MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-10, 23:37 CDT based on data in: /scratch/g/akwitek/wdemos/GSE264129

General Statistics

Showing ³³⁶/₃₃₆ rows and ⁶/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GSM8212524	34.5%
GSM8212524_SRR28709799_1				54.1%	52%	150 bp	150 bp	9%	41.5
GSM8212524_SRR28709799_2				1.8%	52%	150 bp	150 bp	27%	41.5
GSM8212524_STAR		64.0%	26.5
GSM8212525	38.1%
GSM8212525_SRR28709798_1				51.6%	53%	150 bp	150 bp	9%	29.2
GSM8212525_SRR28709798_2				1.8%	52%	150 bp	150 bp	27%	29.2
GSM8212525_STAR		62.1%	18.1
GSM8212526	30.5%
GSM8212526_SRR28709797_1				45.0%	51%	150 bp	150 bp	0%	28.7
GSM8212526_SRR28709797_2				1.3%	51%	150 bp	150 bp	27%	28.7
GSM8212526_STAR		67.2%	19.3
GSM8212527	36.1%
GSM8212527_SRR28709796_1				52.8%	53%	150 bp	150 bp	9%	34.3
GSM8212527_SRR28709796_2				1.9%	52%	150 bp	150 bp	27%	34.3
GSM8212527_STAR		61.9%	21.2
GSM8212528	29.2%
GSM8212528_SRR28709795_1				48.6%	50%	150 bp	150 bp	0%	41.6
GSM8212528_SRR28709795_2				1.5%	49%	150 bp	150 bp	27%	41.6
GSM8212528_STAR		69.2%	28.8
GSM8212529	37.8%
GSM8212529_SRR28709794_1				55.7%	53%	150 bp	150 bp	18%	29.4
GSM8212529_SRR28709794_2				1.8%	53%	150 bp	150 bp	36%	29.4
GSM8212529_STAR		58.5%	17.2
GSM8212530	39.1%
GSM8212530_SRR28709793_1				59.7%	54%	150 bp	150 bp	27%	39.4
GSM8212530_SRR28709793_2				1.9%	54%	150 bp	150 bp	27%	39.4
GSM8212530_STAR		56.9%	22.4
GSM8212531	37.1%
GSM8212531_SRR28709792_1				56.3%	54%	150 bp	150 bp	18%	34.5
GSM8212531_SRR28709792_2				1.7%	53%	150 bp	150 bp	27%	34.5
GSM8212531_STAR		57.9%	20.0
GSM8212532	46.1%
GSM8212532_SRR28709791_1				59.2%	55%	150 bp	150 bp	18%	41.6
GSM8212532_SRR28709791_2				1.6%	56%	150 bp	150 bp	27%	41.6
GSM8212532_STAR		56.1%	23.3
GSM8212533	33.9%
GSM8212533_SRR28709790_1				47.1%	51%	150 bp	150 bp	0%	33.4
GSM8212533_SRR28709790_2				1.3%	50%	150 bp	150 bp	27%	33.4
GSM8212533_STAR		68.8%	23.0
GSM8212534	34.0%
GSM8212534_SRR28709789_1				48.6%	52%	150 bp	150 bp	0%	32.3
GSM8212534_SRR28709789_2				1.6%	52%	150 bp	150 bp	27%	32.3
GSM8212534_STAR		63.7%	20.6
GSM8212535	41.4%
GSM8212535_SRR28709788_1				58.4%	54%	150 bp	150 bp	18%	31.5
GSM8212535_SRR28709788_2				1.8%	54%	150 bp	150 bp	18%	31.5
GSM8212535_STAR		56.7%	17.8
GSM8212536	33.2%
GSM8212536_SRR28709787_1				50.0%	50%	150 bp	150 bp	0%	40.5
GSM8212536_SRR28709787_2				1.8%	49%	150 bp	150 bp	27%	40.5
GSM8212536_STAR		69.1%	28.0
GSM8212537	30.1%
GSM8212537_SRR28709786_1				46.9%	50%	150 bp	150 bp	0%	32.2
GSM8212537_SRR28709786_2				1.5%	50%	150 bp	150 bp	27%	32.2
GSM8212537_STAR		68.3%	22.0
GSM8212538	26.9%
GSM8212538_SRR28709785_1				46.5%	50%	150 bp	150 bp	0%	38.2
GSM8212538_SRR28709785_2				1.3%	49%	150 bp	150 bp	27%	38.2
GSM8212538_STAR		68.8%	26.3
GSM8212539	31.5%
GSM8212539_SRR28709784_1				48.3%	51%	150 bp	150 bp	0%	31.1
GSM8212539_SRR28709784_2				1.6%	51%	150 bp	150 bp	27%	31.1
GSM8212539_STAR		65.5%	20.3
GSM8212540	34.0%
GSM8212540_SRR28709783_1				51.3%	51%	150 bp	150 bp	9%	53.8
GSM8212540_SRR28709783_2				1.3%	51%	150 bp	150 bp	27%	53.8
GSM8212540_STAR		67.7%	36.5
GSM8212541	30.7%
GSM8212541_SRR28709782_1				47.3%	50%	150 bp	150 bp	0%	38.5
GSM8212541_SRR28709782_2				1.3%	50%	150 bp	150 bp	27%	38.5
GSM8212541_STAR		70.0%	26.9
GSM8212542	31.1%
GSM8212542_SRR28709781_1				46.6%	50%	150 bp	150 bp	0%	38.0
GSM8212542_SRR28709781_2				1.7%	49%	150 bp	150 bp	27%	38.0
GSM8212542_STAR		71.9%	27.3
GSM8212543	29.8%
GSM8212543_SRR28709780_1				45.4%	49%	150 bp	150 bp	0%	37.6
GSM8212543_SRR28709780_2				1.2%	48%	150 bp	150 bp	27%	37.6
GSM8212543_STAR		72.9%	27.4
GSM8212544	28.1%
GSM8212544_SRR28709779_1				49.5%	49%	150 bp	150 bp	0%	44.0
GSM8212544_SRR28709779_2				1.6%	49%	150 bp	150 bp	27%	44.0
GSM8212544_STAR		71.7%	31.6
GSM8212545	31.5%
GSM8212545_SRR28709778_1				45.7%	50%	150 bp	150 bp	0%	30.9
GSM8212545_SRR28709778_2				1.3%	50%	150 bp	150 bp	27%	30.9
GSM8212545_STAR		69.3%	21.4
GSM8212546	26.6%
GSM8212546_SRR28709777_1				44.5%	49%	150 bp	150 bp	0%	32.9
GSM8212546_SRR28709777_2				1.1%	48%	150 bp	150 bp	27%	32.9
GSM8212546_STAR		72.0%	23.7
GSM8212547	30.9%
GSM8212547_SRR28709776_1				45.7%	51%	150 bp	150 bp	0%	30.7
GSM8212547_SRR28709776_2				1.4%	51%	150 bp	150 bp	27%	30.7
GSM8212547_STAR		67.4%	20.7
GSM8212548	31.7%
GSM8212548_SRR28709775_1				47.6%	50%	150 bp	150 bp	0%	40.7
GSM8212548_SRR28709775_2				1.4%	49%	150 bp	150 bp	27%	40.7
GSM8212548_STAR		71.8%	29.3
GSM8212549	30.6%
GSM8212549_SRR28709774_1				48.0%	51%	150 bp	150 bp	0%	33.7
GSM8212549_SRR28709774_2				1.5%	50%	150 bp	150 bp	27%	33.7
GSM8212549_STAR		68.8%	23.2
GSM8212550	30.1%
GSM8212550_SRR28709773_1				49.3%	50%	150 bp	150 bp	0%	42.0
GSM8212550_SRR28709773_2				1.6%	49%	150 bp	150 bp	27%	42.0
GSM8212550_STAR		68.8%	28.9
GSM8212551	30.4%
GSM8212551_SRR28709772_1				48.8%	51%	150 bp	150 bp	0%	39.7
GSM8212551_SRR28709772_2				1.4%	50%	150 bp	150 bp	27%	39.7
GSM8212551_STAR		67.0%	26.6
GSM8212552	31.9%
GSM8212552_SRR28709771_1				47.5%	50%	150 bp	150 bp	0%	41.8
GSM8212552_SRR28709771_2				1.4%	49%	150 bp	150 bp	27%	41.8
GSM8212552_STAR		71.2%	29.8
GSM8212553	29.5%
GSM8212553_SRR28709770_1				45.8%	50%	150 bp	150 bp	0%	35.6
GSM8212553_SRR28709770_2				1.4%	49%	150 bp	150 bp	27%	35.6
GSM8212553_STAR		70.3%	25.0
GSM8212554	40.5%
GSM8212554_SRR28709769_1				53.2%	52%	150 bp	150 bp	9%	37.3
GSM8212554_SRR28709769_2				1.7%	51%	150 bp	150 bp	27%	37.3
GSM8212554_STAR		65.5%	24.5
GSM8212555	35.6%
GSM8212555_SRR28709768_1				49.2%	51%	150 bp	150 bp	0%	34.8
GSM8212555_SRR28709768_2				1.6%	50%	150 bp	150 bp	27%	34.8
GSM8212555_STAR		67.8%	23.6
GSM8212556	33.6%
GSM8212556_SRR28709767_1				53.8%	51%	150 bp	150 bp	9%	44.4
GSM8212556_SRR28709767_2				2.0%	51%	150 bp	150 bp	27%	44.4
GSM8212556_STAR		64.7%	28.7
GSM8212557	35.4%
GSM8212557_SRR28709766_1				49.4%	51%	150 bp	150 bp	0%	32.4
GSM8212557_SRR28709766_2				1.5%	51%	150 bp	150 bp	27%	32.4
GSM8212557_STAR		66.0%	21.4
GSM8212558	35.4%
GSM8212558_SRR28709765_1				50.8%	51%	150 bp	150 bp	9%	37.4
GSM8212558_SRR28709765_2				1.6%	51%	150 bp	150 bp	27%	37.4
GSM8212558_STAR		66.3%	24.8
GSM8212559	37.7%
GSM8212559_SRR28709764_1				49.7%	51%	150 bp	150 bp	0%	30.8
GSM8212559_SRR28709764_2				1.5%	51%	150 bp	150 bp	27%	30.8
GSM8212559_STAR		66.2%	20.4
GSM8212560	34.8%
GSM8212560_SRR28709763_1				47.1%	48%	150 bp	150 bp	0%	38.2
GSM8212560_SRR28709763_2				1.9%	48%	150 bp	150 bp	27%	38.2
GSM8212560_STAR		73.5%	28.1
GSM8212561	27.7%
GSM8212561_SRR28709762_1				44.5%	49%	150 bp	150 bp	0%	34.1
GSM8212561_SRR28709762_2				1.4%	49%	150 bp	150 bp	27%	34.1
GSM8212561_STAR		69.9%	23.8
GSM8212562	30.6%
GSM8212562_SRR28709761_1				50.4%	51%	150 bp	150 bp	18%	36.9
GSM8212562_SRR28709761_2				1.9%	50%	150 bp	150 bp	36%	36.9
GSM8212562_STAR		64.1%	23.7
GSM8212563	35.5%
GSM8212563_SRR28709760_1				50.5%	51%	150 bp	150 bp	9%	36.0
GSM8212563_SRR28709760_2				1.4%	51%	150 bp	150 bp	27%	36.0
GSM8212563_STAR		67.3%	24.2
GSM8212564	33.7%
GSM8212564_SRR28709759_1				49.0%	51%	150 bp	150 bp	0%	33.7
GSM8212564_SRR28709759_2				1.7%	50%	150 bp	150 bp	27%	33.7
GSM8212564_STAR		67.7%	22.8
GSM8212565	36.4%
GSM8212565_SRR28709758_1				51.7%	52%	150 bp	150 bp	9%	39.3
GSM8212565_SRR28709758_2				1.6%	52%	150 bp	150 bp	27%	39.3
GSM8212565_STAR		64.4%	25.3
GSM8212566	27.5%
GSM8212566_SRR28709757_1				44.1%	48%	150 bp	150 bp	0%	43.3
GSM8212566_SRR28709757_2				1.5%	47%	150 bp	150 bp	18%	43.3
GSM8212566_STAR		74.5%	32.2
GSM8212567	36.7%
GSM8212567_SRR28709756_1				48.0%	50%	150 bp	150 bp	0%	33.5
GSM8212567_SRR28709756_2				1.5%	50%	150 bp	150 bp	27%	33.5
GSM8212567_STAR		68.8%	23.1
GSM8212568	33.0%
GSM8212568_SRR28709755_1				46.3%	48%	150 bp	150 bp	0%	36.7
GSM8212568_SRR28709755_2				1.5%	47%	150 bp	150 bp	27%	36.7
GSM8212568_STAR		73.2%	26.9
GSM8212569	32.0%
GSM8212569_SRR28709754_1				43.4%	49%	150 bp	150 bp	0%	31.0
GSM8212569_SRR28709754_2				1.2%	48%	150 bp	150 bp	27%	31.0
GSM8212569_STAR		71.3%	22.1
GSM8212570	31.8%
GSM8212570_SRR28709753_1				48.7%	50%	150 bp	150 bp	0%	38.6
GSM8212570_SRR28709753_2				1.6%	49%	150 bp	150 bp	27%	38.6
GSM8212570_STAR		68.4%	26.4
GSM8212571	32.2%
GSM8212571_SRR28709752_1				43.3%	47%	150 bp	150 bp	0%	36.6
GSM8212571_SRR28709752_2				1.2%	47%	150 bp	150 bp	18%	36.6
GSM8212571_STAR		76.1%	27.8
GSM8212572	33.1%
GSM8212572_SRR28709751_1				50.5%	51%	150 bp	150 bp	9%	37.3
GSM8212572_SRR28709751_2				1.7%	50%	150 bp	150 bp	27%	37.3
GSM8212572_STAR		67.5%	25.2
GSM8212573	31.5%
GSM8212573_SRR28709750_1				46.4%	50%	150 bp	150 bp	0%	33.8
GSM8212573_SRR28709750_2				1.3%	49%	150 bp	150 bp	27%	33.8
GSM8212573_STAR		70.1%	23.7
GSM8212574	35.5%
GSM8212574_SRR28709749_1				51.1%	52%	150 bp	150 bp	9%	36.3
GSM8212574_SRR28709749_2				1.5%	51%	150 bp	150 bp	27%	36.3
GSM8212574_STAR		64.6%	23.4
GSM8212575	34.1%
GSM8212575_SRR28709748_1				48.4%	51%	150 bp	150 bp	0%	33.7
GSM8212575_SRR28709748_2				1.5%	50%	150 bp	150 bp	27%	33.7
GSM8212575_STAR		67.6%	22.8
GSM8212576	33.3%
GSM8212576_SRR28709747_1				46.9%	49%	150 bp	150 bp	0%	40.9
GSM8212576_SRR28709747_2				1.4%	48%	150 bp	150 bp	27%	40.9
GSM8212576_STAR		71.7%	29.3
GSM8212577	28.6%
GSM8212577_SRR28709746_1				38.1%	48%	150 bp	150 bp	0%	31.9
GSM8212577_SRR28709746_2				1.2%	47%	150 bp	150 bp	27%	31.9
GSM8212577_STAR		72.3%	23.1
GSM8212578	29.7%
GSM8212578_SRR28709745_1				49.7%	50%	150 bp	150 bp	0%	48.2
GSM8212578_SRR28709745_2				1.5%	49%	150 bp	150 bp	27%	48.2
GSM8212578_STAR		70.8%	34.1
GSM8212579	29.7%
GSM8212579_SRR28709744_1				44.6%	50%	150 bp	150 bp	0%	33.3
GSM8212579_SRR28709744_2				1.5%	49%	150 bp	150 bp	27%	33.3
GSM8212579_STAR		70.6%	23.5
GSM8212580	33.5%
GSM8212580_SRR28709743_1				47.9%	51%	150 bp	150 bp	0%	32.7
GSM8212580_SRR28709743_2				1.4%	50%	150 bp	150 bp	27%	32.7
GSM8212580_STAR		67.0%	21.9
GSM8212581	35.3%
GSM8212581_SRR28709742_1				50.2%	51%	150 bp	150 bp	9%	35.8
GSM8212581_SRR28709742_2				1.6%	50%	150 bp	150 bp	27%	35.8
GSM8212581_STAR		66.8%	23.9
GSM8212582	34.2%
GSM8212582_SRR28709741_1				47.5%	50%	150 bp	150 bp	0%	34.1
GSM8212582_SRR28709741_2				1.4%	50%	150 bp	150 bp	27%	34.1
GSM8212582_STAR		69.3%	23.6
GSM8212583	31.5%
GSM8212583_SRR28709740_1				46.7%	50%	150 bp	150 bp	0%	38.9
GSM8212583_SRR28709740_2				1.5%	49%	150 bp	150 bp	27%	38.9
GSM8212583_STAR		69.7%	27.1
GSM8212584	23.2%
GSM8212584_SRR28709739_1				59.5%	53%	150 bp	150 bp	18%	36.7
GSM8212584_SRR28709739_2				2.2%	52%	150 bp	150 bp	27%	36.7
GSM8212584_STAR		53.2%	19.5
GSM8212585	31.2%
GSM8212585_SRR28709738_1				56.3%	51%	150 bp	150 bp	18%	34.9
GSM8212585_SRR28709738_2				1.7%	51%	150 bp	150 bp	27%	34.9
GSM8212585_STAR		64.5%	22.5
GSM8212586	42.8%
GSM8212586_SRR28709737_1				63.8%	53%	150 bp	150 bp	27%	38.0
GSM8212586_SRR28709737_2				2.2%	52%	150 bp	150 bp	27%	38.0
GSM8212586_STAR		61.7%	23.5
GSM8212587	33.9%
GSM8212587_SRR28709736_1				50.8%	50%	150 bp	150 bp	9%	33.3
GSM8212587_SRR28709736_2				1.3%	50%	150 bp	150 bp	18%	33.3
GSM8212587_STAR		69.6%	23.2
GSM8212588	44.8%
GSM8212588_SRR28709735_1				57.7%	51%	150 bp	150 bp	9%	38.0
GSM8212588_SRR28709735_2				1.6%	51%	150 bp	150 bp	18%	38.0
GSM8212588_STAR		67.6%	25.7
GSM8212589	43.3%
GSM8212589_SRR28709734_1				59.8%	52%	150 bp	150 bp	18%	33.0
GSM8212589_SRR28709734_2				1.8%	52%	150 bp	150 bp	18%	33.0
GSM8212589_STAR		63.8%	21.1
GSM8212590	16.7%
GSM8212590_SRR28709733_1				49.3%	50%	150 bp	150 bp	9%	36.2
GSM8212590_SRR28709733_2				1.6%	49%	150 bp	150 bp	27%	36.2
GSM8212590_STAR		63.0%	22.8
GSM8212591	32.5%
GSM8212591_SRR28709732_1				49.4%	51%	150 bp	150 bp	0%	32.7
GSM8212591_SRR28709732_2				1.3%	51%	150 bp	150 bp	27%	32.7
GSM8212591_STAR		66.0%	21.6
GSM8212592	24.3%
GSM8212592_SRR28709731_1				44.8%	51%	150 bp	150 bp	9%	26.2
GSM8212592_SRR28709731_2				1.6%	51%	150 bp	150 bp	36%	26.2
GSM8212592_STAR		59.6%	15.6
GSM8212593	29.4%
GSM8212593_SRR28709730_1				43.7%	49%	150 bp	150 bp	0%	36.1
GSM8212593_SRR28709730_2				1.3%	49%	150 bp	150 bp	18%	36.1
GSM8212593_STAR		71.5%	25.8
GSM8212594	25.2%
GSM8212594_SRR28709729_1				46.9%	50%	150 bp	150 bp	9%	36.1
GSM8212594_SRR28709729_2				1.4%	49%	150 bp	150 bp	27%	36.1
GSM8212594_STAR		70.1%	25.3
GSM8212595	12.0%
GSM8212595_SRR28709728_1				41.9%	45%	150 bp	150 bp	9%	39.4
GSM8212595_SRR28709728_2				1.9%	45%	150 bp	150 bp	27%	39.4
GSM8212595_STAR		72.6%	28.6
GSM8212596	42.7%
GSM8212596_SRR28709727_1				58.4%	50%	150 bp	150 bp	18%	35.5
GSM8212596_SRR28709727_2				1.8%	50%	150 bp	150 bp	27%	35.5
GSM8212596_STAR		69.4%	24.6
GSM8212597	29.2%
GSM8212597_SRR28709726_1				48.8%	49%	150 bp	150 bp	9%	33.6
GSM8212597_SRR28709726_2				1.4%	49%	150 bp	150 bp	27%	33.6
GSM8212597_STAR		70.7%	23.7
GSM8212598	38.6%
GSM8212598_SRR28709725_1				57.7%	52%	150 bp	150 bp	18%	43.2
GSM8212598_SRR28709725_2				1.7%	51%	150 bp	150 bp	27%	43.2
GSM8212598_STAR		65.7%	28.4
GSM8212599	28.2%
GSM8212599_SRR28709724_1				48.4%	49%	150 bp	150 bp	9%	37.8
GSM8212599_SRR28709724_2				1.6%	49%	150 bp	150 bp	27%	37.8
GSM8212599_STAR		69.3%	26.2
GSM8212600	7.0%
GSM8212600_SRR28709723_1				35.5%	43%	150 bp	150 bp	0%	50.0
GSM8212600_SRR28709723_2				1.1%	43%	150 bp	150 bp	18%	50.0
GSM8212600_STAR		81.6%	40.8
GSM8212601	28.6%
GSM8212601_SRR28709722_1				40.0%	49%	150 bp	150 bp	0%	34.8
GSM8212601_SRR28709722_2				1.1%	48%	150 bp	150 bp	27%	34.8
GSM8212601_STAR		71.4%	24.9
GSM8212602	52.0%
GSM8212602_SRR28709721_1				57.9%	53%	150 bp	150 bp	18%	32.4
GSM8212602_SRR28709721_2				1.7%	53%	150 bp	150 bp	18%	32.4
GSM8212602_STAR		64.0%	20.7
GSM8212603	32.4%
GSM8212603_SRR28709720_1				48.1%	50%	150 bp	150 bp	0%	41.2
GSM8212603_SRR28709720_2				1.5%	50%	150 bp	150 bp	27%	41.2
GSM8212603_STAR		69.2%	28.5
GSM8212604	43.0%
GSM8212604_SRR28709719_1				59.3%	53%	150 bp	150 bp	9%	40.6
GSM8212604_SRR28709719_2				2.0%	53%	150 bp	150 bp	27%	40.6
GSM8212604_STAR		61.5%	25.0
GSM8212605	30.6%
GSM8212605_SRR28709718_1				47.1%	50%	150 bp	150 bp	0%	39.5
GSM8212605_SRR28709718_2				1.2%	49%	150 bp	150 bp	27%	39.5
GSM8212605_STAR		69.7%	27.5
GSM8212606	30.9%
GSM8212606_SRR28709717_1				47.9%	51%	150 bp	150 bp	0%	35.6
GSM8212606_SRR28709717_2				1.3%	50%	150 bp	150 bp	18%	35.6
GSM8212606_STAR		69.1%	24.6
GSM8212607	34.6%
GSM8212607_SRR28709716_1				52.4%	53%	150 bp	150 bp	18%	41.4
GSM8212607_SRR28709716_2				1.6%	53%	150 bp	150 bp	36%	41.4
GSM8212607_STAR		59.2%	24.5

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

All samples have sequences of a single length (150bp).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
CTGGCAAATAATTTTGTAGGTTTAATTATTAAGGTTTAGGGCTAAGCATA	82	7249071	0.1178%
CCTTGGTCCGTGTTACAAGACGGGTCGGGTGGGTAGCCGACATCGCCGCC	81	7408127	0.1204%
ACGAATGGTTTAGCGCCAGGTTCCACACGAACGTGCGTTAAGCGTGACGG	81	6900546	0.1121%
GCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGG	79	6774738	0.1101%
GCCAGGTTCCACACGAACGTGCGTTAAGCGTGACGGGCGAGAGGGCGGCC	78	5324879	0.0865%
CCTCTCATAAATTTGTTAGTGAAATTATGTATATATGAATGCCAATCTAA	77	10077600	0.1637%
CCTTGGTCCGTGTTCCAAGACGGGTCGGGTGGGTAGCCGACATCGCCGCC	73	4251046	0.0691%
GGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGA	69	3742773	0.0608%
CCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTG	56	2669987	0.0434%
GGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGGAAACCGCGGCCC	42	2207032	0.0359%
CCCCTGGTCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCG	36	1955881	0.0318%
GCGCCAGGTTCCACACGAACGTGCGTTAAGCGTGACGGGCGAGAGGGCGG	34	1609583	0.0261%
TTCCTTAAAGCACGCCTGTGTTGGGCTAACGAGTTAGGGATAGGTAATTT	21	942181	0.0153%
TATTGGGAGATTCCAGCCTCTTCACTGGAAGGTCAATTTCACTGATTGAA	19	924790	0.0150%
GCTTCTGGGTCGGGGTTTCGTACGTAGCAGAGCAGCTCCCTCGCTGCGAT	15	671638	0.0109%
GGGCTGGTTCACCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGA	11	550027	0.0089%
CCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATG	10	385603	0.0063%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	9	378832	0.0062%
GGCTCCCTCGGCCCCGGGATTCGGCGAGCGCTGCTGCCGGGGGGCTGTAA	9	422173	0.0069%
TCTCGTCTTATTGGGAGATTCCAGCCTCTTCACTGGAAGGTCAATTTCAC	8	347036	0.0056%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks