant Unknown Ogdh^em1Yuyi 126925168 14 87022994 87090768 1 - by flanking markers 14 87376110 87442862 1 - by flanking markers 14 86414924 86481903 1 - by flanking markers 126925138 SD-Ubd^em1 This Ubd (FAT10) knockout rat strain was generated using theCRISPR-Cas9 technique in a Sprague Dawley (SD) background. The knockout allele has a 911 bp deletion of exon 2, leading to a truncated protein of Ubd. Department of Cardiovascular Medicine, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006 mutant Unknown Ubd^em1 126925166 20 1475944 1477895 1 - by flanking markers 20 3917777 3919728 1 - by flanking markers 20 1876175 1878126 1 - by flanking markers 126925139 SD-Dnmt1^{tm1(Myh6-cre)Cqin} To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats Beijing Engineering Research Center for Experimental Animal Models of Human Diseases, Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences and Peking Union Medical College (ZLF18003), Beijing, China mutant Unknown Dnmt1^{tm1(Myh6-cre)Cqin} 126925165 8 19926995 19973256 1 - by flanking markers 8 21978830 22024656 1 - by flanking markers 8 21922515 21968495 1 - by flanking markers 126925196 F344-Slc6a3^m1Span This strain was identified in the N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis screen. A point mutation in the Slc6a3 (DAT) coding sequence (exon 3) with a T/G transversion at nucleotide position 471 was identified in a male rat. This nucleotide exchange leads to substitution of an asparagine amino acid residue by a lysine residue at position 157 (N157K) in the SLC6A3 (DAT) protein, which introduces new positive charge into the amino acid sequence. Central Institute of Mental Health Department of Psychopharmacology Central Institute of Mental Health Mannheim, mutant Unknown Slc6a3^m1Span 126925197 1 30516568 30557540 1 - by flanking markers 1 33745060 33788878 1 - by flanking markers 1 32323011 32363983 1 - by flanking markers 126925212 WI- Drd1^m1Hubr The Drd1 mutant rat line was generated by target-selected ENU-driven mutagenesis on outbred Wistar rats. Sequencing of genomic target sequences in progeny from mutagenized rats revealed an ENU-induced missense mutation in Drd1. The mutation resulted in an isoleucine to serine exchange (Drd1I116S) in helix III of the protein. Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. mutant Unknown Drd1^m1Hubr 126925213 17 16655926 16658161 1 - by flanking markers 17 13211031 13215581 1 - by flanking markers 17 11099736 11104352 1 - by flanking markers 126925756 SD-Cryba1^Nuc1Dbsa This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1. The Johns Hopkins University School of Medicine The Wilmer Eye Institute The Johns Hopkins University School of Medicine Baltimore mutant Unknown Cryba1^Nuc1Dbsa 126925758 10 63758929 63765451 1 - by flanking markers 10 66458061 66480390 1 - by flanking markers 10 65160777 65167504 1 - by flanking markers 126925949 SD-Myh7b^em1Blar+/- The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. Beijing Laboratory Animal Research Center of Chinese Academy of Medical Sciences. mutant Unknown Myh7b^em1Blar 126925953 3 146115687 146139441 1 - by flanking markers 3 157472519 157518151 1 - by flanking markers 3 151105038 151150621 1 - by flanking markers 126925952 SD-Myh7b^em1Blar-/- The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. Beijing Laboratory Animal Research Center of Chinese Academy of Medical Sciences. mutant Unknown Myh7b^em1Blar 126925953 3 146115687 146139441 1 - by flanking markers 3 157472519 157518151 1 - by flanking markers 3 151105038 151150621 1 - by flanking markers 126925978 SD-Ercc6^em1Cgen The CRISPR/Cas9 system was designed to introduce an in-frame amino acid substitution (R571X. CGA > TGA). A silent mutation (ACC to ACG) was also introduced to prevent the binding and re-cutting of the sequence by gRNA after HDR. Founder animals harboring the expected single-nucleotide substitution were bred to produce heterozygous and homozygous rats.The heterozygous rats had phenotypes similar to the wild type littermates. Key Laboratory of Neurological Function and Health, School of Basic Medical Science, Guangzhou Medical University, Guangzhou 511436, China. mutant Unknown Ercc6^em1Cgen 126925980 16 8024881 8091587 1 - by flanking markers 16 10699983 10770565 1 - by flanking markers 16 8734028 8804610 1 - by flanking markers 126925992 SD-Cftr^em1Ang The CRISPR/Cas9 system targeting at exon 12 to create deletion at codon F508 was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a codon deletion at F508 and the creation of one NdeI restriction site for sequencing identification. mutant Unknown Cftr^em1Ang 126925993 4 43874852 44041870 1 - by flanking markers 4 42281040 42448571 1 - by flanking markers 4 42693263 42860679 1 - by flanking markers 126925994 SD-Cftr^em2Ang The CRISPR/Cas9 system targeting at exon 3 to create gene knock out was injected to the male pronucleus of the fertalized one-cell stage embryos collected from Crl:SD. The donor DNA generated a frameshift and the creation of one XbaI restriction site and a premature stop codon. Two knockout founders ( referred as MUKORAT8.3 and MUKORAT 6.4) exhibit no difference in phenotypes and were pooled for study. INSERM 1151 INEM Universit? de Paris Paris France. mutant Unknown Cftr^em2Ang 126925995 4 43874852 44041870 1 - by flanking markers 4 42281040 42448571 1 - by flanking markers 4 42693263 42860679 1 - by flanking markers 126928141 SD-Tg(ITGA2B-F8*)Mcwi This transgenic was produced by crossing the SD transgenic rat carrying Lentivirus constructs containing the 2bF8 vector [B-domain deleted human FVIII under control of ITGA2B (IIb) promoter] with an F8 knockout rat SD-F8em1Sage-/-/Novo (RGD:11531091). This transgenic rat strain expressed B-domain deleted human F8 under the control of ITGA2B promoter in the absence of rat F8 product. Blood Research Institute 8733 W Watertown Plank Road Milwaukee, WI 53226 transgenic Unknown F8^em1Sage 11531096 126928146 ACI.Cg.-Cdkn1b^em1Musc The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em2Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1b^em1Musc harbors 32-bp deletion of Cdkn1b exhibits same phenotype as the em4Musc with 65-bp deletion Transgenic and Gene Function Core, Medical University of South Carolina, Charleston, South Carolina, United States of America mutant Unknown Cdkn1b^em1Musc 126928147 4 171841705 171846506 1 - by flanking markers 4 232962218 232967323 1 - by flanking markers 4 168689043 168694159 1 - by flanking markers 126928150 ACI.Cg.-Cdkn1b^em4Musc The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em2Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1b^em4Musc harbors 65-bp deletion of Cdkn1b exhibits same phenotype as the em1Musc with 32-bp deletion Transgenic and Gene Function Core, Medical University of South Carolina, Charleston, South Carolina, United States of America mutant Unknown Cdkn1b^em4Musc 126928151 4 171841705 171846506 1 - by flanking markers 4 232962218 232967323 1 - by flanking markers 4 168689043 168694159 1 - by flanking markers 127284837 GK/Wnsm The Goto-Kakizaki (GK) rat is a non-obese Wistar substrain which develops Type 2 diabetes mellitus early in life. The model was developed by Goto and Kakizaki at Tohoku University, Sendai, Japan in 1975. The GK line was established by repeated inbreeding from Wistar rats selected at the upper limit of normal distribution for glucose tolerance. Repeated selection of rats with tendency to lowest glucose tolerance resulted in clear-cut glucose intolerance after five generations. This GK/Wnsm colony was established at the University of Wales College of Medicine (Cardiff, UK) after received breeding pairs provided by Professor Y Goto (Tohoku University School of Medicine, Sendai, Japan). University of Wales College of Medicine (Cardiff, UK) inbred Unknown 127284865 F344-Nppc^em1Kyo This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppc^em1Kyo strain ( delta 6) was deduced to generate a two a.a. deletion (a.a. 28 and 29, Pro and Pro, NP_446202, at nucleotides 198 - 203, NM_053750.1). National BioResource Project for the Rat in Japan mutant Unknown Nppc^em1Kyo 127284866 9 85434254 85438454 1 - by flanking markers 9 93458753 93462953 1 - by flanking markers 9 93731436 93735636 1 - by flanking markers 127284868 F344-Nppc^em2Kyo This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppc^em2Kyo strain ( delta 9) was deduced to generate one amino-acid substitution (a.a. 26, from Gly to Ala, NP_446202, at nucleotides 192 - 194, NM_053750.1) and a three amino-acid deletion (a.a. 27 - 29, Thr, Pro and Pro, NP_446202, at nucleotides 193 - 201, NM_053750.1), within the N-terminal portion of the full-length Nppc National BioResource Project for the Rat in Japan mutant Unknown Nppc^em2Kyo 127284869 9 85434254 85438454 1 - by flanking markers 9 93458753 93462953 1 - by flanking markers 9 93731436 93735636 1 - by flanking markers 127284870 F344-Nppc^em3Kyo This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppc^em3Kyo strain ( delta 11)was deduced to generated a frame shift and a premature stop codon (at nucleotides 275 - 277, NM_053750.1) National BioResource Project for the Rat in Japan mutant Unknown Nppc^em3Kyo 127284871 9 85434254 85438454 1 - by flanking markers 9 93458753 93462953 1 - by flanking markers 9 93731436 93735636 1 - by flanking markers 127284872 F344-Nppc^em4Kyo This strain was established by injecting Zinc-finger nucleases (ZFNs) to F344/Stm pronuclear stage embryos. Selected ZFNs were designed to target exon 1 of rat Nppc, which encodes the N-terminus of natriuretic peptide precursor C (target sequence: CGAAGCCAAGCCCGGGACaccaccGAAGGTGGGTGCTGTCGCG; nucleotides 179 - 221, NC_005108.4). The injected F344/Stm embryos were transferred into the oviducts of pseudopregnant rats. Four lines of knockout strains were estaglished. This F344-Nppc^em4Kyo strain ( delta 774) had a massive deletion within the Nppc gene that included the translation initiation site. Quantitative RT-PCR revealed that the expression of Nppc mRNA in the brain was drastically decreased in homozygous delta 774 mutant rats. National BioResource Project for the Rat in Japan mutant Unknown Nppc^em4Kyo 127284873 9 85434254 85438454 1 - by flanking markers 9 93458753 93462953 1 - by flanking markers 9 93731436 93735636 1 - by flanking markers 127284883 SD-Aqp4^em1Hrt The transcription activator-like effector nuclease (TALEN)-mediated knockout approach was applied to generate Aqp4-deficient rats. The synthesized TALENs against the following sequences: (5′-CACAGCAGAGTTCCTGG-3′) for the sense strand and (5′-GGATCCCACGCTGAGCA-3′) for the antisense strand. The founder animal lacking three base pairs was crossed with wild-type rat to produced the F1 generration and the heterozygous offspring of F1 were corssed to produce mutant strains and confirmed by sequencing analysis of PCR products of modified genome region. Department of Anatomy and Histology, School of Basic Medical Sciences, Peking University, Beijing, China mutant Unknown Aqp4^em1Hrt 127284884 18 6626313 6642766 1 - by flanking markers 18 6720759 6737703 1 - by flanking markers 18 6766009 6782757 1 - by flanking markers 127285380 SD-Mir31^em1Sage CRISPR/Cas9 system was used to introduce the gene knockout of Mir31 in the Sprague Dawley embryos. Department of Cancer Biology and Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, OH 43210; mutant Unknown 127285404 SHR-Cfb^em1Tja This strain was produced by injecting ZFNs targeting exon 6 of rat complement factor b (Cfb) (target sequence: CCCCTCGGGCTCCATGaatatcTACATGGTGCTGGATG),into SHR/NCrl rat embryos. The resulting mutation is a 19-bp deletion. Centre for Genomic and Experimental Medicine, MRC Institute for Genetics and Molecular Medicine, Edinburgh, United Kingdom mutant Unknown Cfb^em1Tja 127285405 20 6616005 6621872 1 - by flanking markers 20 4536206 4542073 1 - by flanking markers 127285409 SD-Abcc8^em1Cgen TALEN system targeting the rat Abcc8 (sulfonylurea receptor 1, SUR1 ) gene was injected into Crl:CD(SD) embryos. This strain carries a 16-bp deletion corresponding to CCT CAC GGG GCT TCTG compared with wild-type rats is homozygous. No Abcc8 protein was detected in the liver and muscle tissues. Cyagen Biosciences Inc., Guangzhou, China mutant Unknown Abcc8^em1Cgen 127285598 1 96622574 96703723 1 - by flanking markers 1 103194473 103275508 1 - by flanking markers 1 102110708 102191287 1 - by flanking markers 127285661 SD-Adgrl3^em1Huyc The CRISPR/Cas9 system was used to to delete exon 3 of the rat Adgrl3 (Lphn3). Two sgRNAs targeting the sequences flanking exon 3 (GTCCCTTGCCAGTACATCTC and CCTAGTGTTGTGTTCTGCTA),Cas9 mRNA with the CRISPR/Cas9 reagents was injected into fertilized eggs. Genotyping of founder rats was confirmed by PCR genotyping using three primers: 1. AAAGGGTCATAGCATCCGGC, 2. CTAACGTGGCTTTTTGTCTTCT, and 3. GCTCGACAGACAGTGTGGAT. The WT band occurs at ~320 bp and KO band at ~452 bp. Department of Pediatrics, University of Cincinnati College of Medicine, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH mutant Unknown Adgrl3^em1Huyc 127285662 14 28385112 28854677 1 - by flanking markers 14 28183727 29040121 1 - by flanking markers 14 28362176 29226085 1 - by flanking markers 127285810 SD-Trpa1^em1Gne This Trpa1-deleted Sprague Dawley strain was generated by using CRISPR/Cas9. Rats harboring a 7282 bp deletion spanning Trpa1 exons 19 through 24, corresponding to genomic position RGSC 6.0/rn6 chr5:3,818,620-3,825,901 were identified. Department of Neuroscience, Genentech, 1 DNA Way, South San Francisco, CA 94080 USA mutant Unknown Trpa1^em1Gne 127285812 5 3531163 3584401 1 - by flanking markers 5 3764339 3818781 1 - by flanking markers 5 3783247 3836485 1 - by flanking markers 127338473 WM/Nem This Strain was from the National Institute of Genetics., Mishima, Japan to the research institute of Environmental Medicine, Nagoya University. The research institute of Environmental Medicine, Nagoya University. inbred Unknown 127338474 BDIX/Nem This strain was maintained in Germany and was transferred to Japan by Dr. Tanaka of Aichi Cancer Center. Thereafter, this strain was transferred to Research Institute of Environmental Medicine, Nagoya University in 1973 inbred Unknown 127345097 SD-Muc1^em1Cgen The Muc1 knock out Sprague Dawley rats were produced by targeted gene mutation at rat Muc1 gene. The deletion was made by microinjection of TALENs and located in the exon 1 of rat Muc1 gene (Gen Bank: NM_012602.1). Genotyping was performed by PCR of tail DNA using primers specific for the rat MUC1 gene with forward primer 5′-CTAGCAAGCCTAAAAGGTGAGAGGT-3′ and reverse primer 5′-ACGAAGAGCATTTGCCTACTC-3′, followed by DNA sequencing analysis. Cyagen Biosciences Inc., Guangzhou, China mutant Unknown Muc1^em1Cgen 127345099 2 181399482 181403640 1 - by flanking markers 2 207957206 207962396 1 - by flanking markers 2 188543137 188547874 1 - by flanking markers 127345123 F344-Angptl8^em1Kyo-/- This line #1 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3' (sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan mutant Unknown Angptl8^em1Kyo 127345127 8 20948070 20950087 1 - by flanking markers 8 22910979 22913005 1 - by flanking markers 8 22855495 22858565 1 - by flanking markers 127345124 F344-Angptl8^em1Kyo+/- This line #1 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers, 5'-CATCTGTTGAGCAGGCAGAA-3'(sense) and 5'-GTTCAGTGGTGGCTTCCTTC-3' (antisense) for line #1. A 7-bp deletion mutation was identified in line #1. Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan mutant Unknown Angptl8^em1Kyo 127345127 8 20948070 20950087 1 - by flanking markers 8 22910979 22913005 1 - by flanking markers 8 22855495 22858565 1 - by flanking markers 127345125 F344-Angptl8^em2Kyo-/- This line #2 Angptl8 knock out (KO) rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon. Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan mutant Unknown Angptl8^em2Kyo 127345128 127345126 F344-Angptl8^em2Kyo+/- This line #2 Angptl8 heterozygous rats were generated using the CRISPR/Cas9 system containing two guide RNAs (gRNAs) targeting exons 2 and 3 in the rat Angptl8 gene. A mixture of transcribed Cas9 and gRNAs was microinjected into F344/Stm rat zygotes [National BioResource Project rat number: 0140) provided by the National BioResource Project for the Rat in Japan. Two lines of rats heterozygous for Angptl8 (lines #1 and #2). Male and female Het rats were intercrossed to obtain homozygous Angptl8 KO rats. Rats were genotyped by PCR with the following primers5'-GGGTGAGCAAAGCTGACCTA-3' (sense) and 5'-GAGTAAACCCACCAGGCTCA-3' (antisense) for line #2. A 980-bp deletion in the ANGPTL8 gene was identified in line # 2, resulting in a premature termination codon. Medical Innovation Center Kyoto University Graduate School of Medicine, Kyoto, Japan mutant Unknown Angptl8^em2Kyo 127345128 149735334 SD-Wfs1^em1Ptsn Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1^em1 ( Wfs1-ex5-KO232), Wfs1^em2 (Wfs1-ex5-KO266) and Wfs1^em3 (Wfs1-ex5-INS244). Wfs1^em1 rats carry a 184 bp deletion, resulting 27 amino acids deletion in exon 5 (aa212-238) and a new GCC codon(alanine). Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu, mutant Unknown Wfs1^em1Ptsn 149735335 14 79379680 79404003 1 - by flanking markers 14 78606172 78630689 1 - by flanking markers 14 78640707 78665224 1 - by flanking markers 149735336 SD-Wfs1^em2Ptsn Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1^em1 ( Wfs1-ex5-KO232), Wfs1^em2 (Wfs1-ex5-KO266) and Wfs1^em3 (Wfs1-ex5-INS244). Wfs1^em2 rats carry a 27 amino acids deletion in exon 5 (aa212-238). Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu, mutant Unknown Wfs1^em2Ptsn 149735337 14 79379680 79404003 1 - by flanking markers 14 78606172 78630689 1 - by flanking markers 14 78640707 78665224 1 - by flanking markers 149735338 SD-Wfs1^em3Ptsn Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1^em1 ( Wfs1-ex5-KO232), Wfs1^em2 (Wfs1-ex5-KO266) and Wfs1^em3 (Wfs1-ex5-INS244). Wfs1^em3 rats carry a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226) into YCMNTI in the WFS1 protein. Institute of Biomedicine and Translational Medicine, Department of Physiology, University of Tartu, mutant Unknown Wfs1^em3Ptsn 149735339 14 79379680 79404003 1 - by flanking markers 14 78606172 78630689 1 - by flanking markers 14 78640707 78665224 1 - by flanking markers 149735356 SD-Tg(Wnt1-cre/ERT2)Appsc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Wnt1 gene linked by 2A peptide. This model is used to lineage tracing of neural crest cells by tissue specific expression of creERT2 Available at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 149735357 SD-Tg(PDGFB-cre/ERT2)Appsc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human PDGFB promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The brain tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Available at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19) 149735358 SD-Tg(Olfr16-cre/ERT2)Appsc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing mouse Olfr16 (MOR23) promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Available at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-07-19) 149735359 SD-Tg(Mnx1-cre/ERT2)Appsc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Mnx1 (HB9) gene linked by 2A peptide. This model is used to lineage tracing of motor neurons by tissue specific expression of creERT2 available at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) 149735361 SD-Tg(Drd1-cre/ERT2)Appsc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Drd1 (Drd1a) gene linked by 2A peptide. This model is used to lineage tracing of dopamine D1 receptor expressing neurons Available at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) 149735362 SD-Tg(Gad1-cre/ERT2)Appsc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Gad1 (Gad67) gene linked by 2A peptide. This model is used to lineage tracing of glutamate decarboxylase 1 expressing cells such as GABAergic neurons, islet cells and spermatocytes. Available at Rat Resource and Research Center transgenic Cryopreserved Embryo; Cryorecovery (as of 2021-07-19) 149735363 SD-Tg(GFAP-cre/ERT2)Appsc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing human GFAP promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The astrocyte tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Available at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 149735364 SD-Tg(Tie2-cre/ERT2)Appsc The CRISPR/Cas9 system was injected to the Crl:CD(SD)embryo to induce the knock-in Cre-ERT2 cassette at the 3' end of Tie2 gene linked by 2A peptide. This model is used to lineage tracing of vascular endothelial cells by tissue specific expression of creERT2 Available at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 149735365 SD-Tg(SMHC-cre/ERT2)Appsc The 'docking site ready (DSR)' rat strain, or TARGAT /TM rat strain was generated using CRISPR/Cas9. With integrase, these TARGAT/DSR rats are used as embryo donors. TARGATT rat embryos will be microinjected with a mixture of TARGATT Cre DNA constructs containing rabbit smooth muscle myosin heavy chain (SMHC) gene promoter, a fluorescent reporter mCherry in the Cre cassette linked by a T2A sequence. The Olfactory sensory neuronal lineage tissue-specific expression of a CreERT2 is also tamoxifen-dependent. Available at Rat Resource and Research Center transgenic Live Animals (as of 2021-07-19) 149735366 SD-Tg(CAG-GFP-LacZ)Appsc A transgenic line carrying random insertion of transgene cassette CAG-LSL-GFP-LacZ (LSL: loxp-Stop-Loxp). It is used as a Cre reporter/test line expressing GFP and lacZ. Used as lineage tracing tool rat line by mating with tissue specific cre or cre/ERT2 line Available at Rat Resource and Research Center transgenic Unknown 149735371 SHR-C3^em1Kyo ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The DNA of 10 day old pups was extracted and screened for ZFN-induced mutations. Briefly, DNA extracted from ear tissue was amplified using primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'-AATAGAGGCCACCAATGCAC-3'). This mutant revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg). National BioResource Project for the Rat in Japan advanced_intercross_line Cryopreserved Embryo (as of 2021-07-20) C3^em1Kyo 149735372 149735516 LL/MavRrrcAek Lyon hypotensive In 1969 outbred Sprague-Dawley rats were selected for high systolic blood pressure using an indirect plethysmographic technique in pre-warmed unrestrained conscious rats. Three pairs were originally selected, and selection was continued with brother x sister mating. Strain LN was maintained as a normotensive control, and LL as a hypotensive strain. The strain from Rat Resource & Research Center was maintained at Department of Pharmacology, University of Iowa inbred Unknown (as of 2021-07-21) 149735517 LEXF10A/StmMcwi These are re-derived rats of LEXF10A/Stm now maintained at Medical College of Wisconsin. The parent strain was derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. RGD HRDP, contact HRDP recombinant_inbred Unknown 149735518 HXB4/IpcvMcwi These are re-derived rats of HXB4/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub RGD HRDP, contact HRDP recombinant_inbred Unknown 149735519 HXB31/IpcvMcwi These are re-derived rats of HXB31/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub RGD HRDP, contact HRDP recombinant_inbred Unknown 149735520 HXB2/IpcvMcwi These are re-derived rats of HXB2/Ipcv now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains SHR/OlaIpcv and BN-Lx/Cub. RGD HRDP, contact HRDP recombinant_inbred Unknown 149735521 HXB20/IpcvMcwi These are re-derived rats of HXB20/Ipcv now maintained at Medical College of Wisconsin. The parent strain wasDerived from founder strains SHR/OlaIpcv and BN-Lx/Cub RGD HRDP, contact HRDP recombinant_inbred Unknown 149735530 BXH2/CubMcwi These are re-derived rats of BXH2/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv RGD HRDP, contact HRDP recombinant_inbred Unknown 149735533 BXH3/CubMcwi These are re-derived rats of BXH3/Cub now maintained at Medical College of Wisconsin. The parent strain was derived from founder strains BN-Lx/Cub and SHR/OlaIpcv. RGD HRDP, contact HRDP recombinant_inbred Unknown 149735557 LE-Tg(Pdyn-cre)2-9Koba This strain was produced by injecting a modified BAC, in which a Cre recombinase was inserted into the third exon of the rat Pdyn gene, into rat zygotes (Iar:Long-Evans, RGD:18337282). This strain is a transgenic rat that expresses Cre recombinase under the control of the Pdyn gene. National BioResource Project for the Rat in Japan transgenic Cryopreserved Sperm (as of 2021-07-22) 149735558 F344.LEA-Ugl/Okt A congenic strain in which the ugl locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the ugl locus, which contains a 13 bp deletion in the Ctns gene.Cystinosis model rat. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2021-07-22) 149735559 F344.LEA-Idao/Okt A congenic strain in which the Idao locus of LEA/Tohm rats was introduced into F344/NSlc rats. "This strain is homozygous for the Idao locus, which contains a 54.1 kb deletion in the Dao gene. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2021-07-22) 149735560 LE-Gad1^em15Yyan Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-22) Gad1^em15Yyan 149735561 3 52789370 52830038 1 - by flanking markers 3 63479963 63519879 1 - by flanking markers 3 56861440 56902139 1 - by flanking markers 149735562 LE-Gad2^em24Yyan Knockout rats in which the Gad2 gene was disrupted using the TALEN. In this strain, the Gad2 gene encoding GAD65 was knocked out. In homozygous rats, a high rate of epileptic seizures was observed at 2 to 3 weeks of age. National BioResource Project for the Rat in Japan mutant Cryopreserved Sperm (as of 2021-07-22) Gad2^em24Yyan 149735563 17 96259430 96321857 1 - by flanking markers 17 90851699 90914893 1 - by flanking markers 17 89171576 89234770 1 - by flanking markers 149735570 F344-Atg16l1^em8Rrrc CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. RRRC mutant Live Animals (as of 2021-07-23) Inflammatory Bowel Disease, autophagy Atg16l1^em8Rrrc 149735571 149735895 LEW-Tg(Col2a1-luc,-mCherry)RmptRrrc Random insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferin Rat Resource and Research Center transgenic Unknown Skeletal Regenerative Medicine 149735896 LEW-Tg(Col2a1-luc,-mCherry)Rmpt Random insertion of transgene consisting of firefly luciferase-T2A-mCherry driven by regulatory elements of rat Col2a1, for conditional expression in chondrogenic cells. Both reporters are expressed by chondrogenic cells, leading to bioluminescence within regions of active chondrogenesis upon injecting rats with D-luciferin This transgenic was created by Dr. Ryan Porter at University of Arkansas for Medical Sciences. Now available at Rat Resource and Research Center transgenic Unknown Skeletal Regenerative Medicine 149735897 F344-Cacna1a^gry/Okym This strain is derived from GRY/Idr (GRY/Idr has the M251K mutation in the Cacna1a gene) provided from NBRP-Rat. GRY/Idr was backcrossed to F344/NSlc. National BioResource Project for the Rat in Japan congenic Cryopreserved Sperm (as of 2021-07-29) Neurobiology 149735898 SD-Myh7b^em1Blar+/+ This is the homozygous wild type littermate from crossing of heterozygous SD-Myh7b mutants. The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. Beijing Laboratory Animal Research Center of Chinese Academy of Medical Sciences. mutant Unknown 149735906 RCCHan:WIST Wistar Hannover rats are derived from the Han:WIST strain from the Zentral Institut fur Versuchstierzucht (ZfV) (Hannover, Germany). In 1989, 156 pairs were introduced from ZfV to the Institute for Biomedical Research (IBM) in Switzerland (IBM underwent a structural change [name change] to BRL Ltd. and RCC Ltd.) outbred Unknown 150340617 SHRSP.SHR-(rs197197017 -rs198445122)/Utx A congenic strain made by introducing B2 fragment (a segment of chromosome 1, 154.7 Mb - 203 Mb) from SHR/Utx into SHRSP/BbbUtx.The B2 fragment contains wild-type Stim1 as confirmed by sequencing. University of Texas, Houston, TX congenic Unknown 1 148969064 186536846 1 - by flanking markers 1 163213339 205713847 1 - by flanking markers 1 156969388 198720287 1 - by flanking markers 150340629 SS-Tgfb1^em3Mcwi+/+ SS-Tgfb1^em3Mcwi+/Tgfb1^em3Mcwi+ ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed to produce homozygous wild type and heterozygous mutant littermates. PhysGen Knockouts mutant Unknown 150404267 LEW-Myo15a^ci2/Ztm LEW/Ztm-ci2 rat is an animal model for syndromal deafness that arose from a spontaneous mutation. Base substitution (T->C) in exon 56 of Myo15, leading to an amino acid exchange from leucine (Leu) to proline (Pro) within the carboxy-terminal MyTH4 domain in the proteins' tail region. Institute of Laboratory Animal Science, Hannover Medical School, Hannover, Germany mutant Unknown Myo15a^ci2 150404269 10 46742535 46798928 1 - by flanking markers 10 46595676 46660835 1 - by flanking markers 10 46840098 46897362 1 - by flanking markers 150429598 SS-Vwf^em4Mcwi The rat strain was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting rat strain has a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. Some mRNA must make it through to translation, because low levels of VWF protein are detectable via ELISA (<10%). Both homozygous pairs and heterozygous pairs were used for breeding. Rat Genetic Models, through Versiti Blood Research Institute mutant Unknown Type I von Willebrand Disease Vwf^em4Mcwi 150429599 4 161723415 161854766 1 - by flanking markers 4 225098521 225229257 1 - by flanking markers 4 158085059 158219525 1 - by flanking markers 150429601 MWF.SHR-(D6Rat1-D6Rat30)/Rkb The congenic MWF.SHR-(D6Rat1-D6Rat30)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 48631043 144152572 1 - by flanking markers 6 58374821 153672040 1 - by flanking markers 6 49695264 144745573 1 - by flanking markers 150429602 MWF.SHR-(D6Rat1-D6Rat106)/Rkb The congenic MWF.SHR-(D6Rat1-D6Rat106)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 68036028 144152572 1 - by flanking markers 6 78348236 153672040 1 - by flanking markers 6 68781170 144745573 1 - by flanking markers 150429603 MWF.SHR-(D6Rat1-D6Mit8)/Rkb The congenic MWF.SHR-(D6Rat1-D6Mit8)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 97561873 144152572 1 - by flanking markers 6 107370981 153672040 1 - by flanking markers 6 97949772 144745573 1 - by flanking markers 150429604 MWF.SHR-(D6Rat1-D6Rat121)/Rkb The congenic MWF.SHR-(D6Rat1-D6Rat121)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 99651951 144152572 1 - by flanking markers 6 109506414 153672040 1 - by flanking markers 6 100120078 144745573 1 - by flanking markers 150429605 MWF.SHR-(D6Rat1-D6Mgh4)/Rkb The congenic MWF.SHR-(D6Rat1-D6Mgh4)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 108503674 144152572 1 - by flanking markers 6 117391806 153672040 1 - by flanking markers 6 108154445 144745573 1 - by flanking markers 150429606 MWF.SHR-(D6Rat1-D6Rat81)/Rkb The congenic MWF.SHR-(D6Rat1-D6Rat81)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 111967597 144152572 1 - by flanking markers 6 120994890 153672040 1 - by flanking markers 6 111715478 144745573 1 - by flanking markers 150429607 MWF.SHR-(D6Rat1-D6Rat115)/Rkb The congenic MWF.SHR-(D6Rat1-D6Rat115)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 116550201 144152572 1 - by flanking markers 6 125802476 153672040 1 - by flanking markers 6 116576030 144745573 1 - by flanking markers 150429608 MWF.SHR-(D6Rat1-D6Rat184)/Rkb The congenic MWF.SHR-(D6Rat1-D6Rat184)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. Freie Universitdt Berlin, Berlin, Germany congenic Unknown 6 121381065 144152572 1 - by flanking markers 6 130448688 153672040 1 - by flanking markers 6 121224054 144745573 1 - by flanking markers 150429614 FHH-Tg(CAG-Add3)McwiRoman A full-length rat wild type Add3 cDNA obtained from an expression plasmid pCMV6-entry-Add3 purchased from Origene (Rockville, MD) was inserted in a sleeping beauty transposon vector. The expression of wild type ADD3 in the transposon vector was driven by a CAG promoter. The construct was injected into the pronucleus ofoocytes collected from female FHH/EurMcwi rats along with SB100 transposase mRNA. A single-transgene insertion was identified on chromosome 10, which is located .64 kbp away from the protein shisa-6 homolog precursor at its 59 end and .360 kbp away from the phosphoinositide-interacting protein at the 3 prime end. Heterozygous founders were intercrossed to derive a homozygous transgenic line that was used for studies. Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi transgenic Unknown Add3 2043 150429615 SD-Add3^em1Mcwi/ Roman ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi mutant Unknown (as of 2021-09-09) Add3^em1Mcwi 150429617 1 259347673 259455407 1 - by flanking markers 1 281267424 281375203 1 - by flanking markers 1 273854195 273961982 1 - by flanking markers 150429618 FHH-Chr 1^BN-Add3^em2Mcwi /Roman ZFN system was used to Knock out the rat Add3 gene of FHH-Chr 1BN/Mcwi rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized FHH-Chr 1BN/Mcwi embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 68-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used Department of Pharmacology and Toxicology, University of Mississippi Medical Center, Jackson, Mississippi mutant Unknown Add3^em2Mcwi 150429619 1 259347673 259455407 1 - by flanking markers 1 281267424 281375203 1 - by flanking markers 1 273854195 273961982 1 - by flanking markers 150429634 F344 -Aspa^em34Kyo Hcn1^em1Kyo F344-Aspaem34Kyo (RGD:11564349) and F344-Hcn1em1Kyo (RGD:38676253) rats from the National BioResource Project-Rat were intercrossed to produce F1 hybrids and then to obtain F2 progeny. Rats homozygous for both Aspa and Hcn1 knockout alleles were selected from among F2 progeny and were used to generate the F344-Aspaem34Kyo/Hcn1em1Kyo double- knockout strain. Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606-8501, Japan mutant Unknown Aspa^em34Kyo|Hcn1^em1Kyo 11564348|150429632 10;2 60178509;49525949 60199207;49939066 1 - by flanking markers;1 - by flanking markers 10;2 59578788;68473431 59627450;68874494 1 - by flanking markers;1 - by flanking markers 10;2 59839693;50099576 59888244;50499799 1 - by flanking markers;1 - by flanking markers 150429707 SD-Cyp2c11^em1Nju CRISPR/Cas9 system containing two pairs of single guide RNA (sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG- TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC- 39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39; reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. mutant Unknown Cyp2c11^em1Nju 150429708 1 243281320 243320945 1 - by flanking markers 1 265418158 265454574 1 - by flanking markers 1 257676172 258004428 1 - by flanking markers 150429760 SHRSP.SHR-(rs198233821-rs198932221)/Utx A congenic strain made by introducing IgH haplotype block (a segment of chr6:146,030,387 to 154,214,590 ,Rn5 assembly of the rat genome). from SHR-B2 (SHR/Utx) into SHR-A3 (SHRSP/BbbUtx). The igH block contains sequences that are highly divergent between of SHR-A3 and SHR-B2 . University of Texas, Houston, TX congenic Unknown 6 137279131 144688132 1 - by flanking markers 6 146030387 154214590 1 - by flanking markers 6 137021260 145293041 1 - by flanking markers 150429814 SD-Gnal^em1Hpng+/- The heterozygousGnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids . Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, Germany mutant Unknown Gnal^em1Hpng 150429816 18 63595606 63735803 1 - by flanking markers 18 61991738 62131420 1 - by flanking markers 18 62805406 62946133 1 - by flanking markers 150429815 SD-Gnal^em1Hpng+/+ The homozygous wild type Gnal rats were littermates of SD-Gnalem1Hpng+/- (RGD:150429814) created by CRISPR/Cas9. The heterozygous mutants carried one copy of mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of theGnal splicing variant 2 was detected resulting in an early stop at position150 and producing a truncated protein with 50 amino acids . Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, Germany mutant Unknown 150429817 SD-Gnal^em1Hpng-/- Thehomozygous Gnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to position 34 to 46 downstream of the translation start point ATG of the Gnal splicing variant 2 was detected resulting in an early stop at position 150 and producing a truncated protein with 50 amino acids. Only 5% of homozygous Gnal knockout mice could survive till maturity Core Facility Transgenic Animals, University Clinics Tuebingen, Tuebingen, Germany mutant Unknown Gnal^em1Hpng 150429816 18 63595606 63735803 1 - by flanking markers 18 61991738 62131420 1 - by flanking markers 18 62805406 62946133 1 - by flanking markers 150429818 BN/HsdMcwiRrrc Inbred from a single pair of SsN line rats obtained from Harlan Sprague Dawley (Alabama colony). Maintained at the Medical College of Wisconsin since 1995. To confirm homozygosity, the strain was tested with 200 microsatellite markers (genome-wide scan at 20cM) all of which were homozygous for all regions tested (Cowley et al. 2000, Physiol. Genomics. 2:107-115). This strain was maintained at RRRC. Rat Resource & Research Center inbred Cryopreserved Embryo; Cryopreserved Sperm; Cryorecovery (as of 2021-09-30) 150429825 SD-Scn9a*^tm1Amgn/Crl Exon 25 of the rat Scn9a gene was replaced with the human SCN9A exon counterpart (exon 26) using ZFN technology. The mRNAs of the active ZFN pair targets middle region of the exon (CACCATCATGGTTCTTATAtgcctcAACATGGTAA CCATGATG, ZFN binding sites in uppercase). This Sprague Dawley (SD) rat model was designed by Amgen, adapted and executed by SAGE Labs, Sigma-Aldrich and maintained in Charles River Laboratories. mutant Unknown Scn9a*^tm1Amgn 150429827 3 48438725 48518893 1 - by flanking markers 3 59207264 59286961 1 - by flanking markers 3 52583953 52664209 1 - by flanking markers 150429828 SD-Tspo^em1Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat5 founders using the following primer pairs: CKOZFN-F: 50-AGAGCATACTCTTGCCGTCG-30 and CKOZFN-R:50-ACTCCTAAAGGGGTTGCAGG-30; Normal PCRs generated 362 bp for the WT and 273 bp for the mutant,(89 bp deletion). McGill University and Genome Quebec Innovation Centre (Montreal, Canada) mutant Unknown Tspo^em1Vpl 150429831 7 121597084 121599342 1 - by flanking markers 7 124449361 124459090 1 - by flanking markers 7 124460358 124470610 1 - by flanking markers 150429830 SD-Tspo^em2Vpl Tspo-targeted genome editing in Sprague Dawley rats embryos by microinjecting with optimized and customized ZFNs designed for targeted gene KO. Locus-specific PCR was performed to identify Rat7 founders using the following primer pairs: COMPOZr-1kbF: 50-CCTGGATATGCTGTGTCCCC-30 and COMPOZr-1kbR: 50-TGATGGGTCATTTGTGCCCT-30.; Normal PCRs generated 818 bp for WT and 652 bp for the mutant (166 bp deletion). McGill University and Genome Quebec Innovation Centre (Montreal, Canada) mutant Unknown Tspo^em2Vpl 150429832 7 121597084 121599342 1 - by flanking markers 7 124449361 124459090 1 - by flanking markers 7 124460358 124470610 1 - by flanking markers 150429960 WIC-Wwox^lde/Fta Established from a closed colony of Wistar-Imamichi (WIC) rats as a spontaneous mutant exhibiting severe dwarfism, short lifespan (early postnatal lethality), and high incidence of epileptic seizures. Mutant rats showed growth retardation after 3 d of age, and at 21 d their weight was about 56% that of normal rats. Sequencing of the full-length Wwox transcript identified a 13-bp deletion in exon 9 in lde/lde rats. This mutation causes a frame shift, resulting in aberrant amino acid sequences at the C-terminal. Laboratory of Veterinary Physiology, Nippon Veterinary and Life Science University, Tokyo mutant Unknown Wwox^lde 150429961 150429963 WI-Pmch^m1Hubr The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. Hubrecht Laboratory, Centre for Biomedical Genetics, 3584 CT Utrecht, The Netherlands. Hera Biolabs, Taconic. mutant Unknown Pmch^m1Hubr 150429964 150429965 SD-Apoa4^em1Bcgen TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp. Beijing Biocytogen Co., Ltd. (Beijing, China). mutant Unknown Apoa4^em1Bcgen 150429966