MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2025-03-11, 16:10 CDT based on data in: /scratch/g/akwitek/wdemos/GSE219045

General Statistics

Showing ³⁵²/₃₅₂ rows and ⁶/₉ columns.

Sample Name	% Alignable, M	% Aligned	M Aligned	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
GSM6765826	76.7%
GSM6765826_1				48.8%	50%	75 bp	76 bp	9%	13.6
GSM6765826_2				36.4%	50%	75 bp	76 bp	9%	13.6
GSM6765826_STAR		72.9%	39.4
GSM6765827	74.8%
GSM6765827_1				49.6%	51%	75 bp	76 bp	9%	12.9
GSM6765827_2				36.1%	51%	75 bp	76 bp	9%	12.9
GSM6765827_STAR		70.5%	36.3
GSM6765828	73.3%
GSM6765828_1				37.9%	48%	75 bp	76 bp	9%	13.4
GSM6765828_2				29.3%	48%	75 bp	76 bp	9%	13.4
GSM6765828_STAR		72.9%	38.9
GSM6765829	73.4%
GSM6765829_1				31.1%	48%	75 bp	76 bp	9%	15.2
GSM6765829_2				23.3%	48%	75 bp	76 bp	9%	15.2
GSM6765829_STAR		76.8%	46.4
GSM6765830	67.7%
GSM6765830_1				29.8%	47%	75 bp	76 bp	9%	14.9
GSM6765830_2				22.0%	47%	75 bp	76 bp	9%	14.9
GSM6765830_STAR		73.3%	43.5
GSM6765831	68.2%
GSM6765831_1				33.0%	47%	75 bp	76 bp	9%	15.5
GSM6765831_2				24.1%	46%	75 bp	76 bp	9%	15.5
GSM6765831_STAR		72.4%	44.7
GSM6765832	74.9%
GSM6765832_1				49.3%	46%	75 bp	76 bp	9%	16.2
GSM6765832_2				37.9%	46%	75 bp	76 bp	9%	16.2
GSM6765832_STAR		76.6%	49.4
GSM6765833	72.9%
GSM6765833_1				39.0%	47%	75 bp	76 bp	9%	17.4
GSM6765833_2				30.2%	47%	75 bp	76 bp	9%	17.4
GSM6765833_STAR		76.2%	53.4
GSM6765834	63.4%
GSM6765834_1				31.3%	48%	75 bp	76 bp	9%	16.2
GSM6765834_2				26.6%	54%	75 bp	76 bp	27%	16.2
GSM6765834_STAR		71.2%	45.3
GSM6765835	63.6%
GSM6765835_1				30.1%	48%	75 bp	76 bp	9%	15.0
GSM6765835_2				25.3%	53%	75 bp	76 bp	27%	15.0
GSM6765835_STAR		71.8%	43.0
GSM6765836	66.3%
GSM6765836_1				28.8%	46%	75 bp	76 bp	9%	17.1
GSM6765836_2				23.2%	51%	75 bp	76 bp	27%	17.1
GSM6765836_STAR		75.8%	51.7
GSM6765837	65.0%
GSM6765837_1				29.4%	47%	75 bp	76 bp	9%	17.0
GSM6765837_2				24.8%	52%	75 bp	76 bp	27%	17.0
GSM6765837_STAR		74.2%	49.7
GSM6765838	68.2%
GSM6765838_1				28.4%	47%	75 bp	76 bp	9%	17.7
GSM6765838_2				24.5%	52%	75 bp	76 bp	27%	17.7
GSM6765838_STAR		75.4%	52.4
GSM6765839	67.1%
GSM6765839_1				29.6%	46%	75 bp	76 bp	9%	20.3
GSM6765839_2				24.8%	51%	75 bp	76 bp	27%	20.3
GSM6765839_STAR		75.4%	60.4
GSM6765840	67.3%
GSM6765840_1				24.1%	46%	75 bp	76 bp	9%	17.4
GSM6765840_2				19.6%	49%	75 bp	76 bp	27%	17.4
GSM6765840_STAR		78.7%	55.5
GSM6765841	68.0%
GSM6765841_1				27.8%	47%	75 bp	76 bp	9%	17.8
GSM6765841_2				22.5%	51%	75 bp	76 bp	27%	17.8
GSM6765841_STAR		75.9%	54.8
GSM6765842	71.7%
GSM6765842_1				30.8%	48%	75 bp	76 bp	9%	14.1
GSM6765842_2				26.6%	51%	75 bp	76 bp	18%	14.1
GSM6765842_STAR		75.6%	42.4
GSM6765843	69.5%
GSM6765843_1				31.2%	48%	75 bp	76 bp	9%	13.6
GSM6765843_2				27.2%	52%	75 bp	76 bp	27%	13.6
GSM6765843_STAR		73.9%	39.2
GSM6765844	74.6%
GSM6765844_1				36.9%	48%	75 bp	76 bp	9%	14.6
GSM6765844_2				32.0%	52%	75 bp	76 bp	18%	14.6
GSM6765844_STAR		73.5%	43.7
GSM6765845	69.8%
GSM6765845_1				35.7%	49%	75 bp	76 bp	9%	12.8
GSM6765845_2				31.5%	53%	75 bp	76 bp	18%	12.8
GSM6765845_STAR		69.6%	36.5
GSM6765846	70.7%
GSM6765846_1				40.6%	49%	75 bp	76 bp	9%	11.7
GSM6765846_2				35.9%	53%	75 bp	76 bp	18%	11.7
GSM6765846_STAR		67.7%	32.5
GSM6765847	62.0%
GSM6765847_1				42.1%	51%	75 bp	76 bp	18%	11.9
GSM6765847_2				35.5%	56%	75 bp	76 bp	27%	11.9
GSM6765847_STAR		62.2%	28.8
GSM6765848	65.3%
GSM6765848_1				32.8%	49%	75 bp	76 bp	9%	8.5
GSM6765848_2				29.1%	54%	75 bp	76 bp	18%	8.5
GSM6765848_STAR		68.5%	23.9
GSM6765849	63.4%
GSM6765849_1				35.4%	50%	75 bp	76 bp	18%	12.2
GSM6765849_2				31.5%	55%	75 bp	76 bp	27%	12.2
GSM6765849_STAR		68.9%	33.3
GSM6765850	76.6%
GSM6765850_1				67.6%	49%	75 bp	76 bp	36%	16.1
GSM6765850_2				58.8%	53%	75 bp	76 bp	36%	16.1
GSM6765850_STAR		54.3%	34.5
GSM6765851	73.3%
GSM6765851_1				66.8%	50%	75 bp	76 bp	36%	15.0
GSM6765851_2				57.6%	55%	75 bp	76 bp	36%	15.0
GSM6765851_STAR		51.0%	30.1
GSM6765852	74.6%
GSM6765852_1				44.7%	49%	75 bp	76 bp	9%	17.3
GSM6765852_2				37.1%	51%	75 bp	76 bp	9%	17.3
GSM6765852_STAR		71.6%	50.2
GSM6765853	78.6%
GSM6765853_1				49.2%	50%	75 bp	76 bp	18%	17.7
GSM6765853_2				42.0%	53%	75 bp	76 bp	18%	17.7
GSM6765853_STAR		72.4%	50.5
GSM6765854	80.9%
GSM6765854_1				36.2%	47%	75 bp	76 bp	9%	17.6
GSM6765854_2				30.4%	49%	75 bp	76 bp	9%	17.6
GSM6765854_STAR		80.9%	55.9
GSM6765855	68.0%
GSM6765855_1				32.4%	48%	75 bp	76 bp	9%	13.6
GSM6765855_2				25.7%	50%	75 bp	76 bp	18%	13.6
GSM6765855_STAR		74.4%	40.4
GSM6765856	76.0%
GSM6765856_1				47.9%	49%	75 bp	76 bp	9%	14.6
GSM6765856_2				40.9%	51%	75 bp	76 bp	18%	14.6
GSM6765856_STAR		75.3%	44.7
GSM6765857	66.2%
GSM6765857_1				44.4%	50%	75 bp	76 bp	9%	12.8
GSM6765857_2				37.5%	53%	75 bp	76 bp	27%	12.8
GSM6765857_STAR		69.1%	35.4
GSM6765858	87.1%
GSM6765858_1				40.0%	47%	75 bp	76 bp	9%	12.0
GSM6765858_2				35.2%	49%	75 bp	76 bp	9%	12.0
GSM6765858_STAR		82.3%	39.6
GSM6765859	83.9%
GSM6765859_1				39.0%	48%	75 bp	76 bp	9%	14.3
GSM6765859_2				34.2%	50%	75 bp	76 bp	18%	14.3
GSM6765859_STAR		81.3%	46.1
GSM6765860	87.1%
GSM6765860_1				58.8%	49%	75 bp	76 bp	18%	12.0
GSM6765860_2				53.8%	50%	75 bp	76 bp	27%	12.0
GSM6765860_STAR		79.4%	37.7
GSM6765861	90.0%
GSM6765861_1				55.4%	48%	75 bp	76 bp	18%	12.9
GSM6765861_2				51.3%	50%	75 bp	76 bp	18%	12.9
GSM6765861_STAR		82.1%	42.0
GSM6765862	85.1%
GSM6765862_1				45.3%	50%	75 bp	76 bp	9%	12.3
GSM6765862_2				40.6%	51%	75 bp	76 bp	9%	12.3
GSM6765862_STAR		74.8%	37.0
GSM6765863	86.0%
GSM6765863_1				35.9%	48%	75 bp	76 bp	9%	11.4
GSM6765863_2				31.0%	49%	75 bp	76 bp	9%	11.4
GSM6765863_STAR		82.3%	37.9
GSM6765864	86.9%
GSM6765864_1				55.2%	51%	75 bp	76 bp	18%	12.8
GSM6765864_2				48.8%	53%	75 bp	76 bp	18%	12.8
GSM6765864_STAR		68.1%	35.1
GSM6765865	87.0%
GSM6765865_1				55.3%	50%	75 bp	76 bp	18%	12.7
GSM6765865_2				48.9%	51%	75 bp	76 bp	18%	12.7
GSM6765865_STAR		77.1%	39.1
GSM6765866	84.3%
GSM6765866_1				49.8%	51%	75 bp	76 bp	18%	10.5
GSM6765866_2				42.1%	53%	75 bp	76 bp	18%	10.5
GSM6765866_STAR		68.8%	28.5
GSM6765867	89.5%
GSM6765867_1				51.0%	50%	75 bp	76 bp	18%	12.5
GSM6765867_2				44.6%	52%	75 bp	76 bp	18%	12.5
GSM6765867_STAR		79.7%	39.7
GSM6765868	84.0%
GSM6765868_1				51.7%	50%	75 bp	76 bp	18%	10.7
GSM6765868_2				44.1%	51%	75 bp	76 bp	9%	10.7
GSM6765868_STAR		70.3%	30.3
GSM6765869	89.3%
GSM6765869_1				59.2%	51%	75 bp	76 bp	18%	12.4
GSM6765869_2				52.4%	53%	75 bp	76 bp	27%	12.4
GSM6765869_STAR		60.3%	29.8
GSM6765870	83.2%
GSM6765870_1				51.4%	47%	75 bp	76 bp	18%	12.4
GSM6765870_2				45.4%	49%	75 bp	76 bp	18%	12.4
GSM6765870_STAR		80.2%	39.3
GSM6765871	84.0%
GSM6765871_1				47.6%	48%	75 bp	76 bp	9%	11.8
GSM6765871_2				41.3%	48%	75 bp	76 bp	9%	11.8
GSM6765871_STAR		82.4%	39.2
GSM6765872	83.4%
GSM6765872_1				48.1%	49%	75 bp	76 bp	9%	11.4
GSM6765872_2				41.0%	51%	75 bp	76 bp	18%	11.4
GSM6765872_STAR		78.0%	35.4
GSM6765873	81.4%
GSM6765873_1				47.3%	49%	75 bp	76 bp	9%	11.3
GSM6765873_2				40.0%	51%	75 bp	76 bp	18%	11.3
GSM6765873_STAR		76.7%	34.5
GSM6765874	73.9%
GSM6765874_1				48.4%	50%	75 bp	76 bp	9%	17.6
GSM6765874_2				39.4%	53%	75 bp	76 bp	18%	17.6
GSM6765874_STAR		68.1%	48.6
GSM6765875	71.9%
GSM6765875_1				46.2%	50%	75 bp	76 bp	9%	15.8
GSM6765875_2				37.5%	54%	75 bp	76 bp	27%	15.8
GSM6765875_STAR		67.1%	42.8
GSM6765876	81.7%
GSM6765876_1				52.6%	49%	75 bp	76 bp	18%	17.8
GSM6765876_2				45.5%	51%	75 bp	76 bp	9%	17.8
GSM6765876_STAR		77.1%	55.6
GSM6765877	80.0%
GSM6765877_1				53.0%	49%	75 bp	76 bp	18%	17.2
GSM6765877_2				45.5%	52%	75 bp	76 bp	9%	17.2
GSM6765877_STAR		75.3%	52.5
GSM6765878	79.5%
GSM6765878_1				42.6%	50%	75 bp	76 bp	18%	14.6
GSM6765878_2				34.4%	52%	75 bp	76 bp	27%	14.6
GSM6765878_STAR		77.7%	45.2
GSM6765879	74.6%
GSM6765879_1				44.5%	51%	75 bp	76 bp	27%	16.2
GSM6765879_2				35.8%	52%	75 bp	76 bp	27%	16.2
GSM6765879_STAR		73.4%	47.4
GSM6765880	78.4%
GSM6765880_1				50.4%	52%	75 bp	76 bp	27%	14.1
GSM6765880_2				42.5%	54%	75 bp	76 bp	18%	14.1
GSM6765880_STAR		70.9%	40.6
GSM6765881	75.5%
GSM6765881_1				49.5%	52%	75 bp	76 bp	27%	13.2
GSM6765881_2				39.5%	55%	75 bp	76 bp	27%	13.2
GSM6765881_STAR		70.4%	37.2
GSM6765882	77.6%
GSM6765882_1				38.0%	49%	75 bp	76 bp	9%	20.3
GSM6765882_2				33.4%	52%	75 bp	76 bp	27%	20.3
GSM6765882_STAR		76.8%	63.0
GSM6765883	79.0%
GSM6765883_1				37.9%	49%	75 bp	76 bp	9%	19.8
GSM6765883_2				32.4%	52%	75 bp	76 bp	27%	19.8
GSM6765883_STAR		77.8%	61.8
GSM6765884	80.9%
GSM6765884_1				58.5%	51%	75 bp	76 bp	18%	16.4
GSM6765884_2				52.1%	54%	75 bp	76 bp	36%	16.4
GSM6765884_STAR		74.1%	49.0
GSM6765885	80.6%
GSM6765885_1				57.7%	52%	75 bp	76 bp	18%	16.2
GSM6765885_2				52.5%	55%	75 bp	76 bp	36%	16.2
GSM6765885_STAR		74.2%	48.5
GSM6765886	83.8%
GSM6765886_1				48.1%	49%	75 bp	76 bp	9%	22.4
GSM6765886_2				42.6%	52%	75 bp	76 bp	27%	22.4
GSM6765886_STAR		80.6%	72.7
GSM6765887	79.3%
GSM6765887_1				42.1%	50%	75 bp	76 bp	9%	17.9
GSM6765887_2				38.1%	52%	75 bp	76 bp	27%	17.9
GSM6765887_STAR		74.2%	53.7
GSM6765888	74.6%
GSM6765888_1				37.7%	51%	75 bp	76 bp	9%	16.7
GSM6765888_2				33.9%	54%	75 bp	76 bp	27%	16.7
GSM6765888_STAR		67.2%	44.2
GSM6765889	72.5%
GSM6765889_1				36.0%	50%	75 bp	76 bp	18%	16.7
GSM6765889_2				32.9%	53%	75 bp	76 bp	27%	16.7
GSM6765889_STAR		73.2%	48.0
GSM6765890	75.0%
GSM6765890_1				77.7%	54%	75 bp	76 bp	36%	10.6
GSM6765890_2				70.0%	54%	75 bp	76 bp	27%	10.6
GSM6765890_STAR		15.7%	6.7
GSM6765891	69.6%
GSM6765891_1				69.3%	53%	75 bp	76 bp	27%	11.0
GSM6765891_2				59.2%	54%	75 bp	76 bp	27%	11.0
GSM6765891_STAR		25.1%	10.7
GSM6765892	67.7%
GSM6765892_1				83.1%	54%	75 bp	76 bp	36%	16.0
GSM6765892_2				75.7%	53%	75 bp	76 bp	18%	16.0
GSM6765892_STAR		11.0%	7.3
GSM6765893	72.3%
GSM6765893_1				86.8%	54%	75 bp	76 bp	36%	15.9
GSM6765893_2				78.6%	55%	75 bp	76 bp	27%	15.9
GSM6765893_STAR		8.8%	5.6
GSM6765894	66.8%
GSM6765894_1				86.6%	55%	75 bp	76 bp	36%	15.9
GSM6765894_2				73.6%	55%	75 bp	76 bp	27%	15.9
GSM6765894_STAR		8.1%	5.2
GSM6765895	64.9%
GSM6765895_1				82.6%	55%	75 bp	76 bp	36%	17.0
GSM6765895_2				70.5%	54%	75 bp	76 bp	27%	17.0
GSM6765895_STAR		10.6%	7.2
GSM6765896	68.0%
GSM6765896_1				84.5%	54%	75 bp	76 bp	36%	15.7
GSM6765896_2				73.5%	54%	75 bp	76 bp	27%	15.7
GSM6765896_STAR		9.0%	5.8
GSM6765897	67.9%
GSM6765897_1				84.9%	55%	75 bp	76 bp	36%	16.2
GSM6765897_2				72.0%	57%	75 bp	76 bp	27%	16.2
GSM6765897_STAR		9.2%	5.7
GSM6765898	66.2%
GSM6765898_1				85.5%	53%	75 bp	76 bp	36%	19.5
GSM6765898_2				75.5%	53%	75 bp	76 bp	27%	19.5
GSM6765898_STAR		9.9%	7.7
GSM6765899	66.4%
GSM6765899_1				84.8%	53%	75 bp	76 bp	36%	14.3
GSM6765899_2				74.1%	53%	75 bp	76 bp	27%	14.3
GSM6765899_STAR		10.8%	6.2
GSM6765900	65.4%
GSM6765900_1				85.1%	54%	75 bp	76 bp	36%	16.8
GSM6765900_2				72.4%	53%	75 bp	76 bp	27%	16.8
GSM6765900_STAR		10.2%	6.9
GSM6765901	67.4%
GSM6765901_1				85.4%	54%	75 bp	76 bp	36%	16.6
GSM6765901_2				72.8%	53%	75 bp	76 bp	18%	16.6
GSM6765901_STAR		12.8%	8.5
GSM6765902	69.4%
GSM6765902_1				90.4%	55%	75 bp	76 bp	36%	19.1
GSM6765902_2				76.4%	55%	75 bp	76 bp	27%	19.1
GSM6765902_STAR		4.3%	3.3
GSM6765903	67.0%
GSM6765903_1				80.5%	54%	75 bp	76 bp	36%	14.7
GSM6765903_2				67.1%	53%	75 bp	76 bp	18%	14.7
GSM6765903_STAR		13.5%	8.0
GSM6765904	66.0%
GSM6765904_1				91.4%	55%	75 bp	76 bp	36%	13.5
GSM6765904_2				76.4%	54%	75 bp	76 bp	27%	13.5
GSM6765904_STAR		5.7%	3.1
GSM6765905	69.1%
GSM6765905_1				91.1%	55%	75 bp	76 bp	36%	19.7
GSM6765905_2				77.6%	55%	75 bp	76 bp	27%	19.7
GSM6765905_STAR		4.6%	3.6
GSM6765906	77.8%
GSM6765906_1				43.0%	49%	75 bp	76 bp	9%	13.4
GSM6765906_2				35.2%	50%	75 bp	76 bp	9%	13.4
GSM6765906_STAR		72.5%	38.3
GSM6765907	75.7%
GSM6765907_1				42.6%	49%	75 bp	76 bp	9%	12.9
GSM6765907_2				35.1%	49%	75 bp	76 bp	9%	12.9
GSM6765907_STAR		75.7%	38.8
GSM6765908	74.2%
GSM6765908_1				35.2%	48%	75 bp	76 bp	9%	14.1
GSM6765908_2				27.2%	49%	75 bp	76 bp	9%	14.1
GSM6765908_STAR		76.2%	43.0
GSM6765909	78.7%
GSM6765909_1				33.2%	47%	75 bp	76 bp	9%	13.7
GSM6765909_2				25.6%	48%	75 bp	76 bp	9%	13.7
GSM6765909_STAR		80.6%	44.2
GSM6765910	76.8%
GSM6765910_1				31.6%	48%	75 bp	76 bp	9%	11.7
GSM6765910_2				24.3%	48%	75 bp	76 bp	9%	11.7
GSM6765910_STAR		79.5%	37.0
GSM6765911	77.3%
GSM6765911_1				31.2%	47%	75 bp	76 bp	9%	17.0
GSM6765911_2				23.9%	48%	75 bp	76 bp	9%	17.0
GSM6765911_STAR		81.0%	54.5
GSM6765912	86.5%
GSM6765912_1				83.5%	53%	75 bp	76 bp	27%	16.5
GSM6765912_2				77.9%	54%	75 bp	76 bp	27%	16.5
GSM6765912_STAR		47.1%	31.5
GSM6765913	85.8%
GSM6765913_1				83.2%	52%	75 bp	76 bp	27%	14.5
GSM6765913_2				77.1%	54%	75 bp	76 bp	27%	14.5
GSM6765913_STAR		45.4%	26.4

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Rsem	% Alignable, M	% Alignable reads, millions	`alignable_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Rsem

Rsem RSEM (RNA-Seq by Expectation-Maximization) is a software package forestimating gene and isoform expression levels from RNA-Seq data.DOI: 10.1186/1471-2105-12-323.

Mapped Reads

A breakdown of how all reads were aligned for each sample.

Multimapping rates

A frequency histogram showing how many reads were aligned to n reference regions.

In an ideal world, every sequence reads would align uniquely to a single location in the reference. However, due to factors such as repeititve sequences, short reads and sequencing errors, reads can be align to the reference 0, 1 or more times. This plot shows the frequency of each factor of multimapping. Good samples should have the majority of reads aligning once.

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

FastQ Screen

Version: 0.15.1

FastQ Screen allows you to screen a library of sequences in FastQ format against a set of sequence databases so you can see if the composition of the library matches with what you expect.DOI: 10.12688/f1000research.15931.2.

Mapped Reads

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.11.9

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	90	16573756	0.6305%
CCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATG	76	5179697	0.1970%
CTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATGC	71	3853303	0.1466%
CTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCC	71	2393574	0.0911%
CTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTCCTACAATGGACCTTG	70	2281385	0.0868%
CAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAG	68	2687972	0.1023%
CGGTGGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGG	68	2602086	0.0990%
CCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCA	66	3610764	0.1374%
CTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGT	56	2071544	0.0788%
CAGGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGGC	54	1272063	0.0484%
CGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTG	44	1082322	0.0412%
CTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGGCAT	44	1177319	0.0448%
TGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	39	2727839	0.1038%
CGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGATCGCT	36	893044	0.0340%
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT	30	824521	0.0314%
AGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATGCCGA	29	698136	0.0266%
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT	29	855972	0.0326%
GTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGTCCCC	28	594561	0.0226%
GGCGCACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGACAGGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGT	28	562256	0.0214%
CTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGA	28	734129	0.0279%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

No samples found with any adapter contamination > 0.1%

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQ Screen	`0.15.1`
FastQC	`0.11.9`

v1.18

MultiQC Toolbox

Highlight Samples

Rename Samples

Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

Rsem

Mapped Reads

Multimapping rates

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Rollover for sample name

Per Sequence GC Content

Per Base N Content

Sequence Length Distribution

Sequence Duplication Levels

Overrepresented sequences by sample

Top overrepresented sequences

Adapter Content

Status Checks

Software Versions

Toggle navigation v1.18

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Rsem

Mapped Reads

Multimapping rates Help

STAR

Alignment Scores

FastQ Screen

Mapped Reads

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18

Highlight Samples

Rename Samples

Show / Hide Samples

Multimapping rates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks